UNIVERSITY OF CINCINNATI
Date:______
I, ______, hereby submit this work as part of the requirements for the degree of: in:
It is entitled:
This work and its defense approved by:
Chair: ______
The Role of Uroguanylin in the Regulation of Renin Angiotensin Aldosterone System
A thesis submitted to the
Division of Research and Advanced Studies of the University of Cincinnati
in partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE
in the Molecular and Developmental Biology Program of the College of Medicine
2006
By
Shams Tabrez Quazi
M.B.,B.S., Pune University, India, 2003
Committee Chair: Katherine Yutzey, Ph.D.
i Abstract
Dysregulation of the Renin Angiotensin Aldosterone System (RAAS) is implicated in
diseases such as hypertension and congestive heart failure. cGMP regulating systems
work as physiological antagonists to counter harmful RAAS hyperactivity. Uroguanylin
(UGN) is one such cGMP regulating peptide, but its effect on RAAS has not been
studied. On the basis of background information from other cGMP regulating factors like
atrial natriuretic peptide (ANP), as well as the phenotype of UGN knockout mice, we
formulated the hypothesis that UGN negatively regulates renin expression and/or
secretion. The microarray results were consistent with our hypothesis that UGN inhibits
renin mRNA expression but we could not validate this by Real-Time PCR. A possible
reason behind this discrepancy could be the remarkable effect of psychosocial stress on renin expression, a parameter not considered during our microarray experiment. Future
studies could be designed to explore the possible negative role of UGN on renin
secretion.
ii
iii
Acknowledgements
It is my pleasure to thank all the people that made this Master’s thesis possible and for
making this endeavor an enjoyable one.
I would like to acknowledge my thesis committee, Dr. Katherine Yutzey, Dr. Mitchell
Cohen, and Dr. Kris Steinbrecher for their time and advice. I also thank the Molecular
and Developmental Biology Graduate program for having provided me the opportunity to
further my education.
It is difficult to overstate my gratitude to my advisor, Dr. Mitchell Cohen. His appreciation and encouragement was invaluable during the two years I was associated
with him and his lab. I saw in him an ideal mentor who displayed the correct balance
between providing me with freedom to think on my own and also being there when I
needed guidance. I will cherish his mentorship all my life.
I would also like to thank everyone in Dr. Cohen’s lab for providing a great working
environment. I appreciate all the advice and guidance I got from Dr. Kris Steinbrecher,
Dr. Maksood Wani, and Dr. Elizabeth Mann. I thank Dr. Monica Garin-Laflam for being
a friend and a colleague. I also thank Jen Hawkins and Juxian Mao for their technical
expertise and support.
iv
Table of Contents
Title i
Abstract ii
Blank Page iii
Acknowledgement iv
Table of Contents v
Introduction 1
Background and Significance 6
Materials and Methods 14
Results 17
Discussion 26
References 30
v Introduction
Guanylin (GN) and uroguanylin (UGN), also referred to as “guanylin peptides,” are small
molecular weight (~12kD) proteins that are found naturally in humans and other
mammals. These peptides are similar to the heat-stable toxin (ST) secreted by E.coli that
causes traveler’s diarrhea (1). Identification of ST-producing organisms in large numbers
of patients with E. coli diarrhea led to studies to find their mechanism of action. It was
discovered that ST increased intracellular cGMP and subsequently, it was shown that the
ST receptor was a transmembrane protein, guanylate cyclase C (GC-C) (2). GC-C was
shown to be expressed at high levels in the apical membrane of the intestinal epithelium
and eventually it was found to be expressed in various other organs such as kidney,
regenerating liver, testes, placenta and uterus (3, 4). The search for endogenous ligands
for this receptor led to the isolation of GN from embryonic rat intestine and a little later,
of UGN from opossum urine (5, 6). Both peptides were shown to bind to and activate the
GC-C receptor. These peptides are also found in various human and other mammalian
organs including the intestinal epithelium, kidney, brain, placenta and the uterus and are secreted as inactive prohormones (4, 7). The guanylin peptides have significant homology to each other, both at the nucleotide level, and at primary protein sequence level (Table I).
Amino terminus Carboxyl termi nus E.coli STporcine N-T-F-Y-C-C-E-L-C-C-N-P-A-C-A-G-C-Y E.coli SThuman N-S-S-N-Y-C-C-E-L-C-C-N-P-A-C-T-G-C-Y GNhuman P-G-T-C-E-I-C-A-Y-A-A-C-T-G-C GNmouse P-N-T-C-E-I-C-A-Y-A-A-C-T-G-C UGNhuman N-D-D-C-E-L-C-V-N-V-A-C-T-G-C-L UGNmouse T-D-E-C-E-L-C-I-N-V-A-C-T-G-C
Table I. The guanylin peptide family. There is a large degree of homology at the protein level between guanylin, uroguanylin and ST and between peptides from different species.
1 After they are secreted in the inactive pro-hormone form, they are cleaved to produce the
active form that binds to GC-C. The cysteine rich carboxy terminal is the active portion
of ST and the guanylin peptides. Binding of this carboxy terminal to the extracellular
domain of GC-C activates the intracellular guanylate cyclase domain raising intracellular
cGMP levels as shown in Figure 1 (6). This in turn has multiple effects on intracellular
kinases, phosphodiesterases and ion transporters. Perhaps the most studied effect is the
activation of cGMP-dependent protein kinase II (cGK-II) (10). Activation of cGK-II
causes the phosphorylation of cystic fibrosis transmembrane conductance regulator
(CFTR) and consequently results in bicarbonate and chloride ion secretion.
Figure 1. Schematic representation of GN/UGN signaling cascade. GN, UGN and ST (also known as STa) bind to the extracellular domain of GC-C producing conformational changes in the intracellular cyclase domain that generates cGMP from GTP. Increased intracellular cGMP activates cGK-II that phosphorylates CFTR causing chloride and bicarbonate secretion.
2 Soon after the isolation of the UGN and GN peptides, their genes were localized to the human chromosome 1 and mouse chromosome 4 and were found to consist of 3 small exons. The genes are located close together and in mouse they are found to be less than
10 kb apart (8, 9).
Because of the close structural resemblance of the guanylin peptides to ST, as well as the extraordinary high levels of expression of these ligands and their receptor GC-C in the intestinal epithelium, most of the initial research work on them was focused on their effects on the intestine. Gradually, the role of these peptides, especially UGN, in the regulation of fluid electrolyte balance through their action on the kidneys was elucidated.
The role played by UGN in the body’s sodium balance can be seen as the mammalian counterpart of the osmoregulatory role of UGN in eurohyaline fish. These fish can adapt to living in salt as well as fresh water. On moving to the sea, they up-regulate the expression of UGN to adapt to the high salt content of sea water (11). This falls perfectly in line with the finding that in mouse, UGN expression increased significantly in the intestine and kidneys with high salt load delivered via drinking water (12). In addition, the 24hr urinary UGN was increased in rats on a high salt diet compared to low salt diet
(13). Additional findings that established UGN as a regulator of sodium balance were that
UGN, GN, as well as ST stimulated the urinary excretion of sodium, chloride, potassium and water in live animals as well as ex vivo, in isolated perfused kidneys (14-20). It was also shown that UGN and prouroguanylin circulate in the blood of human beings as well as animals, indicating that they might have a hormone like effect (21-24).
3 Based on these findings it was hypothesized that UGN might be the hormone that works in an endocrine axis linking the GI system to the kidneys as depicted in Figure 2 (26).
This endocrine axis sends the message to the kidneys to increase sodium excretion in the event of high enteral salt intake. This is similar to the mechanism by which the natriuretic peptides (ANP and BNP) act to excrete the extra salt from the body via the kidneys. In addition, UGN might also act in a local paracrine/autocrine manner involving an intra- renal mechanism (25, 26).
