Equine Adenovirus: Molecular and Host Cell Receptor Characterisation

EQUINE ADENOVIRUS: MOLECULAR AND HOST CELL RECEPTOR CHARACTERISATION

Ayalew Berhanu Mekonnen

ORCID ID: 0000-0003-1686-4201

Submitted in total fulfilment of the requirements of the degree of Doctor of Philosophy

April, 2017

Faculty of Veterinary and Agricultural Sciences

The University of Melbourne ABSTRACT

Equine adenoviruses (EAdV) are members of the family Adenoviridae. While EAdV-1 causes respiratory and ocular infections, EAdV-2 has been associated with gastrointestinal infections. Little is currently known about the way these viruses interact with the host cell, and how the genetic composition of EAdV-2 compares to other adenoviruses. There is also a need for more sensitive detection methods to understand the role of EAdV-2 in foals with diarrhea. The aims of this research project were to characterise the full genome of EAdV2-385/75.4, to develop a quantitative PCR (qPCR) for detection of this virus in faecal samples, and to characterise the putative EAdV receptor molecules on the surface of equine foetal kidney (EFK) cells.

By applying next generation sequencing, the size of the EAdV-2 genome was determined to be 33,010 bp in length, with a GC content of 48%. Comparative genome analysis showed EAdV-2 to be a member of the Mastadenovirus genus but has a distinct arrangement and genetic content in the genome termini, which placed the virus in a separate cluster within the genus Mastadenovirus. A high throughput qPCR assay using primers targeting a 109 bp region of the hexon gene and capable of differentiating EAdV-2 from EAdV-1 were also designed and optimised. The assay was specific and sensitive for the detection of EAdV-2. The detection limit of the assay was 27 genome copies per reaction. The performance of the qPCR assay was assessed using archived faecal samples and was shown to exclusively amplify the targeted EAdV-2 hexon fragment.

To test the possible role of the fibre knob domain in the infectious cycle of both EAdV- 1 and EAdV-2, a recombinant baculovirus was constructed for the expression of the EAdV fibre knob proteins from both serotypes. A soluble EAdV-2 fibre knob protein was successfully expressed and was immunogenic when analyzed by Western blot. Polyclonal antibodies against purified EAdV-1 and EAdV-2 virion were also produced. Sensitive neutralisation assay has shown heterologous neutralisation of both virus serotypes, suggesting the presence of some cross neutralisation antibodies in these sera.

An immune-fluorescent infectivity assay was developed to characterise potential host cell surface receptors for infection of EAdV-1 and EAdV-2 in EFK cells. EAdV-2 infection was significantly inhibited by NaIO4, neuraminidase, wheat germ agglutinin and Sambucus nigra agglutinin treatments, suggesting a sialic acid molecule with an α(2,6) linkage is involved in the attachment and infection of EAdV-2 to the EFKs. Integrin blocking experiment results using vascular cell adhesion molecule 1(VCAM-1) also showed EAdV-2 utilised α4β1 integrins for subsequent internalisation. Similarly, heparan sulfate (HS), heparinase I and III, NaIO4 and neuraminidase significantly inhibited EAdV-1 infection, suggesting HS plays crucial role in promoting EAdV-1 infection and the possible involvement of sialic acid as a secondary receptor. Future studies using cells which express little or no sialic acid containing molecules would be helpful to unravel whether the sialic acids and integrins are used by EAdV-1 and EAdV-2, respectively, as secondary receptors. This study complements new knowledge on the full genome structure of EAdV-2 and has elucidated some of the mechanisms by which EAdVs interact with their receptor, advancing our knowledge of the EAdV-host interactions.

DECLARATION

This is to certify that:

i. The thesis comprises only my original work towards the PhD except where indicated in the preface, ii. Due acknowledgment has been made in the text to all other material used iii. The thesis is fewer than 100,000 words in length, exclusive of tables, maps, bibliographies and appendices.

Ayalew Berhanu Mekonnen

April, 2017

iii

PREFACE

The work presented in this thesis was performed at the Centre for Equine Infectious Disease, Faculty of Veterinary and Agricultural Sciences, The University of Melbourne, between November 2012 and January 2017. The author was a recipient of a Melbourne Research Scholarships and the work was carried out under the supervision of Prof. James Gilkerson, Dr Carol Hartley and A/Prof. Joanne Devlin. Scientific papers associated with thesis that have been presented are:

1. Ayalew M. Berhanu, Carol A. Hartley, Sally J. Symes, James R. Gilkerson. Development and validation of a serotype specific quantitative PCR assay for detection of equine adenovirus 2 (2015). Oral presentation. Australian Society of Microbiology Annual Scientific Meeting. July12 -15, Canberra, Australia.

ACKNOWLEDGEMENTS

First and for most, I would like to extend the deepest gratitude to my supervisor Prof James Gilkerson. Thank you for giving me the opportunity to do this research and develop my skill in molecular virology, over all support and guidance. Many thanks go to my co-supervisors, Dr. Carol Hartley, A/Prof. Joanne Devlin. It has been a privilege to work under your supervision. Especially thank you Dr. Carol Hartley for broadening my practical skills, your invaluable comments and unlimited contributions to seemingly endless troubleshooting.

To everyone at Centre for Equine Infectious Disease, Microbiology and Asia Pacific Centre for Animal Health (APCAH) research groups, I am so grateful for providing me the support, help and guidance whenever needed and your treasured scientific conversations. Sally Symes, your friendly approach and supervision was tremendous. I greatly appreciate it. Also thank you Kirsten Bailey, for providing me faecal samples, support and nice coaching at the beginning of this study. I am also greatly indebted to Prof. Mark Stevenson, for your advice and assistance on the statistical analysis. I would also like to thank Mr. Nino Ficorilli for his excellent technical assistance, advice, support, optimistic encouragement for any issues regarding cell culture. Many special thanks to Dr. Mauricio Coppo for his expert advice on protein expression and many appreciations to all my fellow colleagues, Dr. Olushola Martin, James Adamu, Dr. Zelalem Mekuria, Paola Vaz, Alistair Legoine, Mesula Korsa, thank you all for the direct and indirect input you made to this work and making a friendly working environment.

A special thank also goes to Melbourne International Research Scholarship and Melbourne International Fee Remission Scholarship for providing me financial support during my candidature.

Lastly, to my lovely wife, Haregewoin Mihretie the sacrifices you made and the pain you passed through during those difficult times to get the PhD done were unforgettable but at the same time inspirational. I am greatly indebted to you. To my son and daughter, Yonathan and Selina, I am so blessed to have you and you are truly source of too much needed laughter during this journey.

TABLE OF CONTENTS

ABSTRACT ...... i

DECLARATION ...... iii

PREFACE ...... iv

ACKNOWLEDGEMENTS ...... v

TABLE OF CONTENTS ...... vi

LIST OF FIGURES ...... xiii

LIST OF TABLES ...... xvii

ABBREVIATIONS ...... xviii

CHAPTER ONE ...... 1

LITERATURE REVIEW ...... 1

Adenoviruses ...... 1

1.1.1 Taxonomic classification ...... 1

1.1.2 Adenovirus biology ...... 3

1.1.3 Adenovirus virion architecture and physicochemical composition ...... 6

Cell receptors for adenovirus attachment ...... 10

1.2.1 Coxsackie virus and adenovirus receptor (CAR) ...... 10

1.2.2 Sialic acid...... 11

1.2.3 CD46 ...... 12

1.2.4 CD80 and CD86 ...... 12

1.2.5 Heparan sulfate glycosaminoglycans (HS-GAGs) ...... 13

1.2.6 Integrins as secondary receptors ...... 13

Adenovirus replication cycle ...... 13

1.3.1 Virus attachment and entry into the cell ...... 13

1.3.2 Activation of early viral genes ...... 15

1.3.3 DNA replication...... 15

1.3.4 Late events ...... 15

1.3.5 Virus assembly and release ...... 16

Equine adenovirus ...... 17

1.4.1 Classification and typing ...... 17

1.4.2 Genome structure of EAdV-1 ...... 18

1.4.3 Clinical manifestations ...... 19

1.4.4 Diagnosis ...... 21

Research Aims ...... 23

CHAPTER TWO ...... 29

MATERIALS AND METHODS ...... 29

2.1 Cell culture methods ...... 29

2.1.1 Mammalian cells, cultures and media ...... 29

2.1.2 Bacterial cells and culture ...... 29

2.1.3 Insect cells and culture...... 29

2.2 Classical virology techniques ...... 30

2.2.1 Viruses ...... 30

2.2.2 Virus purification ...... 30

2.2.3 Immunofluorescence infectivity assays ...... 31

2.2.4 Virus titration ...... 32

2.3 Animals ...... 32

2.3.1 Rat immunisation ...... 32

2.4 Molecular methods ...... 32

2.4.1 Viral DNA extraction ...... 32

2.4.2 Extraction of DNA from faecal samples ...... 33

2.4.3 Polymerase chain reaction ...... 34

2.4.4 Purification of PCR products and plasmids ...... 34

2.4.5 Cloning, restriction digestion, ligation and transformation ...... 34

2.4.6 DNA concentration measurement...... 35

vii

2.4.7 DNA sequencing ...... 36

2.5 Protein analysis...... 36

2.5.1 SDS-polyacrylamide gel electrophoresis (SDS-PAGE) ...... 36

2.5.2 Coomassie staining of SDS-PAGE gels ...... 36

2.5.3 Western blotting...... 37

2.5.4 Enzyme-linked immunosorbent assays (ELISA)...... 37

2.6 Full genome characterisation of equine adenovirus-2 (EAdV2-385/75.4) ...... 38

2.6.1 Viral DNA preparation ...... 38

2.6.2 Next generation sequencing library preparation ...... 38

2.6.3 De novo viral genome assembly ...... 38

2.6.4 Direct sequencing of inverted terminal repeats and selected open reading frames (ORF) ...... 39

2.6.5 Sequence analysis of the genome ...... 39

2.6.6 Amino acid sequence percent identity and whole genome nucleotide alignment analysis ...... 40

2.6.7 Phylogenetic analysis...... 40

2.6.8 Penton base, hexon and fibre genes recombination analysis ...... 40

2.6.9 Electron microscopic observation...... 41

2.7 Development and validation of the qPCR ...... 41

2.7.1 Experimental design and viruses used for assay development and validation ...... 41

2.7.2 Primer design ...... 42

2.7.3 DNA extraction ...... 42

2.7.4 SYTO9 qPCR ...... 42

2.7.5 Construction of EAdV-2 qPCR template standard for absolute quantification ...... 43

2.7.6 Standard curve, analytical sensitivity and specificity ...... 43

2.7.7 Reproducibility and repeatability ...... 44

viii

2.7.8 Evaluation of possible PCR inhibitors in clinical samples ...... 44

2.7.9 Testing faecal specimens ...... 45

2.8 Construction of recombinant equine adenovirus fibre knob protein using baculovirus expression vector systems (BEVS) ...... 45

2.8.1 Amplification of genes using PCR ...... 45

2.8.2 Construction of recombinant pfastBac-fibre knob (rpFastBac-fibre knob) transfer vectors...... 46

2.8.3 Sequence confirmation of virus transfer vectors ...... 46

2.8.4 Generation of recombinant Bacmid ...... 46

2.8.5 Isolation of bacmid DNA...... 47

2.8.6 PCR analysis of recombinant genes encoding EAdV-1 fibre knob and EAdV-2 fibre Knob ...... 48

2.8.7 Transfections of Sf-9 cells with recombinant bacmid ...... 48

2.8.8 Amplification of recombinant baculovirus stocks (P2 and P3 viral stock) . 48

2.8.9 Recombinant baculovirus plaque assay ...... 49

2.8.10 Small scale testing of recombinant his6-tagged EAdV-1 and EAdV-2 fibre knob expression ...... 49

2.8.11 Large scale recombinant his6-tagged EAdV-2 fibre knob expression in insect cell culture ...... 50

2.8.12 Purification of recombinant his6-fibre knob ...... 50

2.8.13 Dialysis ...... 51

2.8.14 Concentration of protein samples ...... 51

2.9 Characterisation of host cell receptor for equine adenoviruses ...... 51

2.9.1 Titration of rat anti-EAdV-1 or anti-EAdV-2 polyclonal sera against EAdV infected cells ...... 51

2.9.2 Determining the dose of inoculum for EAdV-1 and EAdV2-385/75.4 infection assay ...... 51

2.9.3 Effect of rat polyclonal sera on the infectivity of EAdV-1 and EAdV-2 .... 52

2.9.4 Enzymatic and chemical treatments of cells and virus ...... 52

2.9.5 Cytopathic effect inhibition assay ...... 55

2.10 Statistical analyses ...... 56

CHAPTER THREE ...... 63

FULL GENOME SEQUENCE ANALYSIS OF EAdV2-385/75.4 ...... 63

3.1 Introduction ...... 63

3.2 Results ...... 64

3.2.1 General properties and organisation of the genome ...... 64

3.2.2 Inverted terminal sequence analysis ...... 65

3.2.3 Comparative genomic analysis ...... 66

3.2.4 Protein homology analysis ...... 68

3.2.5 Phylogenetic analysis...... 68

3.2.6 Penton base, hexon and fibre gene sequence recombination analysis ...... 69

3.3 Discussion ...... 70

CHAPTER FOUR ...... 96

DETECTION OF EQUINE ADENOVIRUS FROM FAECAL SAMPLES FROM FOALS WITH DIARRHEA ...... 96

4.1 Introduction ...... 96

4.2 Results ...... 97

4.2.1 EAdV-2 primer design and optimisation ...... 97

4.2.2 Quantitative PCR performance ...... 97

4.2.3 Reproducibility and repeatability ...... 98

4.2.4 Effects of template dilution on detection of EAdV2-385/75.4 in faeces and PBS ...... 99

4.2.5 Effects of extraction and sample pre-treatment on detection of EAdV-2 in spiked faeces and PBS ...... 99

4.2.6 Faecal specimens from diarrheic foals ...... 100

4.2.7 Comparison of EAdV2-385/75.4 detection by qPCR and conventional PCR from archived faecal samples ...... 101

4.3 Discussion ...... 101

CHAPTER FIVE ...... 115

CONSTRUCTION OF EQUINE ADENOVIRUS RECOMBINANT FIBRE PROTEIN ...... 115

5.1 Introduction ...... 115

5.2 Results ...... 116

5.2.1 Design of the EAdV-2 and EAdV-1 fibre knob polypeptide ...... 116

5.2.2 Generation of recombinant fibre knob baculoviruses ...... 117

5.2.3 Construction of his6-fibre knob tagged transfer vectors; EAdV-2 rpfastbac- fk2 (EAdV-2) and rpfastbac-fk1 (EAdV-1) ...... 117

5.2.4 PCR analysis of recombinant genes encoding EAdV-2 and EAdV-1 fibre knobs ...... 117

5.2.5 Recombinant expression of EAdV-2 and EAdV-1 fibre knobs in baculovirus-infected insect cells ...... 118

5.2.6 Small scale testing of recombinant his6-tagged EAdV-1 and EAdV2- 385/75.4 fibre knob expression...... 118

5.2.7 Purification of recombinant EAdV-2 fibre knob ...... 119

5.2.8 Polyclonal antibodies against purified EAdV-2 fibre knob protein, EAVd-1 and EAdV-2 whole virions ...... 120

5.3 Discussion ...... 121

CHAPTER SIX ...... 133

CHARACTERISATION OF CELL SURFACE RECEPTORS FOR EQUINE ADENOVIRUS INFECTION ...... 133

6.1 Introduction ...... 133

6.2 Results ...... 134

6.2.1 Data analysis methods ...... 134

6.2.2 Development of virus infectivity assays ...... 135

6.2.3 Rat antisera and soluble his6-fibre knob protein inhibits the infectivity of EAdV-1 and EAdV-2 ...... 135

6.2.4 Both EAdV-1 and EAdV-2 virion attachment and infection of EFK cells require carbohydrate moieties...... 137

6.2.5 Sialic acid interacts with both EAdV-1 and EAdV-2 virions ...... 137

6.2.6 Both α(2,3) and α(2,6)-linked sialyated glycoconjugates are involved in EAdV-2 receptor attachment and infection ...... 139

6.2.7 Heparan sulfate acts as a functional receptor for EAdV-1 but not EAdV-2 ...... 140

6.2.8 Equine adenovirus 2 interacts with α4β1 integrins but not with α4β7 ...... 141

6.2.9 Both EAdV-1 and EAdV-2 infections of EFK are CAR-independent ...... 142

6.3 Discussion ...... 143

CHAPTER SEVEN ...... 170

GENERAL DISCUSSION ...... 170

REFERENCES ...... 175

APPENDICES ...... 204

xii

LIST OF FIGURES

PAGE Figure 1.1: Genome organisation map of representative members of four adenovirus genera………………………………………………………………. 24 Figure 1.2: A schematic depiction of the structure of human adenovirus based on cryo-electron microscopy and crystallography…………………………...... 25 Figure 1.3: Structure of HAdV-2 hexon and penton base. (A) Ribbon representation of the hexon subunit…………………………………………….. 27 Figure 1.4: The adenovirus fibre protein and its monomeric and trimeric structure…………………………………………………………………………. 28 Figure 2.1: Schematic overview of Bac-to-Bac system for the expressions and the production of EAdV2-385/75.4 and construction of EAdV-1 recombinant fibre knobs………………………………………………………………………. 62 Figure 3.1: Transmission electron micrograph (TEM) of sucrose gradient purified EAdV2-385/75.4 virion after negative staining……………………….. 81 Figure 3.2: Genomic organisation and putative transcription map of EAdV2- 385/75.4 genome………………………………………………………………... 82 Figure 3.3: Inverted terminal repeats (ITR) alignment of selected adenoviruses at the 5’ end of the genome……………………………………………………... 83 Figure 3.4: Pairwise genome comparative analysis between EAdV2-385/75.4 and EAdV2-385/75.9, BAdV-B, HAdV-41, PAdV-5, EAdV-1 and TsAdV…... 84 Figure 3.5: Phylogenetic analysis of the EAdV2-385/75.4 genome…………… 85 Figure 3.6: Phylogenetic analyses of EAdV2-385/75.4 using (A) DNA polymerase, (B) hexon, (C) penton and (D) fibre genes………………………... 88 Figure 3.7: Nucleotide sequence recombination analysis of concatenated hexon, penton and fibre genes of EAdV2-385/75.4……………………………. 89 Figure 3.8: Analysis of recombination events in EAdV2-385/75.4…………… 90 Figure 3.9: Recombination analysis of EAdV2-385/75.4……………………... 91 Figure 3.10: Multiple alignments of pTP homologues………………………… 92 Figure 3.11: Multiple alignments of penton base homologues………………… 93 Figure 3.12: Pairwise alignments of fibre homologues………………………... 94 Figure 3.13: Alignment of the 16 repeats in EAdV-2.385/75.4 fibre protein

xiii shaft……………………………………………………………………………... 95 Figure 4.1: Performance of the EAdV-2 qPCR assay…………………………. 109 Figure 4.2: Relative detection using (A) EAdV-2 qPCR and (B) EAdV-2 conventional PCR using DNA extracted from EAdV-2 culture supernatant….. 110 Figure 4.3: Amplification plot (A) and melting curve (B) of qPCR for a single EAdV2-385/75.4 fragment product at a melting temperature of approximately 83.5°C.………………………………………………………………………….. 111 Figure 4.4: Evaluation of the effects of template dilution on quantification of EAdV2-385/75.4 DNA ………………………………………………………… 112 Figure 4.5: Evaluation of EAdV-2 detection in faecal samples……………….. 112 Figure 4.6: Dissociation curve analysis of qPCR products from EAdV-2 spiked faecal and PBS samples (A) and agarose gel analysis of the same spiked samples using conventional PCR (B), demonstrating a specific Tm at o approximately 83 C and non-specific peak and Tm…………………………….. 113 Figure 4.7: Quantitative PCR detection of EAdV2-385/75.4 in faecal samples from diarrheic (n = 168), non-diarrheic (n=119) and hospitalized (n = 16) foals……………………………………………………………………………... 114 Figure 5.1: Predicted domain organization of EAdV-2.385/75.4 and EAdV- 1.M1 fibre protein………………………………………………………………. 124 Figure 5.2: Hydrophobicity plots of the fibre proteins of (A) EAdV-2 and (B) EAdV-1 viruses…………………………………………………………………. 125 Figure 5.3: Plasmid DNA analysis of the pFastBac™ 1 constructs of fibre knob proteins by restriction enzyme digestion…………………………………. 126 Figure 5.4: Confirmation of the presence of EAdV-2 (A) and EAdV-1 (B) fibre knob protein expression cassettes in a Bacmid using M13/pUC primers… 126 Figure 5.5: Light photomicrographs of Sf-9 cells (200 X) after inoculation with recombinant baculovirus expressing EAdV-2 fibre knob (upper panel) and EAdV-1 fibre knob (lower panel)………………………………………………. 127 Figure 5.6: Time-course expression of the recombinant fibre knob protein in Sf-9 cells analysed by SDS-PAGE (10%) and Coomassie brilliant blue staining (A) or by Western blot (B)……………………………………………………… 128

Figure 5.7: (A) SDS-PAGE and (B) Western blot analysis of EAdV-2

xiv recombinant fibre knob protein purification fractions…………………………. 129

Figure 5.8: Western blot detection of EAdV-2 his6-fibre knob by rat polyclonal sera………………………………………………………………….. 130

Figure 5.9: Detection of the EAdV-2 fibre protein with rat anti his6-fibre knob polyclonal sera……………………………………………………………. 130 Figure 5.10: Reactivity analysis of (A) EAdV-2 and (B) EAdV-1 rat hyperimmune sera to the homologous purified virus in ELISA…………………….... 131 Figure 5:11: Testing of polyclonal sera by IFA……………………………….. 132 Figure 6.1: Inhibition of (A) EAdV-1 and (B) EAdV-2 infectivity in EFK cells using rat polyclonal sera against EAdV-1, EAdV-2, pre-immune or EAdV-2 fibre knob……………………………………………………………………….. 154 Figure 6.2: The effect of fibre knob protein on infectivity of (A) EAdV-1 and (B) EAdV-2……………………………………………………………………... 155

Figure 6.3: The effect of NaIO4 pre-treatment of EFK cells on the infectivity of (A) EAdV-1 and (B) EAdV-2……………………………………………….. 156 Figure 6.4: The effect of neuraminidase treatment on infectivity of (A) EAdV- 1 and (B) EAdV-2………………………………………………………………. 157 Figure 6.5: The effect of WGA treatment on infectivity of (A) EAdV-1 and (B) EAdV-2……………………………………………………………………... 158 Figure 6.6: The effect of MAA treatment on infectivity of (A) EAdV-1 and (B) EAdV-2……………………………………………………………………... 159 Figure 6.7: The effect of SNA treatment on infectivity of (A) EAdV-1 and (B) EAdV-2………………………………………………………………………… 160 Figure 6.8: The effect of MAA or SNA treatment of EFK cells on the infection by EAdV-1 or EAdV-2………………………………………………. 161 Figure 6.9: The effect of HS treatment on infectivity of (A) EAdV-1 and (B) EAdV-2…………………………………………………………………………. 162 Figure 6.10: The effect of heparinase I treatment on infectivity of (A) EAdV-1 and (B) EAdV-2………………………………………………………………… 163 Figure 6.11: The effect of heparinase III treatment on infectivity of (A) EAdV-1 and (B) EAdV-2………………………………………………………. 164 Figure 6.12: The effect of HS treatment of EFK cells on the infection by EAdV-1 or EAdV-2…………………………………………………………….. 165

Figure 6.13: The effect of VCAM-1 on infectivity of (A) EAdV-1 and (B) EAdV-2…………………………………………………………………………. 166 Figure 6.14: The effect of MAdCAM-1 on infectivity of (A) EAdV-1 and (B) EAdV-2…………………………………………………………………………. 167 Figure 6.15: Level of CAR expression in various cell lines…………………… 168 Figure 6.16: The effect of anti-CAR antibody on infectivity of (A) EAdV-1 and (B) EAdV-2………………………………………………………………… 169

xvi

LIST OF TABLES

PAGE Table 2.1: Equine adenovirus isolates used in the study………………………. 57 Table 2.2: Vector specific primers used to confirm sequence and orientation ………………………….……………………………………………………….. 57 Table 2.3: Primers used for verifying open reading frames and 5’-3’ ends of EAdV2-385/75.4 genome.……………………………………………………… 58

