Targeting Aberrant DNA Double-Strand Break Repair in Triple-Negative Breast Cancer with Alpha-Particle Emitter Radiolabeled Anti-EGFR Antibody

Published OnlineFirst July 19, 2013; DOI: 10.1158/1535-7163.MCT-13-0108

Molecular Cancer Large Molecule Therapeutics Therapeutics

Hong Song1, Mohammad Hedayati2, Robert F. Hobbs1, Chunbo Shao3, Frank Bruchertseifer5, Alfred Morgenstern5, Theodore L. DeWeese2,4, and George Sgouros1,4

Abstract The higher potential efficacy of alpha-particle radiopharmaceutical therapy lies in the 3- to 8-fold greater relative biological effectiveness (RBE) of alpha particles relative to photon or beta-particle radiation. This greater RBE, however, also applies to normal tissue, thereby reducing the potential advantage of high RBE. As alpha particles typically cause DNA double-strand breaks (DSB), targeting tumors that are defective in DSB repair effectively increases the RBE, yielding a secondary, RBE-based differentiation between tumor and normal tissue that is complementary to conventional, receptor-mediated tumor targeting. In some triple- negative breast cancers (TNBC; ER /PR /HER-2 ), germline mutation in BRCA-1, a key gene in homologous recombination DSB repair, predisposes patients to early onset of breast cancer. These patients have few treatment options once the cancer has metastasized. In this study, we investigated the efficacy of alpha-particle emitter, 213Bi-labeled anti-EGF receptor antibody, cetuximab, in BRCA-1–defective TNBC. 213Bi-cetuximab was found to be significantly more effective in the BRCA-1–mutated TNBC cell line HCC1937 than BRCA-1– competent TNBC cell MDA-MB-231. siRNA knockdown of BRCA-1 or DNA-dependent protein kinase, catalytic subunit (DNA-PKcs), a key gene in non–homologous end-joining DSB repair pathway, also sensitized TNBC cells to 213Bi-cetuximab. Furthermore, the small-molecule inhibitor of DNA-PKcs, NU7441, sensitized BRCA-1–competent TNBC cells to alpha-particle radiation. Immunofluorescent staining of g-H2AX foci and comet assay confirmed that enhanced RBE is caused by impaired DSB repair. These data offer a novel strategy for enhancing conventional receptor-mediated targeting with an additional, potentially synergistic radiobiological targeting that could be applied to TNBC. Mol Cancer Ther; 12(10); 1–12. 2013 AACR.

Introduction responses (7). Several factors contribute to this differential Radioimmunotherapy of established large solid tumors response; these include the unique biologic efficacy of anti- has not achieved clinical success (1, 2), partly because CD20 antibody, uniform and high expression of the CD20 radiolabeled antibodies are not able to penetrate and antigen, and the easy accessibility of lymphoma cells to deliver sufficient doses (typically less than 30 Gy) to elicit radiolabeled antibodies (8). More importantly, compared responses (3, 4). Accordingly, radioimmunotherapy of with solid tumors, non–Hodgkin lymphoma cells are solid tumors is best implemented when the tumor size is exquisitely sensitive to radiation with typical D0 values in small or, ideally, at a very early stage when the tumors are the range of 1.3 to 1.8 Gy without an appreciable shoulder still microscopic clusters of malignant cells (5, 6). In con- on the survival curves (9). Genetic analysis has revealed trast, in patients with non–Hodgkin lymphoma, equiva- that the increased radiosensitivity of non–Hodgkin lym- lent or even lower tumor doses are able to elicit objective phoma cells can be attributed to impaired DNA repair due to inactivation of ataxia-telangiectasia mutated kinase (ATM), p53 and DNA-PKcs genes (10). Authors' Affiliations: 1Division of Nuclear Medicine, Russell H. Morgan Solid tumors are often associated with defects in the 2 Department of Radiology and Radiological Science, Departments of Radi- DNA damage response (DDR) pathways and loss-of-func- ation Oncology and Molecular Radiation Sciences, and 3Otolaryngology- Head and Neck Surgery, 4Sidney Kimmel Comprehensive Cancer Center, tion in DDR. Germline mutations in these genes cause Johns Hopkins University School of Medicine, Baltimore, Maryland; and genomic instability and predispose patients to the devel- 5European Commission, Joint Research Centre, Institute for Transuranium Elements, Karlsruhe, Germany opment of cancer (11). For example, 5% to 10% of hereditary breast cancer (12), 10% to 15% of ovarian cancer (13), Corresponding Author: George Sgouros, The Johns Hopkins University School of Medicine, Rm 4M61 Cancer Research Building II, 1550 Orleans and 5% to 10% of pancreatic cancers (14) are caused by Street, Baltimore, MD 21231. Phone: 410-614-0116; Fax: 413-487-3753; mutations in BRCA-1/2, key genes involved in DSB repair E-mail: [email protected] responses. Familial form of colorectal cancer (about 3%– doi: 10.1158/1535-7163.MCT-13-0108 4%), hereditary non–polyposis colorectal cancer (HNPCC), 2013 American Association for Cancer Research. is associated with defective mutations in DNA mismatch

www.aacrjournals.org OF1

Song et al.