Figure 2. Schematic depiction of the hormonal link between the intestine and kidneys through the secretion of UGN by the intestine into the circulation. On ingestion of NaCl, the intestine senses the salt load and secretes UGN which acts on the kidneys to cause natriuresis to excrete the excess salt. Presence of this enterorenal endocrine axis was supported by studies by Lorenz et al (27). Atrial natriuretic protein (ANP), brain natriuretic protein (BNP) and UGN secreted by the cardiac tissue is also believed to participate in the natriuresis seen after high salt loads. The intrarenal paracrine/autocrine effect of the UGN and ANP secreted by the kidneys in the process of natriuresis after oral salt load is not shown in this figure. From Forte et al (26).
4 Perhaps, the most significant and revealing finding comes from the UGN knockout
mouse model. To disrupt the UGN gene locus, a targeted allele was generated by using a
targeting vector that had 140 bp of the promoter region and 807 bp of exon 1 replaced by
a PMC1neo polyA+ cassette in the negative orientation (27). Mice deficient for UGN
were shown by renal clearance measurements to have an impaired ability to excrete an
oral salt load as compared to the normal saliuretic response of wildtype mice (27). This was shown to be mainly due to inappropriate increase in renal sodium reabsorption. Even at baseline, the plasma sodium concentration was higher and the sodium potassium and fluid excretion was significantly lower in UGN knockout compared to wildtype mice.
The phenotype also included a significantly elevated blood pressure measured by telemetric method that was present irrespective of the dietary salt content. Interestingly, the saliuretic response of the knockout mice was similar to the wildtype on intravenous salt loading. This strongly suggested that there existed a mechanism by which the intestine uniquely sensed the increase in salt load and sent the message to the kidneys to increase salt excretion using UGN as the hormonal messenger. This brings to light the therapeutic potential of UGN in patients of congestive heart failure, ascites and salt sensitive hypertension, in whom the basic pathology is the retention of excess salt and water.
5 Background and Significance
Kidneys are the chief excretory organ in vertebrates and are essential for filtering blood of the metabolic waste generated in the body. In addition, this organ has other ancillary but critical functions in mammals. Kidneys produce the hormone erythropoietin, are involved in vitamin D metabolism, and are responsible to a large extent for maintaining fluid and electrolyte balance in the body. The Renin-Angiotensin-Aldosterone System
(RAAS) is the primary renal mechanism by which the hemodynamic stability and electrolyte balance is maintained.
Figure 1. A schematic representation of juxtaglomerular apparatus. The JG apparatus consists of juxtaglomerular (JG) cells and the macula densa cells. Macula densa cells are specialized cells of distal convoluted tubule of the nephron that sense reduced sodium delivery in the filtrate. This signal is transmitted to the adjacent JG cells. JG cells are modified smooth muscle cells in the wall of the afferent arteriole that synthesize and secrete renin into the circulation upon stimulation by the macula densa cells in addition to other stimuli. The cup-shaped structure is the Bowman’s capsule that surrounds the glomerular capillaries which form a convoluted ball of thin walled blood vessels. Through these capillaries, blood is filtered into the lumen of the nephron. It is formed by branching of the afferent arteriole that brings the blood into the glomerulus. The capillaries then unite to form the efferent arteriole that takes the blood out of the glomerulus. From the website- http://facstaff.bloomu.edu.
6 Renin is an aspartyl protease that circulates in the peripheral blood. The level of renin in the blood determines the level of activity of the RAAS making it the key controller of the
system. Renin is synthesized and secreted by the juxtaglomerular cells (JG cells) which
are modified smooth muscle cells located in the wall of the afferent arteriole (28, 29).
The anatomy of the JG apparatus is depicted in Figure 1. The synthesis and release of
renin by the JG cells is under the control of various stimuli that act directly or indirectly on the JG cells. There are three primary stimuli for renin synthesis and release as shown in Figure 2. They include decreased arterial blood pressure, increased renal β-adrenergic nerve activity and decreased glomerular filtration rate that causes decreased sodium delivery to the macula densa cells.
3
2
1
Figure 2. Diagrammatic representation of the three stimuli for renin synthesis and secretion: (1) decreased stretch on smooth muscle cells of the afferent arteriole as a result of decreased systemic blood pressure, (2) decreased sodium load or sodium concentration at the macula densa cells and (3) stimulation of β-adrenergic sympathetic nervous system. From Davis, JO, Am J Med, 55:333, 1973.
All these stimuli are generated as a result of plasma volume depletion with the sole
objective to return the blood pressure back to the normal range. Upon stimulation, JG
7 cells synthesize and secrete renin into the circulation. Circulating renin proteolytically
cleaves another circulating protein called angiotensinogen into the decapeptide
angiotensin I, which in turn is processed to the octapeptide angiotensin II by the action of
angiotensin-converting enzyme present in the lungs (3). The cascade is represented in
Figure 3.
Figure 3. Schematic depiction of the RAAS cascade. After renin is secreted by the kidneys into the circulation, it proteolytically cleaves angiotensinogen found in the blood stream into angiotensin I. Angiotensin I is cleaved to angiotensin II by the action of angiotensin converting enzyme in the lungs. This increases peripheral vascular resistance by vasoconstriction and causes the release of aldosterone from the adrenal glands. Aldosterone also causes sodium retention, potassium secretion and volume expansion. The above figure is from the website- http://www.nicholsdiag.com
Angiotensin II affects blood pressure in a number of ways. It increases vascular resistance directly by its vasoconstrictor action on blood vessels and indirectly by facilitating the sympathetic system. On the other hand, it is also the main stimulus to the adrenal glands for the synthesis and release of aldosterone, a mineralocorticoid hormone.
Aldosterone is the final signaling effector of RAAS that targets the kidney epithelium to
stimulate sodium reabsorption and potassium secretion. Aldosterone functions at two levels as shown in Figure 4. One effect is at the level of the distal tubular epithelial membrane, by enhancing the sodium/potassium exchange through the Na+/K+ antiporter and the other is at the level of the nucleus of these cells, by up-regulating the expression of epithelial sodium channels (ENaC) of the distal convoluted tubules (31, 32). As a consequence, a large amount of sodium is reabsorbed, potassium is secreted and water is
osmotically driven along with sodium into the intravascular space. The result is increase
in blood volume and intravascular pressure (33-35). This is the mechanism that helps
maintain hemodynamic stability in normal healthy individuals through the activation of
RAAS activity.
Figure 4. Mechanism of Aldosterone (ald) action. The green diamond (ald) denotes aldosterone that acts on the distal convoluted tubular cells in two ways. It directly acts on the Na-K exchanger (blue oval) situated on the basolateral membrane of tubular cells to increase sodium reabsorption and potassium secretion. It also acts on the nucleus and up-regulates the expression of epithelial Na channels, ENaC (purple rectangle) on the luminal side of these cells.
Though RAAS is an absolutely critical system in times of intravascular volume loss and
decreased blood pressure, it is essential to have a mechanism to counteract this system as
9 a check and balance. The reason behind this is that uncontrolled RAAS activity would
result in fluid and salt overload leading to elevated intravascular pressure and its
associated complications. The importance of this counter regulatory mechanism can be gauged by the fact that 70% of hypertensive patients have elevated renin levels (36).
According to the World Health Organization (WHO), currently 600 million people suffer
from hypertension worldwide. It is a substantial public health problem especially in
developed countries where 25% of the adult population has elevated blood pressure (37).