Table 2.4: Representative adenoviruses used for full genome and phylogenetic analyses…………………………………………………………...... 60 Table 2.5: Primers used for the amplification and production of each recombinant proteins……………………………………………………………. 63 Table 3.1: General properties of the EAdV2-385/75.4 genome compared to other equine adenovirus isolates………………………………………………... 77 Table 3.2: Summary of predicted transcriptional and translational features of EAdV2-385/75.4 genome………………………………………………………. 78 Table 3.3. Percent amino acid identities of select EAdV-2.385/75.4 proteins with their homologues from other adenoviruses……………………………….. 80

Table 4.1: Optimisation of MgCl2 concentration and PCR primer ratio for SYTO9 qPCR assay…………………………………………………………... 107 Table 4.2: The intra- and inter-assay variation of the EAdV-2 specific qPCR assay…………………………………………………………………………….. 107 Table: 4.3: Analysis of faecal sample detected by CYTO®9 qPCR assays…… 108 Table 4.4: Comparison between qPCR and conventional PCR in the analysis of faecal samples collected between 1990 and 1995…………………………… 108 Table 6.1: Summary of biochemical treatments, ligands used in this study……………………………………………………………………………. 149 Table 6.2: Effect of different treatments on the titre of EAdV-2 and EAdV-1 in infected EFK cells determined by TCID50/ml assay………………………… 151 Table 6.3: Inhibition of EAdV-1 and EAdV-2 infectivity by different sugars and lectins………………………………………………………………………. 151 Table 6.4: Summary of different treatments on equine adenovirus infections to EFK cells……………………………………………………………………….. 152

xvii

ABBREVIATIONS

µg microgram µl microlitre µm micrometre aa amino acid ATF activating transcription factor BAdV bovine adenovirus BDT BigDye terminator BEVS baculovirus expression vector system BHK-21 Syrian hamster kidney cell line bp base pairs BSA bovine serum albumin

BSA10PBST PBST containing 10 mg/ml BSA

BSA5PBST PBST containing 5 mg/ml BSA oC degrees centigrade CAdV canine adenovirus CAR coxsackie virus and adenovirus receptor CD46 cluster of differentiation 46 CD80 cluster of differentiation 80 CELO chicken embryo lethal orphan CI confidence interval ConA concanavalin CP Clostridium perfringens CPE cytopathic effect Cq quantification cycle CSLAdV California sea lion adenovirus CTF 1 CAAT transcription factor 1 CV coefficient of variation Da Daltons DAdV duck adenovirus DBP DNA binding protein ddH2O double distilled water

xviii

DE downstream element DMEM Dulbecco’s modified Eagle’s medium DNA deoxyribonucleic acid EAdV equine adenovirus EAdV-1 equine adenovirus-1 EAdV-2 equine adenovirus-2 EDTA ethylene diamintetraacetic acid ECL enhanced chemiluminescence EFK equine foetal kidney EHV equine herpes virus ELISA enzyme-linked immunosorbent assay EM electron microscopy ERBV equine rhinitis virus B FAdV fowl adenovirus FBS foetal bovine serum FFU fluorescent focus unit FrAdV frog adenovirus g gram GAG glycosaminoglycans HA haemagglutination HAdV human adenovirus HEPES N-2-hydroxyethylpiperazine-N’-2- ethanesulfonic acid) HI haemagglutination inhibition hORF hypothetical open reading frame h.p.i hours post infection hr hour HRP horse radish peroxidase HS heparan sulfate HS-GAGs heparan sulfate glycosaminoglycan Ig immunoglobulin IFA indirect fluorescent assay IPTG isopropyl β-D-thiogalactopyranoside ITR inverted terminal repeat xix kbp kilobase pairs kDa kilodalton kPa kilopascal qPCR quantitative polymerase chain reaction kV kilovolt QVREK Qiagen viral RNA extraction kit LB Luria Bertani LOD limit of detection M molar MAA Maackia amuresnsis lectin II MAdCAM-1 mucosal adressin cell- adhesion molecule 1 Mb mega byte MEGA molecular evolutionary genetic analysis mg milligram min minute ml millilitre MLP major late promoter MLTU major late transcription unit MM maintenance media mM millimolar m.o.i multiplicity of infection mU milliunit

NaIO4 sodium periodate NANA acetylneuraminic acid NES nuclear export signal NFI nuclear factor I NFIII nuclear factor III Ni-NTA nickel nitrilotriacetic acid NLS nuclear localization signal nm nanometre NTC non template control Oct-I octamer-binding protein I OAdV ovine adenovirus ORF open reading frame xx

P1 passage 1 viral stock P2 passage 2 viral stock P3 passage 3 viral stock PAdV porcine adenovirus PBS phosphate buffered saline PBST PBS containing 0.05% (v/v) Tween-20 PCR polymerase chain reaction PFU plaque forming units pM picomolar pRb retinoblastoma susceptibility protein PSCID primary severe combined immunodeficiency disease pTP precursor terminal protein PVDF polyvinylidene difluoride RAdV raptor adenovirus RDP recombination detection program RGD arginine, glycine, aspartate RNA ribonucleic acid rpm revolutions per minute SAdV simian adenovirus SnAdV-1 snake adenovirus-1 SCR short consensus repeat SD standard deviation SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis sec second SOC super optimal broth with catabolite repression SN serum neutralisation SNA Sambucus nigra agglutinin TAdV turkey adenovirus

TCID50 median tissue culture infectious dose TPL tripartite leader xxi

TsAdV tree shrew adenovirus UV ultraviolet v/v volume per volume VCAM-1 vascular cell-adhesion molecule 1 w/v weight per volume WGA wheat germ agglutinin WSAdV-1 white Sturgen adenovirus -1 X-gal 5-bromo-4-chloro-3-indolyl-beta-D- galactopyranoside

xxii

CHAPTER ONE

LITERATURE REVIEW

Adenoviruses

Adenoviruses were first isolated in 1953 by two independent groups during the preparation of cell lines from adenoidal tissues of a child (Rowe et al., 1953) and during the investigation to identify the causative agents of acute respiratory infections in military recruits (Hilleman & Werner, 1954). They were named after human adenoid tissues (tonsils) from which they were first isolated (Enders et al., 1956). The different adenovirus serotypes have been associated with a variety of clinical presentations related with infection of the respiratory, intestinal and urinary tracts of humans and animals. Adenoviruses have been detected in coastal waters, swimming pools, and drinking water (Jiang, 2006). Adenovirus infection is usually restricted to one host species. They can however be present asymptomatically in species other than the natural host (Shenk, 2001), as indicated by the presence of neutralising antibodies. Adenoviruses have also been used as vectors for gene and cancer therapy in many clinical trials (Alvarez et al., 2000; Eulitt et al., 2010; Madhusudan et al., 2004).

1.1.1 Taxonomic classification

The family Adenoviridae is divided formally into five genera, based on phylogenetic distance, genomic distance, nucleotide composition and cross-neutralisation (Harrach et al., 2011). These include Mastadenovirus (infecting mammals), Aviadenovirus (infecting birds), Atadenovirus (infecting ruminants, reptiles and birds), Siadenovirus (infecting birds and frogs) and Ichtadenovirus (infecting fish) (Benko et al., 2002; Davison, 2003; Harrach et al., 2011). More recently, a sixth genus, Testadenovirus (infecting Turtles) has been proposed (Doszpoly et al., 2013).

Members of the Mastadenovirus genus exclusively infect mammalian species and the majority of the adenoviruses identified so far belong to this genus. Members of this genus include all known human (HAdV) and chimpanzee adenovirus (56 serotypes), bovine (BAdV) (types 1, 2, 3, 9 and 10), equine (EAdV-1 and EAdV-2), canine (CAdV-

1 and CAdV-2), porcine and murine adenoviruses (Harrach et al., 2011). Their genome size ranges from 30.536 kilobase pairs (kbp) for CAdV-1, to 36.519 kbp for simian adenovirus type 25 (Davison, 2003). The GC content of adenoviruses is also variable, ranging from 40.8 to 63.8%. Genes encoding the proteins V and IX proteins are characteristic features of members of this genus (Davison, 2003; Hemmi et al., 2011).

The majority of adenoviruses isolated from birds belong to the genus Aviadenovirus and cause disease of varying severity (Harrach & Kaján, 2011). Turkey adenovirus (TAdV) in this genus has one of the largest adenovirus genomes (45.4 kb) of all adenoviruses (Kaján et al., 2010). Aviadenovirus genomes include distinct E1, E3 and E4 regions and genes for protein V, and IX compared to the mammalian adenoviruses (Davison, 2003; Grgić et al., 2011; Marek et al., 2013). Some members of Aviadenovirus were previously thought to be the only genus that contained two distinct fibre proteins protruding from each penton base (Kaján et al., 2012; Kaján et al., 2010; Marek et al., 2012), but more recently, the lizard Atadenovirus has also been shown to have two fibre proteins (Penzes et al., 2014).

Members of the Atadenovirus were isolated from divergent hosts and they were named as a consequence of the relatively high A+T content of their respective genomes compared to other adenoviruses (Benkö & Harrach, 1998). The genome of the first fully sequenced snake adenovirus 1 (SnAdV-1), however, showed an equivalent A+T and G+C content with a characteristic atadenoviral gene arrangement (Farkas et al., 2008). Members of this genus have shown a characteristic gene organization and capsid morphology. They lack homologues of E1A genes, V and IX (Both, 2002; Both, 2004; Davison, 2003).

The genus Siadenovirus, containing a sialidase-like gene in their genome, was originally assumed to be a lineage that had co-evolved with the amphibians (Davison, 2003; Kovács & Benkő, 2011) but are now more frequently isolated from avian hosts. Members of this genus have been isolated from turkeys (TAdV-3), raptors (RAdV-1), frogs (frog adenovirus type 1), and tortoises as well as other bird species (Davison et al., 2000; Kovács & Benkő, 2011; Pitcovski et al., 1998; Rivera et al., 2009). Several features distinguish members of the Siadenovirus from members of other genera. Their genome contains an open reading frame with sequence similarity with bacterial sialidase 2 proteins (Davison et al., 2000) and have a notable low G+C percentage (Benko & Harrach, 2003; Joseph et al., 2014), suggesting a recent host jump from unknown vertebrate host.

The genus Ichtadenovirus has been recently approved and includes the only adenovirus known from a fish, a white Sturgeon (Benko et al., 2002). White sturgeon adenovirus 1 (WSAdV-1), has the longest known adenovirus genome of approximately 48 Kb (Harrach et al., 2011). Phylogenetic analyses of WSAdV-1 partial sequences have shown that it represents a separate genus (Benko et al., 2002; Kovacs et al., 2003) and because of its distinct, ancestral adenoviral lineage; WSAdV-1 1 is often used as an out- group in phylogenetic calculations.

1.1.2 Adenovirus biology

1.1.2.1 Genome organisation

Adenoviruses have linear, non-segmented, double-stranded DNA genomes, ranging from 26 - 48 kbp in length with GC content of 33 - 63% (Davison, 2003; Harrach et al., 2011; Russell, 2009). The viral genome is organised into complex transcriptional units, which can be divided into early (E1A, E1B, E2A, E2B, E3, and E4) or late (L1 to L5) regions, depending on whether their mRNA products accumulate in the early or late course of infection (Fig.1.1). The genomic termini contain short inverted terminal repeats (ITR), of varied length and have a covalently attached terminal protein at the 5'- end of each strand. The ITR serves as the origin of DNA replication and DNA replication occurs via strand displacement from both the right and left hand strands of DNA. During the early phase of the infection, viral regulatory proteins (E1 to E4) are produced, which are required to manipulate the host microenvironment for efficient replication. The late phase genes are under the control of major late promoter (MLP), and result in the production of structural proteins, encapsulation and maturation of viral particles (Russell, 2000) only after DNA replication has commenced. In addition to early and late genes, there are intermediate genes, pIX and IVa2, which are expressed approximately concurrent with DNA replication. The protein IVa2 stimulates the MLP activity (Tribouley et al., 1994) and is crucial for the packaging of viral DNA into the capsid (Ostapchuk et al., 2011). The pIX protein is encoded only by viruses from the genus Mastadenovirus and functions as a transcriptional activator and as a cement

3 protein stabilizing the viral capsid (Parks, 2005). Figure 1.1 shows the general organizational map of typical representative species from four adenovirus genera.

As HAdV-2 and -5 are the most extensively studied serotypes regarding their life cycle, genome organisation and structure, as well as vector development, the majority of the background information pertaining to adenoviruses has been derived from studies carried out on these two serotypes and details may vary or may still be unknown for other non-human adenovirus, unless otherwise stated.

1.1.2.2 Early regions of the genome

The E1 region which encodes E1A, E1B19K and E1B55K proteins, regulates replication and transcription of cellular and viral genes. These genes transform cells in culture, induce cellular DNA synthesis, and inhibit premature cell death and mitotic cell division (Hoffmann et al., 2005; Zhou et al., 2001). Mutational analysis of E1A and E1B regions of BAdV-3 have shown that while E1A and E1B55K are essential for BAdV-3 replication, E1B19K is dispensable in some cell types (Zhou et al., 2001). The E2 region which can be divided into E2A and E2B subunits, encodes for the DNA binding protein (DBP), precursor terminal protein (pTP) and DNA polymerase (Pol). All of these proteins are located on the complementary strand and play a role in DNA replication. The E3 region exists only in the Mastadenoviruses and Siadenovirus, even though no homologies have been observed between them. (Fig. 1.1). The E3 putative genes in Siadenovirus are so-named because they are located in the region corresponding to those containing E3 genes in Mastadenovirus (Davison et al., 2000; Kovács & Benkő, 2011). There were no homologous E3 genes detected in any other genera. The HAdV-5 E3 region encodes gp19, 14.7K, 14.5K, 12.5K, 10.4K, 11.6K and 6.7K (Tollefson et al., 1996). The E3 region encodes proteins that are not essential for virus replication in vitro (Horwitz, 2004) but interfere with the host immune response and inhibit apoptosis (Fessler et al., 2004; Schneider-Brachert et al., 2006). Similar to HAdV, the E3 region is not essential for BAdV-3 replication in cultured cells (Zakhartchouk et al., 1998). The E4 transcription unit is localised at the far right end of the genome in all adenoviruses. It contains six leftward oriented genes (ORF1, ORF2, ORF3, ORF4, 34K and ORF6/7), transcripts from which are regulated by a promoter

4 near the right end of the genome (Davison, 2003; Weitzman & Ornelles, 2005). The E4 region encodes proteins that have a wide variety of functions during virus infection, including gene expression and cell signalling regulation, viral DNA replication, protein stability, and shut off host protein synthesis (Russell, 2000; Täuber & Dobner, 2001; Weitzman & Ornelles, 2005).

1.1.2.3 Intermediate regions of the genome

The intermediate region of the genome is so-named because the genes are transcribed before and after the onset of viral replication. This region encodes two genes, pIX and IVa2 in HAdVs. Unlike the other structural proteins, pIX is expressed from its own promoter after the initiation of early gene expression, but before the expression of late genes (Parks, 2005) . The IVa2 gene product is involved in viral DNA packaging while pIX is a structural component of the capsid (Reddy et al., 1999a; Rosa-Calatrava et al., 2001; Zhang et al., 2001).

1.1.2.4 Late regions of the genome

In most, but not all of the adenoviruses studied, the major late transcription unit of the genome encodes proteins transcribed from the MLP and is divided into five regions L1 to L5, although BAdV-3 is divided into seven regions (L1 to L7) (Reddy et al., 1998b). The L1 region encodes the two genes 52/55K and pIIIa, which in HAdV share common poly A signals. BAdV-3 encodes four genes (52k, pIIIa, pIII (penton) and pVIII) in the L1 region (Fig. 1.1). The L2 region of HAdV encodes for the penton, pX, pV and pVII proteins in contrast to BAdV-3 which codes only the core protein pV (Reddy et al., 1998b). The penton and pV contain the RGD motif, for interaction with receptors, and nuclear localization signal in HAdV, respectively (Zubieta et al., 2005). Three proteins pVI, hexon and protease are encoded in the L3 region whereas the L4 region produces a transcript coding for 100K, 33K, 22K and pVIII (penton) proteins. The fibre is the only protein encoded by the L5 region of HAdV, which plays an important role in virus attachment to the host (Zhang & Bergelson, 2005).

1.1.3 Adenovirus virion architecture and physicochemical composition

Adenoviruses are non-enveloped viruses that are 70 - 100 nm diameter and have icosahedral capsid symmetry (Berk, 2007), with fibre proteins projecting outward from the icosahedron’s vertices (Fig. 1.2). The face of the capsid consists primarily of the hexon protein, while the penton base forms the vertices (Fig. 1.2). These penton capsomers serve as the base for the trimeric fibre protein (Russell, 2009; van Oostrum & Burnett, 1985). In most members of the adenovirus family, several minor capsid proteins, namely IIIa, VI, VIII, and IX, are also present (Russell, 2009; Vellinga et al., 2005), in addition to the three major capsid proteins, namely hexon, penton and fibre (Fig. 1.2). In Atadenoviruses, however, the capsid also contains two genus specific proteins, p32K and LH3 (Gorman et al., 2005). In HAdV, proteins account for 87% of the total mass whereas the double strand DNA molecule contributes the remaining 13% (Green & Pina, 1963). Adenovirus virions do not contain lipids lipids and hence are resistant to lipid solvents such as ether, chloroform, and sodium deoxycholate. They resist treatments with trypsin, 2% v/v phenol as well as variations in pH between 3 and 9 (Adair & Fitzgerald, 2008). Adenoviruses are also more resistant to UV irradiation than RNA viruses due to their double stranded DNA and high molecular mass. The double stranded DNA might serve as a template for repair by host enzyme (Fong & Lipp, 2005; Gerba et al., 2002).

1.1.3.1 Major capsid proteins

1.1.3.1.1 Hexon

The hexon is the largest and most abundant (240 copies per virion) of the structural proteins in the adenovirus capsid and defines the antigenic type, group, and subgroup of the viruses. Each of the 20 capsid facets of the virion has 12 copies of the hexon trimer (Condezo et al., 2015; van Oostrum & Burnett, 1985) (Fig. 1.2 and 1.3A). Each trimeric hexon has a triangular top and a pseudo-hexagonal base rich in β-structure (Athappily et al., 1994). The inter-monomeric interaction between loops connecting the β-strands that reaches out to the top of the trimer and the loops of adjoining subunits plays an important role for the stability of the hexon trimer (Rux & Burnett, 2004).

The outer region of hexon is important in receptor binding and virus internalisation, independent of primary and secondary cellular receptors (Kalyuzhniy et al., 2008; Waddington et al., 2008). The adenovirus hexon directly binds to vitamin K dependent human coagulation factor (F) X leading to liver infection. Also, the hexon protein is the only major protein on the surface of adenovirus that docks at the nuclear pore complex and can be partially imported into the nucleus to facilitate viral DNA delivery (Cassany et al., 2015; Greber et al., 1993; Saphire et al., 2000).

1.1.3.1.2 Penton base

The penton is a complex of the penton base (pentameric assembly of polypeptide III) sitting at each vertex and the externally projecting trimeric fibre protein, forming the 12 vertices of the icosahedron (Fig. 1.2). The crystallographic structure of HAdV-2 penton base shows that the monomer has a basal jellyroll domain and a distal irregular domain formed by two long insertions (Fig. 1.3B). The first insertion includes two external loops, one of which the hypervariable RGD loop contains the integrin-binding domain that is highly variable between serotypes in sequence and length (Fig. 1.3C). Despite this variability, the penton base amino acid sequences outside these external loops are highly conserved, even among human and non-human adenoviruses, suggesting that the bulk of the penton base has a common and highly conserved fold structure (Fuschiotti et al., 2006; Russell, 2009; Zubieta et al., 2005). Penton base protein has diverse functions, including interacting with the minor capsid stabilizing protein IIIa, pentamerisation to form a penton base, and ensuring stable fibre-penton base interactions (Liu et al., 2010).

1.1.3.1.3 Fibre

The adenovirus fibre is a homo-trimeric, long, thin protein projection attached non- covalently by its N-terminus to the penton base at each of the capsid vertices (Fig. 1.2 and Fig. 1.4A). The fibre protein is primarily used for attachment of the virus to specific receptors to initiate attachment and entry. Apart from viral attachment, it is directly responsible for the haemagglutinating properties of different adenovirus species, due to the variable sequences on the fibre knob (Bauer & Wigand, 1963; Pring-Akerblom et al., 1998). This difference has been utilised for diagnostic purposes to distinguish

7 among different isolates by PCR (Pehler-Harrington et al., 2004), or haemagglutination (HA) assays (Hierholzer, 1973; Rosen, 1960). Generally, the number of fibres in most adenoviruses per vertex is one; however, there are some viruses with two fibres in the Aviadenvirus, Atadenovirus genera (Hess et al., 1995; Hung-Yueh et al., 1994; Kaján et al., 2012; Kaján et al., 2010; Kidd et al., 1993; Penzes et al., 2014).

The fibre proteins of all adenoviruses share a common structure, though they vary in length and number depending on the serotype. Structurally, the fibre can be divided into three domains; an N-terminal tail domain that interacts with the pentameric penton base, a C-terminal globular head (knob) domain that functions as the attachment site, and a central shaft domain that connects the tail and the knob domains (Fig. 1.4A). The N- terminal tail domain of the fibre shows a highly conserved motif (FNPVYPY) among all adenoviruses (Tarassishin et al., 2000), which lies in a relatively hydrophobic groove formed between two adjacent monomers (Cusack, 2005; Zubieta et al., 2005), implying that this is a universal mode of binding of the fibre to the penton base. The shaft domain consists of a number of repeating-motifs with the consensus sequence XXφXφXφX-T- X#φXφXX-L (X is any amino acid, # is typically a proline or glycine, φ is a hydrophobic residue, T is a turn region and L a loop region). A conserved amino acid sequence (TLWT) marks the boundary between the shaft and the knob domain. The avian adenovirus fibres show a more complicated and less regular shaft repeat structure with single, double and triple repeats (Hess et al., 1995). The length of the shaft domain can vary due to differences in the total number of these repeat units in the shaft sequence (Chroboczek et al., 1995). For example, HAdV-2 and-5 fibre shafts have 21 repeats, in contrast to the HAd-3 fibre shaft, which has only 6 repeats. This variation may affect viral infectivity and receptor specificity, since the HAdV-5 knob fused to the short, rigid HAdV-37 shaft domain, has significantly reduced infectivity and attachment (Wu et al., 2003). Longer fibre shafts, such as those of HAdV-2 and-5, are considered to be sufficiently flexible to enhance infection by allowing interactions between the penton base and its cellular receptor (Shayakhmetov & Lieber, 2000). Although most of the structural knowledge on adenoviruses comes from studies on the human types (HAdV-2 and HAdV-5), structural studies on canine, fowl, porcine, bovine adenovirus and snake adenovirus fibre heads, have shown similar topology (El Bakkouri et al., 2008; Guardado-Calvo et al., 2007; Guardado-Calvo et al., 2010; Nguyen et al., 2015; Seiradake et al., 2006; Singh et al., 2014) (Fig. 1.4C). The main differences occur in the 8 loop regions that connect the β-strands (Fig. 1.4B). Each monomer of the adenovirus fibre head trimer has a central eight-stranded β-sandwich, connected by loops (Xia et al., 1994). The fibre head sequence varies significantly between human adenoviruses and even more between human and animal adenoviruses, even though the structures of all fibre heads are very similar (Fig. 1.4C). The long and short chicken embryo lethal orphan (CELO) adenovirus fibre heads for instance show only 15% sequence identity (El Bakkouri et al., 2008).

The structural characterisation of different fibre proteins from human and nonhuman adenoviruses has been critical for understanding adenovirus tropism and developing new vectors with modified tropisms (Guardado-Calvo et al., 2010; van Raaij et al., 1999). Animal adenoviruses are of particular interest, as they may be less immunogenic to humans and may have novel receptor-binding properties. Fibre protein is one of the two structural proteins, the other being hexon, against which HAdV-5 specific antibodies are primarily directed (Crawford-Miksza & Schnurr, 1996; Nanda et al., 2005; Sumida et al., 2005; Toogood et al., 1992).