þ þ repair genes, such as MSH2 and MLH1 (15). In glioblas- control cell line MCF-7 (ER ,PR , HER-2 ) were obtained toma, promoter methylation on O6-methylguanine-DNA from the American Type Culture Collection (ATCC). The methyltransferase (MGMT) gene in base alkylation rever- cell lines were authenticated and tested by ATCC using sion repair was found in 40% of patients and is a reliable short tandem repeat profiling and karyotyping tests. The predictor for clinical outcome (16). cell lines were grown in RPMI-1640 media containing 10% The differential DDR between normal tissue cells FBS, 0.5% penicillin/streptomycin (Invitrogen), 1% L-glu- with intact DNA repair and repair-defective tumors cells tamine, 1% nonessential amino acids, 1% sodium pyru- can be used to further enhance the efficacy of highly vate, 0.02% gentamicin, and 0.2% insulin (Sigma) and potent alpha-particle radiopharmaceutical therapy. Alpha maintained at 37 Cin5%CO2. Anti-human EGFR mono- particles travel a short distance (<100 mm) and deposit clonal antibody, cetuximab, was obtained from Eli Lilly & highly focused energy along their tracks (80 keV/mm) Co. under a Material Transfer Agreement. Anti-human enabling a single track to generate DSB (17). Eukaryotic phospho-Histone H2AX (Ser139) monoclonal antibody cells can repair DSBs through two main pathways, homo- was purchased from Millipore. Alexa Fluor 488–conju- logous recombination (HR) and non–homologous end gated goat anti-mouse antibody was purchased from joining (NHEJ; ref. 18). Here, we hypothesized that tar- Invitrogen. DNA-PKcs inhibitor NU7441 was purchased geted alpha-particle radiation is more effective against from Tocris Bioscience. solid tumors that contain somatic loss-of-function mutations in genes involved in HR and NHEJ pathways and Antibody radiolabeling with 213Bi and 111In examined the feasibility of radiobiological targeting that Cetuximab was conjugated to SCN-CHX-A00-DTPA as may complement or synergize with conventional receptor- described earlier (23). 225Ac was provided by the Institute mediated targeting. The BRCA-1–defective triple-negative for Transuranium Elements (Karlsruhe, Germany; refs. 25, breast cancer (TNBC) model was used to evaluate this 26) and 213Bi was eluted from an 225Ac/213Bi generator approach. built in-house (27). Cetuximab conjugated to the chelate Breast cancer is a heterogeneous disease where tumors was incubated with 213Bi (10 mCi/mg) for 8 minutes in a display highly varied histopathologic features, gene reaction buffer (pH 4.5) containing 3 Mol/L ammonium expression profiles, response to therapy, and prognosis acetate (Fisher Scientific) and 150 mg/mL L-ascorbic acid even though they arise from the same organ. Studies in (Sigma) preheated to 37C. The radiolabeling reaction was genome-wide gene expression profiles have established quenched with 1 mL of 100 mmol/L EDTA and radiola- four breast cancer types: luminal (type A and B), HER-2– beled cetuximab was purified by size-exclusion Micro- positive, normal breast–like, and basal-like (19). Among spin G-25 column (GE Healthcare). Cetuximab was also the four types of breast cancer, basal-like breast cancers radiolabeled with 111In (PerkinElmer) according to a constitute approximately 15% of all breast cancers and are published procedure (28). The reaction efficiency and typically ER ,PR , and HER-2 . TNBC is poorly differ- purity of the radioimmunoconjugates was determined entiated and highly aggressive; patients with TNBC are with instant thin layer chromatography (ITLC) using almost twice as likely as other patients with breast cancer silica gel impregnated paper (Agilent Technologies). The to develop distant metastasis and, therefore, suffer shorter immunoreactivity of 13Bi-cetuximab was evaluated by survival (20). BRCA-1–defective tumors often belong to incubating 5 ng of 213Bi-cetuximab with excess antigen TNBC and share many clinical and pathologic features binding sites (1 107 MDA-MB-231 cells) twice on ice for (21). Importantly, most TNBCs have high expression of 30 minutes each time. Antibody immunoreactivity was EGF receptor (EGFR; ref. 22) making it an ideal target for calculated as the percentage of 213Bi-cetuximab bound to alpha radioimmunotherapy. the cells. Our previous studies have shown that alpha-particle emitter, 213Bi-labeled, anti-rat HER-2/neu monoclonal anti- EGFR expression measured by flow cytometry and body 7.16.4 prolongs the survival of HER-2/neu transgenic Scatchard analysis mice (neuN) bearing syngeneic breast cancer bone metas- Expression of EGFR on the four TNBC cells was tasis and lung metastasis but did not lead to cure (23, 24). In determined by fluorescein isothiocynate (FITC)-labeled this study, we first evaluated the efficacy of alpha emitter cetuximab using FACSCalibur (Becton Dickinson Bios- 213Bi-labeled anti-EGFR monoclonal antibody (cetuximab) ciences). The EGFR expression level was also quantified in TNBC cells with mutated BRCA-1. Then, we tested by Scatchard analysis. Briefly, 1 106 cells were incu- inhibition of DNA-dependent protein kinase, catalytic bated with serial dilutions of 111In-cetuximab (0.01 to 4.0 subunit (DNA-PKcs), a key enzyme in the NHEJ pathway, mg/mL) for 45 minutes at 4C. Cells were washed with to sensitize 213Bi-cetuximab. PBS three times before both cell pellets and supernatants were collected and counted with a gamma counter (CompuGamma CS, Pharmacia). The equilibrium-bind- Materials and Methods ing curve of bound/free antibody versus bound anti- Breast cancer cell lines and reagents body concentration was fitted and the number of binding B K Four human TNBC cell lines, MDA-MB-231, MDA-MB- sites, max, and antibody dissociation constant, D,were 436, MDA-MB-468, HCC1937 (BRCA-1–defective), and a calculated.

OF2 Mol Cancer Ther; 12(10) October 2013 Molecular Cancer Therapeutics

Targeting Defective DNA DSB Repair with Alpha Radiation

siRNA knockdown of BRCA-1, DNA-PKcs, and with 8 mCi 213Bi-cetuximab. At various time points (20 RT-PCR minutes, 1, 2, 4, 6, and 24 hours) after initiation of 213Bi- The siRNA knockdown studies are carried out mainly cetuximab treatment, cells were washed with PBS and to account for impact of the receptor number and cell sizes fixed with 2% paraformaldehyde. After incubation with on cell survival after DSB induction by radiolabeled anti- 0.5% NP-40 to permeabilize cell membrane, g-H2AX was body. siRNAs targeting BRCA-1 and DNA-PKcs as well detected by mouse anti-human phosphorylated histone as nontargeting scrambled siRNA were obtained from H2AX (Ser139) and Alexa Fluor 488–conjugated goat anti- Ambion. Twenty-four hours before transfection, TNBC mouse IgG. Cell nuclei were stained with Hoechst 33342 cells were plated into 24-well plates at a density of 5 (Invitrogen). The fluorescent images were examined and 104 cells per well in cell culture media without antibiotics. captured by a Nikon E800 fluorescent microscope Cells were transfected with Lipofectamine (Invitrogen) in equipped with NIS-Element software (Nikon). The num- OPTI-MEM media (Invitrogen) at a siRNA concentration of ber of g-H2AX foci per cell was counted (>50 cells per data 20 pmol/well (add 100 mL of siRNA:Lipofectamine 2000 point). complexes to 0.5 mL medium). Forty-eight hours after For TNBC cells transfected with siRNA targeting either transfection, breast cancer cells were examined for knock- DNA-PKcs or BRCA-1,thenumberofg-H2AX foci down of gene expression by real time reverse transcription was counted at 1 and 24 hours after treatment with (RT) PCR. Total cellular RNA was isolated with PerfectPure 213Bi-cetuximab. In addition, to compare the effect of RNA Cultured Cell Kit (5 Prime) according to the manu- small-molecule DNA-PKcs inhibitor NU7441 on DSB facturer’s instruction. For cDNAsynthesis, 1mg of RNA was repair after alpha radiation, TNBC cells were treated with reverse transcribed using qScript cDNA Synthesis Kit NU7441 as described before with 213Bi-cetuximab and the (Quanta Bioscience). BRCA-1 and DNA-PKcs mRNA level number of g-H2AX foci was quantified at 1 and 24 hours were measured by quantitative real-time RT-PCR using after treatment. SYBR Green PCR Master Mix on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems). The pri- Comet assay and cell-cycle analysis mers for BRCA-1 are: forward GGCTATCCTCTCAGAGT- MDA-MB-231 and HCC1937 cells were incubated with GACATTTTA, reverse GCTTTATCAGGTTATGTTGCA 213Bi-cetuximab (8mCi/mL) in cell culture media contain- TGGT; for DNA-PKcs are: forward CCACTTACAGGATC- ing 2% FBS at 37C. Cells were harvested for comet assays ATAGCGACGAATGC, reverse CGTGCGGGTAGTTAT- under neutral condition at 1 or 24 hours after initiation of CAGTGATTT. b-Actin mRNA level was used as control incubation using the Trevigen CometAssay kit (Trevi- and the primers are: forward ACCAACTGGGACGACAT- gen). Briefly, cells were mixed with low melting point GGAG, reverse GTGAGGATCTTCATGAG GTAGTC. agarose and plated on microscope slides and allowed to gel. Cells were then lysed for 1 hour at 4C followed by Specific kill of TNBC cells by 213Bi-cetuximab rinse in TBE buffer [10.8% (w/v) Tris base, 5.5% (w/v) Survival curves of TNBC cells after treatment with boric acid, and 0.93% (w/v) EDTA]. After electrophoresis 213Bi-cetuximab were measured by colony formation in TBE buffer for 30 minutes at 1 V/cm, slides were assay. The four TNBC cells and MCF-7 cells were plated washed in water and dehydrated with ethanol, air dried in 24-well plates. Two days after cell plating, they were overnight, and then treated with SYBR Green for DNA incubated with 213Bi-cetuximab (concentration from 1.0– staining. Comets were imaged using a Zeiss Imager.Z1 8.0 mCi/mL) overnight in duplicates and transferred to fluorescent microscopy (Carl Zeiss AG) and analyzed Petri dishes for colony growth. All survival curves studies using the software CometScore (Autocomet.com). The were repeated again to confirm the findings. To investi- Olive Tail Moment (OTM) was calculated as the average gate the effects of BRCA-1 and DNA-PKcs on cell kill by of at least 70 comets. alpha radiation, TNBC cells were transfected with siRNAs For cell-cycle assay, at 1 or 24 hours after 213Bi- targeting BRCA-1 and DNA-PKcs. Forty-eight hours after cetuximab treatment, cells were harvested and fixed transfection, cells were treated with 213Bi-cetuximab over- in 70% ethanol overnight. After PBS wash, cells were night and transferred to Petri dishes for colony growth. To stained with 0.02 mg/mL propidium iodide (Sigma) in compare the effect of small-molecule inhibitor of DNA- 0.1% (v/v) Triton X-100/PBS containing 0.2 mg RNase PKcs on cell kill by alpha radiation, TNBC cells were A (Sigma). Flow cytometry was conducted on a FACS- treated with NU7441 (1.0 mmol/L) one hour before Calibur and data were analyzed with Cell Quest Pro 213Bi-cetuximab treatment and cells were continuously (BD Bioscience). incubated with NU7441 for 16 hours before they were transferred for colony formation (29). Biodistribution of radiolabeled cetuximab in EGFR-positive TNBC Immunofluorescent staining of g-H2AX foci as a Nude mice (5 mice/group) were injected with 1 106 biomarker for DSBs MDA-MB-231 cells subcutaneously in the mammary fat DSBs induced by 213Bi-cetuximab were measured by pad region. Ten weeks after tumor inoculation (tumor size immunofluorescent staining of phosphorylated histone 0.5–1.0 cm in diameter), mice were injected intravenously H2AX (g-H2AX). TNBC and MCF-7 cells were treated with approximately 20 mCi 111In-cetuximab and were

