Published OnlineFirst July 19, 2013; DOI: 10.1158/1535-7163.MCT-13-0108
Molecular Cancer Large Molecule Therapeutics Therapeutics
Targeting Aberrant DNA Double-Strand Break Repair in Triple-Negative Breast Cancer with Alpha-Particle Emitter Radiolabeled Anti-EGFR Antibody
Hong Song1, Mohammad Hedayati2, Robert F. Hobbs1, Chunbo Shao3, Frank Bruchertseifer5, Alfred Morgenstern5, Theodore L. DeWeese2,4, and George Sgouros1,4
Abstract The higher potential efficacy of alpha-particle radiopharmaceutical therapy lies in the 3- to 8-fold greater relative biological effectiveness (RBE) of alpha particles relative to photon or beta-particle radiation. This greater RBE, however, also applies to normal tissue, thereby reducing the potential advantage of high RBE. As alpha particles typically cause DNA double-strand breaks (DSB), targeting tumors that are defective in DSB repair effectively increases the RBE, yielding a secondary, RBE-based differentiation between tumor and normal tissue that is complementary to conventional, receptor-mediated tumor targeting. In some triple- negative breast cancers (TNBC; ER /PR /HER-2 ), germline mutation in BRCA-1, a key gene in homologous recombination DSB repair, predisposes patients to early onset of breast cancer. These patients have few treatment options once the cancer has metastasized. In this study, we investigated the efficacy of alpha-particle emitter, 213Bi-labeled anti-EGF receptor antibody, cetuximab, in BRCA-1–defective TNBC. 213Bi-cetuximab was found to be significantly more effective in the BRCA-1–mutated TNBC cell line HCC1937 than BRCA-1– competent TNBC cell MDA-MB-231. siRNA knockdown of BRCA-1 or DNA-dependent protein kinase, catalytic subunit (DNA-PKcs), a key gene in non–homologous end-joining DSB repair pathway, also sensitized TNBC cells to 213Bi-cetuximab. Furthermore, the small-molecule inhibitor of DNA-PKcs, NU7441, sensitized BRCA-1–competent TNBC cells to alpha-particle radiation. Immunofluorescent staining of g-H2AX foci and comet assay confirmed that enhanced RBE is caused by impaired DSB repair. These data offer a novel strategy for enhancing conventional receptor-mediated targeting with an additional, potentially synergistic radio- biological targeting that could be applied to TNBC. Mol Cancer Ther; 12(10); 1–12. 2013 AACR.
Introduction responses (7). Several factors contribute to this differential Radioimmunotherapy of established large solid tumors response; these include the unique biologic efficacy of anti- has not achieved clinical success (1, 2), partly because CD20 antibody, uniform and high expression of the CD20 radiolabeled antibodies are not able to penetrate and antigen, and the easy accessibility of lymphoma cells to deliver sufficient doses (typically less than 30 Gy) to elicit radiolabeled antibodies (8). More importantly, compared responses (3, 4). Accordingly, radioimmunotherapy of with solid tumors, non–Hodgkin lymphoma cells are solid tumors is best implemented when the tumor size is exquisitely sensitive to radiation with typical D0 values in small or, ideally, at a very early stage when the tumors are the range of 1.3 to 1.8 Gy without an appreciable shoulder still microscopic clusters of malignant cells (5, 6). In con- on the survival curves (9). Genetic analysis has revealed trast, in patients with non–Hodgkin lymphoma, equiva- that the increased radiosensitivity of non–Hodgkin lym- lent or even lower tumor doses are able to elicit objective phoma cells can be attributed to impaired DNA repair due to inactivation of ataxia-telangiectasia mutated kinase (ATM), p53 and DNA-PKcs genes (10). Authors' Affiliations: 1Division of Nuclear