1.1.3.2 Minor capsid proteins

In addition to these three major capsid proteins, there are several minor capsid proteins, namely IIIa, VI, VIII, and IX that complete capsid structure and primarily act as cement proteins (Fig. 1.2). Their precise contribution towards virus structure and life cycle is not completely understood (Vellinga et al., 2005). Polypeptide VIII is located below the penton base and is associated with other proteins at the vertex, mainly with the hexon and pV (San Martin et al., 2008). Protein IIIa acts like a cementing material and plays a crucial role in the virion structural stability, reflected in absence of mature viral capsid formation in case of mutations in polypetide IIIa (Liu et al., 2010; Vellinga et al., 2005). Protein VI appears to be located in the interior of the capsid, bringing the bases of two adjacent peripentonal hexons together and connects individual hexon trimers to the double stranded DNA (Stewart et al., 1993; Wodrich et al., 2003) (Fig. 1.2). Protein VI, liberated from the virion during pH dependent partial disassembly, promotes endosomal membrane disruption, resulting in the release of viral capsid into the cytoplasm (Wiethoff et al., 2005). Protein VIII is the least characterised capsid protein and appears to be present in the interior of the viral capsid (Fabry et al., 2009; Vellinga

9 et al., 2005) (Fig. 1.2). Protein VIII might have a role in stabilising the virion as mutational analysis has shown changes to the thermolability of the virion (Liu et al., 1985). In addition, polypeptide VIII binds to pIVa2 in porcine adenovirus-3 (PAdV-3) (Singh et al., 2005b), suggesting possible role in genome packaging. Protein IX is encoded only in viruses from the genus Mastadenovirus and not in any other genus of the Adenoviridae family (Fig. 1.1). This protein was originally identified as a minor component of the adenovirus capsid, and is not essential for virus assembly (Colby & Shenk, 1981; Parks, 2005). In addition to its stabilising role, it appears to be involved in multiple roles including transcriptional activation and virus-induced nuclear reorganisation to provide an environment more conducive to virus replication (Lutz et al., 1997; Rosa-Calatrava et al., 2001).

Cell receptors for adenovirus attachment

The engagement of a virus with its cellular receptor initiates a chain of dynamic events that enable entry of the virus into the cell. Since this interaction is a multistep process, multiple attachment receptors may be used sequentially, or in a cell-type-specific manner (Schneider-Schaulies, 2000). Expression of receptors may determine whether tissues are susceptible to adenovirus infection and adenovirus-mediated gene delivery.

1.2.1 Coxsackie virus and adenovirus receptor (CAR)

Coxsackie virus and adenovirus receptor is a class I trans-membrane protein with two immunoglobulin-like extracellular domains. It mediates homotypic cell adhesion and has been detected in a number of human organs and tissues including in the lung, pancreas, brain, heart, liver and kidney (Fechner et al., 1999; Tomko et al., 1997). Prior to glycosylation, CAR has a molecular weight of 46 kDa and is composed of a C- terminal cytoplasmic domain, a transmembrane helix and two extracellular immunoglobulin domains (D1 and D2) (Bai et al., 1993; Bergelson et al., 1997; Majhen et al., 2011; Philipson & Pettersson, 2004). The amino-terminal immunoglobulin domain (D1) of CAR is necessary and sufficient for adenovirus binding (Freimuth et al., 1999), while the intracellular domain is not necessary for adenovirus infection.

The Coxsackie virus and adenovirus receptor is one of the best-studied adenovirus receptors and most HAdVs bind to this receptor, except for members of Group B and a few adenoviruses of group D (Zhang & Bergelson, 2005). Coxsackie virus and adenovirus receptor also serves as a receptor for several animal adenoviruses. The crystal structure of the HAdV fibre bound to CAR's N-terminal domain (D1) reveals that CAR interacts with a discontinuous region of the trimeric fibre knob (Bewley et al., 1999), which is located on the lateral side of the trimer, involving the AB and DE-loops of one monomer and the FG-loop of the neighbouring monomer (Fig. 1.4B). From site-directed mutagenesis and structural studies, the AB-loop is the main binding determinant of the fibre protein; although the CAR-binding residues are not strictly conserved, even among divergent fibres of different CAR-binding adenovirus types (Roelvink et al., 1999).

The length of the fibre protein, as well as its flexibility, also plays a significant role in efficient CAR binding (Shayakhmetov & Lieber, 2000; Wu et al., 2003), as short and sturdy fibres cannot bend to bind CAR on a cell surface. Although the very short fibres of HAdV-9 can bind to CAR, HAdV-9 interaction with cells is not CAR dependent since the penton base may interact directly with a second receptor such as an integrin molecule (Roelvink et al., 1998).

1.2.2 Sialic acid

Sialic acids are derivatives of neuraminic acid that share a common nine-carbon monosaccharide that are ubiquitously expressed in higher vertebrates (Büll et al., 2014; Varki, 2009). Sialic acids frequently terminate glycan chains on glycoproteins and glycolipids and contribute to protein stability and trafficking as well as cell-cell and cell-extracellular matrix interactions (Stencel-Baerenwald et al., 2014).

Sialic acids have different structural variants of which the C5 carbon is frequently modified with an N-acetyl group to form N-acetyl neuraminic acid (Neu5Ac) and N- glycolyl neuraminic acid (Neu5Gc), which differs from Neu5Ac by one additional oxygen atom. N-acetyl neuraminic acid is ubiquitous in all mammals, while Neu5Gc frequently detected in many mammals but not in all species (Varki & Schauer, 2009). Additional modifications of neuraminic acid involve acetylation, methylation and

11 sulphation of its hydroxyl groups. Sialic acids are often α-linked from the C2 carbon to carbohydrate chains on glycoproteins and glycolipids via different glycosidic linkages (α2,3; α2,6 or α2,8) by different sialyltransferases (Varki & Schauer, 2009).

Several viruses of subgroup D HAdVs (AdVs 8,19 and 37) use α2,3-linked sialic acid as their attachment receptors (Burmeister et al., 2004) instead of CAR. These serotypes are involved in ocular infections. Among animal adenoviruses, BAdV-3 utilises sialic acid as a cellular receptor for its entry (Li et al., 2009). Crystallographic studies demonstrate that the fibre residues involved in the interaction with sialic acids are located at the top of the fibre knob (Burmeister et al., 2004) and the residues are conserved in the fibres of all group D viruses.

1.2.3 CD46

CD46 is a membrane-linked glycoprotein that is a ubiquitously expressed complement regulatory protein (Liszewski et al., 1991). CD46 consists of four amino-terminal short consensus repeat (SCRs), one to three Ser/Thr-rich domains, a short region of unknown function, one transmembrane domain, and a cytoplasmic tail (Sirena et al., 2004). This protein functions to prevent complement activation by binding C3b/C4b as well as serving as a receptor for virus entry through two or more SCR domains.

Mass spectrometric analyses of proteins interacting with a group B fibre have shown that human CD46 is a cellular attachment receptor for several group B adenoviruses (Gaggar et al., 2003; Sirena et al., 2004). CD46 is expressed on all human cells except for erythrocytes and hence viruses using CD46 as a receptor may potentially have a relatively broad tropism for a range of cell types and tissues.

1.2.4 CD80 and CD86

Both CD80 and CD86 are co-stimulatory molecules that are involved in stimulating T- lymphocyte activation and are expressed on mature dendritic cells and B lymphocytes. HAdV-3, and other members of group B adenoviruses with highly homologous receptor -interacting fibre knob demonstrated CD80 and CD86-specific infections in CHO cells.

Infections of CHO cells expressing CD80 and CD86 indicated that these viruses utilise CD80 and CD86 as cellular attachment receptors (Short et al., 2004; Short et al., 2006).

1.2.5 Heparan sulfate glycosaminoglycans (HS-GAGs)

Heparan sulfate glycosaminoglycans are long, heterogeneous, heavily sulfated carbohydrates, ubiquitously expressed at the surface of mammalian cells and in extracellular matrices (Hassell et al., 1986). Heparan sulfate proteoglycans are heavily glycosylated proteins containing one or more covalently attached heparan sulfate chains. The infection efficiency of HAdV-2 and 5, which primarily utilise CAR as a receptor, varies greatly in different experimental conditions. Additional receptors, like the HS-GAG analogue heparin, decreased HAdV-2 and 5-mediated infection and binding indicating HS-GAGs mediate CAR-independent attachment and infection by HAdV-2 and -5 (Dechecchi et al., 2001; Dechecchi et al., 2000).

1.2.6 Integrins as secondary receptors

Integrins are heterodimeric receptors for extracellular matrix proteins and cell surface co-receptors, composed of α and β subunits. Eighteen distinct α subunits and 8 different β subunits have been detected in mammals (Stewart & Nemerow, 2007). Integrins known to facilitate adenovirus entry include the vitronectin receptors αvβ3 and αvβ5 (Wickham et al., 1993), as well as αvβ1 (Li et al., 2001), α3β1 (Salone et al., 2003), and α5β1 (Davison et al., 1997), all of which recognize RGD motifs. Most HAdVs have been shown to interact with αVβ3 and αVβ5 integrins to enter human epithelial cells.

Adenovirus replication cycle

1.3.1 Virus attachment and entry into the cell

Most of our knowledge of the adenovirus infection cycle has been determined primarily from studies of HAdV-2 and 5. Adenovirus entry into the host cell is initiated by the attachment of the fibre knob to different primary cellular receptors. The head domain of the fibre recognizes a specific surface exposed cellular receptor (Zhang & Bergelson, 2005). For example, the HAdV-2, 5 and avian adenovirus CELO attaches to the host preferentially via CAR (Arnberg et al., 2002; Roelvink et al., 1998; Zhang &

Bergelson, 2005), while BAdV-3, PAdV-3, and HAdV- 8, 19 and 37 use the sialic acid receptor (Arnberg et al., 2002; Li et al., 2009; Zhang & Bergelson, 2005), and HAdV- 11, 14, 16, 21, 35 and 50 utilises CD46 (Segerman et al., 2003). The difference in these primary receptors on the surface of the host cell are reflected in the tissue tropism and pathogenesis of virus infection (Zhang & Bergelson, 2005).

Once the fibre protein binds to its host receptor, a secondary interaction between the viral penton base protein and cellular integrins leads to virus internalisation via clathrin dependent endocytosis (Bai et al., 1993; Bangari et al., 2005; Soudais et al., 2000; Stewart & Nemerow, 2007; Wickham et al., 1994). This interaction occurs between the RGD motif sequence of the penton protein and integrins. It is noteworthy that not all adenovirus types contain the RGD motif. HAdV-40, 41, BAdV-3, CAdV-1, 2 and FAdVs, for example, lack the conserved RGD motif (Albinsson & Kidd, 1999; Davison et al., 1993; Hess et al., 1995; Reddy et al., 1998b; Soudais et al., 2000), suggesting either alternative mechanisms are required to trigger cell entry for these viruses, or distinct integrin motifs are in use.

Following the uptake of an adenovirus particle by receptor-mediated endocytosis, the acidic environment of the endosome causes the loss of capsid proteins (hexon, penton base, IIIa and pVI) and partial disassembly (Greber et al., 1993; Wiethoff et al., 2005). Consequently, the amphipathic α-helix of pVI destabilizes the endosomal membrane, resulting in the release of viral capsid into the cytosol of the infected cell (Wiethoff et al., 2005). The capsids interact with the network of microtubules in the cytosol, and direct the partially disassembled capsid towards the nucleus. The capsid then docks at the nuclear pore complex, and finally undergoes dismantling and release of the viral genetic material into the nucleus (Bremner et al., 2009; Kelkar et al., 2006; Kelkar et al., 2004; Leopold & Pfister, 2006).

1.3.2 Activation of early viral genes

The early events of infection are characterised by the production of viral mRNAs from the early transcription units, E1A, E1B, E2, E3 and E4. These transcription units produce multiple differentially spliced and polyadenylated mRNAs encoding a variety of distinct polypeptides (Russell, 2000). The role of these early viral gene products is to regulate transcriptional and post-transcriptional viral and host RNA production, promote cell cycle progression, and counteract a variety of antiviral defence mechanisms, such as apoptosis and immune responses (Bandara & La Thangue, 1991; Evans & Hearing, 2003; Hoffmann et al., 2005; Leppard, 1997; Zhou et al., 2001). The primary role of early genes expression is to induce suitable conditions for efficient viral DNA replication and the subsequent expression of the late genes (Shenk, 2001).

1.3.3 DNA replication

Genome replication is a point that defines the separation of early and late phase gene expression. This occurs by a strand displacement mechanism from each end of the molecule in two stages, in which a new strand is synthesised from the single DNA strand (template DNA) in the first stage and the synthesis of the second strand occurs from the displaced single strand after it circularises to form partial duplex DNA (Shenk, 2001). The pTP, pol and DBP viral proteins, encoded by the E2 transcription unit, together with the core origin initiate a low level of replication (de Jong et al., 2003; Mysiak et al., 2004). In addition, cellular factors such as cellular nuclear factor I (NFI) or CAAT transcription factor (CTF1) and nuclear factor III (NFIII) or octamer-binding protein (Oct-1) are required to enhance the rate of replication (De Jong & Van der Vliet, 1999). During initiation of replication, pTP functions as a primer to which the first nucleotide becomes covalently bound. Both NFI and Oct-1 stimulate the initiation by recruiting the pTP-pol complex to the origin of replication.

1.3.4 Late events

Following the onset of viral DNA replication, the IVa2 and IX genes are expressed at high levels and subsequently the late phase of infection starts (Lutz et al., 1997). The late genes encode structural proteins that make up the viral capsid and non-structural

15 proteins that package the viral genomic DNA. These late genes are organized into a single transcription unit, major late transcription unit (MLTU), which is controlled by MLP (Thomas & Mathews, 1980). The MLTU generates a large primary transcript that is processed by differential splicing into different late mRNAs grouped into five regions (L1-L5) in human adenoviruses (Imperiale et al., 1995) based on common polyadenylation sites (Miller et al., 1980). All alternatively spliced mRNAs contain a common set of short 5’ leader segments known as the tripartite leader (TPL) sequences (Chow et al., 1980). These leader sequences enhance the translation of viral mRNAs independent of host initiation factor (Dolph et al., 1988; Huang & Flint, 1998; Logan & Shenk, 1984). The MLP also requires the so-called downstream element (DE) located downstream of the transcription initiation site for maximum activation during viral infection (Jansen-Durr et al., 1989; Leong et al., 1990). These two downstream enhancer sequences are DE1 and DE2b/a, which specifically bind to factors present in adenovirus (Ali et al., 2007).

1.3.5 Virus assembly and release

As is common in double-stranded DNA viruses, adenoviruses assemble with the aid of scaffolding proteins and subsequently mature into infectious virions. Most of the late mRNAs encode structural proteins, which are transported to the nucleus where virus assembly occurs. The capsid assembly is initiated after C-terminal peptide of pVI, which contains the nuclear localisation signal (NLS) and the nuclear export signal, (NES) is cleaved by adenovirus protease (Wodrich et al., 2003). Cleavage of the pVI NLS restricts the hexon in the cytoplasm, initiating virus assembly and stops the transport of hexon into the nucleus.

The 100k protein is required for the formation of capsomers from the hexon monomers (Hodges et al., 2001; Hong et al., 2005) and also for the transport of newly synthesized hexon monomers to the nucleus (Cepko & Sharp, 1982). The penton base interacts with the fibre trimer to form penton capsomers once they are released from their ribosomal site of synthesis. Although there is an initial rapid association in the cytoplasm to form intact capsids (24% of assembly) (Horwitz et al., 1969), the completion of the assembly takes place slowly. The mechanism through which the adenovirus is assembled and viral DNA is packaged is not yet fully understood. It has been suggested that assembly

16 involves insertion of the viral DNA into the preformed empty capsid (D’Halluin, 1995) or else assembly of the capsid occurs around the viral genome (Zhang & Imperiale, 2003). Packaging viral genome and core proteins into preassembled empty capsids is the current accepted mechanism (Ostapchuk et al., 2011; Ostapchuk & Hearing, 2005). Proteins IVa2 and IX are important for packaging of full-length genomes into the capsid (Ghosh-Choudhury et al., 1987; Zhang & Imperiale, 2003). During the maturation phase, adenovirus protease processes the precursors of several polypeptides like IIIa, VI, VII, VIII, μ and terminal protein into their mature forms (Diouri et al., 1996; Snijder et al., 2014). Adenovirus protease recognises the (I/L/M)XGG/X and (I/L/M)XGX/G) sequence motifs (X refers to any amino acid) of minor capsid proteins IIIa, VI, and VIII as well core proteins VII,µ and TP (Diouri et al., 1996; Webster et al., 1989). Without cleavage of these proteins, the viral particles will be non-infectious due to failure to uncoat (Cotten & Weber, 1995; San Martin, 2012). The mature virions remain in the infected cells and are released by cell lysis.

Equine adenovirus

Adenoviruses were first detected in horses in the late 1960s in the USA from a foal with respiratory disease (Todd, 1969) and in the early 1970s in Germany (McChesney et al., 1970). Since these first reports, the sero-prevalence of EAdV has been reported to range between approximately 10% and 20% in studies performed in Iran (Afshar, 1969), Ireland (Timoney, 1971) and Australia (Harden et al., 1974). Equine adenoviruses (EAdV) are members of the genus Mastadenovirus, and have been predominantly associated with upper respiratory tract and gastrointestinal infections in foals (Studdert and Blackney, 1982). They have also been isolated from apparently healthy animals (Bell et al., 2006).

1.4.1 Classification and typing

Two types of EAdV have been identified based on their immuno-biological properties and grouped as serotypes using serum neutralisation (SN) and haemagglutination inhibition (HI) assays. If any two viruses show either no cross reaction or greater than 16 fold difference in the titre to the homologous or heterologous genus, they are considered as distinct serotypes (Benko et al., 2005). A closer relationship with an 8 to

16 fold difference in sera, a serotype assignment is made on the basis of cross reaction in HI tests and/or the existence of major biophysical and biochemical differences (Benko et al., 2005). Extensive analysis of adenoviruses recovered from horses with respiratory disease, including primary severe combined immunodeficiency disease (PSCID) in Arabian foals (Studdert, 1978), indicated that most of them are closely related and constituted a single antigenic type, designated as EAdV-1. However, another equine adenovirus was isolated in 1982 from diarrheic foal faeces and was described to be antigenically distinct from EAdV-1 by SN (Studdert & Blackney, 1982) and did not haemagglutinate any RBCs tested including human, monkey, equine, porcine, guinea pig and chicken. Most of the EAdV-1 isolates haemagglutinate human type O and equine RBCs. Based on phylogenetic sequence analysis, the identified serotypes of EAdV are grouped into the Mastadenovirus genus (Cavanagh et al., 2012; Giles et al., 2015). However, EAdV-1 is more closely related to other members of Mastadenovirus such as canine and bat adenovirus than EAdV-2.

1.4.2 Genome structure of EAdV-1

The genome of EAdV-1 has been determined and is 32.69 kbp long (Cavanagh et al., 2012) with typical genus Mastadenovirus genome organization. The genes encoding protein V and protein IX along with the E1A, E1B, E3 and E4 regions that are characteristic of members of the genus Mastadenovirus were all identified in the viral genome sequence. Comparison of restriction maps of three different EAdV-1 isolates have shown similar cleavage pattern among different EAdV-1 isolates, despite some polymorphism that could be detected with appropriate enzymes (Higashi & Harasawa, 1989).

Similarly, the genome EAdV-2 has been fully sequenced more recently (Giles et al., 2015) and contains a double stranded DNA genome of 32, 090 base pairs flanked by a 253 bp long inverted terminal repeats (ITR). As expected, the majority of genes are conserved, as are the Mastadenovirus-specific proteins E1B 55K, E1A 19K, pIVa2 and V, but it is unique in that portions of the pIX and E1B 55k open reading frame appear to be fused. In addition, 10 hypothetical ORFs were identified which account about 9.3% of the viral genome clustering at the 3’ and 5’ regions.

Comparison of EAdV-1 and EAdV-2 based on the four viral genes such as pVI, hexon, 23K proteinase and DBP indicated that hexon genes shared the highest amount of amino acid identities (69%), followed by the 23K (66%), DBP genes (58%) and pVI genes (40%) with the lowest identities (Reubel & Studdert, 1997). Moreover, three amino acids deletions have been observed in the two loop regions of hexon gene in EAdV-2 resulting a shorter hexon gene than its counterpart in EAdV-1 (Reubel & Studdert, 1997). One of the deletions was localized in loop 1, the other two in loop 2. These regions correspond to loops exposed on the surface of the virion that contribute to differences between adenovirus serotypes. Among the three insertions in the EAdV-2, two of them also occurred in these loops.

1.4.3 Clinical manifestations

Horses and foals infected with EAdV-1 are commonly sub-clinically infected and show no clinical abnormality or a very mild respiratory disease, while EAdV-2 has been detected from the faeces of foals with mild diarrhea (Studdert, 1996). Equine adenoviruses were isolated from cases of acute respiratory disease and fatal pneumonia in Arab foals (Ardans et al., 1973; Bell et al., 2006; McChesney et al., 1970; Thompson et al., 1976) in Fell pony foals with an undefined immunodeficiency (Richards et al., 2000), from non-Arab and older horses with non-fatal respiratory disease (England et al., 1973; Horner & Hunter, 1982) and also from apparently healthy horses (Bell et al., 2006; Wilks & Studdert, 1972). Adenovirus was also isolated from a pneumonic bronchus and from lung tissue of a three month old thoroughbred colt with fatal mucopurulent pneumonia, although secondary bacterial infection with a Corynbacterium sp. was thought to be the cause of the death (Konishi et al., 1977).

EAdV-1 is a dominant pathogen of the uniformly fatal, inherited disorder PSCID. This PSCID disorder is characterised by a total absence of T and B lymphocytes and is inherited as an autosomal recessive gene affecting certain Arabian foals (Perryman, 2000). In these foals, the EAdV-1 infection is characterised by inexorably progressive bronchopneumonia with involvement of other organs and tissues. It can result in death due to generalized infections in which adenovirus play a predominant role (Ardans et al., 1973; Jolly et al., 1986).

Clinical signs of EAdV-1 infection in horses include nasal discharge, conjunctivitis, and bronchopneumonia and infection of the gastrointestinal tract, leading to the production of soft faeces, coughing after exercise and enlarged submandibular lymph nodes (Dutta, 1975; Powell et al., 1974; Studdert, 1996). More severe clinical signs have been observed in adenoviral infection at the time of immunosuppression due to stress, cold season and other concomitant infections. While adenovirus infection is a common cause of epidemic kerato-conjuctivitis in human, attempts to isolate EAdV-1 and -2 from the conjunctival sacs of horses suffering from ocular disease (McMullen & Richard, 2005) have shown no evidence of EAdV involvement in the pathogenesis of keratitis in the horse, despite isolation of adenoviruses from the conjunctival sacs of foals suffering respiratory infection (McChesney et al., 1973; Roberts et al., 1974). EAdV-2 was isolated from two foals with severe diarrhea which were also positive for rotavirus particles (Studdert et al., 1978).

Respiratory disease signs have been described for EAdV-1 in experimentally infected foals of different breeds (Arabian and non-Arabian), ages (neonatal or 2-4 months of age), and colostrum status (deprived or not) (Gleeson et al., 1978; McChesney et al., 1974). The clinical signs appeared 5 - 7 days post infection and varied from non- apparent infection to severe respiratory signs. The clinical signs observed included mucopurulent nasal discharge, severe follicular conjunctivitis, transient anorexia and pyrexia, polypnea, and cough (McChesney et al., 1974). Colostrum-deprived foals tended to have more apparent clinical signs and more extensive post-mortem lesions than colostrum fed foals. The 2 - 4-month-old foals at the time of viral inoculation had few or no clinical signs and were free from gross lesions at necropsy. Gross pathological and histological changes in the colostrum-deprived SPF foal consisted of pulmonary atelectasis, interstitial pneumonia, swelling, hyperplasia, necrosis, and intra- nuclear inclusions of epithelial cells. Duodenal villous atrophy and idiopathic glomerular hyperplasia were also observed. Abortion in mares was shown experimentally after intrauterine inoculation of the EAdV-1 (McChesney & England, 1978).

In the above studies, authors did not record any EAdV-1 viremia, however EAdV-1 was isolated from nasal conjunctival and rectal swabs and from tissue homogenates

20 such as lung, trachea, lymph nodes and intestine) six days after infection (Gleeson et al., 1978; McChesney et al., 1974). In the immunocompetent foals, no virus was recovered by day 10 after infection, possibly due to production of virus neutralising antibodies and all immunocompetent foals recovered from the disease (McChesney et al., 1974). Reinfection by EAdV-1 is a common phenomenon in mares and foals, and many of these infections occurred in the presence of high serum neutralising antibody levels. (Harden et al., 1974). This could be due to rapidly declining levels of immunoglobulin A (IgA) in nasal secretions which is responsible for resistance to reinfection. In a studies of horses with respiratory disease (Powell et al., 1974) 19 horses seroconverted to EAdV-1, 13 of the horses were 2 years old.