www.aacrjournals.org Mol Cancer Ther; 12(10) October 2013 OF3

Song et al.

Figure 1. Radiosensitivity of TNBC A B 1 cell lines. A, ﬂow cytometry found 1501209060300 MCF-7 high expression of EGFR in all four MDA-MB-231 TNBC cells (MDA-MB-231, MDA- MB-436, HCC1937, MDA-MB- MDA-MB-436 0.1 HCC1937 468). MCF-7 cells have very low- MDA-MB-468 level expression of EGFR and were MCF-7 used as negative control in the Counts 0.01 MDA-MB-231 studies. B, cell survival curves of

Surviving fraction MDA-MB-436 TNBC cells and MCF-7 cells after HCC1937 treatment by 137Cs (gamma) MDA-MB-468 radiation. BRCA-1–defective 0.001 0 1 2 3 4 HCC1937 was found to be the 10 10 10 10 10 0102468 FL1-H most radiosensitive cell line. MDA- Cs-137 irradiator (Gy) MB-468 cells are also relatively C 1.000 sensitive to 137Cs radiation when D 213 Control Bi-Cetuximab delivered at 0.5 Gy per minute. C, cell survival curves of TNBC cells 0.100 1 h24 h 1 h24 and MCF-7 cells after treatment by MDA-MB-231 alpha-particle emitter–labeled MCF-7 213Bi-cetuximab. BRCA-1– 0.010 HCC1937 MDA-MB-231 defective HCC1937 cells are more

Surviving fraction 213 MDA-MB-436 sensitive to Bi-cetuximab

MDA-MB-468 h 1 h24 compared with MDA-MB-231 and 0.001 HCC1937 MDA-MB-436 cells. MDA-MB-468 012246810 cells are the most sensitive among Cetuximab-Bi213 (μCi/mL) 25 the TNBC cells treated. D, DNA E 213 1 h neutral damage caused by Bi- cetuximab at 1 hour after treatment 20 24 h neutral * and DNA damage repair at 24 hours after treatment in MDA-MB- 15 231 and HCC937 cells as assessed by neutral Comet assay. 10 Representative images showing Olive moment head and tail ﬂuorescent 5 intensities of MDA-MB-231 and HCC1937 cells. E, quantiﬁcation of 0 comet tail Olive moments at 1 and MDA-MB-231 MDA-MB-231 HCC1937 HCC1937 Control Cetuximab-Bi213 Control Cetuximab-Bi213 24 hours after treatments.

then sacrificed at 1, 3, 6, 24, 48, and 72 hours postinjection. for alpha particles, Da, and electrons, De, is 1.33 10 12 and Major organs, including blood, heart, lungs, liver, spleen, 1.05 10 13 Gy kg/Bq-s, respectively. For cell level dosim- kidney, stomach, intestine, muscle, femur, and tumor etry, the absorbed dose to the TNBC cells treated with were collected and counted in the gamma counter. The nonbinding antibody was calculated as the absorbed dose uptake of 111In-cetuximab in the tumor and organs was to the irradiated media volume assuming all alpha-particle E R t A elt decay corrected to the time of injection and calculated as D Bi213 1 0 energies are absorbed locally: D ¼ rV dt where %ID/g SD. 2 0 0 DEBi213 is the mean alpha-particle and electron energy per t A decay (Gy-kg/Bq-s), 1 is the time of treatment, 0 is the Dosimetry initial activity, r is the density of the cell (assuming water 111 3 V Biodistribution data from In-cetuximab were convert- equivalent at 1.0 g/cm ), 0 is the volume of the treatment, ed to 213Bi-cetuximab biodistribution based on our previ- and l is the decay constant for 213Bi. The absorbed dose was ous findings that radioisotope properties of 111In is a good divided by two, as the cells are attached to the bottom of surrogate for 213Bi antibody kinetics (23). An exponential the tissue culture plates and are assumed to receive half expression was fitted to the time activity data, and the of the radiation from above them. The absorbed dose to cumulative activity in each normal organ was calculated by EGFR-positive TNBCcells targeted by 213Bi-cetuximab was analytic integration of the fitted expression. Absorbed calculated using a cellular S factor (31, 32) for 213Bi, the doses were calculated as described in the study conducted measured number of EGF receptors per cell, and assum- by Sgouros and colleagues (30). Absorbed dose is thus cal- ing receptor saturationR at 1 hour after generator elution. ~ ~ t lt ¼ þ D ¼ SBi ;N CS 1 SA Ne dt SBi-213, N CS culated as D (A Da A De)/M, wherein D is absorb- 213 0 0 ,where is the ~ SA N ed dose (no RBE adjustment), A is the total number of cellular S factor, 0 is the specific activity, and is disintegrations in an organ or tumor, M is the weight of the the number of EGF receptors per cell. The sizes of cell and organ, and the mean energy emitted per nuclear transition cell nuclei were measured by fluorescent microscopy

OF4 Mol Cancer Ther; 12(10) October 2013 Molecular Cancer Therapeutics

Targeting Defective DNA DSB Repair with Alpha Radiation

Comet assay showed that DSBs are repaired in MDA- Table 1. Dissociation constant (KD) and MB-231 cells but not in BRCA-1–defective HCC1937 cells receptor density for the cell lines used in this at 24 hours after treatment (Fig. 1D). Two-way ANOVA study test showed significant decrease in Olive moment in MDA- MB-231 cells from 1 to 24 hours (, P < 0.0001) but not in P ¼ Cell line KD (nmol/L) EGFR/cell HCC1937 cells ( 0.88). The difference in Olive moment MDA-MB-231 0.8 2.8 105 between MDA-MB-231 and HCC1937 cells is also statisti- P ¼ P MDA-MB-436 0.2 0.8 105 cally significant at 1 hour ( 0.02) and 24 hour ( < HCC1937 0.8 4.5 105 0.001; Fig. 1E). Pretreating TNBC cells with the DNA-PKcs MDA-MB-468 2.0 2.7 106 inhibitor NU7441 (1.0 mmol/L) further improved the efficacy of 213Bi-cetuximab for TNBC cells (Fig. 2A–C), with ED50 of 0.61, 0.77, 0.58 mCi/mL for MDA-MB-231, MDA- MB-436, and HCC1937 cells, respectively. (Nikon 80i) and analyzed with NIS-Element imaging Immunofluorescent staining of g-H2AX at 1 and 24 analysis software (Nikon) after cells were stained with hours after treatment with 213Bi-cetuximab is shown Hoechst 33342 (Invitrogen). Cell and nucleus radius of MDA-MB-231 cell were measured as 9.2 0.8 and 6.4 0.8 mm, respectively. A 1.00 Statistical analysis The statistical significance of differences between two groups was analyzed using MedCalc (MedCalc. Software). P Differences with values < 0.05 were considered statisti- 0.10 cally significant.