It is called “The Silent Killer” since patients are often asymptomatic but the long term complications of hypertension cause significant morbidity and mortality and include congestive heart failure, end stage renal disease, retinopathy, stroke and myocardial infarction (38-40). RAAS overactivity is also implicated in the salt and fluid retention in congestive heart failure and ascites.
cGMP based regulatory mechanisms are of vital importance for this physiological
antagonism of RAAS. These systems include the natriuretic peptides (ANP, BNP and
CNP), nitric oxide (NO) and the guanylin peptides. All the three groups raise intracellular
cGMP, albeit through different receptors. ANP operates through membrane associated
guanylate cyclase-A, NO diffuses into the cell where it activates soluble intracellular
guanylate cyclase while the guanylin peptides activate membrane associated guanylate
cyclase-C (41, 42). Though there are large amounts of data to support the fact that ANP
and NO inhibit RAAS activity, similar studies to elucidate the relationship between the
guanylin peptides and RAAS have not been conducted.
10 Studies showed that ANP inhibited the release of renin in isolated JG cells in culture in a
dose dependent manner and this inhibition was a cGMP mediated process (43). Similar
data was generated from ANP deficient mice. In these mice, plasma renin activity failed
to decrease in response to a high salt diet leading to salt sensitive hypertension (44). Also, there is reduced sensitivity to the pressure-natriuresis mechanism. This mechanism operates at times of high pressure status leading to a reduction in sodium and water overload consequently reducing the blood pressure. In Dahl Iwai rats there is inability to
suppress plasma renin activity when these rats are on a high salt diet and as a result they
develop hypertension. This hypertension is prevented by delivery of exogenous ANP
gene (45). Going downstream of the cGMP signaling cascade, it was found that
endogenous or over-expressed cGMP dependent protein kinase II (cGK-II) inhibited
cAMP mediated renin release in isolated perfused rat kidneys, microdissected glomeruli
and isolated JG cells (46). Studies done on cGK-II knockout mice further elucidated the
general inhibitory effect of activated cGK-II on renin. These mice exhibit inhibition of
renin expression and secretion which was significantly suppressed independent of the salt
content of the diet (47). All these studies are consistent with the general counter
regulation of RAAS by cGMP regulatory systems through their physiologically
antagonistic effects and also through the direct inhibition of renin transcription and
release from JG cells.
Uroguanylin is a part of this cGMP regulating system and could potentially play a synergistic role with ANP in this inhibition. Since UGN knockout mice have high blood pressure and an impaired natriuretic response and cGK-II is a downstream effector of
11 UGN signaling cascade (48), it is logical to evaluate whether UGN acts along with ANP
in the counter-regulation of RAAS. This is further strengthened by the observation that in
congestive heart failure, plasma levels of ANP increases proportional to the severity of
the disease. The effect of ANP is thought to partially counteract the fluid and electrolyte
imbalance associated with congestive heart failure. The effect of increased plasma ANP is the increase of plasma and urinary cGMP levels. However, the increase in cGMP levels
does not parallel the increase in ANP and thereby suggest that additional factors are
involved (49-51). Urinary UGN levels increase 70-fold in patients with congestive heart
failure compared to normal individuals and this increase is simultaneous with a similar
increase in urinary ANP (52). This could be considered as a synergistic adaptive
mechanism in which ANP and UGN are up-regulated to diminish the salt and water overload in these patients. Because ANP and UGN have a common cGMP dependent
signaling mechanism and have a common role in the body’s salt and water homeostasis,
it would be logical to hypothesize that UGN has a similar inhibitory effect on RAAS as
does ANP. This defines my thesis that deals with elucidating the molecular mechanism
behind the elevated blood pressure and impaired natriureis in UGN knockout mice. We
sought to test the hypothesis that the loss of inhibitory regulation of renin in UGN knockout mice is the cause of the elevated blood pressure and impaired natriuresis.
Alternatively, other mechanisms may be involved where the down-regulation of ion channels and transporter proteins in UGN knockout mice kidneys could be responsible for the phenotype.
12 As part of our genome-wise analysis of UGN knockout mice we designed microarray experiments to look for changes in the renal transcriptome that we could associate with the UGN knockout phenotype. Keeping in mind the impaired natriuresis and elevated blood pressure in the UGN knockout mice and our hypothesis that UGN negatively regulates renin gene expression and/or secretion, we were specifically looking at possible changes in expression of ion transporters and renin gene in the transcription profile of
UGN knockout mice kidneys.
13 Materials and Methods
Animals:
All animal studies were approved by the Institutional Animal Care and Use Committee of the Cincinnati Children's Hospital Medical Center. Animals were obtained from the mouse colony that is maintained by our lab. Eight to ten week old wild type and UGN knockout male mice in Balb/c background, after five generations of backbreeding) were used in all the experiments. Prior to the experiments, the animals were kept in filtered cages in a viral/pathogen free vivarium and food and water were available ad libitum.
The mice were exposed to standard 12 hour light and 12 hour dark cycles. They were sacrificed and the kidneys were harvested during the same two hour period for all the experiments to avoid diurnal variation in gene expression.
Microarray Analysis:
The animals were sacrificed and kidneys were harvested and flash frozen in liquid nitrogen after being weighed. Frozen kidney tissue was pulverized in chilled mortars and pestles and RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. Total RNA was extracted. Individual samples were sent to the Digestive Disease Research Development Center (DDRDC) Microarray core at CCHMC. The RNA was assessed for quality and converted to cDNA. The core then performed biotinylation and reverse transcription to form cRNA which was then hybridized to a murine GeneChip, Mouse Genome 430 2.0 Array (Affymetrix, Santa
Clara, CA). This was followed by washing, staining and scanning of the gene chips. The microarray data obtained from the core was analyzed with the help of DDRDC
Bioinformatics Core. The CEL files obtained from the microarray core was imported into
14 GeneSpring software Ver 7.2 (Silicon Genetics, Redwood City, California, USA). The software performed the prenormalisation (IMA). The data was then normalized to the mean of control i.e. wild type mice. Filtering was done on fold change (2.0 fold) comparing wild type with UGN knockout. At this stage 513 genes were obtained. To find out the genes that were statistically significant at this threshold (2 fold change), these 513 genes were subjected to Welch t test (p-value<0.05) variances not assumed equal. This gave us the final list of 105 genes. These genes were clustered and a gene tree was constructed using standard correlation according to whether the genes were up or down- regulated. These genes were further analyzed with the online software Onto-Express for the purpose of functional annotation.
Real-Time PCR analysis:
Baseline renal expression of renin mRNA in wildtype control (n=6) and UGN knockout mice (n=5), otherwise identical to those used to prepare RNA for microarray analysis, was assessed by Real-Time PCR. In a separate experiment, wildtype control and UGN knockout mice, were divided into two groups. One group was fed normal rodent diet
(0.5% NaCl) while the other group was given sodium deficient diet (Harlan Teklad TD-
90228, contains 0.01-0.02% background NaCl) for 2 weeks. The purpose was to find baseline renin mRNA expression in wildtype and UGN knockout mice and also to determine the increase in expression in renin mRNA in each of these groups when subjected to sodium deficient diet. Total RNA was extracted from the kidneys exactly as described earlier. Contaminating genomic DNA was removed by treating the samples with RNAse-free DNAse I (Invitrogen Life Technologies, USA). The RNA samples
15 (500ng) were subjected to reverse transcription to cDNA using Superscript II reverse transcriptase and oligo(dT) 12-18 primer (Invitrogen) to serve as template. Forward and reverse primers for the renin gene were designed and real time PCR was run using
Mx4000 Multiplex Quantitative PCR System (Stratagene, La Jolla, CA) that is operational in our laboratory. Amplification was performed in a total volume of 20µl containing 0.1pmol of each primer, 10µl of 2x Brilliant SYBR QPCR master mix
(Stratagene), 3nM of 1:500 diluted reference dye (ROX), 1µl of 1:10 diluted cDNA and nuclease free water. The amplification cycle consisted of 40 cycles at 95ºC for 30 sec
(denaturation), 55ºC for 1 min (annealing), and 72ºC for 30 sec (elongation). Brilliant
SYBR green QPCR master mix (Stratagene) fluorescence was used to detect the amplified PCR product. Results were then normalized to the GAPDH levels amplified from the same cDNA mix expressed as fold difference compared with controls.