Even though the role of EAdV-2 in enteric disease has not been defined experimentally, adenoviral enteritis was described in a foal with a history of diarrhea and progressive weight loss. A 9-month old Arabian foal was presented for necropsy and parameters including total and differential leukocyte count, packed cell volume and serum protein concentrations were in the normal limits prior to death. Though faecal samples were negative for parasitic eggs, Pseudomonas species was isolated from faecal culture. Pathological lesions included ulcers in the mucosa of the distal oesophagus, perforating ulcers in the non-glandular region of the stomach, and grey fluid in the peritoneal cavity. Histological changes included necrosis and ulceration of the oesophageal and gastric mucosal squamous epithelium, adenoviral intra-nuclear inclusions in the enterocytes and crypt cells of duodenum, jejunum and villous atrophy throughout the small intestine (Corrier et al., 1982). Though no tissues cultured for bacterial and viral organisms, inclusions containing protein matrix mixed with viral nucleocapsids of approximately 80 nm in diameter were confined to small intestine and none were observed in other tissues examined.

1.4.4 Diagnosis

Diagnosis of adenovirus infections can be achieved by virus isolation in cell culture, antigen detection, adenovirus DNA detection by PCR, as well as serology. A range of assays including immune precipitation, complement fixation, haemagglutination, HI, and SN assays have been extensively used in diagnosis and sero-epidemiologic studies of EAdV (Dunowska et al., 2002; Giles et al., 2010; Harden et al., 1974; Horner &

Hunter, 1982). Nasopharyngeal and conjunctival swabs (for EAdV-1) and rectal swabs and faecal samples (for EAdV-2) taken during the acute phase of the diseases are used for virus isolation.

EAdV-1 and -2 are highly host cell specific and grow readily in cells of equine origin in which both viruses produce a cytopathic effect (Bell et al., 2006). Isolation of adenovirus from faecal materials may require extended incubation times and several blind passages before the cytopathic effects appear in the cell culture (Ishibashi & Yasue, 1984). The isolated virus can subsequently be characterised as an adenovirus by histologic (characterised by intra-nuclear inclusions), immunofluorescence or immuno- diffusion or the demonstration of viral particles in the infected cells or cell lysates by electron microscopy (Ishibashi & Yasue, 1984). The isolates can also be identified as adenovirus by complement fixation test or immuno-diffusion tests, using infected cell supernatants against a reference serum possessing adenovirus group antibody. The new isolate can then be assigned to a particular serotype by viral neutralisation tests using type specific immune sera. Isolation of adenovirus from diarrheic faeces is not sufficient evidence to incriminate the virus as a cause of diarrhea, since these viruses can also be isolated from normal faeces (Benfield, 1990). Electron microscopic examination of faeces or intestinal contents provides a method for visually identifying the unknown causative agents of viral diarrhea in faeces, though it is expensive and requires skilled personnel. Specific antisera can also be used in immune electron microscopy to increase the sensitivity of the technique and confirm the identity of the virus morphology. Detection of adenovirus in negatively stained preparations from faecal samples by electron microscopy (EM) is readily achieved (Benfield, 1990).

Serotype identification is classically performed by SN and/or HI with type-specific hyperimmune antisera. Most adenoviruses haemagglutinates appropriately chosen RBCs, and HI assays are used for antibody detection. EAdV-1 possesses the common group-specific Mastadenovirus genus antigen which haemagglutinates equine and human blood group O erythrocytes, but not those of sheep or chicken (Wilks & Studdert, 1973) while EAdV-2 does not haemagglutinate equine, human O, or rhesus macaque, RBCs and hence, HI assays for EAdV-2 have not been developed (Studdert & Blackney, 1982).

Earlier diagnostic approaches to adenovirus detection relied mainly on conventional cell culture and serological tests and so cannot be used as routine and robust detection tools as they are laborious and expensive. While cell culture systems are the standard to examine the infectivity of the isolated viruses, the introduction of PCR-based assays has opened new ways to rapid, specific, and sensitive adenovirus detection. For equine adenoviruses, a single conventional assay, using type-specific primers have been described and used for detection purposes (Dynon et al., 2001). Development and validation of a quantitative PCR (qPCR) test would expand capabilities toward higher sensitivity and accurate quantification of viral loads in a reproducible and high throughput manner.

Research Aims

The overall purpose of this work is to improve our understanding of the role of EAdV-2 in diarrheic foals in order to develop effective diagnostic methods, and gain knowledge of adenovirus-host interactions and its molecular biology. The specific aims of this study were to: 1) Develop and validate a sensitive qPCR for detection of EAdV-2 in clinical samples and to attempt to detect EAdV-2 from archived equine faecal samples, 2) Sequence and analyse the genome of EAdV-2 and study the relationship with other adenovirus genomes, 3) Characterise the host cell receptor for equine adenovirus infection in EFK cells and investigate the role of EAdV-2 fibre knob for host-cell attachment.

Studies on the first aim would provide a rapid and more sensitive qPCR method that could be applied for early diagnosis and rational treatment of EAdV-2. Studies on full genome sequence of EAdV-2 would help to identify the locations of putative virus genes and binding domains needed for further work and to provide an update of the genetic content, phylogeny and evolution of the virus. Elucidation of the precise mechanism(s) of adenovirus interaction with host cells would enable a better understanding of adenovirus tropism and pathogenesis. In addition, it would help to identify EAdV-1 and -2 putative host receptor(s).

Figure 1.1: Genome organisation map of representative members of four adenovirus genera. Black arrows show conserved genes; grey arrow indicates genes that are present in more than one genus; coloured arrows show genus-specific genes. Taken from (Harrach et al., 2011).

Figure 1.2: A schematic depiction of the structure of human adenovirus based on cryo- electron microscopy and crystallography. Taken from Russel (2009).

(A)

(B)

(C)

Figure 1.3: Structure of HAdV-2 hexon and penton base. (A) Ribbon representation of the hexon subunit. The view is perpendicular to the molecular 3-fold axis and from inside the trimeric molecule. The top of the molecule, which contains the loops (DE1, FG1, and FG2), forms the outer surface of the viral capsid. The hexon base contains a small loop (DE2) and two eight-stranded “viral” jelly-rolls (V1 and V2), which are separated by the connector, VC. The N-terminal loop, NT, lies underneath the base. Taken from (Rux et al., 2003). (B) Left, tricolor ribbon representation of the monomer with the jellyroll domain (green) and the insertion domain (blue, residues 129–434; red, residues 466–519). The termini are labeled N and C. The variable loop and the RGD loop are labelled with disordered residues 298–373 of the RGD loop depicted by a dotted line. (C) The pentamer, the functional unit of the penton base protein, shown as a surface representation (left) and ribbon diagram (right), with each monomer colored uniquely. The variable loop, RGD loop and N- and C termini are marked. Taken from (Zubieta et al., 2005).

Figure 1.4: The adenovirus fibre protein and its monomeric and trimeric structure. (A) Fibre trimers (green) protrude from each penton complex (yellow) of the icosahedral capsid of adenovirus. The fibre trimer comprises N-terminal tails (thin tubes), a central shaft, and globular knob (ovals). The third β-repeat of the shaft is indicated by the red arrow. Taken from (Nicklin et al., 2005); (B) Stereo ribbon diagram of the knob monomer, showing the eight-stranded antiparallel β–sandwich fold. β–strands are represented as ribbons in green, and coils and loops are shown in yellow. The β–strands G, H, I and D comprise the R-sheet, and β–strands J, C, B, A, E and F the V-sheet; (C) Stereo ribbon diagram of the knob trimer, showing the putative receptor binding surface viewed down the three-fold molecular symmetry axis. The individual monomers are coloured red, purple and green. The overall shape of the trimer resembles a three-bladed propeller, with a central surface depression and three valleys formed by the symmetry- related R-sheets and HI loops. The amino termini of the three monomers converge at the three-fold molecular axis. In the intact fibre protein, this marks the end of the shaft region. Taken from (Xia et al., 1994).

CHAPTER TWO

MATERIALS AND METHODS

2.1 Cell culture methods 2.1.1 Mammalian cells, cultures and media

Primary equine foetal kidney (EFK) cells were used at passage 9 - 10 for the cultivation and assay of EAdV-1 and -2. Equine foetal kidney cells were prepared from equine foetuses at the Faculty of Veterinary and Agricultural Sciences by Nino Ficorilli using established techniques. Equine foetal kidney cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich) containing penicillin (1000 IU/ml), streptomycin (1000 µg/ml), amphotericin B (5 µg/ml), 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) pH 7.2 and 10% v/v foetal bovine serum (FBS). Infected cells were maintained at 37°C in maintenance media, which contains the same formulation as described above except the FBS concentration was reduced to 1% (v/v).

2.1.2 Bacterial cells and culture

Escherichia coli JM109 (Promega) and DH5α (Thermofisher Scientific) bacterial strains were used during the course of this work for most applications in cloning, protein expression ® ® ® and plasmid propagation. MAX EFFICIENCY DH10 BACTM (GIBCO ) competent E.coli cells were used for the transposition into the bacmid. Cells were grown in Luria Bertani (LB) broth containing 1% w/v tryptone, 0.5% w/v yeast extract, and 0.5% w/v NaCl. When grown on solid media in petri dishes, cells were grown on LB broth containing 1% w/v agarose.

2.1.3 Insect cells and culture

Spodoptera frugiperda (clone Sf-9) (GIBCO®) cells were used for the expression studies. Sf- 9 cells were maintained in SF900 II SFM (serum free medium) (GIBCO®) supplemented with gentamicin (10 µg/ml) and amphotericin B (0.25 µg/ml) in a suspension culture at 85 rpm and were incubated at 27 to 28°C. The cultured cells were sub-cultured once a density of approximately 2 – 4 x 106 cells/ml has been reached at a starting concentration of 3 – 5 x 105 cells/ml. Cells were used between passage numbers 17 and 21 in this study.

2.2 Classical virology techniques 2.2.1 Viruses

Equine adenovirus isolates used this study are listed in Table 2.1. The EAdV serotypes EAdV-1 (isolate EAdV-1.M1) and EAdV-2 (isolate EAdV2-385/75.4) were used as prototypes of EAdV serotype 1 and 2, respectively, and both virus stocks were propagated in EFK cells.

2.2.2 Virus purification

Purification of the virus was performed as described elsewhere (Croyl et al, 1998) with some 8.2 6.6 modifications. One ml of virus stock (10 TCID50/ml EAdV2-385/75.4 and 10 TCID50/ml EAdV-1.M1) was used to inoculate a 75 cm2 flask of sub-confluent EFK cells. After cells were incubated for 2 hr at 37°C for adsorption with constant rocking, an additional 20 ml of maintenance media was added to the flask and incubated at 37°C. When complete cytopathic effect (CPE) was observed after 24 hrs, cell debris was removed by centrifugation at 1600 x g for 10 min at 4°C. The infected cell supernatant was harvested and used to infect one 1750 cm2 roller bottles of EFK cells. When complete CPE was observed (typically 24 hrs), the roller bottle was swirled to detach debris and the infected cell supernatant was harvested and centrifuged at 3000 x g for 10 mins at 4°C. The pellet was resuspended in 8 ml of 10 mM Tris-HCl buffer (pH 8.1) and stored at -80°C. The supernatant from this centrifugation step was also stored at -80°C. The virus was released from the pelleted cells by three cycles of freezing at -80°C and thawing at 37°C.

The frozen and thawed pellet fractions were overlaid on a continuous 20 - 80% (w/v) sucrose gradient and ultracentrifuged at 100,000 x g for three hrs at 4°C (SW41 rotor, Beckman L-90) without a brake. Distinct bands were then collected by side puncture using 18 G needles and the presence of the virus in the fractions was identified by SDS-PAGE on 12.5% (w/v) acrylamide under reducing conditions and Coomassie Brilliant Blue R-250 staining. Fractions in which virus was detected were pooled and ultracentrifuged (100,000 x g for 3 hrs, 4°C) to pellet virus. The final pellet was resuspended in in 0.5 to 1 ml Tris-HCl (10 mM, pH 8.1) or PBS and stored at -80oC until use.

2.2.3 Immunofluorescence infectivity assays

Confluent EFK cell culture monolayers in 8-well chambered slides (LabTeks®II, Thermofisher Scientific) were infected at a multiplicity of infection (m.o.i) of 0.2 and 0.3 with EAdV-1 or EAdV-2, respectively in maintenance media for 1 hr at 37°C in a humidified atmosphere of 5% v/v CO2 in air. After 1 hr incubation, the inoculum was removed, and the cell monolayers were washed 2 times with maintenance media before being incubated at

37°C in a humidified atmosphere of 5% v/v CO2 in air. After 24 hrs (EAdV-1.M1 infection) and 48 hrs (EAdV2-385/75.4 infection), the maintenance media was removed, and cells were

fixed in ice-cold 90% v/v methanol with 0.06% v/v H2O2 for 10 mins, before removing the methanol and drying the slides at room temperature. The wells were blocked with 200 µl of

PBS containing 10 mg/ml bovine serum albumin (BSA10PBS) for 1 hr at room temperature. The wells were washed three times prior to the addition of 200 µl/well primary antibody, either rat antiserum to EAdV-1 or EAdV-2 or pre-immune rat serum (diluted 1/200) in PBS containing 5 mg/ml BSA (BSA5PBS) for 1 hr. Cells were then washed 3 times with PBS and probed with 200 µl of Alexa Fluor® 488-conjugated goat antibodies to rat immunoglobulin G

(Cell Signaling Technology) diluted 1/200 in BSA5PBS for 1 hr. Equine foetal kidney cells were washed three times in PBS. The slides were then mounted by using fluorescent mounting medium (Dako) covered with coverslips and examined immediately by fluorescence microscopy (Olympus BX60). The total numbers of fluorescent cells were counted over four non-overlapping fields at 200X magnification.

For infectivity inhibition assays, EFK cells were treated or pre-incubated with the recombinant fibre knob, enzymes, biochemicals or ligands (Section 2.9) prior to the addition of virus, washing and immuno-staining as described above. In each assay, at least two virus control wells (containing virus and untreated cells only), and two cell control wells (containing uninfected and untreated cells only) were included. Results are expressed as the ratio of the sum of fluorescent foci counts from the two replicates of the treated wells to the sum of the cell counts from the two-mock treated virus control wells. Error bar plots for each assay show the point estimate of the ratio and its 95% confidence interval (CI) (Chapter 6).

2.2.4 Virus titration

Virus titration assays were performed in sterile 96-well flat-bottomed polyvinyl chloride plates (Nunc). Ten-fold serial dilutions (10-1 - 10-8) of the virus cell culture supernatants were made in maintenance media (Section 2.1.1). Fifty µl of maintenance media was added to each well of the 96 well plate, and then 50 µl diluted virus was added to the well with four replicates per dilution starting at the highest dilution (10-8) of the test virus. The first and last rows were used as negative controls and with 50 µl maintenance media added instead of virus. Fifty µl of EFK cell suspension (approximately 3 x 105 cells) was added to all wells. o Plates were incubated at 37 C with 5% CO2 for the 72 hours in humidified incubator and examined for CPE. Viral titres were calculated as 50% tissue culture infectious dose (TCID50) using the method described by Reed and Muench (Reed & Muench, 1938).

2.3 Animals

2.3.1 Rat immunisation

Rat hyper immune sera against purified EAdV2-385/75.4 fibre knob, EAdV2-385/75.4 and EAdV-1.M1 purified viruses were prepared by subcutaneous immunisation of 7-week-old male and female rats (Sprague Dawley, University of Melbourne Animal Facility) with 15 – 20 µg purified antigen in 100 µl PBS. A total of 0.25 ml of an emulsion of proteins or viruses in Freund's complete adjuvant (Sigma-Aldrich) was used per rat, in multiple injection sites. Two rats were immunised with each antigen. Three weeks after the first inoculation, the rats received a further injection with a third inoculation after another 4 weeks interval. Each of the second or third inoculation was 10 µg proteins or purified virus in 100 µl PBS together with 100 µl Freud’s incomplete adjuvant (Sigma-Aldrich). Blood samples were collected from the tail vein 2 weeks after the final booster. The animal experimental protocol was approved by The University of Melbourne animal ethics committee (ID: 1413074.1).

2.4 Molecular methods 2.4.1 Viral DNA extraction

Nucleic acids from cell culture supernatants and faeces (Section 2.7.8) were extracted using the QIAmp Viral RNA Extraction Kit (QVREK) (Qiagen) according to manufacturer’s

instructions. Viral DNA for full genome sequencing was extracted from purified virus following proteinase K treatment using High Pure PCR Template Preparation Kit (Roche) following manufacturer’s instructions.

2.4.2 Extraction of DNA from faecal samples

Viral DNA from faecal samples was extracted using either the PowerSoil-htp™ 96 Well Soil DNA Isolation Kit (MO BIO Laboratories, inc) (Section 2.4.2.1) or phenol chloroform extraction (Section 2.4.2.2).

PowerSoil-htp™ 96 Well DNA extraction

The PowerSoil-htp™ 96 Well Soil DNA Isolation Kit (MO BIO Laboratories, inc) was used to extract DNA from foal faecal samples from a case-control matched study of foal diarrhea samples collected in 2010. The method followed manufacturer’s instructions with some amendments including (a) DNA was extracted from samples of 225 µl faeces in RNA Later (Sigma) (16.6% w/v) which were thawed and vigorously vortexed prior to addition to the lysis plate; (b) Samples containing the lysis buffers and beads were shaken on an orbital shaker at maximum speed for 20 min instead of using the 96 well plate shaker. After lysis of samples and removal of debris, the remaining extraction procedure was adapted for use by vacuum extraction in a Qiaextractor robot (Qiagen). This procedure followed the instructions for PowerSoil kit, except that vacuum at 20 – 30 kPa replaced centrifugation, with automation of the necessary pipetting steps. The sample was finally eluted with 100 µl of elution solution (C6). An extraction negative control (water) which was subjected to all steps of DNA extraction was included in every extraction (8 to 12 negative controls per 96 well plate).

Phenol chloroform extraction of DNA

DNA was also extracted from samples used in comparisons of qPCR and conventional PCR using phenol-chloroform (Allard et al., 1990). Briefly, 50 µl of faecal samples were incubated at 55°C for 1 hr with 60 µg/ml of proteinase K in Tris-HCl (pH 7.5). The solution was then extracted with 2 volumes of phenol-chloroform-isoamyl alcohol (25:24:1) to 1

volume of sample, and the DNA was precipitated with ethanol. Precipitated DNA was

resuspended in sterile double distilled water (ddH2O) prior to use as template in PCR.

2.4.3 Polymerase chain reaction

Quantitative and conventional PCR were performed under different condition with different primers (Tables 2.2 and 2.3). For a 25 µl standard reaction, the reactions mixture contains 2 - 5 µl template, 0.2 µM of each desired forward and reverse primers (GeneWorks), 200 µM of each dNTPs (dATP, dTTP, dCTP and dGTP) in GoTaq reaction buffer with 1U GoTaq® Flexi DNA Polymerase (Promega). All PCR reaction were carried out in a thin walled 0.2 ml reaction tube (AXYGEN) (conventional PCR) and clear reaction tube (4titudE®) (qPCR). The reaction was typically carried out by 1 cycle of denaturation at 94°C for 4 min, followed by 35 - 40 cycles of denaturation at 94°C for 30 secs, annealing at different temperatures for 30 - 60 sec, and extension at 72°C (1 min per kb of amplicon) using a T100™ thermal cycler (BioRAD) for conventional PCR and MxPro-Mx3000P® (Stratagene) for qPCR.

Conventional PCR products were analysed by agarose gel electrophoresis and staining with SYBR®Safe DNA gel stain (Thermo Fisher scientific). The gels were imaged using the Molecular Imager®chemiDoc™XRS+ imaging system (Bio-Rad).

2.4.4 Purification of PCR products and plasmids

PCR products were separated on agarose gel and purified from oligonucleotide primers and unincorporated single nucleotides using QIAquick Gel Extraction Kit (Qiagen) following the manufacturer’s protocol. Plasmids were purified from bacterial cultures grown overnight (Section 2.1.1) using a Wizard plus SV Miniprep (Promega) following the manufacturer’s protocol. Purified products were quantified using NanoDrop® ND-1000 spectrophotometer (NanoDrop Technologies) and an aliquot of 5 µl was examined by agarose gel electrophoresis to confirm purity.

2.4.5 Cloning, restriction digestion, ligation and transformation

Purified PCR products (Sections 2.4.3 and 2.4.4) were cloned into the pGEM-T vector (Promega) and ligation was performed using T4 DNA ligase according to the manufacturer’s

34 instructions. Briefly, for EAdV-2 qPCR plasmid standard, purified vector (50 ng) and insert (33 ng) were mixed with 1 U T4 DNA ligase and the supplied T4 ligation buffer in a 10 µl reaction volume. The ligation mixture was incubated at 4°C overnight or at room temperature for 4 hrs.

To produce recombinant proteins, DNA was cloned directly into pfastBac™ 1 or pGEM-T if required. In brief, 1 - 2 µg of DNA, was incubated with the appropriate restriction enzymes, SalI/XhoI or BamHI/SalI (10 U each) in the required restriction enzyme buffer (NEBuffer 3.1) in a final volume of 20 – 50 µl. The mixture was incubated for 1 - 2 hr at 37°C. The samples were then run on agarose gel and the bands were gel purified (Section 2.4.4). Digested PCR product and vector were ligated in a 3:1 insert:vector molar ratio using 1U T4 DNA ligase (Promega), following the manufacturer’s protocol.

Transformation was performed either into E. coli JM109 or DH5α cells by electroporation using gene pulser (BioRad). After electroporation, the mixture was transferred into LB broth shaken for 1 hr at 37°C. The cells were then spread on LB agar plates containing ampicillin (50 - 100 µg/ml) and incubated overnight at 37°C. Colonies were screened by PCR using either gene specific primers or the vector primers T7 and SP6 primer sets (Table 2.2). Positive colonies were grown in 5 - 10 ml of LB broth overnight in a shaker incubator at 37°C, 200 rpm. Plasmids were purified using methods described in section 2.4.4. Each of the plasmid constructs were analysed on agarose after appropriate restriction endonucleases digestion to test whether the recombinant plasmid contained appropriate insert size. If required, each insert were then sub-cloned into either pGEM-T or pfastBac™ 1.

2.4.6 DNA concentration measurement

The NanoDrop® ND-1000 spectrophotometer (NanoDrop Technologies) was used to assess the DNA concentration and purity by measuring the optical density of the DNA at a wavelength of 260 nm. The A260/A280 ratio was used to estimate the relative purity of the DNA.

2.4.7 DNA sequencing

Nucleotide sequencing was carried out using BDTv3.1 cycle sequencing Kit (Applied Biosystems), according to the manufacturers’ instructions. The primers used in sequencing the products were either gene specific or vector based primers as required. The sequencing reactions were carried out in PCR thermocyclers (BioRad) with the following thermal cycling conditions: initial denaturation cycle of 96oC for 60 secs, followed by 25 cycles of 96°C for 10 sec, 50°C for 5 sec, and 60°C for 4 min. Sequencing reaction products were purified according to manufacturer’s directions and were sent for sequencing to Centre for Translational Pathology, Department of Pathology, The University of Melbourne (Melbourne, Australia). Sequence chromatograms were analysed using Geneious software package 7.1.9 (Kearse et al., 2012).

2.5 Protein analysis 2.5.1 SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

Sodium dodecyl sulfate-polyacrlamide gel electrophoresis (SDS-PAGE) was performed as described previously (Laemmli, 1970), using BioRad Mini-Protean III system. Proteins were electrophoresed in either 10% w/v or 12% w/v slab cross-linked with bis-acrylamide in a buffer containing 50 mM Tris-HCl, 380 mM glycine and 0.1% v/v SDS. Prior to electrophoresis, purified virus samples or proteins were boiled for 5 min in Laemmli’s double strength reducing buffer (50 mM Tris-HCl (pH 6.8), 2% w/v SDS, 10% v/v glycerol, 0.0001% w/v bromophenol blue and 0.1 M β-mercaptoethanol). Gels were run at 200 volts for 50 mins or until the dye left the lower separating gel. Pre-stained molecular weight marker (PageRuler, Fermentas) was run simultaneously to estimate the molecular weight of the proteins.

2.5.2 Coomassie staining of SDS-PAGE gels

After electrophoresis, gels were stained with 0.05% w/v Coomasie Brilliant blue in 45% v/v methanol and 10% v/v glacial acetic acid for visualisation of the protein with 30 min of gentle shaking. Destaining was performed using first de-staining solution (7% v/v acetic acid) for 30 min and longer de-staining solution (containing equal volumes of 50% v/v methanol and 7% acetic acid) for variable times.

2.5.3 Western blotting

Proteins separated by SDS-PAGE, as described above, were transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore) using the mini-trans-blot system (BioRad) in Western blot transfer buffer (20% v/v methanol in 50 mM Tris-HCl, 380 mM glycine) at 100V for 60 min. The membrane was blocked with 5% w/v skim milk in PBST (PBS, 0.05% Tween 20) overnight at 4°C or 1 hr at room temperature. All incubations and washes were performed on a rocking platform.