Results Surviving fraction Cetuximab-Bi213 Cetuximab-Bi213 + NU7441 MDA-MB-231 EGFR expression, radiolabeling, and antibody 0.01 immunoreactivity 012246810 Cetuximab-Bi213 (μCi/mL) Flow cytometry with cetuximab-FITC found EGFR B expression on all four TNBC cell lines, but not on 1.00 MCF-7 cells (Fig. 1A). MDA-MB-468 had the highest expression level. The results of Scatchard analysis using 111In-cetuximab are shown in tabular form in Table 1, with increased EGFR expression on MDA-MB-436, 0.10 MDA-MB-231, HCC1937, and MDA-MB-468 cells. Also shownonTable1aretheKD values of radiolabeled cetuximab for these cell lines, which are similar to values Surviving fraction Cetuximab-Bi213 obtained with unlabeled antibody. Reaction efficiency Cetuximab-Bi213 + NU7441 MDA-MB-436 and purity after size exclusion purification of 213Bi- 0.01 n ¼ 024681012 labeled cetuximab was 93.5% 1.7% ( 7) and μ n ¼ Cetuximab-Bi213 ( Ci/mL) 97.2% 0.4% ( 4) as determined by ITLC. Both C 1.000 reaction efficiency and purity of 111In-labeled Cetuxi- Cetuximab-Bi213 Cetuximab-Bi213 + NU7441 mab were routinely more than 98%. The fraction of 213Bi-cetuximab that is able to bind MDA-MB-231 cells 0.100 in the immunoreactivity assay was 89.7%.

In vitro 213 cytotoxicity of Bi-cetuximab to TNBC 0.010

cells and immunoﬂuorescent staining of g-H2AX Surviving fraction 213Bi-cetuximab kills EGFR-expressing TNBC cells effec- HCC1937 tively (Fig. 1C). The activity concentrations that can kill 0.001 50% (ED50) of MDA-MB-231 and MDA-MB-436 cells are 024681012 3.2 and 3.5 mCi/mL, compared with 7.8 mCi/mL in EGFR- Cetuximab-Bi213 (μCi/mL) negative MCF-7 cells. Noticeably, the radiosensitivity of BRCA-1–defective HCC1937 cells to 213Bi-cetuximab is Figure 2. DNA-PKcs inhibitor NU7441 enhances cytotoxicity of 213Bi- signiﬁcantly enhanced with an ED50 of 0.63 mCi/mL. 213 cetuximab in TNBC cells. Cell survival curves of MDA-MB-231 (A), MDA-MB-468 cells are the most sensitive to Bi-cetux- MDA-MB-436 (B), and HCC1937 (C) after treatment by 213Bi-cetuximab 213 imab treatment with an ED50 of 0.50 mCi/mL. Neutral or Bi-cetuximab plus NU7441.

www.aacrjournals.org Mol Cancer Ther; 12(10) October 2013 OF5

Song et al.

in Fig. 3. Unlike random g-H2AX foci that are usually treatment by 213Bi-cetuximab, indicating DSBs caused by formed after the cells are irradiated with gamma rays alpha-particle tracks (e.g., Fig. 3A). The time course of (data not shown), the g-H2AX foci typically formed g-H2AX foci formation after alpha radiation treatment noticeable straight-line tracks within cell nuclei after was evaluated at 20 minutes, 1, 2, 4, 6, and 24 hours after

A 1 h 24 h 1 h 24 h NU7441 NU7441

MCF-7 MCF-7 MCF-7 MCF-7

NU7441 NU7441

MDA-MB-231 MDA-MB-231 MDA-MB-231 Figure 3. A, representative images showing immunofluorescently NU7441 NU7441 stained g-H2AX foci at 1 and 24 hours after treatment with 213Bi- cetuximab or 213Bi-cetuximab plus NU7441 in MCF-7 and the four TNBC cell lines studied. B, quantification of number of MDA-MB-436 MDA-MB-436 MDA-MB-436 MDA-MB-436 g-H2AX foci at 1 and 24 hours after treatment by 213Bi-cetuximab or 213Bi-cetuximab plus NU7441. NU7441 NU7441 Two-way ANOVA test showed that there was a statistically significant decrease () of DSBs foci in MDA- MB-231 (P < 0.001), MDA-MB-436 (P < 0.001), and MCF-7 (P < 0.001) cells from 1 to 24 hours after HCC1937 HCC1937 HCC1937 treatment with 213Bi-cetuximab alone, whereas such decrease was NU7441 NU7441 not observed in HCC1937 (P ¼ 0.13) and MDA-MB-468 (P ¼ 0.63) cells. NU7441 treatment significantly inhibited the decrease of g-H2AX foci from 1 to 24 hours in MDA-MB-231 (P ¼ 0.43) and MDA- MDA-MB-468 MDA-MB-468 MDA-MB-468 MDA-MB-468 MB-436 (P ¼ 0.68) cells, but did not affect HCC1937 and MDA-MB- B 50 468 cells. MCF-7 MDA-MB-231 MDA-MB-436 HCC1937 40 MDA-MB-468

30 -H2AX foci γ 20

10 * Number of γ

0 1 h 24 h 1 h NU7441 24 h NU7441

OF6 Mol Cancer Ther; 12(10) October 2013 Molecular Cancer Therapeutics

Targeting Defective DNA DSB Repair with Alpha Radiation

initiation of treatment. The number of g-H2AX foci peak- 468, adding NU7441 to 213Bi-cetuximab did not affect the ed at 1 hour and decreased gradually thereafter (data not number of g-H2AX foci from 1 hour to 24 hours. (Fig. 3B). shown). The reduction in g-H2AX foci from 1 to 24 hours was therefore used as a measure of DSB repair capacity siRNA knockdown of BRCA-1 or DNA-PKcs after 213Bi-cetuximab treatment. In MCF-7, MDA-MB-231, enhanced radiosensitivity of TNBC cells and MDA-MB-436 cells, the number of g-H2AX foci per Gene expression of either BRCA-1 or DNA-PKcs was cell all decreased significantly from 15.5 4.8 (1 hour) to downregulated in the four TNBC cells, MCF-7, MDA- 5.2 2.4 (24 hours), 18.7 4.7 (1 hour) to 10.0 5.1 (24 MB-231, MDA-MB-436, and HCC1937 after transfection hours) and 16.0 3.8 (1 hour) to 4.9 2.3 (24 hours), of siRNA targeting either BRCA-1 or DNA-PKcs as con- respectively. In contrast, in BRCA-1–defective HCC1937 firmed by real-time RT-PCR (Fig. 4A). Knockdown of cells and MDA-MB-468 cells, there was no significant either DNA-PKcs or BRCA-1 improved the radiosensitiv- change in the number of g-H2AX foci at 1 hour (22.5 ity of TNBC cells to 213Bi-cetuximab. In MCF-7 cells, the 6.6 and 31.3 8.0) and 24 hours (20.3 6.5 and 33.8 ED50 was reduced from 6.5 mCi/mL from control siRNA 10.3; Fig. 3B), strongly suggesting compromised, if not to 3.4 and 1.9 mCi/mL in cells knocked down with complete lack of DSB repair in these two cell lines. BRCA-1 or DNA-PKcs siRNA, respectively (Fig. 4B). In Treatment of MCF-7, MDA-MB-231, and MDA-MB-436 MDA-MB-231 cells treated with 213Bi-cetuximab, the 213 cells by the DNA-PKcs inhibitor NU7441 and Bi-cetux- ED50 improved significantly from 1.8 mCi/mL in cells imab abolished the significant decrease of g-H2AX foci transfected by negative control scrambled siRNA to 0.56 from 1 hour to the 24-hour period, likely a result of DSB mCi/mL in cells transfected by siRNA targeting BRCA-1 repair inhibition (Fig. 3). For the two cell lines already and to 0.78 mCi/mL in cells transfected by siRNA target- sensitive to 213Bi-cetuximab, HCC1937, and MDA-MB- ing DNA-PKcs (Fig. 4C). Likewise, siRNA knockdown of