Medicine, Russell H. Morgan Solid tumors are often associated with defects in the 2 Department of Radiology and Radiological Science, Departments of Radi- DNA damage response (DDR) pathways and loss-of-func- ation Oncology and Molecular Radiation Sciences, and 3Otolaryngology- Head and Neck Surgery, 4Sidney Kimmel Comprehensive Cancer Center, tion in DDR. Germline mutations in these genes cause Johns Hopkins University School of Medicine, Baltimore, Maryland; and genomic instability and predispose patients to the devel- 5European Commission, Joint Research Centre, Institute for Transuranium Elements, Karlsruhe, Germany opment of cancer (11). For example, 5% to 10% of hered- itary breast cancer (12), 10% to 15% of ovarian cancer (13), Corresponding Author: George Sgouros, The Johns Hopkins University School of Medicine, Rm 4M61 Cancer Research Building II, 1550 Orleans and 5% to 10% of pancreatic cancers (14) are caused by Street, Baltimore, MD 21231. Phone: 410-614-0116; Fax: 413-487-3753; mutations in BRCA-1/2, key genes involved in DSB repair E-mail: [email protected] responses. Familial form of colorectal cancer (about 3%– doi: 10.1158/1535-7163.MCT-13-0108 4%), hereditary non–polyposis colorectal cancer (HNPCC), 2013 American Association for Cancer Research. is associated with defective mutations in DNA mismatch
www.aacrjournals.org OF1
Downloaded from mct.aacrjournals.org on September 27, 2021. © 2013 American Association for Cancer Research. Published OnlineFirst July 19, 2013; DOI: 10.1158/1535-7163.MCT-13-0108
Song et al.
þ þ repair genes, such as MSH2 and MLH1 (15). In glioblas- control cell line MCF-7 (ER ,PR , HER-2 ) were obtained toma, promoter methylation on O6-methylguanine-DNA from the American Type Culture Collection (ATCC). The methyltransferase (MGMT) gene in base alkylation rever- cell lines were authenticated and tested by ATCC using sion repair was found in 40% of patients and is a reliable short tandem repeat profiling and karyotyping tests. The predictor for clinical outcome (16). cell lines were grown in RPMI-1640 media containing 10% The differential DDR between normal tissue cells FBS, 0.5% penicillin/streptomycin (Invitrogen), 1% L-glu- with intact DNA repair and repair-defective tumors cells tamine, 1% nonessential amino acids, 1% sodium pyru- can be used to further enhance the efficacy of highly vate, 0.02% gentamicin, and 0.2% insulin (Sigma) and potent alpha-particle radiopharmaceutical therapy. Alpha maintained at 37 Cin5%CO2. Anti-human EGFR mono- particles travel a short distance (<100 mm) and deposit clonal antibody, cetuximab, was obtained from Eli Lilly & highly focused energy along their tracks (80 keV/mm) Co. under a Material Transfer Agreement. Anti-human enabling a single track to generate DSB (17). Eukaryotic phospho-Histone H2AX (Ser139) monoclonal antibody cells can repair DSBs through two main pathways, homo- was purchased from Millipore. Alexa Fluor 488–conju- logous recombination (HR) and non–homologous end gated goat anti-mouse antibody was purchased from joining (NHEJ; ref. 18). Here, we hypothesized that tar- Invitrogen. DNA-PKcs inhibitor NU7441 was purchased geted alpha-particle radiation is more effective against from Tocris Bioscience. solid tumors that contain somatic loss-of-function muta- tions in genes involved in HR and NHEJ pathways and Antibody radiolabeling with 213Bi and 111In examined the feasibility of radiobiological targeting that Cetuximab was conjugated to SCN-CHX-A00-DTPA as may complement or synergize with conventional receptor- described earlier (23). 