Following primers were used: mouse renin-1 (206bp), forward primer-
TGCTTGTGGGATTCACAGCCTCTA and reverse primer-
CAAACTTGGCCAGCATGAAAGGGA.
Statistical Analysis:
Values are expressed as mean + SD and statistical significance was determined by unpaired t test between the UGN knock out and WT control mice, assuming normal distribution with a significant level of p<0.05.
16 Results
Microarray Results:
A scatter plot summary of all the genes represented on the chip is shown in Figure 1. As
in most cases, greater variance is observed at lower expression levels than at higher
expression levels. Although expression of most of the genes was unchanged between the
UGN knockout and WT, there were a considerable number of genes that were either
expressed at higher or lower levels when the two groups were compared.
1e4
1000
100
10
wt v ko wt (raw)
10 100 1000 1e4
X-axis: kidney_feb24_05 (AVE of ugn and wt) : wt v ko wt Colored by:kidney_feb24_05, AVE of ugn and wt (wt v ko ugn ) Y-axis: kidney_feb24_05 (AVE of ugn and wt) : wt v ko ugn Gene List: all genes (45101)
Figure 1. Two-dimensional scatter plot of the microarray results. Each dot represents average expression values for the same gene from control (wildtype, WT) animals (horizontal axis) and from UGN knockout animals (vertical axis) on a log10 scale. Genes with similar expression levels between the two groups lie along the diagonal (line y=x). Genes with expression different between the two groups lie above or below this line depending on whether there is up-regulation or down- regulation of that gene, respectively. The larger the difference the further the point is going to be from the y=x line. The two parallel lines on either side of the y=x line mark the limits for two-fold change. This identified 513 genes that are changed two-fold or more in the UGN knockout compared to WT.
17 WT UGN KO
1434675_at (1700065O13Rik)
1451064_a_at (Psat1; PSA; EPIP; D8Ertd814e)
1440194_at (2210011C24Rik)
1436545_at (Dtx4)
1450779_at (Fabp7)
1416827_at (Tbxas1)
1426309_at (Asb9)
1450131_a_at (Bspry)
1432538_a_at (Rfc3)
1425099_a_at (Arntl)
1424885_at (A630065K24Rik)
1460025_at (Lrig2) 1415802_at (Slc16a1) 29 genes 1439797_at (Ppard) 1416686_at (Plod2) Down-regulated 1423413_at (Ndrg1)
1423702_at (H1f0)
1455106_a_at (Ckb)
1429953_at (2210011C24Rik)
1460233_at (Guca2b)
1450977_s_at (Ndrg1)
1423447_at (Clpx)
1420760_s_at (Ndrg1)
1456174_x_at (Ndrg1)
1450976_at (Ndrg1)
1420835_at (Slc25a30)
1428758_at (1810054O13Rik)
1460405_at (2810441C07Rik)
1431167_at (Dgkg)
1442097_at
1448318_at (Adfp)
1416142_at (Rps6)
1438395_at
1416639_at (Slc2a5)
1438211_s_at (Dbp)
1448185_at (Herpud1)
1433758_at (Nisch)
1417168_a_at (Usp2)
1449206_at (Mg29)
1435230_at (AI447928)
1448233_at (Prnp)
1450387_s_at (Ak4)
1436200_at (A830039N02Rik)
1455665_at (1810013K23Rik)
1435188_at
1434824_at (Baz1b)
1417169_at (Usp2)
1424126_at (Alas1)
1428975_at (Susd3)
1421087_at (Per3)
1421829_at (Ak4)
1455454_at (na)
1416773_at (Wee1)
1425281_a_at (Dsip1)
1448975_s_at (Ren1)
1447462_at (D7Wsu130e)
1448276_at (Tm4sf7)
1417603_at (Per2)
1417466_at (Rgs5)
1455090_at (Angptl2) 1460151_at 76 genes 1418003_at (1190002H23Rik) 1457350_at (Per2) Up-regulated 1432195_s_at (Ccnl2)
1416835_s_at (Amd1)
1452252_at (3830408P06Rik)
1422740_at (Tnfrsf21)
1420772_a_at (Dsip1)
1421830_at (Ak4)
1454670_at (Rere)
1449878_a_at (Slc12a6)
1419070_at (Cys1)
1418288_at (Lpin1)
1437765_at (Cpeb3)
1418591_at (Dnaja4)
1457189_at (Itpr1)
1424022_at (1700012B18Rik)
1439093_at (Osp94)
1424735_at (Slc25a25)
1426568_at (Slc2a9)
1418025_at (Bhlhb2)
1438781_at (E130014J05Rik)
1424811_at (Cml5)
1434360_s_at (Ptprg)
1420623_x_at (Hspa8)
1432827_x_at (Ubc)
1426642_at (Fn1)
1426235_a_at (Glul)
1417516_at (Ddit3)
1417740_at (Cdc37l1)
1427977_x_at (Oog1)
1426516_a_at (Lpin1)
1436101_at (Pank2)
1458161_at (Kcnq1)
1444258_at (Actn4)
1455616_at (Aebp2)
1457306_at (Alad)
1416600_a_at (Dscr1)
1425966_x_at (Ubc)
1434496_at (Plk3)
1453929_at (Rnf24)
1427126_at (Hspa1a)
1427127_x_at (Hspa1a)
1416756_at (Dnajb1) 1439695_a_at (Mphosph1)
Figure 2. Gene Tree showing differential gene expression between wildtype and UGN knockout (KO) mouse kidney mRNA.
18 An arbitrary filter of two-fold change or more was applied to identify genes that showed different expression levels between the two groups to obtain a list of 513 genes. In addition, the genes were filtered to select only those genes that passed the Welch t test
(p<0.01) variances assumed not equal to obtain statistical significance between the three samples in the UGN knockout and WT control group. A total of 105 genes were obtained that were changed two fold or more and were statistically significant. Out of these, 76 genes were up-regulated, while 29 genes were down-regulated. A gene tree was constructed showing the differential expression of the 105 genes between the wildtype controls and UGN knockout mice kidneys (Figure 2). Functional clustering of these differentially expressed genes in the UGN knockout mice compared to the WT was done according to the Gene Ontology (GO) classification (53). For this, the online software
Onto-Express was utilized (54, 55). Tables I and II show the GO categories obtained from analysis with Onto-Express that are significantly overrepresented among the 105 genes over-expressed in the UGN knockout.
GO category Number of genes p-value
Protein binding 13 8.0E-5 ATP binding 8 8.4E-4 Transferase activity 8 0.00116 Kinase activity 6 0.00298 Molecular function 6 0.00375 unknown Transporter activity 4 1.2E-4 Calcium ion binding 3 0.01851 GTP binding 3 0.00178 Signal transducer activity 3 0 .00719 Unfolded protein binding 3 4.0E-5 Regulation of transcription, 10 4.5E-4 DNA dependent Transport 7 0.0021
19 Transcription 6 0.00974 Protein folding 4 1.0E-5 Signal transduction 4 0.01121 Protein modification 3 6.1E-4 Ion transport 3 0.00547 Cell cycle 3 0.00245 Circadian rhythm 3 1.0E-5 Nucleus 20 1.2E-4 Integral to membrane 12 0.00457 Membrane 10 6.7E4 Mitochondrion 6 5.0E-5 Cytoplasm 6 0.00168 Endoplasmic reticulum 4 2.8E-4 Plasma membrane 3 0.00634
Table I: Ontology categor ies significantly (p<0.05) overrepresented among the 76 genes up- regulated in UGN knockout mice kidney mRNA.