A 120 Control siRNA BRCA1 siRNA DNA-PKcs siRNA 100

Percentage expression (%) expression Percentage 0 MCF-7 MDA-MB-231 HCC1937 MDA-MB-436

Figure 4. siRNA knockdown of BRCA-1 (HR) and DNA-PKcs BC (NHEJ) enhances the 1.00 1.00 Cetuximab-Bi213 + siRNA Control radiosensitivity of breast cancer Cetuximab-Bi213 + siRNA DNA-PKcs cells. A, real-time RT-PCR Cetuximab-Bi213 + siRNA BRCA1 conﬁrmed siRNA knockdown of BRCA-1 and DNA-PKcs in MCF-7, MDA-MB-231, MDA-MB-436, and 0.10 0.10 HCC1937 cells. Cell survival curves are shown for MCF-7 cells Cetuximab-Bi213 + siRNA Control Surviving fraction (B), MDA-MB-231 cells (C), MDA- Surviving fraction Cetuximab-Bi213 + siRNA DNA-PKcs MB-436 cells (D), and HCC1937 Cetuximab-Bi213 + siRNA BRCA-1 MCF-7 MDA-MB-231 cells (E) to alpha-particle radiation 0.01 0.01 012246810 012246810 delivered by 213Bi-cetuximab. Cetuximab-Bi213 (μCi/mL) Cetuximab-Bi213 (μCi/mL) DE1.00 1.000 Cetuximab-Bi213 + siRNA Control Cetuximab-Bi213 + siRNA DNA-PKcs

0.100

0.10

0.010 Surviving fraction Surviving fraction Cetuximab-Bi213 + siRNA Control

Cetuximab-Bi213 + siRNA BRCA1 MDA-MB-436 HCC1937 0.01 0.001 012246810 012246810 Cetuximab-Bi213 (μCi/mL) Cetuximab-Bi213 (μCi/mL)

www.aacrjournals.org Mol Cancer Ther; 12(10) October 2013 OF7

Song et al.

the MDA-MB-231 tumors; %ID/g in the tumors increased 1 h 24 h from 2.9 0.5% at 1 hour to its peak of 40.6 8.9% at 48 Control siRNA Control siRNA hours after injection. Tumor uptake persisted at 72 hours at 38.0 7.9%ID/g. Like most antibodies, liver is the normal organ after blood with the highest uptake of 21.1 9.5%ID/g at 1 hour. Consistent with the ﬁnding that cetuximab does not cross react with mouse EGFR, no signiﬁcant uptake in other normal organs was observed. Finally, 111In-cetuximab cleared slowly from major organs MDA-MB-231 MDA-MB-231 with half-life ranging from 40.8 to 173.3 hours.

BRCA-1 siRNA BRCA-1 siRNA Dosimetry Absorbed doses from 120 mCi 213Bi-cetuximab to normal organs are shown in Table 2. The blood-absorbed dose from alpha particles is 5.23 Gy and liver has the highest normal organ absorbed dose with 4.28 and 0.22 Gy from alpha- and beta-particle emissions, respectively. These results are consistent with our observations in other dosi- metric studies of alpha-particle emitter–labeled intact MDA-MB-231 MDA-MB-231 antibodies (23). The RBE for MDA-MB-231 cells based on calculations using nonspecific and specific antibody DNA-PKcs siRNA DNA-PKcs siRNA showed that nonspecific 213Bi-rituximab gives an RBE of 3.8 using 37% cell survival as biologic endpoint and 137Cs gamma rays as reference, whereas a similar RBE of 3.7 was found for 213Bi-cetuximab. When DSB repair genes DNA-PKcs and BRCA-1 are knocked down by siRNA, the RBEs increased significantly to 8.6 and 15.6, respectively (Table 3). MDA-MB-231 MDA-MB-231 Discussion In this study, we showed that targeting alpha-particle Figure 5. g-H2AX immunofluorescent staining shows that knockdown of radiation (213Bi) with anti-EGFR antibody cetuximab is BRCA-1 DNA-PKcs and genes inhibited the resolution of g-H2AX at 24 highly effective in killing BRCA-1–defective TNBC cells hours in MDA-MB-231 cells. where DSB repair is compromised. We further showed that inhibiting DSB repair pathways, either the HR BRCA-1 in MDA-MB-436 cells enhanced its radiosensi- pathway via BRCA-1 or NHEJ pathway via DNA-PKcs, tivity to 213Bi-cetxumiab with an ED change from 5.6 to 50 preferentially sensitizes breast cancer cells with intact 1.4 mCi/mL (Fig. 4D). In the BRCA-1–mutated HCC1937 DSB repair function to alpha particles. Thus, similar cells, knockdown of DNA-PKcs slightly reduced the ED 50 to the concept of prescreening HER-2–positive breast from 0.60 to 0.53 mCi/mL, consistent with that observed cancer before treatment with trastuzumab, one could in the parental cells treated with DNA-PKcs inhibitor envision, in the era of cancer genomics, prescreening NU7441 and 213Bi-cetuximab. breast tumors with loss-of-function mutations in DSB Immunofluorescent staining of g-H2AX foci confirmed repair genes would increase the efficacy of targeted the inhibition of DSB repair in MDA-MB-231 cells trans- alpha radioimmunotherapy. fected with siRNA targeting DNA-PKcs or BRCA-1 (Fig. 5). Targeted alpha-particle emitters are currently under Cell-cycle analysis showed that both TNBC cells, MDA- clinical investigations for leukemia (33), ovarian cancer MB-231 and HCC1937, were arrested in G –M phase after 2 (34), malignant melanoma (35), and glioblastoma (36) treatment with 213Bi-cetuximab. Inhibiting DNA-PKcs in because of their high potency. The recent clinical success MDA-MB-231 cells further enhanced the G –M arrest after 2 of Radium-223 (Alpharadin) in castration-resistant pros- 213Bi-cetuximab treatment (Fig. 6). tate cancer with bone metastases (37) supports further development of alpha-particle emitters and highlights the Biodistribution of 111In-cetuximab EGFR-positive importance of a unique biologic mechanism in the highly TNBC tumors specific accumulation of targeted radioisotopes. EGFR is The biodistribution of 111In-cetuximab in nude mice highly expressed on a variety of epithelial cancers, 99mTc, bearing a subcutaneous MDA-MB-231 tumor is shown 64Cu, 86Y, 89Zr anti-EGFR antibodies (cetuximab, panitu- in Fig. 7. 111In-cetuximab was cleared slowly from blood mumab) have been extensively investigated as imaging with an effective half-life of 40.8 hours and accumulated in agents in colorectal cancer, head and neck squamous cell