225Ac was provided by the Institute mediated targeting. The BRCA-1–defective triple-negative for Transuranium Elements (Karlsruhe, Germany; refs. 25, breast cancer (TNBC) model was used to evaluate this 26) and 213Bi was eluted from an 225Ac/213Bi generator approach. built in-house (27). Cetuximab conjugated to the chelate Breast cancer is a heterogeneous disease where tumors was incubated with 213Bi (10 mCi/mg) for 8 minutes in a display highly varied histopathologic features, gene reaction buffer (pH 4.5) containing 3 Mol/L ammonium expression profiles, response to therapy, and prognosis acetate (Fisher Scientific) and 150 mg/mL L-ascorbic acid even though they arise from the same organ. Studies in (Sigma) preheated to 37 C. The radiolabeling reaction was genome-wide gene expression profiles have established quenched with 1 mL of 100 mmol/L EDTA and radiola- four breast cancer types: luminal (type A and B), HER-2– beled cetuximab was purified by size-exclusion Micro- positive, normal breast–like, and basal-like (19). Among spin G-25 column (GE Healthcare). Cetuximab was also the four types of breast cancer, basal-like breast cancers radiolabeled with 111In (PerkinElmer) according to a constitute approximately 15% of all breast cancers and are published procedure (28). The reaction efficiency and typically ER ,PR , and HER-2 . TNBC is poorly differ- purity of the radioimmunoconjugates was determined entiated and highly aggressive; patients with TNBC are with instant thin layer chromatography (ITLC) using almost twice as likely as other patients with breast cancer silica gel impregnated paper (Agilent Technologies). The to develop distant metastasis and, therefore, suffer shorter immunoreactivity of 13Bi-cetuximab was evaluated by survival (20). BRCA-1–defective tumors often belong to incubating 5 ng of 213Bi-cetuximab with excess antigen TNBC and share many clinical and pathologic features binding sites (1 107 MDA-MB-231 cells) twice on ice for (21). Importantly, most TNBCs have high expression of 30 minutes each time. Antibody immunoreactivity was EGF receptor (EGFR; ref. 22) making it an ideal target for calculated as the percentage of 213Bi-cetuximab bound to alpha radioimmunotherapy. the cells. Our previous studies have shown that alpha-particle emitter, 213Bi-labeled, anti-rat HER-2/neu monoclonal anti- EGFR expression measured by flow cytometry and body 7.16.4 prolongs the survival of HER-2/neu transgenic Scatchard analysis mice (neuN) bearing syngeneic breast cancer bone metas- Expression of EGFR on the four TNBC cells was tasis and lung metastasis but did not lead to cure (23, 24). In determined by fluorescein isothiocynate (FITC)-labeled this study, we first evaluated the efficacy of alpha emitter cetuximab using FACSCalibur (Becton Dickinson Bios- 213Bi-labeled anti-EGFR monoclonal antibody (cetuximab) ciences). The EGFR expression level was also quantified in TNBC cells with mutated BRCA-1. Then, we tested by Scatchard analysis. Briefly, 1 106 cells were incu- inhibition of DNA-dependent protein kinase, catalytic bated with serial dilutions of 111In-cetuximab (0.01 to 4.0 subunit (DNA-PKcs), a key enzyme in the NHEJ pathway, mg/mL) for 45 minutes at 4 C. Cells were washed with to sensitize 213Bi-cetuximab. PBS three times before both cell pellets and supernatants were collected and counted with a gamma counter (CompuGamma CS, Pharmacia). The equilibrium-bind- Materials and Methods ing curve of bound/free antibody versus bound anti- Breast cancer cell lines and reagents body concentration was fitted and the number of binding B K Four human TNBC cell lines, MDA-MB-231, MDA-MB- sites, max, and antibody dissociation constant, D,were 436, MDA-MB-468, HCC1937 (BRCA-1–defective), and a calculated.