GO categories No. of genes p-value
DNA binding 5 0.00152 Transcription factor activity 3 0.00248 Transport 4 0.00162 Regulation of transcription, 4 0.00779 DNA dependent Transcription 3 0.001216 Nucleus 5 0.03758
Table II: On tology categories significantly (p<0.05) overrepresented among the 29 genes down-regulated in UGN knockout mice kidney mRNA.
In addition to using Onto-Express software for the analysis, the entire list of 105 genes was studied on an individual basis as regards to their function and their relevance to the salt and water balance in the body. Ion channels and transporters were specifically evaluated for changes in expression in knockout compared to WT.
20 Of note was the statistically significant (p<0.05) up-regulation of renin gene 2.63 fold in the knockout mice. The figure below demonstrates that part of the gene tree that shows the up-regulation of renin (Ren1) gene.
WT UGN KO
1448975_s_at (Ren1)
Figure 3. Microarray data showing up-regulation of renin mRNA expression in UGN knockout mice.
This was a potentially physiologically relevant finding as the UGN knockout phenotype of elevated blood pressure and impaired natriuretic response could be explained on the basis of elevated renin levels. This also formed part of our preliminary data to support our hypothesis that UGN negatively regulated the RAAS.
Real-Time PCR results:
Baseline renin mRNA expression in WT control and UGN knockout mice on normal sodium diet: The baseline renin mRNA expression in wildtype (n=6), as well as UGN knockout mice (n=5) on normal salt diet (0.5% NaCl) was found to be highly variable and more importantly, not significantly different from each other (Figure 4).
21 Renin mRNA Expression in WT and UGN KO Kidneys
1 0.9 ession 0.8 0.7 0.6 Wild Type 0.5 UGN knockout 0.4 0.3 0.2 0.1 0 Normalised Renin mRNA Expr Genotype
Figure 4. Baseline renin mRNA expression in wildtype and UGN knockout mice on normal diet.
Change in renin mRNA expression in WT mice on sodium deficient diet (n=3) compared
to normal diet (n=3) for 2 weeks: The renin mRNA expression in the group fed a sodium
deficient diet was up-regulated 2.55 fold (p<0.05) compared to normal diet (Figure 5).
Change in renin mRNA expression in UGN knockout mice on sodium deficient diet (n=3) compared to normal diet (n=3) for 2 weeks: The renin mRNA expression in the group
fed a sodium deficient diet was up-regulated 2.57 fold (p<0.05) compared to normal diet
(Figure 6).
The increase in renin mRNA expression levels when either wildtype or UGN knockout
mice were put on sodium deficient diet was similar and consistent with normal increase
in expression that have been shown in past studies. However, the expected exaggerated
response in UGN knockout mice was absent.
22 Increase in Renin mRNA Expression in WT mice on 2 Weeks Sodium Deficient Diet
4 3.5 3 2.5 Normal Diet 2 Sodium Deficient Diet 1.5 1 0.5 0 Dietary Condition Normalised Expression Renin mRNA
Figure 5. Renin mRNA expression increases in WT mice on a sodium deficient diet. Normalized renin expression was 0.97 +/- 0.38 on a normal diet and 2.47 +/- 0.32 on a sodium deficient diet, p<0.05.
Increase in Renin mRNA Expression in UGN Knockout mice on 2 Weeks Sodium Deficient Diet
4 3.5 3 2.5 Normal Diet 2 Sodium Deficient Diet 1.5 1 0.5 0 Dietary Condition Normalised Renin Expression mRNA
Figure 6. Renin mRNA expression increases in UGN knockout mice on a sodium deficient diet. Normalized renin expression was 0.92 +/- 0.09 on a normal diet and 2.35 +/- 0.43 on a sodium deficient diet, p<0.05.
Potential sources of variability in renin mRNA expression were minimized by using specific experimental design. The mice were exposed to standard 12 hour light and 12 hour dark cycle to avoid variation in renin gene expression due to circadian rhythm. They
23 were sacrificed and the kidneys were harvested during the same two hour period for all
the experiments to avoid diurnal variation in renin gene expression. In addition, the mice
were kept in separate cages during the 2 week period of experiment to avoid the
psychosocial and stress related effects on renin mRNA expression of having more than
one animal per cage. This was a very significant consideration because plasma renin
activity and plasma renin concentration was found to be more than two-fold elevated and variable in mice kept together as compared to mice kept in isolation for one week (56).
Conclusion: The microarray data analysis indicated an up-regulation of renin gene
expression in UGN knockout kidney at baseline without any dietary sodium restriction
compared to wild type controls. This finding was important as it could explain the UGN
knockout phenotype. Excess renin could be implicated in the up-regulation of RAAS and
impaired natriuresis and the phenotype of elevated blood pressure could be explained as
to be secondary to this. In addition, all the supportive literature on other cGMP regulating
peptides and the role of UGN in salt and water balance formed the basis of the hypothesis
that UGN negatively regulated the expression and/or release of renin. To verify the
microarray results, RNA from wild type and UGN knockout mice on normal diet (0.5%
NaCl) were subjected to real time PCR. There was no statistically significant difference
between the two groups. This result was contrary to the microarray data. To further work
on these results, wild type and UGN knockout mice were put on sodium deficient diet for
a period of one week. We speculated that the normal increase in renin expression with
such a diet would be exaggerated in UGN knockout mice. No significant difference in the
24 increase in renin mRNA expression in UGN knockout and wildtype control animals on sodium deficient diet was noted.
25 Discussion
Our hypothesis was that UGN negatively regulates the expression and/or secretion of renin by directly acting on the JG cells. The real time PCR data did not support our hypothesis that that UGN negatively regulates renin transcription as the microarray data had suggested earlier. Though we did not pursue the project further, there remains a possibility that post-translational events, e.g. renin secretion might be regulated by UGN.
In the future, this is an aspect that can be further explored.
If UGN inhibited renin release, we could expect that the plasma level of renin and
aldosterone would be elevated. Performing radioimmunoassays for plasma renin and
aldosterone to look for elevated RAAS activity due to increased renin release in UGN
knockout mice in vivo would enable us to address this possibility. Further, in vitro
experiments with isolated JG cell primary culture could also be designed to look for the
effect of UGN on these cells. Primary JG cells can be prepared by separating them
through isoosmotic percol solution gradients and culturing them in a defined media (57).
Assaying for renin release into the culture media before and after subjecting the cells to
UGN would elucidate any negative regulation by UGN. As in in vivo experiments, it
could be expected that addition of UGN to the culture media, would result in inhibition of
renin release.
Regulation of renin secretion is a complex phenomenon. There are three major
intracellular effectors in this mechanism, e.g. cAMP, calcium and cGMP, as shown
schematically in Figures 1 and 2. Stimulation of the sympathetic beta adrenergic system
26 and the consequent increase in cAMP levels in the JG cells is the central molecular
mechanism of renin release. This was shown in numerous in vivo and in vitro systems including single JG cells by patch clamp experiments (58-60). Other neurotransmitters and peptides that increased intracellular cAMP like dopamine, prostacyclin, glucagon,
PGE2 and adrenomodullin, were also shown to increase renin release (61-65). The inhibition of renin secretion by adenosine that decreases cAMP levels further underscored the stimulatory role of cAMP (66). Calcium ions in general support the process of exocytosis in almost all the cells of the body. Contrary to this, in JG cells, an
increase in cytosolic calcium ion concentration inhibits renin secretion (67).