OF8 Mol Cancer Ther; 12(10) October 2013 Molecular Cancer Therapeutics

Targeting Defective DNA DSB Repair with Alpha Radiation

1 h 24 h 300240180120600 300240180120600

Sub-G1: 1.3 Sub-G1: 1.5

G1: 57.8 G1: 29.3 S: 20.5 S: 9.5

G2–M: 18.2 G2–M: 56.5 Counts

HCC1937 HCC1937 Figure 6. Cell-cycle analysis showed alpha-particle–induced cell-cycle arrest in G2–M phase in 0 200 400 600 800 1,000 0 200 400 600 800 1,000 BRCA-1–defective HCC1937 and FL2 FL2

NU7441-treated MDA-MB-231 300240180120600 300240180120600 cells. NU7441 NU7441 Sub-G : 2.8 Sub-G1: 2.2 1 G : 20.3 G1: 42.3 1 S: 20.8 S: 5.3 G –M: 70.1 G2–M: 33.8 2 Counts

MDA-MB-231 MDA-MB-231

0 200 400 600 800 1,000 0 200 400 600 800 1,000 FL2 FL2 carcinoma (HNSCC), and lung cancer (38–40). As radio- the prevalent expression of EGFR on normal epithelial therapeutics, anti-EGFR antibodies have been labeled cells that lead to skin and gastrointestinal toxicity obs- with both beta emitters 90Y and 177Lu, and alpha emitter, erved in cetuximab trials (43). A clinical study of intra- 213Bi, and were found effective in several preclinical venous 125I-labeled anti-EGFR antibody 425 with radio- models of HNSCC, bladder, and colorectal cancer (41, therapy in patients with glioblastoma found no survival 42). Few clinical trials have been launched partially due to beneﬁt compared with radiotherapy alone (44). Targeting

60 1 h 3 h Cetuximab-In111 6 h 24 h MDA-MB-231 tumor 50 48 h 72 h

Figure 7. Biodistribution of 111In- 40 cetuximab in nude mice (5 mice/ group) bearing subcutaneous MDA-MB-231 tumors. Mice were sacriﬁced at 1, 3, 6, 24, 48, and 30 72 hours after injection of %ID/g radiolabeled cetuximab. Tumor uptake of cetuximab peaked at 48 hours postinjection. 20

0 Blood Heart Lung Liver Spleen Kidney Stomach Intestine Muscle Femur Tumor

www.aacrjournals.org Mol Cancer Ther; 12(10) October 2013 OF9

Song et al.

Table 2. Tissue-absorbed doses cell survival. This is consistent with heavy ion-beam studies. Irradiation of glioblastoma cells MO59J deficient in DNA-PKcs with heavy ion beam found no reduction of Absorbed dose (Gy) g-H2AX foci after 21 hours (47). In Ku80-deficient (NHEJ- Tissue a-Particle Electron deficient) Chinese hamster ovary (CHO) cells treated with Blood 5.23 0.27 alpha particles, significantly more g-H2AX foci were Heart 1.34 0.07 present (58.4%–69.5%) 2 hours after radiation compared Lung 2.14 0.11 with normal CHO cells (36.5%–42.8%; ref. 48). 213 Liver 4.28 0.22 Cell survival curves showed that Bi-cetuximab is most BRCA-1 Spleen 1.21 0.06 efficacious in –defective HCC1937 cells and BRCA-1 Kidney 1.15 0.06 knockdown MDA-MB-231 cells. In patients with BRCA-1 Stomach 0.37 0.02 TNBC that are not –defective, agents that lead to Intestine 0.66 0.03 BRCA-1 inhibition combined with targeted alpha radio- Muscle 0.19 0.01 therapy would be useful. Until recently, only a handful Femur 0.40 0.02 of BRCA-1 inhibitors, however, are under early stage evaluation primarily due to low specificity, as many of these protein–protein interactions, unlike enzyme active TNBC cells with high EGFR expression level and defective sites, also have large, multiple contact points and poorly DSB repair pathways can potentially open a therapeutic defined topology (49). Many other DSB repair inhibitors window that leads to clinical responses with tolerated are currently available for combination with targeted alpha toxicity to normal tissues. therapy for TNBC including the DNA-PKcs inhibitor used Tumors that have homologous loss-of-function in this study (29), ATM inhibitor and Rad51 inhibitors (50). defects at DSB repair pathway genes often arise from PARP-1 inhibitors are also under clinical investigation the normal tissues that are heterozygous and preserve for patients with breast and ovarian cancer with BRCA-1 DNA repair function. Nieuwenhuis and colleagues mea- mutations under the synthetic lethality hypothesis (21). A sured the rejoining of DNA breaks in normal fibroblast phase II trial showed that PARP-1 inhibitor iniparib in and lymphocytes cells with heterozygous BRCA-1/ combination with gemcitabine and carboplatin signifi- BRCA-2 mutations after X-ray radiation and found no cantly improved progression-free survival and overall defect in their ability to repair DNA breaks (45). In survival in patients with TNBC (51). The subsequent external beam radiotherapy, multiple studies were not phase III trial, however, failed to confirm its survival able to link pathogenic heterozygous mutations in DDR benefit (52). As alpha-particle emitter radiolabeled anti- genes such as ATM, BRCA-1, BRCA-2,andRAD50 to body is targeting the same DNA repair deficiency as normal tissue radiosensitivity (46). These findings sug- PARP-1 inhibitors, these clinical results suggested the gest that high LET alpha-particle radiation could be potential of alpha radioimmunotherapy in patients with targeted to treat tumors with homozygous loss-of-func- TNBC, but at the same time warrant more careful pre- tion in DNA repair while sparing normal tissues with clinical studies of, for example, the correlation of EGFR heterozygous DNA repair genes. expression level, mutation rate with their deficiency in In cells deficient in NHEJ and HR, we found that BRCA-1, and response to alpha radiation. compromised repair of DSB lesions, rather than initially An interesting observation in this study is that MDA- produced DSBs by alpha-particle radiation, determines MB-468 cells were exquisitely sensitive to the treatment of 213Bi-cetuximab, even more so than the BRCA-1–defective HCC1937 cells. One of the main reasons probably is its Table 3. Radiosensitivity (D0) and RBE of the high expression of EGFR receptors (almost 10 times MDA-MB-231cell line under different exposure higher) compared with other TNBC cells lines, potentially and DNA repair pathway inhibition conditions delivering significantly higher alpha doses to the tumor cells. In addition, the cell survival curve with gamma rays showed that the MDA-MB-468 cells are sensitive to radi- D0 Agent, manipulation (Gy) RBEa ation and exhibit a diminished shoulder region, consistent with its radiosensitivity to UV radiation attributed to the 213Bi-Rituximab (irrelevant Ab) 0.84 3.8 RB 213 deficient gene and deficiency in recovery of mRNA Bi-Cetuximab 0.87 3.7 synthesis (53). The possible dysregulation of DSB repair in 213Bi-Cetuximab, siRNA scrambled control 0.69 4.7 213 MDA-MB-468 cells remains to be studied. Bi-Cetuximab, siRNA DNA-PKcs-/ 0.37 8.6 We have conducted initial in vivo evaluation of 213Bi- DNA-PKcs- 213 cetuximab in a mouse model of TNBC. Because of poor Bi-Cetuximab, siRNA BRCA1-/BRCA1- 0.21 15.6 tumorigenesis of the HCC1937 cells, however, we cannot aRBE is reported using 37% cell survival as the biologic interpret the data reliably. We are currently developing a endpoint and Cs-137 gamma rays as the reference radiation. more robust mouse model to evaluate the efficacy of alpha radioimmunotherapy in tumors with homozygous