The membranes were rinsed three times in PBST before probing with rat antiserum to

EAdV2-385/75.4 fibre knob (diluted 1:100) (Section 2.3) or anti-his6 antibody (GE Health- care Life Science) as primary antibody diluted in 1% w/v skim milk in PBST for 1 hr at room temperature. After three PBST washes, the membranes were probed with HRP-conjugated goat anti-rat IgG (DAKO) or anti- mouse IgG (for the his6 tag probe) secondary antibody diluted (1/1000) in 1% skim milk in PBST for 1 hr at room temperature. The membranes were then washed three times in PBST and developed using Clarity®ECL blotting substrate (BioRad) following manufacturer’s protocol. The image was taken using the Molecular Imager®chemiDoc™XRS+ imaging system (BioRad).

2.5.4 Enzyme-linked immunosorbent assays (ELISA)

ELISAs were performed in 96 well flat bottomed, polyvinyl chloride microtitre plates (Nunc- immunoplate Maxisorb). The wells were coated with 50 ul of 0.75 µg/ml purified EAdV-1 or EAdV-2 virion in coating buffer (0.1M bicarbonate/carbonate buffer, pH 9.6) and incubated overnight at 4°C. The wells were washed two times using PBST and then blocked with 100 ul

PBS blocking buffer (BSA10PBST + 5% v/v normal sheep serum) overnight at 4°C. Serial

dilutions of polyclonal sera were then made in the wells using BSA diluent (BSA5PBST + 5% v/v normal sheep serum) at 100 µl final volume per well. After 2 hrs at room temperature on an orbital shaker, plates were washed 4 times in PBST and bound antibody was detected using 50 µl of horse radish peroxidase (HRP) conjugated swine anti-rabbit IgG (1/400; Dako)

in BSA5PBST and incubated for 1 hr at room temperature with shaking. Wells were washed 4 times with PBST and developed using 50 µl of ABTS® peroxidase substrate (KPL) substrate per well. The reaction was stopped using 25 µl of 1M HCl and the plates were read on an

ELISA plate reader at 450 nm (Gen5; BioTek®). The absorbance vs the reciprocal of the dilution of the polyclonal sera was plotted.

2.6 Full genome characterisation of equine adenovirus-2 (EAdV2-385/75.4) 2.6.1 Viral DNA preparation

EAdV2-385/75.4 (Studdert & Blackney, 1982) was grown on EFK cells in a 1750 cm2 flask (passage 7) and purified from the cell pellet by sucrose gradient according to the method described elsewhere (Croyle et al., 1998) and as described in section 2.2.2. Viral DNA was extracted from the purified virus following proteinase K treatment using High Pure PCR Template Preparation Kit (Roche) following manufacturer’s instructions. The presence of EAdV2-385/75.4 DNA in sample was verified by PCR targeting the region of the hexon gene and electron microscopy (Section 2.4.3).

2.6.2 Next generation sequencing library preparation

The DNA sample was sent to Monash University, Department of Microbiology, Micromon sequencing facility (Melbourne, Australia) and the nucleic acid was processed using Nextera XT Library Preparation Kit (Illumina) as per the manufacturer's instructions. The samples were then diluted to 10 pM and sequenced using an Illumina MiSeq using TruSeq V2 chemistry as per the manufacturer's instructions.

2.6.3 De novo viral genome assembly

For each data set, raw deep sequencing reads were initially trimmed off all regions with the median Phred quality score 30 (Q30) or below. Phred is a base calling program which examines the chromatogram peaks around each base call to assign a quality score. All the remaining reads pairs were de novo assembled into contiguous sequences (contig) using Geneious 7.1.9 software (Kearse et al., 2012).

2.6.4 Direct sequencing of inverted terminal repeats and selected open reading frames (ORF)

To verify the ITR at the genome termini, primers were designed based on EAdV2-385/75.9 (Genbank accession number NC027705) and the sequence of adjacent ORF, respectively (Table 2.3). PCR, PCR product purification and Sanger sequencing were carried out as described in sections 2.4.4 and 2.4.7.

2.6.5 Sequence analysis of the genome

Open reading frame identification and gene prediction were carried out using Glimmer3 (Delcher et al., 2007) as a Geneious software package. First, EAdV2-385/75.4 genome was aligned to the most similar reference genome in GenBank, followed by identification of ORFs using Geneious open reading finder. The selection of ORFs required the presence of an ATG start codon, coded for over 50 amino acids and which could be identified by the existence of homologous ORFs in published adenovirus genomes or by genomic location are described. The putative amino acid sequences derived from these ORFs were searched against the non-redundant NCBI GenBank database using the program Basic Local Alignment Search Tool (BLASTx). Default parameters of word size = 3 and expectation = 10, with the BLOSUM62 substitution matrix and with gap penalties of 11 (existence) and 1 (extension), were applied to these analyses.

Genome annotations and visualisation were also manually curated for some of the EAdV2- 385/75.4 genes, which are not fully annotated by the previously described methods. Predicted genes were named according to earlier given names including the possible genes with unknown function. Open reading frames that did not show significant protein similarity against GenBank entries were named as hypothetical open reading frames (hORF). PCR using specific primers (Table 2.3) designed from adjacent regions followed by Sanger sequencing were also used to confirm the correctness of the assembly. Putative RNA splicing sites for commonly spliced adenoviral transcripts were predicted using a combination of the GT-AG intron start-stop signal manually and SplicePort (Dogan et al., 2007) and confirmed by comparisons with previously annotated adenovirus genomes.

2.6.6 Amino acid sequence percent identity and whole genome nucleotide alignment

analysis

The coding sequences of EAdV2-385/75.4 were compared to homologues found in other animal and human adenoviruses genomes, with the percent identities for the proteins calculated using Molecular Evolutionary Genetic Analysis software (MEGA v6) (Tamura et al., 2013). Global pairwise whole genome alignment, visualisation and comparisons of EAdV2-385/75.4 with other members of adenovirus from different animals’ species and human were made using zPicture (http://zpicture.dcode.org/) (Ovcharenko et al., 2004). Whole genome nucleotide pairwise distance calculations were performed from alignments using Geneious software.

2.6.7 Phylogenetic analysis

To construct the nucleotide phylogeny trees corresponding to fibre, DNA polymerase, penton base and hexon proteins, representative coding sequences of all adenovirus genera were first downloaded from GenBank (Table 2.4). Multiple sequence alignments of nucleotides of the whole genome and coding regions of hexon, DNA polymerase, penton base and fibre were then performed using Multiple Alignment via Fast Fourier Transforms (MAFFT v7.017) (Katoh et al., 2002) at default parameters and phylogenetic trees were generated from the aligned sequences. The default parameters for gap open penalty, gap extension penalty, and perform fft were used (1.53, 0.123, ‘‘local pair’’). Subsequent phylogenetic trees were obtained using bootstrap tests of phylogeny of 1000 replicates with neighbour-joining method (Saitou & Nei, 1987) featured in the program. The evolutionary distances were computed using the Maximum Composite Likelihood Method (Tamura et al., 2004) and are units of the number of base substitutions per site. Representative adenoviruses full genome sequences from each genus with the following accession numbers were used for the full genome analysis and phylogenetic tree construction (Table 2.4)

2.6.8 Penton base, hexon and fibre genes recombination analysis

To further explore the data from the whole genome alignment (zPicture) and the findings from the phylogenetic tree, a detailed examination of the EAdV2-385/75.4 penton, hexon and fibre coding sequences was performed for any possible recombination events. Concatenated

penton base, hexon and fibre genes sequences were first aligned with MAFFT. BootScan and SimPlot recombination analysis on aligned sequences were performed using SimPlot version 3.5.1 (Lole et al., 1999) with default parameters (window size of 200 bp, step size of 20 bp, 100 repetitions, gap stripping, on; Kimura distance model; and neighbor-joining tree model). To further assess recombination breakpoints, multiple alignment of the concatenated sequence results were analysed using recombination detection program (RDP4 v3.6) (Martin et al., 2015).

To further explore other regions of the genome for possible recombination sites, multiple full genome alignment from diverse animals was tested using SplitsTree4 software (V.13.1) (Huson & Bryant, 2006). Networks were constructed using the NeighborNet method, uncorrected character transformation and the Kimura two-parameter model. The analysis was also tested by removing the ORF5 and E312.5K as well as by using split tree decomposition method (Huson & Bryant, 2006).

2.6.9 Electron microscopic observation

To confirm the presence and investigate the morphology of EAdV2-385/75.4, the purified virus was analysed by electron microscopy by Liliana Tatarczuch, Faculty of Veterinary and Agricultural Sciences, The University of Melbourne. Purified virus pellet resuspended in TNE was sent and negatively stained prior to transmission electron microscope observation. The observed virions were photographed and analysed.

2.7 Development and validation of the qPCR 2.7.1 Experimental design and viruses used for assay development and validation

SYTO9 qPCR was developed and validated for specific identification and differentiation of EAdV2-385/75.4 from the only other serotype 1 equine adenovirus (EAdV-1.M1). Equine adenovirus-2 (EAdV2-385/75.4) grown on tissue culture was used to assess the analytical performance of the SYTO9 qPCR and to validate the developed assay. EAdV-1.M1 was used as negative control.

2.7.2 Primer design

A pair of oligonucleotides was designed to amplify a 109 bp fragment of the hexon gene corresponding to EAdV2-385/75.4 sequence available in NCBI, Genbank (Accession No. L80007) using Primer 3, in Geneious Pro 5.1.7 software (Kearse et al., 2012). Additional sequences of EAdV-1 retrieved from GenBank (Acc. No. JN418926) were used to select regions of strong nucleotide variation. Specificity of the primer sequences was then confirmed by comparing to the GenBank DNA database by BLASTn for matches. The primers were also tested for their melting temperatures, potential hairpins, self-annealing sites, and primer-primer interactions. The sequences of primers are: EAdV2.qpcr.hexF 5’-CGCCGCCTAACACCACCCTG-3’, EAdV2.qpcr.hexR 5’-CACCGGGAGCCCACGTTCAC-3’. Primers were synthesised at the oligonucleotide synthesis facility of GeneWorks, Australia.

2.7.3 DNA extraction

Viral DNA extractions from cell supernatant and faecal specimens were performed as described in sections 2.4.1 and 2.4.2.

2.7.4 SYTO9 qPCR

The qPCR assay was performed on MxPro-Mx3000P® (Stratagene) real time PCR platform.

Assay conditions were optimised by varying concentrations of MgCl2 (1.9 - 3.8 mM), primer ratios (1:1 to 1:5; F:R primers), final primer concentrations of 0.21 µM to 1 µM and annealing temperatures (52 – 65°C). The optimised assay was carried out in a final volume of 20 µl that contained 2 µl template, Green GoTaq® Flexi Buffer, 0.21 µM of each of forward

 and reverse primer, 0.5 mM SYTO 9, 1.88 mM MgCl2, 0.25 mM dNTPs and 1.25U GoTaq® Flexi DNA Polymerase. The cycling conditions were as follows: an initial denaturation at 95°C for 5 min for 1 cycle and 40 cycles of denaturation, annealing and extension at 94°C for 30 sec, 63°C for 30 sec and 72°C for 15 sec, respectively.

A dissociation curve was performed after amplification by increasing the temperature from 55°C to 95°C and fluorescence signal was acquired at each annealing and extension step.

Specimens were considered positive if both an exponential increase of fluorescence and an EAdV2-385/75.4 specific melting peak were observed. The analysis of data obtained during the curve construction process was performed using MxPro-Mx3000P (Stratagene) optical system software.

2.7.5 Construction of EAdV-2 qPCR template standard for absolute quantification

A pGEM-T Vector (Promega) containing a 109 bp fragment of the EAdV2-385/75.4 hexon gene was constructed and used for optimisation of the qPCR and for construction of standard curve (Section 2.4.5). The plasmid (EAdV-2 qPCR, pGEM-T) was linearized using the restriction endonuclease NdeI (Promega) and the standard plasmid copy number was calculated using the following equation:

Plasmid copies/µL = [plasmid amount (g/µl) × 6.022 × 1023 (copies/mol)] [Plasmid length (bp) × 650 (g/mol)]. The final copy number for 10-fold serial dilutions ranged from 2.7 × 1010 to 2.7 template copies per reaction.

2.7.6 Standard curve, analytical sensitivity and specificity

A standard curves were generated by plotting the starting quantity of the template against quantification cycle (Cq) value obtained during amplification of each dilution (Bustin et al., 2009). To construct this standard curve, assays were performed in three separate experiments on 10-fold dilutions of EAdV-2 qPCR pGEM-T plasmid (2.7 × 101 – 2.7 × 108 copies per reaction) within a single run. The Cq was determined automatically by thermal cycler program software (MxPro-Mx3000P Stratagene) for each dilution. The limit of detection (LOD) was determined based on the highest dilution of the standard plasmid possible to amplify with good reproducibility. The analytical sensitivity was also assessed using 10-fold serial dilutions of DNA extracts from a tissue culture with initial concentration of 108.2

TCID50/ml and was run in parallel to compare with conventional PCR. The specificity of the assay for EAdV2-385/75.4 DNA was assessed by testing genomic extracts of other viruses affecting horses including, equine herpesvirus 5 (EHV-5), equine rhinitis virus B1 (ERBV1), and equine adenovirus 1 (EAdV-1). Additionally, negative faecal extracts were tested and

melting curve analysis of PCR products was considered to exclude unspecific products. Moreover, the genotype was finally confirmed by direct sequencing the PCR products obtained to EAdV2-385/75.4 recombinant plasmids.

2.7.7 Reproducibility and repeatability

In order to determine the reproducibility (mean inter- assay variability) of the technique for the standard plasmids, each standard dilution series (2.7 X 108 to 2.7 x 101 copies/reaction) EAdV2-385/75.4 recombinant plasmid, was tested in triplicate once per day for three different days. The repeatability (mean intra-assay variability) was also evaluated by testing each standard series in triplicates in one run. Mean, standard deviation (SD), and coefficient of variation (CV) were calculated. The coefficient of variation (CV) was determined for using the formula CV=σ/μ×100, where CV is defined as the ratio of the standard deviation (σ) to the mean (μ) and expressed as a percentage.

2.7.8 Evaluation of possible PCR inhibitors in clinical samples

In order to evaluate the effects of inhibitors in clinical sample matrices, a known EAdV2- 385/75.4 negative faecal sample and PBS were spiked with EAdV2-385/75.4 infected tissue culture in a ten-fold dilution (10 µl of tissue supernatant into 90 ul PBS or faecal suspensions). A negative/un-spiked control from faecal samples and PBS were also included. Prior to extraction, the spiked and un-spiked faecal samples were spun to pellet the solids at 20,000 x g for 10 min. DNA was extracted from the four samples using QVREK and 1/10, 1/100 and 1/1000 dilutions of the all the extracts was prepared. Quantitative PCR (Section 2.7.1) was run using a standard curve prepared from plasmid and neat (undiluted), 1/10, 1/100 dilutions of the extracts.

In a second experiment, another sample set of EAdV2-385/75.4 negative faeces and PBS 7.2 were spiked using 10 µl of EAdV2-385/75.4 infected cell supernatants (10 TCID50/ml) in order to examine the extraction and qPCR efficiencies of EAdV2-385/75.4 in natural sample matrices and assess the optimum sample pre-treatments. Thus, five sets of serials two-fold dilutions were prepared that covered the starting faecal dilution used in the detection of the archived faecal samples. DNA was extracted, this time, from each spiked sample using

PowerSoil DNA extraction kit (Mo BIO inc) to avoid effects of extraction methods used and run in triplicate. A standard was prepared from the EAdV2-385/75.4 plasmid and included in the run (Section 2.7.6). The mean DNA copies for each dilution of faeces and PBS were compared. On each occasion, a non-spiked faeces and PBS sample were included as negative process controls.

2.7.9 Testing faecal specimens

The qPCR procedure was applied to the detection of EAdV-2 in a total of 313 freezer-stored faecal specimens in RNA later (16.6% w/v faecal suspensions), collected in 2010 from New South Wales (NSW), Australia. Briefly, 0.5 ml or 0.5 g of foal faeces was added to 2.5 ml RNA later (Sigma) and thoroughly mixed with a vortex, followed by incubation at 4°C overnight to allow the solution to thoroughly penetrate the sample. The sample was then frozen at -20°C overnight, followed by long term storage at -70°C until RNA/DNA extraction and polymerase chain reaction (PCR) assay (Kirsten Bailey, personal communication). The samples were originally collected from farms with scouring foals and from intensive care unit at a veterinary hospital. Non-diarrheic specimens were also collected from clinically normal foals. A 225 μl aliquot of each faecal suspension was used for genomic DNA extraction to a final elution volume of 100 μl DNA using the X-tractor Gene automated DNA extractor (Corbett Life Science). Sterile water was included as negative extraction and no template controls, respectively.

Samples used for comparisons of qPCR and conventional were processed and DNA was extracted using phenol-chloroform extraction methods (Section 2.4.2.2).

2.8 Construction of recombinant equine adenovirus fibre knob protein using baculovirus expression vector systems (BEVS) 2.8.1 Amplification of genes using PCR

Equine adenovirus genomic DNA extraction and purification were performed by standard techniques from cell culture supernatants as described previously in sections 2.4.1 and 2.4.4. DNA fragments encoding the fibre knob of EAdV-1 and -2 were amplified by PCR. The oligonucleotides used in the PCR to produce fragments of EAdV-1 and EAdV2-385/75.4

fibre knobs for baculovirus expression are listed in Table 2.5 and the PCR conditions were 1 cycle at 95oC for 4 min, 40 cycles at 95oC for 30 sec, 50oC for 30 sec, and 68oC for 1 min and one cycle at 72oC for 7 min, and 1 cycle at 95oC for 5 min, 40 cycles at 95oC for 30 sec, 55oC for 30 sec, and 72oC for 30 sec and one cycle at 72oC for 7 min for EAdV-1 and EAdV2-385/75.4 fibre knobs, respectively.

2.8.2 Construction of recombinant pfastBac-fibre knob (rpFastBac-fibre knob) transfer vectors

The rpFastBac-fibre knob transfer vectors were constructed after the PCR products of EAdV- 1 (rpfastback-fk1) and EAdV2-385/75.4 (rpfastback-fk2) fibre knob region were gel purified (Section 2.4.4), and digested by SalI/XhoI and BamHI/SalI restriction enzymes, respectively (Section 2.4.5) and successfully ligated into the pFastBac™ 1 donor transfer vector as described in section 2.4.5, with the exception that DH5α cells were used. All plasmids were analysed by restriction enzyme analysis using appropriate enzymes and sequenced before cloning into the pFastBac™ 1 donor plasmid.

2.8.3 Sequence confirmation of virus transfer vectors

The correct sequence of the each recombinant baculovirus transfer vectors (rpfastback-fk1 and rpfastback-fk1) was confirmed by Sanger sequencing (Section 2.4.7). The baculovirus transfer vectors were purified from 5 ml overnight cultures and quantified as described in sections 2.4.4 and 2.4.6. Sequencing was performed using pfastBac sequencing primers (Table 2.2) and DNA sequences were analysed using Geneious software.

2.8.4 Generation of recombinant Bacmid

Generation of Bacmid DNA was performed based on Invitrogen’s Bac-to-Bac system (Carlsbad, CA). After verification of desired baculovirus transfer constructs, the plasmids (rpfastback-fk1 and rpfastback-fk2) gene expression cassettes were transformed into Max ® TM Efficiency DH10BAC competent cells (Invitrogen) following the manufacturer’s protocol. For each transformation 100 μl of cells were removed into a sterile 15 ml Falcon tube and one ng of each rpfastbac-fk1 and rpfastbac-fk2 were mixed gently into the competent cells. The mixture was incubated on ice for 30 min. following heat shock at 42°C for 45 sec, the

mixture were chilled on ice once again for 2 min. Nine-hundred microlitres of super optimal broth with catabolite repression (S.O.C) was then added to the mixture and incubated at 37°C for 4 hrs in a shaker incubator (200 rpm). The cells were diluted to 10-1, 10-2, 10-3 using S.O.C media and 100 μl of each dilution was plated on the LB-agar supplemented with kanamycin (50 μg/ml), gentamicin (7 μg/ml), tetracycline (10 μg/ml), 5-bromo-4-chloro-3- indolyl-beta-D-galactopyranoside (X-Gal) (100 μg/ml), isopropyl β-D-thiogalactopyranoside (IPTG) (40 μg/ml). Successful recombination is identified by the disruption of the lac-Zα gene on the Bacmid, allowing a blue/white screening in the presence of X-gal and IPTG. After 48 hrs incubation, the white colonies were re-streaked to confirm phenotype and the white colonies were grown in supplemented LB media overnight at 37°C.

TM DH10Bac competent cells contain the Bacmid with a mini-attTn7 target site and the helper plasmid. With the assistance of helper protein, the mini-Tn7 element on the pFastBac™ 1 transfer vector can transpose to the mini-attTn7 target site on the Bacmid in the presence of transposition proteins (Fig. 2.1). When successful transposition occurs, disruption of lac-Zα gene expression creates white colony.

2.8.5 Isolation of bacmid DNA

Isolation of Bacmid DNA was carried out using Qiagen plasmid midi kit (Qiagen) following manufacturer’s instruction with modifications. Briefly, two to three large colonies were picked for each Bacmid and inoculated into 2 ml DH10Bac growth medium (LB growth medium with same antibiotic concentrations as DH10Bac plates) and grown at 37°C overnight. The culture was transferred to 2 ml microcentrifuge tubes and cells were pelleted by centrifugation at 14,000 x g for 1 min pelleted cells were resuspended with 300 μl of reagent P1 and lysed with 300 μl P2 reagent. Two hundred μl of P3 reagent was then added and centrifuged at 14,000 x g for 10 min to pellet debris. Supernatant was collected and transferred to clean tubes containing 800 µl isopropanol to precipitate the Bacmid DNA. After incubation on ice for 10 min, mix was centrifuged once again to pellet DNA. DNA was air dried and resuspended in 40 μl of water.

2.8.6 PCR analysis of recombinant genes encoding EAdV-1 fibre knob and EAdV-2 fibre Knob

The presence of the recombinant genes in the bacmids were confirmed using the M13 primer pairs (Table 2.2). After the initial denaturation at 94°C for 3 min, 30 cycles of 94°C for 20 sec, 55°C for 20 sec and 72°C for 3 min were performed, followed by a final extension at 72°C for 7 min.

2.8.7 Transfections of Sf-9 cells with recombinant bacmid

Transfections were performed using 6 well plates (Nunc) at a cell density of 9 x 105 Sf9 cells/well in 2 ml of SF900 II SFM (GIBCO®) without antibiotics. The cells were allowed to attach on the surface of the well for 1 hr at 27°C. Meanwhile, 1 µg and 1.6 µg of EAdV-1 and-2 fibre knob Bacmids, respectively, were transferred into a polystyrene tube containing 8 μl of Cellfectin® reagent (Invitrogen). The mixture was incubated in 200 μl of antibiotic-free SF900 II SFM for 45 min at room temperature and added drop-wise directly onto the Sf-9 monolayers. After 5 hrs, the medium containing the transfection agent was removed and replaced with 2 ml of fresh SF900 II SFM supplemented with gentamycin (10 µg/ml) and amphotericin B (0.25 µg/ml). The cells were incubated for an additional 72 hrs at 28°C in humid environment. Viral supernatants were recovered by centrifugation at 500 × g for 5 min. The supernatants were kept and stored at 4°C in the dark as passage 1 (P1) recombinant baculovirus.

2.8.8 Amplification of recombinant baculovirus stocks (P2 and P3 viral stock)

The viruses were further amplified using suspension culture of Sf-9 cells. Sf-9 cells with greater than 97% viability were infected at a density of 1 x 106 cells/ml. For amplifying P1, suspension cultures were infected at a m.o.i of 0.1 expecting initial transfection viral titres of 2 - 4 x 107 pfu/ml. Cells were monitored morphologically and counted to ensure cell growth had ceased. After 72 h of post incubation, P2 baculovirus was collected in the same manner as P1 and stored light protected at 4°C until further use. Similarly, 30 ml suspension culture (1 × 106 cells/ml) of Sf-9 cells were infected using cell culture medium containing P2 baculovirus incubated at 28°C, with shaking at 80 rpm to generate P3 virus.