Figure 1 (top) and Figure 2 (bottom). Regulation of renin synthesis and secretion. Fig.1 shows the ligands that are involved in regulating renin synthesis and/or secretion through their respective receptors that regulate the levels of various intracellular effectors. Fig. 2 depicts the mechanism by which the intracellular effectors e.g. cAMP, calcium and cGMP, regulate renin
27 synthesis and/or secretion. Red arrows indicate inhibition or decrease and blue arrows indicate stimulation or increase. PKA is protein kinase A; PDE3 is phosphodiesterase 3. From Ole Skott and Boye L. Jensen: Cellular and Renal Control of Renin Secretion (www.uninet.edu/cin2000/conferences/OleS/OleS).
The role of cGMP in this regulation is complex. It has a dual role wherein under certain
conditions it enhances renin secretion while in others, cGMP inhibits it. The stimulatory
effect of cGMP is an indirect one in which an increase in cGMP inhibits
phosphodiesterase-3 (PDE-3). PDE-3 is a phosphodiesterase that specifically degrades
cAMP. This indirectly raises cAMP levels thereby increasing renin release (68-71). On
the other hand cGMP can also inhibit the renin secretion through activation of cGK-II.
Pharmacological blockade of cGK-II stimulated renin secretion in isolated perfused kidneys. In microdissected glomeruli, the effect of cAMP on renin secretion is blunted by a cGMP analogue and this blunting is completely abolished by pretreatment with a cGK blocker (72). More in vitro studies with JG cells further showed that treatment with cGMP inhibited renin secretion. JG cell cultures from cGK type II knockout mouse kidneys did not show such an inhibition implicating this cGK isoform in cGMP mediated
inhibition of renin secretion (73).
It is not yet clear as to what determines whether the cGMP would inhibit or enhance renin
secretion. Because cGMP has greater affinity for PDE-3 than for cGK-II, it could be
postulated that cGMP increases renin secretion by inhibiting PDE-3 at low
concentrations. On the other hand, at high intracellular levels of cGMP, cGK-II would be
activated and renin secretion would be inhibited. This could be why the stimulatory role
of cAMP can be attenuated by high intracellular cGMP levels. Experiments can be
designed to test whether UGN mediates inhibition of renin secretion by an increase in
28 cGMP and subsequent activation of cGK-II. A cGMP assay performed on primary JG
cells after addition of UGN would identify whether JG cells have a transmembrane
guanylate cyclase that is activated by UGN. Increasing cGMP levels after
pharmacological inhibition of PDE-5 by zaprinast or using cGMP analogues would be
expected to enhance the inhibitory effect of UGN and reduce the threshold required to
inhibit renin secretion.
These experiments would shed light on the mechanism involved in the inhibitory role of
UGN on renin secretion and underscore the therapeutic potential of UGN in conditions
such as hypertension and congestive heart failure, where the pathogenic mechanism
involves fluid and electrolyte overload. In such conditions, not only does intestinal and renal UGN expression increase, but UGN levels in urine are also elevated. This suggests that UGN is one of the body’s compensatory mechanisms to antagonize the effects of
RAAS. Proving that UGN inhibits renin secretion by the experiments listed above would open up a whole new pharmacological mechanism that could potentially utilize UGN analogues in treating diseases associated with an overactive RAAS such as hypertension.
29 References
1. Ryder RW, Sack DA, Kapikian AZ, McLaughlin JC, Chakraborty J, Mizanur Rahman
AS, Merson MH, Wells JG. Enterotoxigenic Escherichia coli and Reovirus-like agent in
rural Bangladesh. Lancet. 1976 Mar 27;1(7961):659-63.
2. Schulz S, Green CK, Yuen PS, Garbers DL: Guanylyl cyclase is a heat-stable
enterotoxin receptor. Cell 1990, 63:941-948.
3. Laney DW Jr, Bezerra JA, Kosiba JL, Degen SJ, Cohen MB. Up-regulation of
Escherichia coli heat-stable enterotoxin receptor in regenerating rat liver.
Am J Physiol. 1994 May;266(5 Pt 1):G899-906.
4. Fan X, Wang Y, London RM, Eber SL, Krause WJ, Freeman RH, Forte LR: Signaling
pathways for guanylin and uroguanylin in the digestive, renal, central nervous,
reproductive, and lymphoid systems. Endocrinology 1997, 138:4636-4648.
5. Currie MG, Fok KF, Kato J, Moore RJ, Hamra FK, Duffin KL, Smith CE: Guanylin:
an endogenous activator of intestinal guanylate cyclase. Proc Natl Acad Sci U S A 1992,
89:947-951.
6. Hamra FK, Forte LR, Eber SL, Pidhorodeckyj NV, Krause WJ, Freeman RH, Chin
DT, Tompkins JA, Fok KF, Smith CE, et al.: Uroguanylin: structure and activity of a
second endogenous peptide that stimulates intestinal guanylate cyclase. Proc Natl Acad
Sci U S A 1993, 90:10464-10468
7. D'Este L, Kulaksiz H, Rausch U, Vaccaro R, Wenger T, Tokunaga Y, Renda TG, Cetin
Y.Expression of guanylin in "pars tuberalis-specific cells" and gonadotrophs of rat
adenohypophysis. Proc Natl Acad Sci U S A. 2000 Feb 1;97(3):1131-6.
30 8. Miyazato M, Nakazato M, Matsukura S, Kangawa K, Matsuo H. Genomic structure
And chromosomal localization of human uroguanylin. Genomics. 1997 Aug 1;43(3):359-
65.
9. Whitaker TL, Steinbrecher KA, Copeland NG, Gilbert DJ, Jenkins NA, Cohen MB:
The uroguanylin gene (Guca1b) is linked to guanylin (Guca2) on mouse chromosome 4.
Genomics 1997, 45:348-354.
10. Vaandrager AB, Bot AG, De Jonge HR. Guanosine 3',5'-cyclic monophosphate- dependent protein kinase II mediates heat-stable enterotoxin-provoked chloride secretion in rat intestine. Gastroenterology. 1997 Feb;112(2):437-43.
11. Yuge S, Inoue K, Hyodo S, Takei Y. A novel guanylin family (guanylin, uroguanylin, and renoguanylin) in eels: possible osmoregulatory hormones in intestine and kidney.
J Biol Chem. 2003 Jun 20;278(25):22726-33. Epub 2003 Apr 8.
12. Potthast R, Ehler E, Scheving LA, Sindic A, Schlatter E, Kuhn M: High salt intake increases uroguanylin expression in mouse kidney. Endocrinology 2001, 142:3087-3097.
13. Fukae H, Kinoshita H, Fujimoto S, Kita T, Nakazato M, Eto T. Changes in urinary levels and renal expression of uroguanylin on low or high salt diets in rats.
Nephron. 2002 Oct;92(2):373-8.
14. Lima, A. A. M., Monteiro, H. S. A., & Fonteles, M. C. (1992). The effects of
Escherichia coli heat-stable enterotoxin in renal sodium tubular transport. Pharmacol
Toxicol 70, 163– 167.
15. Fonteles, M. C., Monteiro, H. S. A., Soares, A. M., Santos-Neto, M. S., Greenberg, R.
N., & Lima, A. A. M. (1996). The lysine-1 analog of guanylin induces intestinal secretion and natriuresis in the isolated perfused kidney. Braz J Med Biol Res 29, 267– 271.