OF2 Mol Cancer Ther; 12(10) October 2013 Molecular Cancer Therapeutics
Downloaded from mct.aacrjournals.org on September 27, 2021. © 2013 American Association for Cancer Research. Published OnlineFirst July 19, 2013; DOI: 10.1158/1535-7163.MCT-13-0108
Targeting Defective DNA DSB Repair with Alpha Radiation
siRNA knockdown of BRCA-1, DNA-PKcs, and with 8 mCi 213Bi-cetuximab. At various time points (20 RT-PCR minutes, 1, 2, 4, 6, and 24 hours) after initiation of 213Bi- The siRNA knockdown studies are carried out mainly cetuximab treatment, cells were washed with PBS and to account for impact of the receptor number and cell sizes fixed with 2% paraformaldehyde. After incubation with on cell survival after DSB induction by radiolabeled anti- 0.5% NP-40 to permeabilize cell membrane, g-H2AX was body. siRNAs targeting BRCA-1 and DNA-PKcs as well detected by mouse anti-human phosphorylated histone as nontargeting scrambled siRNA were obtained from H2AX (Ser139) and Alexa Fluor 488–conjugated goat anti- Ambion. Twenty-four hours before transfection, TNBC mouse IgG. Cell nuclei were stained with Hoechst 33342 cells were plated into 24-well plates at a density of 5 (Invitrogen). The fluorescent images were examined and 104 cells per well in cell culture media without antibiotics. captured by a Nikon E800 fluorescent microscope Cells were transfected with Lipofectamine (Invitrogen) in equipped with NIS-Element software (Nikon). The num- OPTI-MEM media (Invitrogen) at a siRNA concentration of ber of g-H2AX foci per cell was counted (>50 cells per data 20 pmol/well (add 100 mL of siRNA:Lipofectamine 2000 point). complexes to 0.5 mL medium). Forty-eight hours after For TNBC cells transfected with siRNA targeting either transfection, breast cancer cells were examined for knock- DNA-PKcs or BRCA-1,thenumberofg-H2AX foci down of gene expression by real time reverse transcription was counted at 1 and 24 hours after treatment with (RT) PCR. Total cellular RNA was isolated with PerfectPure 213Bi-cetuximab. In addition, to compare the effect of RNA Cultured Cell Kit (5 Prime) according to the manu- small-molecule DNA-PKcs inhibitor NU7441 on DSB facturer’s instruction. For cDNAsynthesis, 1mg of RNA was repair after alpha radiation, TNBC cells were treated with reverse transcribed using qScript cDNA Synthesis Kit NU7441 as described before with 213Bi-cetuximab and the (Quanta Bioscience). BRCA-1 and DNA-PKcs mRNA level number of g-H2AX foci was quantified at 1 and 24 hours were measured by quantitative real-time RT-PCR using after treatment. SYBR Green PCR Master Mix on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems). The pri- Comet assay and cell-cycle analysis mers for BRCA-1 are: forward GGCTATCCTCTCAGAGT- MDA-MB-231 and HCC1937 cells were incubated with GACATTTTA, reverse GCTTTATCAGGTTATGTTGCA 213Bi-cetuximab (8mCi/mL) in cell culture media contain- TGGT; for DNA-PKcs are: forward CCACTTACAGGATC- ing 2% FBS at 37 C. Cells were harvested for comet assays ATAGCGACGAATGC, reverse CGTGCGGGTAGTTAT- under neutral condition at 1 or 24 hours after initiation of CAGTGATTT. b-Actin mRNA level was used as control incubation using the Trevigen CometAssay kit (Trevi- and the primers are: forward ACCAACTGGGACGACAT- gen). Briefly, cells were mixed with low melting point GGAG, reverse GTGAGGATCTTCATGAG GTAGTC. agarose and plated on microscope slides and allowed to gel. Cells were then lysed for 1 hour at 4 C followed by Specific kill of TNBC cells by 213Bi-cetuximab rinse in TBE buffer [10.8% (w/v) Tris base, 5.5% (w/v) Survival curves of TNBC cells after treatment with boric acid, and 0.93% (w/v) EDTA]. After electrophoresis 213Bi-cetuximab were measured by colony formation in TBE buffer for 30 minutes at 1 V/cm, slides were assay. The four TNBC cells and MCF-7 cells were plated washed in water and dehydrated with ethanol, air dried in 24-well plates. Two days after cell plating, they were overnight, and then treated with SYBR Green for DNA incubated