OF10 Mol Cancer Ther; 12(10) October 2013 Molecular Cancer Therapeutics

Targeting Defective DNA DSB Repair with Alpha Radiation

loss-of-function and toxicity in normal tissues with het- Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): H. Song, M. Hedayati, C. Shao, F. Bruchertseifer, erozygous at DSB repair genes. T.L. DeWeese In conclusion, we have shown that TNBC can be tar- Analysis and interpretation of data (e.g., statistical analysis, biostatis- tics, computational analysis): H. Song, M. Hedayati, R.F. Hobbs, G. geted by alpha-particle emitter–labeled anti-EGFR anti- Sgouros body. The defective DSB repair machinery in a subset of Writing, review, and/or revision of the manuscript: H. Song, M. Hedayati, TNBC can be uniquely suitable for alpha radiation treat- R.F. Hobbs, C. Shao, A. Morgenstern, T.L. DeWeese, G. Sgouros Administrative, technical, or material support (i.e., reporting or orga- ment. New approaches combining inhibitors of DSB nizing data, constructing databases): H. Song, R.F. Hobbs, F. Bruchert- repair pathways and internal alpha-particle emitters tar- seifer, A. Morgenstern, G. Sgouros geting remain to be explored. Finally, the safety of such an Study supervision: H. Song, G. Sgouros approach in patients with heterozygous expression of DSB repair genes needs to be evaluated. Grant Support This work was supported by NIH grant R01 CA 113797 (to G. Sgouros) ﬂ and Maryland Stem Cell Research Fund (MSCRF) grant 2009-MSCRFE- Disclosure of Potential Con icts of Interest 0109-00 (to H. Song). G. Sgouros has ownership interest in a patent licensed to Actinium The costs of publication of this article were defrayed in part by the Pharmaceuticals, Inc. No potential conﬂicts of interest were disclosed by payment of page charges. This article must therefore be hereby marked the other authors. advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Authors' Contributions Conception and design: H. Song, G. Sgouros Received February 13, 2013; revised June 18, 2013; accepted July 14, 2013; Development of methodology: H. Song, M. Hedayati published OnlineFirst July 19, 2013.

References 1. Goldenberg DM. Targeted therapy of cancer with radiolabeled anti- 15. Lynch HT, de la Chapelle A. Hereditary colorectal cancer. N Engl J Med bodies. J Nucl Med 2002;43:693–713. 2003;348:919–32. 2. Song H, Sgouros G. Radioimmunotherapy of solid tumors: searching 16. Esteller M, Garcia-Foncillas J, Andion E, Goodman SN, Hidalgo OF, for the right target. Curr Drug Deliv 2011;8:26–44. Vanaclocha V, et al. Inactivation of the DNA-repair gene MGMT and the 3. Pai-Scherf LH, Carrasquillo JA, Paik C, Gansow O, Whatley M, Pear- clinical response of gliomas to alkylating agents. N Engl J Med son D, et al. Imaging and phase I study of 111In- and 90Y-labeled anti- 2000;343:1350–4. LewisY monoclonal antibody B3. Clin Cancer Res 2000;6:1720–30. 17. McDevitt MR, Sgouros G, Finn RD, Humm JL, Jurcic JG, Larson SM, 4. Sharkey RM, Goldenberg DM, Murthy S, Pinsky H, Vagg R, Pawlyk D, et al. Radioimmunotherapy with alpha-emitting nuclides. Eur J Nucl et al. Clinical evaluation of tumor targeting with a high-affinity, antic- Med 1998;25:1341–51. arcinoembryonic-antigen-specific, murine monoclonal antibody, MN- 18. Kasparek TR, Humphrey TC. DNA double-strand break repair path- 14. Cancer 1993;71:2082–96. ways, chromosomal rearrangements and cancer. Semin Cell Dev Biol 5. Ballangrud AM, Yang WH, Palm S, Enmon R, Borchardt PE, Pellegrini 2011;22:886–97. VA, et al. Alpha-particle emitting atomic generator (Actinium-225)- 19. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al. labeled trastuzumab (Herceptin) targeting of breast cancer spheroids: Molecular portraits of human breast tumours. Nature 2000;406: efficacy versus HER2/neu expression. Clin Cancer Res 2004;10: 747–52. 4489–97. 20. Dent R, Trudeau M, Pritchard KI, Hanna WM, Kahn HK, Sawka CA, 6. Ballangrud AM, Yang WH, Charlton DE, McDevitt MR, Hamacher KA, et al. Triple-negative breast cancer: clinical features and patterns of Panageas KS, et al. Response of LNCaP spheroids after treatment with recurrence. Clin Cancer Res 2007;13:4429–34. an alpha-particle emitter (213Bi)-labeled anti-prostate-specific mem- 21. Anders CK, Winer EP, Ford JM, Dent R, Silver DP, Sledge GW, et al. brane antigen antibody (J591). Cancer Res 2001;61:2008–14. Poly(ADP-Ribose) polymerase inhibition: "targeted" therapy for triple- 7. Sgouros G, Squeri S, Ballangrud AM, Kolbert KS, Teitcher JB, Pana- negative breast cancer. Clin Cancer Res 2010;16:4702–10. geas KS, et al. Patient-specific, 3-dimensional dosimetry in non- 22. Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T, et al. A Hodgkin's lymphoma patients treated with 131I-anti-B1 antibody: collection of breast cancer cell lines for the study of functionally distinct assessment of tumor dose-response. J Nucl Med 2003;44:260–8. cancer subtypes. Cancer Cell 2006;10:515–27. 8. Hernandez MC, Knox SJ. Radiobiology of radioimmunotherapy with 23. Song H, Shahverdi K, Huso DL, Esaias C, Fox J, Liedy A, et al. 213Bi 90Y ibritumomab tiuxetan (Zevalin). Semin Oncol 2003;30:6–10. (alpha-emitter)-antibody targeting of breast cancer metastases in the 9. Johansson L, Carlsson J, Nilsson K. Radiosensitivity of human B- neu-N transgenic mouse model. Cancer Res 2008;68:3873–80. lymphocytic lymphomas in vitro. Int J Radiat Biol Relat Stud Phys 24. Song H, Hobbs RF, Vajravelu R, Huso DL, Esaias C, Apostolidis C, et al. Chem Med 1982;41:411–20. Radioimmunotherapy of breast cancer metastases with alpha-particle 10. M'Kacher R, Bennaceur A, Farace F, Lauge A, Plassa LF, Wittmer E, emitter 225Ac: comparing efficacy with 213Bi and 90Y. Cancer Res et al. Multiple molecular mechanisms contribute to radiation sensitivity 2009;69:8941–8. in mantle cell lymphoma. Oncogene 2003;22:7905–12. 25. Apostolidis C, Molinet R, Rasmussen G, Morgenstern A. Production of 11. Lord CJ, Ashworth A. The DNA damage response and cancer therapy. Ac-225 from Th-229 for targeted alpha therapy. Anal Chem 2005;77: Nature 2012;481:287–94. 6288–91. 12. Fackenthal JD, Olopade OI. Breast cancer risk associated with BRCA1 26. Zielinska B, Apostolidis C, Bruchertseifer F, Morgenstern A. An and BRCA2 in diverse populations. Nat Rev Cancer 2007;7:937–48. improved method for the production of Ac-225/Bi-213 from Th-229 13. Risch HA, McLaughlin JR, Cole DE, Rosen B, Bradley L, Kwan E, et al. for targeted alpha therapy. Solvent Extr Ion Exc 2007;25:339–49. Prevalence and penetrance of germline BRCA1 and BRCA2 mutations 27. McDevitt MR, Finn RD, Sgouros G, Ma D, Scheinberg DA. An 225Ac/ in a population series of 649 women with ovarian cancer. Am J Hum 213Bi generator system for therapeutic clinical applications: construc- Genet 2001;68:700–10. tion and operation. Appl Radiat Isot 1999;50:895–904. 14. Goggins M, Schutte M, Lu J, Moskaluk CA, Weinstein CL, Petersen 28. Song H, Shahverdi K, Huso DL, Wang Y, Fox JJ, Hobbs RF, et al. An GM, et al. Germline BRCA2 gene mutations in patients with apparently immunotolerant HER-2/neu transgenic mouse model of metastatic sporadic pancreatic carcinomas. Cancer Res 1996;56:5360–4. breast cancer. Clin Cancer Res 2008;14:6116–24.

www.aacrjournals.org Mol Cancer Ther; 12(10) October 2013 OF11

Song et al.