31 16. Greenberg, R. N., Hill, M., Crytzer, J., Krause, W. J., Eber, S. L., Hamra, F. K., et al.
(1997). Comparison of effects of uroguanylin, guanylin, Escherichia coli heat-stable
enterotoxin STa in mouse intestine and kidney: evidence that uroguanylin is an intestinal
natriuretic hormone. J Invest Med 45, 276–282.
17. Fonteles, M. C., Greenberg, R. N., Monteiro, H. S. A., Currie, M. G., & Forte, L. R.
(1998). Natriuretic and kaliuretic activities of guanylin and uroguanylin in the isolated
perfused rat kidney. Am J Physiol 275, F191– F197.
18. Carrithers, S. L., Hill, M. L., Johnson, B. J., O’Hara, S. M., Jackson, B. A., Ott, C. E.,
et al. (1999). Renal effects of uroguanylin and guanylin in vivo. Braz J Med Biol Res 32,
1337– 1344.
19. Santos-Neto, M. S., Carvalho, A. F., Forte, L. R., & Fonteles, M. C. (1999).
Relationship between the actions of atrial natriuretic peptide ANP, guanylin and
uroguanylin on the isolated kidney. Braz J Med Biol Res 32, 1015– 1019.
20. Carrithers, S. L., Ott, C. E., Hill, M. J., Johnson, B. R., Cai, W., Chang, J. J., et al.
(2004). Guanylin and uroguanylin induce natriuresis in mice lacking guanylyl cyclase-C.
Kidney Int 65, 40–53.
21. Kuhn, M., Rida, M., Adermann, K., Schulz-Knappe, P., Gerzer, R., Heim, J. -M., et
al. (1993). The circulating bioactive form of human guanylin is high molecular weight
peptide 10.3 kDa. FEBS 318, 205–209.
22. Date, Y., Nakazato, M., Yamaguchi, H., Miyazato, M., & Matsukura, S. (1996).
Tissue distribution and plasma concentration of human guanylin. Intern Med 35, 171–
175.
32 23. Fan, X., Hamra, F. K., Freeman, R. H., Eber, S. L., Krause, W. J., Lim, R. W., et al.
(1996). Uroguanylin: cloning of preprouroguanylin cDNA, mRNA expression in the
intestine and heart and isolation of uroguanylin and prouroguanylin from plasma.
Biochem Biophys Res Commun 219, 457– 462.
24. Kinoshita, H., Fujimoto, S., Fukae, H., Yokota, N., Hisanaga, S., Nakazato, M., et al.
(1999). Plasma and urine levels of uroguanylin, a new natriuretic peptide, in nephrotic
syndrome. Nephron 8, 160– 164.
25. Forte, L. R., London, R. M., Freeman, R. H., & Krause, W. J. (2000a). Guanylin
peptides: renal actions mediated by cyclic GMP. Am J Physiol 278, F180– F191.
26. Forte, L. R. (2003). A novel role for uroguanylin in the regulation of sodium balance.
J Clin Invest 112, 1138–1141.
27. Lorenz, J. N., Nieman, M., Sabo, J., Sanford, L. P., Hawkins, J. A., Elitsur, N., et al.
(2003). Uroguanylin knockout mice have increased blood pressure and impaired
natriuretic response to enteral NaCl load. J Clin Invest 112, 1244– 1254.
28. Barajas L. Anatomy of the juxtaglomerular apparatus. Am J Physiol. 1979 Nov;
237(5):F333-43. Review.
29. Taugner R, Buhrle CP, Hackenthal E, Mannek E, Nobiling R. Morphology of the
juxtaglomerular apparatus and secretory mechanisms. Contrib Nephrol. 1984; 43:76-101.
30. Braun-Menendez, E., and J.C. Fasciolo. 1939. Rev. Soc. Argent. Biol. 15:420–425.
31. Funder JW, Mantero F. The clinical pathophysiology of aldosterone. Introduction.
J Endocrinol Invest. 1995 Jul-Aug;18(7):493.
33 32. Funder JW, Krozowski Z, Myles K, Sato A, Sheppard KE, Young M.
Mineralocorticoid receptors, salt, and hypertension. Recent Prog Horm Res.
1997;52:247-60; discussion 261-2. Review.
33. Ebata S, Muto S, Okada K, Nemoto J, Amemiya M, Saito T, and Asano Y.
Aldosterone activates Na_/H_ exchange in vascular smooth muscle cells by nongenomic and genomic mechanisms. Kidney Int 56: 1400–1412, 1999.
34. Haseroth K, Gerdes D, Berger S, Feuring M, Gunther A, Herbst C, Christ M, and
Wehling M. Rapid nongenomic effects of aldosterone in mineralocorticoid-receptor- knockout mice. Biochem Biophys Res Commun 266: 257–261, 1999.
35. Johnson JP. Cellular mechanisms of action of mineralocorticoid hormones.
Pharmacol Ther 53: 1–29, 1992.
36. J. Blumenfeld. Renin system analysis: a rational method for the diagnosis and treatment of the individual patient with hypertension. American Journal of
Hypertension, Volume 11, Issue 7, Pages 894-896
37. Burt VL, Cutler JA, Higgins M, Horan MJ, Labarthe D, Whelton P, Brown C,
Roccella EJ. Trends in the prevalence, awareness, treatment, and control of hypertension
in the adult US population. Data from the health examination surveys, 1960 to 1991.
Hypertension. 1995 Jul;26(1):60-9. Erratum in: Hypertension 1996 May;27(5):1192.
38. Mosterd A, D'Agostino RB, Silbershatz H, Sytkowski PA, Kannel WB, Grobbee DE,
Levy D. Trends in the prevalence of hypertension, antihypertensive therapy, and left
ventricular hypertrophy from 1950 to 1989. N Engl J Med. 1999 Apr 22;340(16):1221-7.
34 39. US Renal Data System USRDS 1999 annual data report. Bethesda, Maryland: US
Department of Health and Human Services, National Institutes of Health, National
Institute of Diabetes and Digestive and Kidney Diseases, 1999.
40. Kannel WB. Review of recent Framingham study hypertension research. Curr
Hypertens Rep. 2000 Jun;2(3):239-40.
41. E. R. Levin, D. G. Gardner, and W. K. Samson. Natriuretic Peptides N. Engl. J. Med.,
July 30, 1998; 339(5): 321 - 328.15. Misono KS. Natriuretic peptide receptor: structure
and signaling (review). Mol Cell Biochem, 230: 49-60, 2002.
42. Stone, J.R. and Marletta, M.A. (1994) Soluble Guanylate Cyclase from bovine lung:
activation with nitric oxide and carbon monoxide and spectral characterization of the
ferrous and ferric states. Biochemistry 33:5636-5640.
43. Armin Kurtz, Roberto Della Bruna, Josef Pfeilschifter, Roland Taugner, and Christian
Bauer. Atrial Natriuretic Peptide Inhibits Renin Release from Juxtaglomerular Cells by a
cGMP-Mediated Process. PNAS 1986 83: 4769-4773.
44. Melo, L. G., A. T. Veress, C. K. Chong, S. C. Pang, T. G. Flynn, and H. Sonnenberg.
Salt-sensitive hypertension in ANP knockout mice: potential role of abnormal plasma
renin activity. Am. J. Physiol. 274 (Regulatory Integrative Comp. Physiol. 43): R255–
R261, 1998.
45. Lin KF, Chao J, Chao L. Atrial natriuretic peptide gene delivery attenuates
hypertension, cardiac hypertrophy, and renal injury in salt-sensitive rats. Hum Gene Ther.