with 213Bi-cetuximab (concentration from 1.0– staining. Comets were imaged using a Zeiss Imager.Z1 8.0 mCi/mL) overnight in duplicates and transferred to fluorescent microscopy (Carl Zeiss AG) and analyzed Petri dishes for colony growth. All survival curves studies using the software CometScore (Autocomet.com). The were repeated again to confirm the findings. To investi- Olive Tail Moment (OTM) was calculated as the average gate the effects of BRCA-1 and DNA-PKcs on cell kill by of at least 70 comets. alpha radiation, TNBC cells were transfected with siRNAs For cell-cycle assay, at 1 or 24 hours after 213Bi- targeting BRCA-1 and DNA-PKcs. Forty-eight hours after cetuximab treatment, cells were harvested and fixed transfection, cells were treated with 213Bi-cetuximab over- in 70% ethanol overnight. After PBS wash, cells were night and transferred to Petri dishes for colony growth. To stained with 0.02 mg/mL propidium iodide (Sigma) in compare the effect of small-molecule inhibitor of DNA- 0.1% (v/v) Triton X-100/PBS containing 0.2 mg RNase PKcs on cell kill by alpha radiation, TNBC cells were A (Sigma). Flow cytometry was conducted on a FACS- treated with NU7441 (1.0 mmol/L) one hour before Calibur and data were analyzed with Cell Quest Pro 213Bi-cetuximab treatment and cells were continuously (BD Bioscience). incubated with NU7441 for 16 hours before they were transferred for colony formation (29). Biodistribution of radiolabeled cetuximab in EGFR-positive TNBC Immunofluorescent staining of g-H2AX foci as a Nude mice (5 mice/group) were injected with 1 106 biomarker for DSBs MDA-MB-231 cells subcutaneously in the mammary fat DSBs induced by 213Bi-cetuximab were measured by pad region. Ten weeks after tumor inoculation (tumor size immunofluorescent staining of phosphorylated histone 0.5–1.0 cm in diameter), mice were injected intravenously H2AX (g-H2AX). TNBC and MCF-7 cells were treated with approximately 20 mCi 111In-cetuximab and were
www.aacrjournals.org Mol Cancer Ther; 12(10) October 2013 OF3
Downloaded from mct.aacrjournals.org on September 27, 2021. © 2013 American Association for Cancer Research. Published OnlineFirst July 19, 2013; DOI: 10.1158/1535-7163.MCT-13-0108
Song et al.
Figure 1. Radiosensitivity of TNBC A B 1 cell lines. A, flow cytometry found 1501209060300 MCF-7 high expression of EGFR in all four MDA-MB-231 TNBC cells (MDA-MB-231, MDA- MB-436, HCC1937, MDA-MB- MDA-MB-436 0.1 HCC1937 468). MCF-7 cells have very low- MDA-MB-468 level expression of EGFR and were MCF-7 used as negative control in the Counts 0.01 MDA-MB-231 studies. B, cell survival curves of
Surviving fraction MDA-MB-436 TNBC cells and MCF-7 cells after HCC1937 treatment by 137Cs (gamma) MDA-MB-468 radiation. BRCA-1–defective 0.001 0 1 2 3 4 HCC1937 was found to be the 10 10 10 10 10 0102468 FL1-H most radiosensitive cell line. MDA- Cs-137 irradiator (Gy) MB-468 cells are also relatively C 1.000 sensitive to 137Cs radiation when D 213 Control Bi-Cetuximab delivered at 0.5 Gy per minute. C, cell survival curves of TNBC cells 0.100 1 h24 h 1 h24 and MCF-7 cells after treatment by MDA-MB-231 alpha-particle emitter–labeled MCF-7 213Bi-cetuximab. BRCA-1– 0.010 HCC1937 MDA-MB-231 defective HCC1937 cells are more
Surviving fraction 213 MDA-MB-436 sensitive to Bi-cetuximab
MDA-MB-468 h 1 h24 compared with MDA-MB-231 and 0.001 HCC1937 MDA-MB-436 cells. MDA-MB-468 012246810 cells are the most sensitive among Cetuximab-Bi213 (μCi/mL) 25 the TNBC cells treated. D, DNA E 213 1 h neutral damage caused by Bi- cetuximab at 1 hour after treatment 20 24 h neutral * and DNA damage repair at 24 hours after treatment in MDA-MB- 15 231 and HCC937 cells as assessed by neutral Comet assay. 10 Representative images showing Olive moment head and tail fluorescent 5 intensities of MDA-MB-231 and HCC1937 cells. E, quantification of 0 comet tail Olive moments at 1 and MDA-MB-231 MDA-MB-231 HCC1937 HCC1937 Control Cetuximab-Bi213 Control Cetuximab-Bi213 24 hours after treatments.