2.8.9 Recombinant baculovirus plaque assay

Sf-9 cells were seeded at a density of 5 x10 5 cells/ml in 6-well plates. After 1 hr at room temperature, the supernatant was removed by aspiration before the addition of the viral inoculum. Serial dilutions of the clarified baculovirus stock (10-4 - 10-8) was prepared in SF900TM II SFM and 1 ml of each dilution added to each well in duplicate. Media without the virus was added as a negative control. The viral infection was allowed to proceed for 1 hr at room temperature. Starting with highest dilution, media containing the virus was removed from the cells and replaced with 2 ml of molten 1% (w/v) SeaPlaque® agarose (Lonza) in plaque medium [SF900-II (1.3X)]. Once the agarose solidified, the plates were incubated at 28°C for 7 - 10 days in humidified box until plaque formation was observed. Plaques were stained with neutral red and counted. The titre of the virus in plaque forming units (pfu/ml) was calculated by counting plaques and multiplying the average plaque count by the dilution factor. Plaque assays were conducted using the working stocks, P3 and P2 for EAdV-1 and EAdV2-385/75.4 fibre knobs, respectively.

2.8.10 Small scale testing of recombinant his6-tagged EAdV-1 and EAdV-2 fibre knob expression

Preliminary small scale expression test was carried to ensure that each recombinant protein was being expressed and optimisation of expression was carried out using different time points. For the protein expression, >97% viable Sf-9 cells are infected at a density of 1 x106 cells/ml. Each recombinant baculovirus were inoculated into 20 ml suspension cultures of Sf- 9 cells (1x106 cells/ml) at a m.o.i of 5. The cells were incubated at 28°C and counted every day for 4 days prior to 2 ml sample collection. They were collected at low speed (800 rpm) for 5 min. Both cells and supernatants were kept at -20°C until all the samples at each time points collected. The cells were lysed in 500 µl of lysis buffer containing 50 mM Tris-HCl (pH 6.8),150 mM NaCl, 1 mM EDTA, 1% v/v Triton-X 100 and 1% protease inhibitor cocktail (Roche) by vertexing up to 5 times during the 30 mins incubation on ice. The supernatant (soluble fraction) was separated from the cellular debris by spinning at 10,400 x g for 10 min at 4°C for analysis by SDS-PAGE and Western blot. The maximum recombinant protein yield as visualised from SDS-PAGE/Western blot by time course analysis was considered as the optimum time of harvest.

2.8.11 Large scale recombinant his6-tagged EAdV-2 fibre knob expression in insect cell culture

Large scale expression was performed in culture volumes of 500 – 750 ml in 1L spinner flasks. Once a cell density of 2 x 106 - 3 x 106 viable cells/ml was reached, cells were infected with the recombinant baculovirus (P2 virus) at a m.o.i of 5. Infected cells were monitored by counting cells in a hemocytometer using trypan blue exclusion and were harvested at 72 hrs post inoculation (h.p.i).

2.8.12 Purification of recombinant his6-fibre knob

Purification of the recombinant his6-fibre knob protein was performed using the

QIAexpressionist™ (Qiagen) handbook protocol used for purification of his6-tagged proteins from baculovirus infected insect cells under native conditions.

In brief, approximately 500 - 1000 ml cultures of transfected cells were collected by centrifugation at 1000 x g for 5 min and washed twice using PBS. The cells were then lysed using 4 ml lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0 supplemented with 1% v/v Tween-20 and protease inhibitors cocktail (Roche) per 1 x 107 cells. The mixture was incubated for 10 min on ice and the lysate was centrifuged at 10,000 x g for 10 min at 4°C to pellet cellular debris and DNA. Lysate was then collected and passed through a 0.45 µm filter (Millipore). Approximately, 200 µl 50% v/v nickel nitrilotriacetic acid (Ni-NTA) slurry (Qiagen) per 4 ml of the cleared lysate was used and mixed gently at 200 rpm on a rotary shaker at 4°C for 1 - 2 hr. The lysate was passed through the column twice by gravity flow. The Ni-NTA beads were then washed twice using wash buffer (800 µl

per 4 ml lysate) (50 mM NaH2PO4, 300 mM NaCl, 25 mM imidazole, pH 8.0). Following washing, the proteins were eluted from the Ni-NTA column using elution buffer (100 µl per 4

ml lysates) (50 mM NaH2PO4, 300 mM NaCl, 250mM imidazole, pH 8.0 supplemented with 1% protease inhibitor cocktail) and the eluates were collected 1 - 1.5 ml fractions. The concentration of purified protein was estimated using Qubit® Protein Assay Kit (Life Technologies), following manufacturers’ protocol. Samples collected from each the purification process were run on SDS-PAGE and transferred into PVDF membrane for Western blotting.

2.8.13 Dialysis

The fractions containing the target protein were pooled together and sealed into a dialysis membrane (molecular cut of 12-14 kDa) (Sigma-Aldrich). Dialysis was carried out overnight using at least 50 times the sample volume of PBS (pH 7.4) with constant stirring at 4oC and buffer changes.

2.8.14 Concentration of protein samples

Purified his6-EAdV2-385/75.4 fibre knob protein was subjected to another processing to concentrate the protein. Amicon®Ultra-4 centrifugal filter devices (Millipore) were used with volumes and molecular weight cut off (10 kDa) following manufacturers’ instruction.

2.9 Characterisation of host cell receptor for equine adenoviruses 2.9.1 Titration of rat anti-EAdV-1 or anti-EAdV-2 polyclonal sera against EAdV infected cells

To determine the optimum titre of the rat sera used in the immunofluorescence infectivity assay, a 70 - 90% confluent monolayer culture of EFK cells in 96 well flat bottomed 8.2 microtitre plates were infected with 100 ul of EAdV2-385/75.4 (10 TCID50/ml) (m.o.i = 0.2 6.6 and EAdV-1(10 TCID50/ml) (m.o.i = 0.3. The infection was performed in duplicate and one row of uninfected cell control (MM only) was included as a negative control. Rat anti- EAdV1, EAdV-2 and pre-immune sera at a dilution from 1:100 to 1:400 were tested using immunofluorescence assay as described previously (Section 2.2.3) The optimum antisera titre was chosen in which fluorescent infected cells could be clearly distinguished without background while negative controls showing no fluorescence.

2.9.2 Determining the dose of inoculum for EAdV-1 and EAdV2-385/75.4 infection assay

To determine the virus dilution and incubation time that would generate statistically reliable foci, infection experiments were carried out serial ten-fold viral dilutions in duplicate at 4 different incubation time points. Briefly, 70 - 90% confluent monolayer culture of EFK cells in 96 well flat-bottomed microtiter plates were infected with 100 ul of EAdV2-385/75.4 (108.2

6.6 -1 -7 TCID50/ml) or EAdV-1 (10 TCID50/ml) virus dilutions (10 - 10 ) prepared in maintenance media. The infection was performed in duplicate and one row of uninfected cell control (maintenance media only) was included. The monolayers were incubated at 37°C for 30 mins, or 60 mins, for viral binding. The sets were incubated for an additional 12 or 24 and 24 or 48 hrs inoculated with EAdV-1 and EAdV-2, respectively, for replication. The optimum incubation time for each virus was chosen based on the time point analysis that showed detectable infection with a statistically reliable number of foci. Adenovirus infected cells were analysed by immuno-infectivity assay (Section 2.2.3) and the dilutions that gave around 50 to 100 fluorescent cells per well were used in subsequent assays.

2.9.3 Effect of rat polyclonal sera on the infectivity of EAdV-1 and EAdV-2

To examine the attachment and hence infectivity of EAdV-1 and EAdV2-385/75.4 on EFK cells, the fluorescent infectivity assay was performed with the following additions/variations: EAdV-1 or EAdV2 virions were pre-incubated at 37oC for 1 hr with increasing concentration of rat sera against EAdV-1 virion, pre-immune sera, against EAdV2-385/75.4 virion and EAdV2-385/75.4 fibre knob (1:50, 1:100, 1:200, or 1:500 dilutions).

2.9.4 Enzymatic and chemical treatments of cells and virus

As the first step in identifying the receptor used by EAdV-1 and EAdV2-385/75.4 to bind and enter cells, general biochemical characterisation of the cell binding receptor for EAdV on the surface of EFK cell were assessed.

Sodium periodate (NaIO4) treatment of EFK cells

To evaluate the role of cell surface carbohydrate in infection, cells were treated with NaIO4 (Sigma-Aldrich) dissolved in PBS, which cleaves carbohydrate vicinyl hydroxyl groups without affecting polypeptide chains.

A total of 2 x 105 EFK cells as monolayers in LabTeks® were incubated with 200 µl of

NaIO4 at a concentration of 0.001, 0.01, or 0.1 mM in PBS and incubated for 30 min at room temperature. The periodate was then neutralised by adding two volumes of 0.22 % (v/v) glycerol in PBS and the cells incubated for a further 15 mins at 4°C (Stevenson et al., 2004).

Cells were then washed two times in DMEM before being used in the infectivity assay. The negative controls (mock treated) in which 200 µl of 0.22% glycerol in PBS was added to the 400 µl of 0.1 mM NaIO4 in PBS in an Eppendorf were incubated for 30 mins on ice before being added to the well of EFK cells in an 8 well chambered LabTeks®.

Treatment of EFK cells with HS-GAGs

To investigate that the interaction of EAdV-1/EAdV-2 with cell receptors involves HS- GAGs, HS was tested in the competition experiments. Different concentrations of HS (1, 10 and 100 µg/ml) (Sigma-Aldrich) were pre-incubated with EFK cells for 30 min prior to addition of the EAdV-1 or EAdV-2 virion and incubated for additional 1 hr for viral attachment. The unbound virions were removed by washing 2 times with DMEM prior to incubating for 24 hrs (EAdV-1) and 48 hrs (EAdV-2).

Enzymatic removal of GAGs from the surfaces of EFK cells

EFK cells were treated with heparinase I (Sigma-Aldrich) or III (Sigma-Aldrich) at a concentration of 1, 2.5 and 5 U dissolved in 20 mM Tris-HCl (pH 7.4), 50 mM NaCl, 4 mM

CaCl2 and 0.01% (v/v) FBS for 1 hr at 37°C. Treated and untreated cells were washed 3 times using serum free DMEM prior to addition of EAdV-1 or EAdV-2 virion and incubated further for 1 hr 37°C.

Treatment of cells with neuraminidase

To further characterise the nature of the carbohydrate component of the putative receptor, EFK cells were treated with Clostridium perfringens (C.welchii) neuraminidase (Sigma- Aldrich), to remove cell surface sialic acid molecules. A total of 2 x 105 EFK cells were treated with neuraminidase at concentrations of 0, 0.1, 1 or 10 mU in DMEM and incubated for 1 hr at 37°C. Subsequently, the cells were washed with DMEM and treated and untreated cells were then infected.

Effect of sialic acid or sialoconjugates on the EAdV-1 and EAdV-2 infections

on EFK cells

Sialylated and non-sialyalted saccharides were dissolved and incubated with EFK cells, prior to addition of EAdV-1 and EAdV-2. EFK cells were treated with 40 and 200 mM/ml of each glucose and lactose (Sigma-Aldrich) on ice for 30 min and further incubated for 1 hr at 37oC after addition of EAdV-1 or EAdV-2 virions. The cells also treated similarly, for N- acetylneuraminic acid (NANA) (Sigma-Aldrich) with exception that 10 and 40 mM/ml NANA was used for treatment.

EAdV-2 fibre knob mediated inhibition assays

To analyse the ability of the soluble recombinant EAdV-2 fibre knob to competitively inhibit homologous and/or heterologous virus infectivity, EFK cells were incubated with increasing concentration of fibre knob protein (0.1, 1, 10 µg/ml) for 30 min at 37°C in 8 well chambered LabTeks®. EAdV-1 (m.o.i = 0.3) or EAdV-2 (m.o.i = 0.2) in 200 µl DMEM were added and further incubated for 1 hr. The cells were then washed twice and incubated for 24 hrs (EAdV- 1) or 48 hrs (EAdV-2) at 37oC.

Role of integrins as EAdV cell receptors

To determine if EAdV interacts with the α4β1or α4β7 integrins, to attach and replicate in the EFK cells, cells were incubated with increasing concentration (1, 5, 10 µg/ml) of vascular cell-adhesion molecule 1 (VCAM-1) (R&D Systems) or mucosal adressin cell- adhesion molecule 1 (MAdCAM-1) (R&D Systems) for 30 min at 37oC before infection with EAdV-1 or EAdV-2.

Antibody mediated blocking experiments

To examine the role of CAR molecules in the attachment and entry of EAdV-1 and EAdV-2, confluent EFK cells grown in LabTeks® were incubated with various concentrations (1, 5, 10 µg/ml) of polyclonal rabbit serum to human CAR (H-300) (Santa Cruz Biotechnology) for 30 min at 37oC before infection with EAdV-1 or EAdV-2.

Treatment of cells with lectins

To investigate the involvement of sialic acid residues in EAdV attachment and infection, EFK cells were pre-incubated with different lectins wheat germ agglutinin (WGA) (from Triticum vulgaris; Sigma-Aldrich), Maackia amurensis lectin (MAA) (Sigma-Aldrich), Sambucus nigra (SNA) (Sigma-Aldrich) prior to incubation the virus to block availability of sialic acid molecule.

2.9.4.9.1 Wheat germ agglutinin blocking assay

A total of 2 x 105 EFK cells were incubated with 200 µl of WGA lectin (Sigma-Alderich) at a concentration of 10, 100, or 200 µg/ml on ice for 1 hr. WGA-treated and untreated cells were mixed with each virion and incubated for additional 1 hr at 37oC.

2.9.4.9.2 M.amurensis agglutinin and S.nigra agglutinin treatment

A total of 2 x 105 EFK cells were incubated with 100 µl of MAA or SNA at concentrations of 10, 100, or 200 µg/ml on ice for 1 hr. MAA/SNA-treated and untreated cells will be mixed with the virions and kept at 37°C for 1 hr prior to washing.

2.9.5 Cytopathic effect inhibition assay

A second method, in addition to IFA (Section 2.2.3) was performed to examine the effects of various treatments on infection. In this assay virus was titrated on treated and untreated control EFK monolayers in 96 well trays to examine how these treatments would affect infection. For treatment of confluent EFK cells with neuraminidase, 10 mU/ml diluted in DMEM was used per well. Prior to EAdV-1 or EAdV-2 infection, culture media was replaced with 50 µl of diluted neuraminidase in duplicate at the indicated concentrations and incubated at 37°C in CO2-incubator for 1 hr. The mock controls were treated with DMEM only. After incubation, cells (treated and mock treated) were infected with 50 µl of ten-fold dilution of 6.6 8.2 EAdV-1 (10 TCID50/ml) or EAdV-2 (10 TCID50/ml). After 1 hr of incubation at 37°C, unbound viruses were removed, and the cells were washed twice in DMEM (1% v/v FBS)

prior to incubation at 37°C in CO2-incubator for four days. For treatments of EFK cells with lectins, 50 µl of WGA (200 µg/ml), MAA (10 or 200 µg/ml) and SNA (10 or 200 µg/ml)

55 diluted in DMEM were added to each well in duplicate. Another set of mocks treated (treated with DMEM) cells were included. The cells were incubated at 30 min on ice prior to addition EAdV-1 and EAdV-2 ten-fold dilutions and incubated for additional 1 hr. After 2 washes, the experiment was performed as described for neuraminidase in this section.

2.10 Statistical analyses

Statistical analyses were performed using SPSS (SPSS v 22) and R software packages. Two tailed paired samples student t test was performed to evaluate the difference between mean copy number value of spiked faeces and PBS using SPSS software (SPSS v 22).

Once EAdV-1 or EAdV-2 specific fluorescent foci were counted from the treated and mock treated cells (Section 2.2.3), multiple comparisons were carried out to quantify and statistically test for differences in the ratios of the total number of fluorescent foci for the mock and treated wells using Tukey’s procedure implemented in the multicomp package (Hothorn et al., 2008) in R (R Core Team, 2016). It is expected that the number of cells in the monolayers and growth conditions will vary between different wells (replicates) and assays ultimately serve as covariates. Hence, the p values were adjusted for the effect of the experiment (assay), the concentration of treatment and replicates. P-values < 0.05 were considered statistically significant.

Table 2.1: Equine adenovirus isolates used in the study.

Serotype Name/Genotype Passage No. Site Reference EAdV-1 EAdV1.M1 6 Respiratory (nasal) Wilks and Studdert, 1972 EAdV-2 EAdV2-385/75.4 7 Digestive tract (faeces) Studdert and Blackney, 1982 EAdV-2 EAdV2-385/75.9 NK Digestive tract (faeces) Studdert and Blackney, 1982 NK= not known

Table 2.2: Vector specific primers used to confirm sequence and orientation. Primer Name Sequence (5’-3’) Purpose pfastBac Forward GGATTATTCATACCGTCCCA 5’-Sequencing pfastBac™1 insertion pfastBac Reverse CAAATGTGGTATGGCTGATT 3’-Sequencing pfastBac™1 insertion T7 Forward TAATACGACTCACTATAGGG Verifying pGME®T construct SP6 Reverse ATTTAGGTGACACTATAGAATAC Verifying pGME®T construct M13/pUC Forward GTTTTCCCAGTCACGAC Verifying Bacmid insertion M13/pUC Reverse CAGGAAACAGCTATGA Verifying Bacmid insertion

Table 2.3: Primers used for verifying open reading frames and 5’-3’ ends of EAdV2-385/75.4 genome.

Primer Name Target Sequence (5’-3’) Primers position Amplicon sense Purpose size (bp) p32F hORF5/E3 GCTGAGTGGTAGGAACTATG 1428-2335 908 F Sequencing E3R- CACTGCCAGCATCCGATA R hORF5 region pVIIIF hORF4 CAACTCAACGAATACAACCG 26791-27683 893 F Sequencing fibre R TAGTTGTAAGACTGCTCCG R hORF4 region ORFA-F hORF1 GCACTCCAGGATAGAATGT 32016 - 32918 902 F Sequencing ITR-R TACCCAGTGACCGGTG R hORF1 region ORFB-F hORF2 ACAGTGGTTGTTGGTCGC 30953-31857 905 F Sequencing ORFA-R CATGACGTACCATCTCCA R hORF2 region dUTP-F dUTP/ORFA GGGGTGGATATTCAAAGTGT 30283- 31075 793 F Sequencing /hORF3 dUTP/ORFA/ ORFB-R TAGAATGGGGTCTGCCT R hORF3 region Fibre-F ORF6/7 GAAGTTACGCATAGCTCTCA 28838 - 29589 752 F Sequencing 34K-R TGTCCAGCTGTCATGTATG R ORF6/7 region EAdV2ITR- 5’-ITR GGCCCAGTTTCGAGTCAT 1 - 167 167 R 5’-end sequencing R1 EAdV2ITR- 3’-ITR CTGGGTAAAAGGTCACAGAG 32,912 - 33,010 99 F 3’-end sequencing F3

Table 2.3: Contd… Primer Name Target Sequence (5’-3’) Primers position Amplicon sense Purpose size (bp) EAdV2hexF1 Hexon CTCTGAACAGAATAGTGGGG 19,108 - 20,584 1477 F Detection in faeces EAdV2hexR1 CGTTCATGTAGTCATAGGTG R EAdV2hexF2 Hexon GGGGCTTTCTCTATTCCAAC 20,477 - 22,022 1546 F Detection in faeces EAdV2hexR2 CCAAGCAGTAATGGGGTTAC R EAdV2fibrF Fibre TTCGAAACAGCCTGAGAAC 27,487 - 29,067 1581 F Detection in faeces EAdV2FibrR ATGTCTTGGATTGGTGGTG R EA2hexF.34 hexon GGAGAAGGCTATAACGTGTCG 21,319 - 21,888 572 F detection in faeces EA2hexR.34 GACCACTTCTATGACGCCTCG R

Table 2.4: Representative adenoviruses used for full genome and phylogenetic analyses.

Virus Abbreviation Genbank Accession No. Bovine adenovirus 4 BAdV-4THT/62 AF036092 bovine adenovirus B BAdV-B NC001876 bat adenovirus TJM BAdV-TJM GU226970 canine adenovirus 1 CAdV-1 AC000003 California sea lion adenovirus 1 CSLAdV-1 KJ563221 duck adenovirus A DAdV-A NC001813 equine adenovirus 1 EAdV-1.M1 JN418926 frog adenovirus FrAdV NC002501 human adenovirus 2 HAdV-2 (AC000007 human adenovirus 5 HAdV-5) AC000008 human adenovirus 31 HAdV-31 AM749299 human adenovirus 41 HAdV-4 KF303070 human adenovirus 49 HAdV-49 DQ393829 human adenovirus A HAdV-A AC000005 human adenovirus B Guangzhou01 HAdV-B DQ09943 Guangzhou01 human adenovirus D HAdV-D JF799911 human adenovirus F HAdV-F NC001454 human adenovirus E HAdV-E NC003266 ovine adenovirus D OAdV-D NC004037 porcine adenovirus 3 PAdV-3 AC000189 porcine adenovirus 5 PAdV-5 AF289262) raptor adenovirus RAdV EU715130 simian adenovirus 49 SAdV-49 HQ241819 turkey adenovirus 4 TAdV-4 KF477312 turkey adenovirus 5 TAdV-5 NC022613 tree shrew adenovirus 1 TsAdV-1 AC000190 equine adenovirus 2 EAdV2-385/75.9 NC027705

Table 2.5: Primers used for the amplification and production of each recombinant proteins.

Protein Primer Name Primer sequence (5’- 3’) a Location b Product size (bp) EAdV1.fibre EAdV1.SalI.fibreExpnF TACGTCGACGCCACCATGCATCACCAT 1801 – 2508 708 knob CACCATCACCTTTACAAAGAGCCGCTT EAdV1.XhoI.fibreExpnR ATACTCGAGTTACAAGGGGTCCTCGCC EAdV2.fibre EAdV2.BamHI.fibreExprnF TACGGATCCGCCACCATGCATCACCATC 826 –1422 597 knob ACCATCACCCACTGTTTGTGGACACCCGC EAdV2.SalI.fibreExprnR ATAGTCGACTTATTCCTGCGCGAGATA a Underlined sequences are restriction sites, bold sequences are gene specific sequences and ATG start codons are illustrated red. The six nucleotide sequences between the restriction sequence and start codons in each forward primer are his6-tags. b The numbering is based on EAdV1.M1 fibre protein (Acc.No JN418926) and EAdV2-385/75.4 fibre protein.

Figure 2.1: Schematic overview of Bac-to-Bac system for the expressions and the production of EAdV2-385/75.4 and construction of EAdV-1 recombinant fibre knobs. (A) Cloning EAdV-1 and EAdV2-385/75.4 fibre knob into pfastBac™1 donor plasmid; (B) Insertion of recombinant vector into Bacmid in DH10Bac E.coli, with the helper function; (C) Isolation of Bacmid DNA from selected DH10Bac clones; (D) Transfection of isolated Bacmids into insect cells using cellfectin reagent; (E) Obtaining and amplifying baculovirus stocks as P1, P2 and P3; (F) Recombinant protein expression using either P2 or P3; (G) Purification of recombinant EAdV2-385/75.4 fibre knob.

CHAPTER THREE

FULL GENOME SEQUENCE ANALYSIS OF EAdV2-385/75.4

3.1 Introduction Along with several other infectious causes of equine diarrhea, EAdV-2 has been associated with gastrointestinal infections although most of these infections are subclinical or associated with only mild clinical signs (Frederick et al., 2009; Horner & Hunter, 1982; Studdert & Blackney, 1982; Studdert et al., 1978). Despite the first reports of EAdV-2 isolation or detection in horses four decades ago there are no detailed studies on the pathology, antigenicity, and genome sequence.

The virus sequenced in this chapter (EAdV2-385/75.4) was isolated from the faeces of diarrheic a foal in Tasmania, Australia (Studdert & Blackney, 1982). This virus was one of two isolates obtained during an outbreak of diarrhea on this farm, where viruses EAdV2-385/75.4 and EAdV2-385/75.9 were isolated from two different diarrheic foals that also had large numbers of rotavirus particles in their faeces (Studdert & Blackney, 1982). To get more insights into the genetic content and evolution of EAdV2-385/75.4, this study employed the Illumina MiSeq Platform to determine the full genome sequence. The accumulation of full genome sequences of many diverse adenoviruses and the development of bioinformatics tools is enabling higher resolution analysis of adenovirus diversity.

The aim of this study was therefore to add to full genome sequence data in order to characterise the genome structure and determine its phylogenetic relationship with other known adenoviruses. Some sequence information for the EAdV2-385/75.4 isolate was determined almost 20 years ago, including the genes for the hexon protein (2742 bp) and 23K proteinase, E1B/19K, IVa2, DNA polymerase, terminal protein, pVI, DNA binding and 100K (Reubel & Studdert, 1997). Most recently however, after the genome assembly phase of this chapter was completed, the complete genome sequence of the EAdV2-385/75.9 sequence was published (Giles et al., 2015). The results presented in this chapter describe the genome assembly of EAdV2-385/75.4, compare this genome with EAdV2-385/75.9, and re-assesses and updates the analysis and phylogeny of the EAdV-2 genome.