1998 Jul 1;9(10):1429-38. Erratum in: Hum Gene Ther 2001 Nov 1;12(16):2034.
46. Stepan Gambaryan, Charlotte Wagner, Albert Smolenski, Ulrich Walter, Wolfgang
Poller, Winfried Haase, Armin Kurtz, and Suzanne M. Lohmann. Endogenous or
35 overexpressed cGMP-dependent protein kinases inhibit cAMP-dependent renin release
from rat isolated perfused kidney, microdissected glomeruli, and isolated juxtaglomerular
cells Proc. Natl. Acad. Sci. USA Vol. 95, pp. 9003–9008, July 1998
47. Charlotte Wagner, Alexander Pfeifer, Peter Ruth, Franz Hofmann, and Armin Kurtz.
Role of cGMP-Kinase II in the Control of Renin Secretion and Renin Expression.
Volume 102, Number 8, October 1998, 1576–1582 J. Clin. Invest.
48. Forte, L. R., Eber, S. L., Turner, J. T., Freeman, R. H., Fok, K. F., & Currie, M. G.
(1993). Guanylin stimulation of Cl_ secretion in human intestinal T84 cells via cyclic
GMP. J Clin Invest 91, 2423– 2428.
49. Hirata Y, Sugimoto T. Atrial natriuretic peptides. b. Atrial natriuretic peptide in
edematous disorders Nippon Rinsho. 1987 Nov;45(11):2609-15. Japanese.
50. Lerman A, Gibbons RJ, Rodeheffer RJ, Bailey KR, McKinley LJ, Heublein DM,
Burnett JC Jr. Circulating N-terminal atrial natriuretic peptide as a marker for
symptomless left-ventricular dysfunction. Lancet. 1993 May 1;341(8853):1105-9.
51. G.A. Sagnella. Clinical Science (1998) 95, (519–529) Review.Measurement and
significance of circulating natriuretic peptides in cardiovascular disease
52. Stephen L. Carrithers, Sammy L. Eber, Leonard R. Forte, and Richard N. Greenberg.
Increased urinary excretion of uroguanylin in patients with congestive heart failure
Am. J. Physiol. Heart Circ. Physiol. 278: H538–H547, 2000.
53. Harris MA, Clark J, Ireland A, Lomax J, Ashburner M, Foulger R, Eilbeck K, Lewis
S, Marshall B, Mungall C, Richter J, Rubin GM, Blake JA, Bult C, Dolan M, Drabkin H,
Eppig JT, Hill DP, Ni L, Ringwald M, Balakrishnan R, Cherry JM, Christie KR,
Costanzo MC, Dwight SS, Engel S, Fisk DG, Hirschman JE, Hong EL, Nash RS,
36 Sethuraman A, Theesfeld CL, Botstein D, Dolinski K, Feierbach B, Berardini T,
Mundodi S, Rhee SY, Apweiler R, Barrell D, Camon E, Dimmer E, Lee V, Chisholm R,
Gaudet P, Kibbe W, Kishore R, Schwarz EM, Sternberg P, Gwinn M, Hannick L,
Wortman J, Berriman M, Wood V, de la Cruz N, Tonellato P, Jaiswal P, Seigfried T,
White R; Gene Ontology Consortium The gene ontology (GO) database and informatics resource. Nucl Acid Res 2004, 32:D258-D261.
54. Draghici S: Data Analysis Tools for DNA Microarrays Boca Raton:Chapman
& Hall/CRC; 2003.
55. Draghici S, Khatri P, Martins RP, Ostermeier GC, Krawetz SA: Global functional profiling of gene expression. Genomics 2003, 81:98-104.
56. P. B. Hansen, T. Yang, Y. Huang, D. Mizel, , J. Briggs and J. Schnermann. Plasma renin in mice with one or two renin genes. Acta Physiologica Scandinavica Volume 181 Page
431 - August 2004.
57. Kurtz A, della Bruna RD. Determinants of renin secretion and renin synthesis in isolated mouse juxtaglomerular cells. Kidney Int Suppl. 1991 Jun;32:S13-5.
58. Hackenthal, E., Paul, M., Ganten, D. & Taugner, R. 1990. Morphology, physiology and molecular biology of renin secretion. Physiol Rev 70, 1067–1116.
59. Kurtz, A. & Wagner, C. 1999. Cellular control of renin secretion. J Exp Biol 202,
219–225.
60. Friis, U.G., Jensen, B.L., Aas, J.K. & Skott, O. 1999. Direct demonstration of exocytosis and endocytosis in single mouse juxtaglomerular cells. Circ Res 84, 929–936.
61. Jensen, B.L., Schmid, C. & Kurtz, A. 1996. Prostaglandins stimulate renin secretion and renin mRNA in mouse renal juxtaglomerular cells. Am J Physiol 271, F659–F669.
37 62. Kurtz, A., Della Bruna, R., Pratz, J. & Cavero, I. 1988a. Rat juxtaglomerular cells are endowed with DA-1 dopamine receptors mediating renin. J Cardiovasc Pharmacol 12,
658–663.
63. Kurtz, A., Muff, R., Born, W. et al. 1988b. Calcitonin generelated peptide is a stimulator of renin secretion. J Clin Invest 82, 538–543.
64. Vandongen, R. 1976. Suppression of renin secretion in the isolated rat kidney by cycloheximide. Eur J Pharmacol 40, 179–181.
65. Jensen, B.L., Kramer, B.K. & Kurtz, A. 1997. Adrenomedullin stimulates renin release and renin mRNA in mouse juxtaglomerular granular cells. Hypertension 29,
1148–1155.
66. Weihprecht, H., Lorenz, J.N., Schnermann, J., Skott, O. & Briggs, J.P. 1990. Effect of adenosine1-receptor blockade on renin release from rabbit isolated perfused juxtaglomerular apparatus. J Clin Invest 85, 1622–1628.
67. Friis UG, Jorgensen F, Andreasen D, Jensen BL & Skott O (2003). Molecular and functional identification of cyclic AMP-sensitive BKCa potassium channels (ZERO variant) and L-type voltage dependent calcium channels in single rat juxtaglomerular cells. Circ Res 93, 213–220.
68. Beavo, J.A. 1995. Cyclic nucleotide phosphodiesterases: functional implications of multiple isoforms. Physiol 75, 725–748.
69. Chiu, T. & Reid, I.A. 1996. Role of cyclic GMP-inhibitable phosphodiesterase and nitric oxide in the beta adrenoceptor control of renin secretion. J Pharmacol Exp Ther
278, 793–799.
38 70. Chiu, Y.J., Hu, S.H. & Reid, I.A. 1999. Inhibition of phosphodiesterases III with milrinone increases renin secretion in human subjects. J Pharmacol Exp Ther 290, 16–19.
71. Friis, U.G., Jensen, B.L., Sethi, S., Andreasen, D., Hansen, P.B. & Skott, O. 2002.
Control of renin secretion from rat juxtaglomerular cells by cAMP-specific phosphodiesterases. Circ Res 90, 996–1003.
72. Gambaryan, S., Wagner, C., Smolenski, A. et al. 1998. Endogenous or overexpressed cGMP-dependent protein kinases inhibit cAMP-dependent renin release from rat isolated perfused kidney, microdissected glomeruli, and isolated juxtaglomerular cells. Proc Natl
Acad Sci USA 95, 9003–9008.
73. Charlotte Wagner, Alexander Pfeifer, Peter Ruth, Franz Hofmann, and Armin Kurtz.
Role of cGMP-Kinase II in the Control of Renin Secretion and Renin Expression. J. Clin.
Invest. Volume 102, Number 8, October 1998, 1576–1582.
39