29. Zhao Y, Thomas HD, Batey MA, Cowell IG, Richardson CJ, Griffin RJ, EGFR-mAb defeats human bladder carcinoma in xenografted nude et al. Preclinical evaluation of a potent novel DNA-dependent protein mice. J Nucl Med 2009;50:1700–8. kinase inhibitor NU7441. Cancer Res 2006;66:5354–62. 42. Milenic DE, Wong KJ, Baidoo KE, Ray GL, Garmestani K, Williams M, 30. Sgouros G, Ballangrud ÅM, Humm JL, Jurcic JG, McDevitt MR, Erdi et al. Cetuximab: preclinical evaluation of a monoclonal antibody YE, et al. Pharmacokinetics and dosimetry of an alpha-particle emitter targeting EGFR for radioimmunodiagnostic and radioimmunothera- labeled antibody: 213Bi-HuM195 (anti-CD33) in patients with leukemia. peutic applications. Cancer Biother Radiopharm 2008;23:619–31. J Nucl Med 1999;40:1935–46. 43. Van Cutsem E, Kohne CH, Hitre E, Zaluski J, Chang Chien CR, 31. Howell RW, Rao DV, Bouchet LG, Bolch WE, Goddu SM. MIRD cellular Makhson A, et al. Cetuximab and chemotherapy as initial treatment S values. Reston, VA: Society of Nuclear Medicine; 1997. for metastatic colorectal cancer. N Engl J Med 2009;360:1408–17. 32. Hamacher KA, Den RB, Den EI, Sgouros G. Cellular dose conversion 44. Wygoda Z, Kula D, Bierzynska-Macyszyn G, Larysz D, Jarzab M, factors for alpha-particle–emitting radionuclides of interest in radio- Wlaszczuk P, et al. Use of monoclonal anti-EGFR antibody in the nuclide therapy. J Nucl Med 2001;42:1216–21. radioimmunotherapy of malignant gliomas in the context of EGFR 33. Rosenblat TL, McDevitt MR, Mulford DA, Pandit-Taskar N, Divgi CR, expression in grade III and IV tumors. Hybridoma 2006;25:125–32. Panageas KS, et al. Sequential cytarabine and alpha-particle immu- 45. Nieuwenhuis B, Van Assen-Bolt AJ, Van Waarde-Verhagen MA, Sij- notherapy with bismuth-213-lintuzumab (HuM195) for acute myeloid mons RH, Van der Hout AH, Bauch T, et al. BRCA1 and BRCA2 leukemia. Clin Cancer Res 2010;16:5303–11. heterozygosity and repair of X-ray-induced DNA damage. Int J Radiat 34. Andersson H, Cederkrantz E, Back T, Divgi C, Elgqvist J, Himmelman Biol 2002;78:285–95. J, et al. Intraperitoneal alpha-particle radioimmunotherapy of ovarian 46. Andreassen CN, Alsner J. Genetic variants and normal tissue toxicity cancer patients: pharmacokinetics and dosimetry of (211)At-MX35 F after radiotherapy: a systematic review. Radiother Oncol 2009;92: (ab')2–a phase I study. J Nucl Med 2009;50:1153–60. 299–309. 35. AllenBJ,SinglaAA,RizviSM,GrahamP,BruchertseiferF,Aposto- 47. Karlsson KH, Stenerlow B. Focus formation of DNA repair proteins in lidis C, et al. Analysis of patient survival in a Phase I trial of systemic normal and repair-deficient cells irradiated with high-LET ions. Radiat targeted alpha-therapy for metastatic melanoma. Immunotherapy Res 2004;161:517–27. 2011;3:1041–50. 48. Kinashi Y, Takahashi S, Kashino G, Okayasu R, Masunaga S, Suzuki 36. Kneifel S, Cordier D, Good S, Ionescu MC, Ghaffari A, Hofer S, et al. M, et al. DNA double-strand break induction in Ku80-deficient CHO Local targeting of malignant gliomas by the diffusible peptidic vector cells following Boron Neutron Capture Reaction. Radiat Oncol 1,4,7,10-tetraazacyclododecane-1-glutaric acid-4,7,10-triacetic acid- 2011;6:106. substance p. Clin Cancer Res 2006;12:3843–50. 49. Pessetto ZY, Yan Y, Bessho T, Natarajan A. Inhibition of BRCT 37. Nilsson S, Franzen L, Parker C, Tyrrell C, Blom R, Tennvall J, et al. (BRCA1)-phosphoprotein interaction enhances the cytotoxic effect Bone-targeted radium-223 in symptomatic, hormone-refractory pros- of olaparib in breast cancer cells: a proof of concept study for tate cancer: a randomised, multicentre, placebo-controlled phase II synthetic lethal therapeutic option. Breast Cancer Res Treat 2012; study. Lancet Oncol 2007;8:587–94. 134:511–7. 38. Nayak TK, Regino CA, Wong KJ, Milenic DE, Garmestani K, Baidoo KE, 50. Huang F, Motlekar NA, Burgwin CM, Napper AD, Diamond SL, Mazin et al. PET imaging of HER1-expressing xenografts in mice with 86Y- AV. Identification of specific inhibitors of human RAD51 recombinase CHX-A00-DTPA-cetuximab. Eur J Nucl Med Mol Imaging 2010;37: using high-throughput screening. Acs Chem Biol 2011;6:628–35. 1368–76. 51. O'Shaughnessy J, Osborne C, Pippen JE, Yoffe M, Patt D, Rocha C, 39. Nayak TK, Garmestani K, Milenic DE, Brechbiel MW. PET and MRI of et al. Iniparib plus chemotherapy in metastatic triple-negative breast metastatic peritoneal and pulmonary colorectal cancer in mice with cancer. N Engl J Med 2011;364:205–14. human epidermal growth factor receptor 1-targeted 89Zr-labeled 52. O'Shaughnessy J, Schwartzberg LS, Danso MA, Rugo HS, Miller K, panitumumab. J Nucl Med 2012;53:113–20. Yardley R, et al. A randomized phase III study of iniparib (BSI-201) in 40. Schechter NR, Wendt RE III, Yang DJ, Azhdarinia A, Erwin WD, combination with gemcitabine/carboplatin (G/C) in metastatic triple- Stachowiak AM, et al. Radiation dosimetry of 99mTc-labeled C225 negative breast cancer (TNBC). J Clin Oncol 2011;29:S1007. in patients with squamous cell carcinoma of the head and neck. J Nucl 53. Billecke CA, Ljungman ME, McKay BC, Rehemtulla A, Taneja N, Ethier Med 2004;45:1683–7. SP. Lack of functional pRb results in attenuated recovery of mRNA 41. Pfost B, Seidl C, Autenrieth M, Saur D, Bruchertseifer F, Morgenstern synthesis and increased apoptosis following UV radiation in human A, et al. Intravesical alpha-radioimmunotherapy with 213Bi-anti- breast cancer cells. Oncogene 2002;21:4481–9.

OF12 Mol Cancer Ther; 12(10) October 2013 Molecular Cancer Therapeutics

Targeting Aberrant DNA Double-Strand Break Repair in Triple-Negative Breast Cancer with Alpha-Particle Emitter Radiolabeled Anti-EGFR Antibody

Hong Song, Mohammad Hedayati, Robert F. Hobbs, et al.

Mol Cancer Ther Published OnlineFirst July 19, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-13-0108

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/early/2013/09/25/1535-7163.MCT-13-0108. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.