3.2 Results 3.2.1 General properties and organisation of the genome

The propagation, purification and genome extraction from the EAdV2-385/75.4 virus isolate is described in sections 2.1.1, 2.2.2 and 2.4.1. Electron microscopy of the purified virus used for genome extraction is shown in Fig. 3.1, showing viral particles typical of members of the family Adenoviridae. The purified genome was submitted for sequencing using the Illumina HiSeq platform (2.4.2). The sequencing from the Illumina HiSeq platform generated a total of 151.9 Mb of sequence and 977,512 raw sequencing reads with the length of 143.2 ± 55.3 (mean ± SD) with at least Q30 = 91.9% from both read 1 and read 2. A quality (Q) score is a prediction of the probability of an error in base calling, which ranges from 4 to about 60, where higher Q-scores implies higher quality. For instance, if a base has a quality score of Q30, the chances that this base called incorrectly is 1 in 1000 (Ewing & Green, 1998). A total of 172,735

(N50 ≥ 54, 274) contigs were assembled de novo with an average length of 222 bp (N50 = 251 bp) using Geneious (Kearse et al., 2012) assembler. Alignment of quality checked and cleaned sequences that were ≥ Q30, a base calling Q-score standard against the consensus sequence generated, resulted a depth of coverage greater than 405-fold. The complete genome size of EAdV2-385/75.4 was 33,010 bp with a base composition of 23.7% G, 24.3% C, 26.9% A and 25.1% T. The G+C content of 48% (Table 3.1) is 11.9% lower than EAdV-1 (59.9%). The genome termini of EAdV2-385/75.4 contains 213 bp inverted terminal repeat (ITR) sequences, which are longer than EAdV-1 (103 bp) but shorter than EAdV2-385/75.9 (253 bp) ITRs at each 5’ and 3’ end (Giles et al., 2015) (Table 3.1). This is notable in comparison with EAdV2-385/75.9, since this is the only difference between the two EAdV-2 isolates EAdV2-385/75.4 and EAdV2- 385/75.9) that were isolated from the same farm. The G+C content and ITR lengths of these isolates are shown in Table 3.1.

The size of EAdV2-385/75.4 genome is longer than EAdV-1 by 320 nucleotides and shorter than EAdV2-385/75.9 by 80 nucleotides. The position and size of ORFs with the potential to encode polypeptides are summarized in Table 3.2. The genomic and predicted transcription map is also presented in Fig. 3.2.

Four early, one intermediate and four late transcription units have been predicted in the full genome of EAdV2-385/75.4 (Fig. 3.2). Based upon blast analysis, it was determined that the first 3 kbp at the 5’-terminal region of the genome has no significant homology to known adenovirus species. It contains an additional left oriented ORF (hORF 5) and E3 regions as shown in Fig. 3.2. At the 3’ end of the genome, none of the first three ORFs (hORF 1, hORF 2 and hORF 3) also showed homology to the known E4 regions from other adenoviruses. More interestingly, the EAdV2-385/75.4 genome displayed a fused E2 and rearranged E3 regions, albeit the significance of these genes orientations is not known. The central part of the genome is similar to other members of Mastadenovirus genus with all viral genes present in the sequenced genome with the exceptions of E3 regions (Fig. 3.2).

3.2.2 Inverted terminal sequence analysis

The only significant difference between EAdV2-385/75.4 and EAdV2-385/75.9 was in the ITR regions, which contain identical sequences that are shorter by 40 nucleotides at the end of EAdV2-385/75.4 genome, compared with EAdV2-385/75.9 genome (Fig. 3.3). Sanger sequencing at 3’ and 5’ genome ends using primers designed from adjacent ORFs (Table 2.3) verified the absence of the extra 40 nucleotides in the EAdV2- 385/75.4. Moreover, multiple alignments with other adenovirus at the 5’-end of the ITR showed that the EAdV2-385/75.4 sequence begins with a sequence that is conserved in the other adenoviruses compared (Fig. 3.3). In view of this, and the fact that the two virus genomes are 100% identical in the other regions of the genome, this difference between EAdV2-385/75.4 and EAdV2-385/75.9 may have occurred in the process of assembly and constructing the genomes. The ITR of both isolates contain the consensus motif CATCATCAAT found in most adenoviruses (Stone et al., 2003). The conserved TATAATACC motif that binds the complex pTP and DNA polymerase during viral DNA replication (Temperley & Hay, 1992) was not present in EAdV2-385/75.4, rather there were insertions in this region. Transcription factor prediction using the Geneious software indicated that the ITR contained conserved sequence motif for the activating transcription factor (ATF) at 38 - 44 nucleotides (GTGACGT) which are involved in the efficiency of viral DNA replication (Fig. 3.3).

3.2.3 Comparative genomic analysis

Computational analysis confirmed both EAdV2-385/75.4 isolates as almost identical to EAdV2-385/75.9 except for the 40 nucleotides in the ITRs at each 5’ and 3’end. It should be noted that in any EAdV2-385/75.4 comparison hereafter, the findings are the same for EAdV2-385/75.9 virus unless otherwise stated.

Comparison of EAdV2-385/75.4 to a range of different adenovirus family members has shown quite distant relationships. The highest percent nucleotide identity is 37.0% with PAdV-5 and SAdV-49, and the lowest of those examined is 26.0% with DAdV-D (Appendix A1). Among human adenoviruses, EAdV2-385/75.4 has shown a maximum percent identity of 58.0% including with HAdV-41 which is commonly associated with acute diarrhea across the world (Reis et al., 2016). Global pairwise whole genome alignment using zPicture graphically complement the sequence data analysis and demonstrate the low level of similarity across the genome (Fig. 3.4).

As already described, the EAdV2-385/75.4 genome had the greatest similarity to EAdV2-385/75.9, with an overall similarity ≥ 99%. The EAdV2-385/75.4 genome had also showed heterogeneity in the ITR region, hORF5, E3 12.5K, E1A, E1B, the fibre and E4 coding regions, compared to other sequences. The pV coding region appears to be the most divergent from those of EAdV-1 and BAdV-B regions (Fig. 3.4) though low similarity is also observed with other species. The analysis, in general, showed that the EAdV-2 genomes have low level of similarity to any other adenoviruses and contains unique regions among the adenovirus genomes.

The E4 region of EAdV2-385/75.4 locates close to the right end of the genome (29,023 to 32,139(c)). Nucleotide sequence analysis identified six ORFs, four of which (ORF6/7, 34K, dUTP/ORFA) are homologues to those occurring in most members of Mastadenovirus genus. Rightward to the dUTP/ORFA gene, 3 hORFs were predicted (hORF1, hORF2 and hORF3), which have no significant homology to any known adenovirus genes in the GenBank. In EAdV2-385/75.4, the E1A transcriptional unit is located close to the left end of the genome with an initiation and termination codons located at nucleotides 2638 and 3042, respectively (Fig. 3.2 and Table 3.2).

Based on sequence comparison to known adenovirus MLP sequences, the putative MLP of EAdV2-385/75.4 was deduced and four late regions (L1 to L4) were predicted; depending on the poly (A) signal used by these mRNAs. Like other adenoviruses, the MLP of the EAdV2-385/75.4 genome has an inverted CAAT box (nucleotides 8067 - 8064), a TATA box (nucleotides 8112 - 8115), an upstream activating element (nucleotides 8084 - 8089), initiator element (nucleotides 8140 - 8145) and two downstream activating elements; DE1 (nucleotides 8229 - 8238); DE2 (nucleotides 8244 - 8259) (data not shown). The L1 transcription unit contains six ORFs including 52K, pIIIa, penton, pVII, pV and pX homologues (Fig. 3.2 and Table 3.2). The putative 52K protein homologue, which is required for virion assembly, is predicted to be 345 amino acids long and showed the highest identity to the corresponding PAdV-5 protein (59.6%) (Table 3.3). Similarly, the predicted penton base protein is 1500 amino acids in length and has shown the highest identity with that of PAdV-5 and TsAdV-1 (73%) as shown in Table 3.3. Protein VI, hexon and the virus encoded protease are predicted to be encoded in the L2 region (Fig. 3.2 and Table 3.2) while the L3 region of EAdV2- 385/73.4 codes for two non-structural (100K and 22K) proteins and one structural (pVIII) protein (Fig. 3.1 and Table 3.2). The 100K protein of EAdV2-385/75.4 is 689 amino acids long and shows 18.6 – 51.9% (Table 3.3) amino acid identities with 100K proteins of other adenoviruses. Protein VIII is predicted to be 215 amino acids in length and shares the highest degree of homology with the corresponding protein from TsAdV- 1 (Table 3.3). One potential protease cleavage site (141LAGG-SRSS) was recognized in EAdV2-385/75.4 pVIII sequence in contrast to two cleavage sites observed in those of HAdV-46 (108LAGA↓G and 154LAGA↓G), PAV-3 (108LAGG↓GALA and 150LGGG↓GRSS) (Reddy et al., 2006; Reddy et al., 1998a).

The predicted EAdV2-385/75.4 hexon protein is 904 amino acids in length. The hexon protein contains neutralisation epitopes for adenoviruses, and this is where EAdV2- 385/75.4 shows a higher degree of amino acid identity to the hexon genes of TSAdV-1 (74.2%) and PAdV-5 (73.8%) than to that of the other equine adenovirus serotype EAdV-1 (70.7% identity). Fibre protein is the only protein encoded by the transcript produced from the L4 region of EAdV2-385/75.4.

3.2.4 Protein homology analysis

Pairwise amino acid sequence identity calculations of the select genes showed highest similarity to TsAdV-1 sequences in most cases, than the human, bovine and porcine adenovirus prototypes, as in Table 3.3. EAdV2-385/75.4 has shown the highest percent amino acid identities of DBP, PTP and DNA polymerase proteins, which are crucial for viral DNA replication, with different adenovirus counterparts. The percentages of amino acid identity were 47.0% (with BAdV-B), 60.5% (TsAdV-1) and 66.9% (EAdV-1) for DPB, PTP and DNA polymerase proteins, respectively (Table 3.3).

3.2.5 Phylogenetic analysis

Phylogenetic analysis of the nucleotide sequence of the full genome of EAdV2- 385/75.4 with representative adenovirus genomes from each genus clearly showed that this adenovirus belongs to the Mastadenovirus genus. EAdV2-385/75.4 was close to EAdV2-385/75.9 and did not form any cluster with any of the other adenoviruses, and instead formed a separate cluster (Fig. 3.5). The grouping of the two adenoviruses in a separate cluster, with high confidence (boostrap 100), underscores EAdV-2 might be a potential parental lineage for other Mastadenovirus members.

To further examine the phylogenetically distinct nature of EAdV2-385/75.4 from other members of the Mastadenovirus genus, individual genes across the genome were examined in detail. Molecular Evolutionary Genetic Analysis (MEGA 6) was used for phylogenetic analysis of DNA polymerase, hexon, penton base, and fibre genes using bootstrapped neighbour-joining trees. Phylogenetic analysis of the DNA polymerase gene has shown EAdV2-385/75.4 is in a subclade separate from other Mastadenovirus species (Fig. 3.6A). As expected, the EAdV2-385/75.4 and EAdV2-385/75.9 DNA polymerase genes group together in this tree and this tree appears similar to that derived from the full genome analysis (Fig. 3.5) as EAdV2-385/75.4 falls in a separate clade.

Figures 3.6B and 3.6D show hexon gene and fibre phylogeny analysis trees, respectively. This shows both hexon and fibre genes grouping is closest to TsAdV-1, though the clade in the fibre gene tree is not as strongly supported by the boostrap value of <50. However, these results are consistent with, and support the findings from, the

68 analysis of amino acid identities which have shown the highest homology with TsAdV- 1 for both gene sequences (Table 3.3).

Phylogenetic analysis of the penton gene showed the closest relationship with the bovine adenovirus, BAdV-B (Fig. 3.6C), with 67% amino acid homology but with a long evolutionary distance indicating a large divergence between them. This result is consistent with the amino acid identity findings.

3.2.6 Penton base, hexon and fibre gene sequence recombination analysis

Given the variability of the location of different EAdV-2 genes within the adenovirus phylogenetic trees (Fig. 3.6A to D), a closer examination of the penton, hexon and fibre coding regions was performed using SimPlot and Bootscan analyses. SimPlot provides plots of the percent similarity of the query sequences to that of the reference sequence (Lole et al., 1999). Bootscan analysis provides the percent of phylogenetic trees that group the similar sequences together. The reference sequence that has been grouped with the query sequence is displayed on the top of the plot.

Bootscan analysis of the EAdV2-385/75.4 provided inconclusive results though it revealed multiple cross over points in the penton and hexon regions with multiple adenovirus genomes (Fig. 3.7B). The peaks in the bootscan did not demonstrate any long stretches of higher values for possible lateral gene transfer events (< 95%) indicating a weaker phylogenetic relationship between the recombinant sequences. SimPlot analyses of the penton region also suggested some levels of identity with that of BAdV-B, and the hexon region with that of PAdV-5 and CSLAd-1 (Fig. 3.7A). Sequences in both regions, however, appear to be less similar (highest 74% similarity) to the parental sequence suggesting recombination has not taken place across different members of Mastadenovirus. These results were supported by RDP analyses, showing no break points in EAdV2-385/75.4 sequences (Fig. 3.8). Given the results from the phylogenetic analyses, it is likely that EAdV2-385/75.4 has accumulated nucleotide changes overtime due to mutation and that this has contributed to divergence from other genomes. It is possible that sequences from other adenoviruses, including undiscovered or known adenoviruses that were not included in these analyses contribute to variations.

Since recombination can occur at any region of the genome, we tested recombination using full genome alignment from diversified animal adenovirus. The analysis did not find statistically significant evidence for recombination (p > 0.05) as shown in Fig. 3.9. We repeated the recombination analysis by excluding the ORF5 and E312.5K (not shown) as well as using split tree decomposition method which tends to infer more resolved graphs (Huson & Bryant, 2006). This analysis is also confirmed that there was no evidence of recombination.

3.3 Discussion High-resolution genome data provides insight into unique and variable features of EAdV-2 The complete 33,010 bp genome of EAdV2-385/75.4 prototype strain was determined. Analysis of the genome sequence identified 31 ORFs with the potential to encode 30 putative proteins. The genome organisation of this virus shows unusual organisation for any known Mastadenovirus, with the most 5’-end containing hORF5 and E312.5K (an E3 gene) instead of E1 genes. A number of features are used to distinguish Mastadenoviruses from members of other adenovirus genera in the 2011 ICTV report (Harrach, 2011). Members of Mastadenovirus genus generally share complement fixing antigen (using traditional serological techniques), contain the unique proteins V and IX, and most of those genes coded by the E1A, E1B, E3 and E4 regions. In addition, they contain a considerably longer and more complex ITR (93 - 371), and a phylogenetic distance of greater than 5 - 15% based primarily on distance matrix analysis of the DNA pol amino acid sequence. In all Mastadenoviruses, a single homologue of the HAdV-2 34K protein exists in the E4 region. EAdV-2 shows no similarity in the location of E3 region and contains the pIX fused to the E1B-55K ORF, and has highly divergent E4 regions. In addition, it showed less than 70% identity (more than 30% distances) to any other DNA pol amino acid sequence, while maintaining genus specific proteins (pV and 34K). Hence, it is proposed that this adenovirus represent a unique species within the Mastadenovirus genus.

The complete genome sequence of the EAdV2-385/75.4 isolate (33,010 bp) was very close to the genome size (33,090 bp) of the EAdV2-385/75.9 isolate (Giles et al., 2015)) from fecal samples. The genomes of the two isolates also shared high homology,

70 although an additional 80 nucleotides were identified in the ITR region by comparison. The high similarity along genome regions of both isolates comes as no surprise as they are originated from the same farm. Also, both isolates were propagated in the EFK cells before sequencing, despite differences in virus recovery and DNA extraction methods. EAdV2-385/75.4 was recovered from cell pellet by sucrose gradient and DNA was extracted using High Pure PCR Template Preparation Kit, while EAdV2-385/75.9 was recovered by polyethylene glycol precipitation and genomic DNA extracted using phenol-chloroform. In this study, next generation sequencing libraries were analysed and sequenced using Illumina MiSeq in contrast to Illumina GA2 sequencing platform used in EAdV2-385/75.9. Moreover, the data assembly for EAdV2-385/75.4 and EAdV2-385/75.9 was performed using Geneious 7.1.9 software and SeqMan NGen software (DNASTAR), respectively. Comparing the two softwares was beyond the scope of this thesis, however, the difference in the ITR region might have occurred during the process of assembly and constructing the genomes, given the high identity between the two genomes.

The ORFs at the 5’ end of EAdV2-385/75.4 genome are distinct from all currently known Mastadenoviruses, which contain E1A transcription unit genes at the most 5’ end of their genome (reviewed in Chapter one and Fig. 1.1). The biological significance of the hORF 5 at 5’end of the genome is not yet known. In the same position as hORF 5, however, the p32 ORF encodes a protein that has a structural role to protect the DNA against harmful environmental conditions (ÉlŐ et al., 2003), and is a unique characteristic of the Atadenovirus genus (Khatri & Both, 1998). The E3 region is located between the genes coding for pVIII and fibre proteins in all members of the Mastadenovirus genus, whereas in members of Atadenovirus genus and snake adenovirus, no homologues of E3 genes could be identified in the same location (Farkas et al., 2002; Vrati et al., 1995) in this region. The functional importance of the predicted E3 12.5K location and the absence of any homologue for E3 transcript gene product at the usual position is yet to be determined. While the E3 region of most of human sub genus C adenoviruses encode seven different proteins, BAdV-3 encodes at least four proteins (Mittal et al., 1992). Nevertheless, the EAdV2-385/75.4 genome contains an additional ORF (hORF 4) in the region which is not a homologue of any E3 genes. The E3 genes products in human adenovirus codes for proteins that are not essential for

71 virus replication in vitro but can interfere with the host immune response (Horwitz, 2004) and could be consistent with persistence in the host and clinical incidence in immunocompromised animals. This feature also places EAdV-2, the only member of the Mastadenovirus genus that does not have E3 region in the expected location, after members of Atadenovirus genus (Farkas et al., 2002; Vrati et al., 1995; Zakhartchouk et al., 2002).

One of the most variable regions among the members of the Mastadenovirus genus is the E4 region (Ursu et al., 2004). Whole genome pairwise alignment of the EAdV2- 385/75.4 E4 region clearly demonstrated a low level of conservation compared to any other E4 regions included. Evolutionary mechanisms such as gene duplication, divergence and functional partition of genus specific genes have been widely used by larger DNA viruses such as adenoviruses for generating new genes (Davison, 2003). Evolution of E4 in Mastadenoviruses has evidently involved duplication or deletion events resulting in variable numbers of genes. This appears to happen in the EAdV2- 385/75.4 E4 region with divergence of hORF 1, hORF 2 and hORF 3. In EAdV2- 385/75.4, less familiar gene such as dUTPases were also identified that showed homology to E4-like genes similar to members of the Aviadenovirus genus (Chiocca et al., 1996) and certain Mastadenovirus members (Weiss et al., 1997) and CSLAdV- 1(Cortés-Hinojosa et al., 2015) suggesting that EAdV2-385/75.4 genetically distinct from other members of the Mastadenovirus genus.

Detailed analysis of selected genome regions

Equine adenovirus 2 revealed only one zinc finger motif (CDCC) and the essential pRb binding motif (LQCHE) at amino acid positions 105 - 108 and 87 - 91, respectively, suggesting that the E1A 14.9K of EAdV2-385/75.4 may have functions similar to those of HAdV E1As. Proteins encoded by ORFs within E1A such as HAdV-5 E1A 249R and 283R have defining characteristics including transactivation domains (zinc finger motif), that is formed by four cysteine residues (CX2CX13CX2C) (Culp et al., 1988) and the retinoblastoma susceptibility protein (pRb) binding motif (LXCXE) (Singh et al., 2005a), respectively.

Interestingly, the 55K ORF is effectively duplicated in EAdV2-385/75.4 unlike in other Mastadenoviruses (Fig. 3.2). The 55K ORF exists as a single ORF, directly upstream of an ORF (55K/pIX) (Fig. 3.2) that contains pIX fused to the second predicted E1B 55K. In HAdVs, the 19K and 55K proteins are involved in preventing virus-induced apoptosis by countering the actions of the E1A proteins (Debbas & White, 1993; Teodoro et al., 1994). The pIX ORF is an exclusive Mastadenovirus characteristic (Fig. 3.2). The E1B region genes are transcribed early in infection, while pIX gene transcription occurs at an intermediate stage. It is possible that a splicing event taking place in the E1B region may have resulted in the formation of the fusion protein between pIX and E1B 55K and possibly expressed early in the infection as a fused form, although no splice-donor sites are predicted (Dogan et al., 2007) with available sequence information. Unpublished reports indicated that a newly discovered splice donor (SD1) interacts with splice acceptor three (SA3) to produce a new E1B splice form encoding pIX in HAdV-5 (Mun, 2014). The new splice form is, however, between pIX and E1B 19K unlike the case in the EAdV2-385/75.4, but it might suggest a possible mechanism for the occurrence of this event.

The E2 region contains ORFs that encode proteins involved in DNA replication including viral DNA polymerase, pTP and DBP. The EAdV2-385/75.4 pol and pTP ORFs encode putative proteins of 1116 and 603 amino acids, respectively (Table 3.2). It has been demonstrated that the sequence motif YSRLRYT in pTP is conserved and plays an important role in protein-primed DNA replication initiation (Hsieh et al., 1990). In EAdV2-385/75.4 pTP, the corresponding conserved sequence; FSRLKYT was found at amino acids 99 to 105 which might play a similar role. Moreover, the common nuclear localisation signal (NLS); 339RLPITRRRRRR and the 528NSGD motif (Fig. 3.10), which are involved in the initiation of DNA replication, are also conserved (Nagy et al., 2001; Smart & Stillman, 1982).

One of the notable features of EAdV2-385/75.4 is the absence of a RGD motif in the penton base which is an integrin (αvβ3 and αvβ5) binding motif required for binding to the host cell in every primate (monkey, ape or human) AdV except HAdV-40 and HAdV-41(Russell, 2009; Wickham et al., 1993). Like EAdV2-385/75.4, the RGD motif is missing from other adenovirus penton sequences including PAdV-3 (Reddy et al., 1998a), BAdV-3 (Reddy et al., 1998b), TSAdV-1 (Schondorf et al., 2003), HAdV-40 73 and 41 (Davison et al., 1993), MAdV-1, 2, 3) (Hemmi et al., 2011; Meissner et al., 1997). In the absence of an RGD motif, an alternative integrin binding motif, LDV, was identified at amino acid positions 267 - 269 (Fig. 3.11). The LDV is a motif known to bind α4β1 and α4β7 integrins (Komoriya et al., 1991), but it not known if this is functionally active in this regard in EAdV-2. In contrast, the fibre-interacting domain (233TRLNNLLGIRKR) was highly conserved with one residue substitutions compared to TsAdV-1 (Schondorf et al., 2003), PAdV-3, 5 (Nagy et al., 2001; Reddy et al., 1998a) and 2 residue substitutions in contrast to EAdV-1 domain (Fig. 3.11).

The other protein that plays a crucial role in virus tropism and the haemagglutination properties of species is the fibre protein. It is predicted to be 474 amino acids in length and shares the lowest and highest amino acid identity with the fibre proteins of RAdV-4 (10.5%) and TsAdV-1 (26.5%), respectively (Tables 3.2 and 3.4). Despite the absence of significant homology, the predicted fibre protein can be divided into three regions where the first 36 amino acids form the tail, the central 255 amino acids form the shaft and last 182 amino acids constitute the fibre knob (Fig. 3.12). The tail contains a conserved amino acid sequence (10DPVYPY) at the N-terminal end of the fibre (Fig. 3.12). This amino acid motif is speculated to be involved in interacting with penton base similar to human adenovirus (Caillet-Boudin, 1989).

Among adenoviruses, the length of the shaft varies greatly due to deletion or insertion of different number of repeats. Such deletion is evident in the EAdV2-385/75.4 shaft region in contrast to the only other equine adenovirus serotype, EAdV-1 (Fig. 3.11), resulting in a relatively shorter fibre protein by at least 302 amino acids. The functional impact of this deletion is unknown, though it has been reported that longer fibre shafts, such as those of HAdV-2 and-5, are sufficiently flexible for better infectivity and attachment (Shayakhmetov & Lieber, 2000). Both viruses have also shown a very low amino acid homology (15.3%) in their fibre proteins (Table 3.3). Unlike most Mastadenoviruses, the EAdV2-385/75.4 fibre shaft lacks a consensus flexibility motif (KLGXGLXFD/N) in the last repeat domain (Darr et al., 2009), and instead contains the amino acid sequence RLGTLGIDFD. Whether this affects the flexibility of the EAdV2-385/75.4 fibre is not known, although the fibre-primary receptor interaction and the length as well as flexibility of fibre shaft are dispensable for viral infectivity and tropism. Taking this into account and the low amino acid identity (27.9%) between the 74 fibre heads of the two equine adenovirus serotypes, EAdV-1 and EAdV-2, it is possible that the EAdV2-385/75.4 fibre binds to a different receptor, perhaps, leading to unique clinical features associated with infection.

Alignment of the repeats of the shaft region (Green et al., 1983) and sequence analysis as described for HAdV-2 and PAdV-5 (Nagy et al., 2002; van Raaij et al., 1999), has shown a predicted 16 repeats, containing about 15 amino acid each, with a well conserved hydrophobic glycine (G) or proline (P) residues at position of 10 of the beta sheet/beta turn model (Green et al., 1983) (Fig. 3.13). The predicted repeats in EAdV2- 385/75.4 closely resemble in number to those in the PAdV-5 fibre shaft which contains 19 repeats (Nagy et al., 2002). In comparison, it is much shorter than fibre shafts of BAdV-3 that is predicted to contain 42 repeats (Mittal et al., 1992). The head/knob of the Mastadenovirus fibre has a characteristic well-conserved TLWT motif, marking the beginning of the fibre head (Green et al., 1983; Xia et al., 1994). The consensus motif, TLWT in amino acid sequence of EAdV2-385/75.4 fibre might be important for trimerisation of the fibre protein (Hong & Engler, 1996). The equivalent sequence in EAdV-1 was TRWT (Fig. 3.13).

Phylogenetic place of EAdV2-385/75.4

Detailed phylogenetic analysis of selected proteins using nucleotide sequences have shown that the tree topology of EAdV2-385/75.4 varied depending on the ORFs being tested. Analysis based on full nucleotide sequence and DNA polymerase, showed that EAdV2-385/75.4 did not form any cluster with any of the adenovirus sequences included and instead formed a separate cluster (Fig. 3.5 and 3.6A). As the full EAdV2- 385/75.4 genome formed a subclade with a robust bootstrap value (100), it is phylogenetically distinct from other sequenced members of the Mastadenovirus genus (Fig. 3.5). Pairwise alignment of the whole genome to phylogenetically related adenoviruses also identified areas of sequence divergence in both extreme ends including the fibre gene, supporting the findings from phylogenetic analyses. The high level of full genome nucleotide distance (60% being the lowest distance), compared to the other adenoviruses used for comparison in this study, further suggests that EAdV2- 385/75.4 is a distinct species within the Mastadenovirus genus. These trees suggest that other members of the Mastadenovirus genus might evolve from EAdV2-385/75.4.

Surprisingly, analysis based on the hexon and fibre genes, the main structural proteins of adenovirus and immunogenic determinants, indicated that EAdV2-385/75.4 had a closest relationship to TsAdV-1, forming the same clade, raising questions for possible recombination events. In contrast, the penton base sequences revealed that EAdV2- 385/75.4 was most closely related to BAdV-B. The fact that EAdV2-385/75.4 is serologically distinct from the EAdV-1 was also fully supported by the phylogenetic and genetic differences they demonstrated in this work.

As the data from the protein percent identities and phylogenetic trees suggest EAdV2- 385/75.4 is more closely related to adenoviruses that infect hosts more distantly related to horses, a detailed examination of the EAdV2-385/75.4 penton, hexon and fibre coding for any possible recombination events were assessed. Recombination is a common event in the hexon and fibre genes that are prone to immune pressure from the host, especially between closely related serotypes that are grouped into a common species (Dehghan et al., 2013; Robinson et al., 2013; Walsh et al., 2009; Walsh et al., 2011). It is one of the most important factors driving the evolution of AdVs. Simplot software, RDP and SplitsTree4 analysis did not show any significant recombination events in those regions. One possible explanation for this finding could be that mutation rather than recombination plays an important role for genetic variation. It has been observed that mutation plays the predominant role for genetic diversity of HAdV-B genomes, unlike those of HAdV-D species, in which recombination is more important than mutation rates (Robinson et al., 2013). The other possible explanation could be recombination among viruses infecting different host species is unlikely to reshuffle their sequences. It also possible that those adenoviruses that played a key intermediate role are not yet discovered or included in the analyses. In a rare case, however, recombination between more distantly related types, even between members of different genera, can happen. Sequences analysis of PAdV-5 fibre gene indicated a recombination event in this region (Nagy et al., 2002). Conserved amino acid sequences of Mastadenovirus origin were identified in the tail and the shaft of the PAdV-5, whereas the sequence of the fibre knob showed a characteristic protein sequence from the corresponding part of Atadenoviruses. Our studies suggested that EAdV2-385/75.4 possibly serves as parental genome sequence for other adenoviruses that accumulated nucleotide changes and differences could be as a result of changes in host specificity.

Table 3.1: General properties of the EAdV2-385/75.4 genome compared to other equine adenovirus isolates.

Virus G+C Genome ITR size (bp) Reference Content (%) Size (bp) EAdV2-385/75.4 48% 33,010 213 This study EAdV2-385/75.9a 48% 33,090 253 Giles et al., 2015 EAdV-1.M1b 59.9% 103 Cavanagh et al., 32,690 2012 a EAdV2-385/75.9 genome sequence GenBank number NC027705 b EAdV-1 genome sequence GenBank number JN418926.

Table 3.2: Summary of predicted transcriptional and translational features of EAdV2-385/75.4 genome.

Region Gene Product Location Protein length(aa) Poly (A) signal(s) hORF 5 490 - 1,944 485 283 (C), 288(C), 453(C) E3 E3 12.5K 1,922 - 2,284 121 ND E1A E1A 14.9K 2,638 - 3,042 135 6173 E1B E1B 19K Protein 3,214 - 3,630 139 E1B 55K protein 3,573 - 4,736 388 E1B pIX /55K 5,107 - 6,144 346 E2A DBP 22,603 - 23,913 437 22,573(C) E2B pTP 10,540 - 12,348 603 6191 (C) DNA Polymerase 7,268 - 10,615 1116 E3 hORF 4 27,093 - 27,371 93 27,368 E4 ORF6/7 29,023 - 29,157 45 29,013 (C) 34K 29,221 - 29,985 255 dUTPase/ORF A 29,996 - 30,787 264 hORF 3 30,771 - 31,205 145 hORF 2 31,258 - 31,662 135 hORF 1 31,747 - 32,139 131 Intermediate IVa2 Protein 6,180 - 7,220 445 6191 (C)

Table 3.2: Contd… Region Gene Product Location Protein length(aa) Poly (A) signal(s) L1 52K 12,410 - 13,482 345 18343, 18408 pIIIa 13,488 - 15,167 560 Penton 15,221 - 16,720 500 pVII 16,736 - 17,155 140 pV 17,182 - 18,084 301 pX 18,097 - 18,351 85 L2 pVI 18,429 - 19,166 246 22,559 Hexon 19,219 - 21,930 904 Protease 21,955 - 22,563 203 L3 100K 23,925 - 25,991 689 27,068 22K 25,798 - 26,286 163 pVIII 26,425 - 27,069 215 U exon 27,380 - 27,559 60 ND L4 Fibre 27,561 - 28,982 474 28,978 Note: C, coded on complementary strand. ND, data not determined.

Table 3.3. Percent amino acid identities of selected EAdV2-385/75.4 proteins with their homologues from other adenoviruses.

Genus Adenoviruses DBP pTP pol IVa2 52K pIIIa penton pVII Mastadenovirus BAdV-B 47.0 53.2 66.0 66.0 49.6 49.3 67.0 40.7 CSLAdV-1 39.9 51.5 53.6 21.1 52.8 50.3 62.1 36.8 EAdV-1 39.3 58.5 66.9 66.9 52.9 47.9 63.7 36.1 HAdV-2 31.3 56.9 59.3 59.3 48.9 50.1 53.8 35.1 PAdV-5 43.8 59.3 62.9 62.9 59.6 50.2 73.4 30.6 TSAdV-1 39.3 60.5 57.8 57.8 58.3 52.3 72.9 47.9 Atadenovirus OVAdV-D 30.7 29.8 39.4 39.4 23.8 26.7 52.1 22.9 Siadenovirus RAdV-4 23.3 25.4 31.7 31.7 19.9 20.7 45.8 23.3 Aviadenovirus TAdV-4 18.8 30.5 35.6 35.6 23.4 21.3 40.6 20.3 Genus Adenoviruses pV pX pVI Hexon Protease 100K pVIII Fibre Mastadenovirus BAdV-B 21.4 52.5 32.6 67.5 63.4 42.2 53.2 13.4 CSLAdV-1 53.6 58.6 52.8 66.0 58.9 50.4 52.5 25.1 EAdV-1 19.8 NA 35.9 70.7 61.0 48.4 53.9 15.3 HAdV-2 29.6 43.8 42.8 67.1 60.9 43.1 54.2 21.4 PAdV-5 28.5 54.9 42.4 73.8 60.9 48.4 64.0 13.9 TSAdV-1 29.0 58.0 51.9 74.2 57.4 51.9 63.3 26.5 Atadenovirus OVAdV-D NA 34.8 17.5 52.8 36.1 30.2 26.4 15.1 Siadenovirus RAdV-4 NA 24.6 20.2 50.5 44.6 31.4 19.8 10.5 Aviadenovirus TAdV-4 NA 17.8 21.3 45.3 46.5 18.6 19.9 12.3 NA, Data not available. Percent identities were calculated using MEGA 6 (Tamura et al., 2013).

Figure 3.1: Transmission electron micrograph of sucrose gradient purified EAdV2- 385/75.4 virion after negative staining (magnification x 166,000). The icosahedral capsid structure is typical of members of the family Adenoviridae.

Figure 3.2: Genomic organisation and putative transcription map of EAdV2-385/75.4 genome. The genome is represented by a central black horizontal line marked at 5 kbp intervals. The complete genome size is 33,010 bp and encompasses the right (above central solid line) and left (below central solid line) strands. The predicted protein-coding regions and ORFs are denoted as blue arrows, where broken lines indicate introns and arrowheads represent polyadenylation signals and indicate the direction of transcription. The MLP is indicated by downward arrow. Early (E1 – E4) and late (L1 – L4) transcription regions are indicated by square brackets.

Figure 3.3: Inverted terminal repeats alignment of selected adenoviruses at the 5’ end of the genome. Core origin and the activation transcription factor motifs (ATF) are marked. The first 40 nucleotides in the published sequence of EAdV2-385/75.9 is the region that was not detected in EAdV2-385/75.4 while other regions are 100% identical.

Figure 3.4: Pairwise genome comparative analysis between EAdV2-385/75.4 and EAdV2-385/75.9, BAdV-B, HAdV-41, PAdV-5, EAdV-1 and TsAdV. The analysis has shown a low level of similarity across the length of the genome with a major divergence at the end of the genomes, corresponding to ITR, hORF5, E3 12.5K, E1A, E1B, fibre and E4 regions. With the exception of HAdV-41, only adenoviruses phylogenetically closest to EAdV2-385/75.4 were included in this analysis. The zPicture pairwise sequence alignment and visualisation tool (Ovcharenko et al., 2004) was used to investigate the areas of greatest interspecies diversities with a default search window of 100 bp. The y axis (scale, 50 to 100%) provides the percent identities between genomes, with peaks showing regions with more than 50% sequence identity. The x-axis indicates the nucleotide alignment position on the EAdV2-385/75.4 genome. The evolutionary conserved regions (ECR) are indicated by the red peaks.

Figure 3.5: Phylogenetic analysis of the EAdV2-385/75.4 genome. This analysis has shown EAdV2-385/75.4 belongs to the Mastadenovirus genus and forms a separate cluster within this genus. The phylogenetic tree was generated after multiple nucleotide sequence alignments using the MAFFT (Katoh et al., 2002) using Geneious software (Kearse et al., 2012) and default parameters. A neighbour-joining algorithm (Saitou & Nei, 1987) was used to determine the phylogenetic relationships of the EAdV2-385/75.4 full genome with a maximum-composite-likelihood model (Tamura et al., 2004). Bootstrap numbers (values above 50) shown at the nodes indicates the percentages of replicate trees, in which the associated taxa clustered in the boostrap test (1000 replicates). The scale bar is in units of nucleotide substitutions per site. The evolutionary analysis was conducted using Molecular Evolutionary Genetic Analysis software (MEGA v6) (Tamura et al., 2013).

Figure 3.6: Phylogenetic analyses of EAdV2-385/75.4 using (A) DNA polymerase, (B) hexon, (C) penton and (D) fibre genes. The phylogenetic tree was generated after multiple nucleotide sequence alignments using the MAFFT software (Katoh et al., 2002) with default parameters. A neighbour-joining algorithm (Saitou & Nei, 1987)) was used to determine the phylogenetic relationships with a maximum-composite- likelihood model (Tamura et al., 2004). Analysis have shown that EAdV2-385/75.4 forms a separate cluster within the Mastadenovirus genus based on DNA polymerase gene, and is also related to BAdV-B and TsAdV-1 based on penton, hexon and fibre genes, respectively. Bootstrap numbers (values above 50 are shown) at the nodes indicates the percentages of replicate trees, in which the associated taxa clustered in the boostrap test (1000 replicates). The scale bar is in units of nucleotide substitutions per site. The evolutionary analysis was conducted using Molecular Evolutionary Genetic Analysis software (MEGA v6) (Tamura et al., 2013).

Figure 3.7: Nucleotide sequence recombination analysis of concatenated hexon, penton and fibre genes of EAdV2-385/75.4. The concatenated sequences were analysed for recombination events with other closely related animal adenoviruses using Simplot software and bootscan. MAFFT software was used to align the sequences prior to recombination analysis. For Simplot (A) Bootscan (B) graphs, the following settings were used: window size, 500; a step size 50; 100 replicates used; gap stripping, on; Kimura distance model; and neighbour-joining tree model. Genome nucleotide positions are noted along the x-axis, and the percentages of permutated trees that supported grouping are marked along the y-axis. For reference, gene-specific landmarks are noted above the graphs. colors: Red, BAdV-B; Green, CSLAdV-1; yellow, EAdV-1; black, PAdV-5 and Pink, TsAdV-1.

Figure 3.8: Analysis of recombination events in EAdV2-385/75.4. Schematic representation indicates the recombination events in adenoviruses analysed by RDP4 package with p-value < 0.05. Continuous lines indicate no recombination. Analysis was performed on sequences closely related on phylogenetic analysis in Fig. 3.5, with exception of HAdV-5.

Figure 3.9: Recombination analysis of EAdV2-385/75.4. The phi-test for recombination did not find statistically significant evidence for recombination (p = 1.0). Networks were constructed using the NeighborNet method, uncorrected character transformation and the Kimura two- parameter model, implemented in with the splitTree4 software (V.13.1) (Huson & Bryant, 2006).

Figure 3.10: Multiple alignments of pTP homologues. Amino acids sequences of different animal and human adenoviruses were aligned using MAAFT of Geneious software (Katoh et al., 2002), employing default parameters. NLS (RLPITRRRRRR) and the NSGD motif are well conserved as shown (black boxes) and may be involved in the initiation of DNA replication. Only amino acids alignment regions containing NLS and NSGD motif were shown. Identical residues are coloured. Dashes indicate gaps.

Figure 3.11: Multiple alignments of penton base homologues. Amino acids sequences of different animal and human adenoviruses were aligned using MAAFT (Katoh et al., 2002) of Geneious software, employing default parameters. Only amino acids alignment regions containing fibre interacting domain and LDV motif were shown. The integrin interacting domain, RGD domain, is absent but contains LDV (top small black box) indicating EAdV2-385/75.4 penton might interact with a different group of integrins. Identical residues are coloured. Dashes indicate gaps. Conserved fibre-interacting (large black box) and integrin’s interacting, RGD (lower black box), domains are indicated by boxes.

Figure 3.12: Pairwise alignments of fibre homologues. Amino acids sequences of EAdV2-385/75.4 and EAdV-1.M1 were aligned using MAAFT (Katoh et al., 2002) of Geneious software, employing default parameters. The alignment has shown a conserved, PVYPY sequence, which might be involved in an interaction with penton. A large section of deletion (18 to 355 aa) in EAdV2-385/75.4 fibre indicated by the dashes. Identical residues are coloured. Penton base interacting domain (upper box) and N-terminus of fibre head (lower box), TLWT, sequences are indicated. Dashes indicate gaps.

Figure 3.13: Alignment of the 16 repeats in EAdV-2.385/75.4 fibre protein shaft. The alignment and analysis were performed using MEGA (Tamura et al., 2013) as described previously (Green et al., 1983). The sequences analysis predicted that EAdV-2.385/75.4 fibre protein contains 16 repeats in its shaft region. The pseudo repeats of the shaft region are numbered on the left. Residues forming β - strands are indicated with β. hydrophobic residues (green) are indicated and conserved glycine or prolines forming the turns (orange, except the corresponding residue in shafts 4, 11, 13, 14, 15) are shown. The consensus sequence for proline and glycine repeats are indicated (bottom) (φ is hydrophobic). The structural domains tail, shaft and head (knob) are marked.

CHAPTER FOUR

DETECTION OF EQUINE ADENOVIRUS FROM FAECAL SAMPLES FROM

FOALS WITH DIARRHEA

4.1 Introduction

This chapter describes the development and validation of a quantitative PCR assay and the detection of EAdV-2 from faecal samples.

While there are only limited data available on methods for the detection EAdV-2, diagnosis of adenovirus infections in general can be achieved by virus isolation in cell culture, antigen detection, and adenovirus DNA detection by PCR. Equine adenovirus 2 is highly host cell specific and grows readily in cells of equine origin to produce CPE (Bell et al., 2006; Savage et al., 2013). Isolation of animal adenovirus, including EAdV- 2 from faecal materials, may require extended incubation times and several blind passages before CPE is detected (Ishibashi & Yasue, 1984). Serology has also been used to diagnose adenovirus infections. A range of assays including immuno- precipitation, complement fixation, HI, and SN assays have been used for the detection of antibodies, although HI and SN are the more commonly reported assays (Giles et al., 2010; Harden et al., 1974; Horner & Hunter, 1982; Studdert & Blackney, 1982). Studies that compared ELISA with SN tests for the detection of antibodies to adenoviruses in horses found that the ELISA was not as sensitive as the SN assay, and cross-reactivity between antibodies to EAdV-1 and EAdV-2 was observed when samples with high antibody titres were tested (Giles et al., 2010). Currently, serotype identification of equine adenovirus is performed by SN and/or HI which requires type specific hyperimmune sera. Hence, development of molecular methods such as PCR with serotype specific primers would help in differentiating the two serotypes in a timely manner. The introduction of PCR-based assays has resulted in more rapid, specific, and highly sensitive adenovirus detection. For equine adenoviruses, a conventional assay using type-specific primers has been described and used for diagnostic purposes (Dynon et al., 2001). The development of qPCR not only will expand the capabilities toward higher sensitivity and accurate quantification of viral loads in a reproducible and high

96 throughput manner but also provide information relating to viral load and how that may be associated with parameters such as the severity of the clinical signs.

The aims of this study were to develop a quantitative real time PCR targeting the hexon gene of EAdV-2 and to determine the performance of the assay for the detection of EAdV-2 in faecal specimens.

4.2 Results 4.2.1 EAdV-2 primer design and optimisation

The primers were designed to be specific for EAdV-2. In silico analysis using the GenBank database did not show any significant matches between the EAdV-2 primer pair and any other equine viruses or other related organisms. The conditions of the PCR assay were optimized by titration of MgCl2 concentration (1.9 to 3.8 mM/reaction) and using different primer ratios (1:1 to 1:5, F:R) (0.21 µM to 1 mM/reaction). While amplicon production was detected at all MgCl2 concentrations and at all primer ratios

(Table 4.1), the amplification with MgCl2 at 1.9 mM and 1:1 primer ratios resulted in specific amplification with the lowest Cq values. While the 1:5 and 5:1 primer combination produced the lowest Cq values (Table 4.1), these ratios also resulted in positive non-template control (NTC) values (Cq = 36 and 38, respectively). The 1:1 forward and reverse primer ratio (0.21 µM/reaction each) was chosen as optimal because this ratio represented the lowest primer concentration that reproducibly yielded a low Cq value while retaining negative NTC. The specificity of the amplification was determined by amplicon sequencing, which was 100% identical to the expected EAdV2-385/74.4 (Reubel & Studdert, 1997) and the best PCR conditions obtained were those described in section 2.7.4.

4.2.2 Quantitative PCR performance

The linearity and efficiency of the SYTO9 real-time PCR (Sections 2.7.4 and 2.7.6) were determined by generating a standard curve using serial 10-fold dilutions of EAdV2-385/75.4 hexon gene amplicon plasmid DNA (Section 2.7.5). The resulting slope had a linear relationship between Cq and template DNA between 2.7 x 108 and 2.7

97 x101 copies per 20 µl reactions (Fig. 4.1A). The assay had an average efficiency of 103.4% with a correlation coefficient (R2) of 0.992 and slope -3.32 (Fig. 4.1A and B) from three independent assays.

The end point limit of detection (LOD) on the standards was 27 copies/reaction (Fig. 4.1A). This detection limit corresponded to a Cq of 38.00 (Caraguel et al., 2011) thus, samples with a Cq > 38.00 were reported as not quantifiable.

A single, distinct amplicon melting peak was observed for the EAdV-2 standard plasmid dilution at approximately 83.5oC. This was confirmed by melting (dissociation) curve analysis (Fig. 4.1C), showing the formation of single PCR product. No template controls did not produce specific peaks on melting curve analysis, nor was non-specific product observed on agarose gel electrophoresis (data not shown).

To compare the sensitivity of this EAdV-2 specific qPCR with that of the standard PCR for EAdV-2 detection (Dynon et al., 2007), both the qPCR and PCR were performed using 10-fold serial dilutions of DNA extracted from EAdV2-385/75.4 virus of known 8.2  infectious virus titre (10 TCID50/ml). This direct comparison shows that SYTO 9 qPCR assay can detect 10-fold less DNA (0.08 TCID50/ml equivalents per reaction) than the conventional PCR (0.8 TCID50/ml equivalents per reaction) as shown in Fig. 4.2. Hence, the qPCR based assays appear more sensitive than the conventional, for the detection of EAdV-2.

The qPCR assay was able to detect EAdV2-385/75.4 and EAdV2-385/75.9 viruses from infected tissue culture supernatants. No positive results were obtained from the DNA of other equine viruses tested (Fig. 4.3). These viruses include a panel of common equine digestive and respiratory tract viruses. Furthermore, the nucleotide sequence of the products obtained from EAdV2-385/75.4 plasmid amplification verified the specificity of the target.

4.2.3 Reproducibility and repeatability

The intra- and inter-assay reproducibility was evaluated using the serial dilutions of the recombinant plasmid (Table 4.2). The intra-assay coefficient of variation (CV) that was

98 obtained ranged between 0.31 and 2.73% for the all recombinant plasmid concentrations tested (Table 4.2). The inter-assay CVs for all recombinant plasmids were between 1.17 – 3.51% (Table 4.2). These results indicated high reproducibility and repeatability between and within assays at all dilutions.

4.2.4 Effects of template dilution on detection of EAdV2-385/75.4 in faeces and PBS

In order to investigate the effects of PCR inhibitors in clinical samples, known EAdV-2 negative faecal samples and a no faeces (PBS) control were spiked with EAdV2- 385/75.4 infected tissue culture supernatants in ten-fold dilutions. Ten-fold dilutions were made after DNA extraction using QVREK and the percentage of DNA detected over the spiked PBS values was determined. The copies of the EAdV2-385/75.4 detected in samples spiked with faeces were variably affected by PCR inhibitors and extraction. The percentage of DNA detected in spiked faeces ranged from 80.1% to 87.6% of the amount of DNA detected in spiked PBS (Fig. 4.4). In 1/10 and 1/100 diluted faeces, the target copy number detected were lower than the undiluted faeces by at least 1.5% (equivalent to 0.1 log10 copy number) and 7.5% (0.5 log10 copy), respectively. A higher detection percentage was observed in undiluted faeces (87.6%) compared to the subsequent dilutions (1/10 and 1/100) (86.1 and 80.1%, respectively) in faeces, indicating template dilution after DNA extraction did not improve detection of EAdV2-385/75.4 (Fig. 4.4).

4.2.5 Effects of extraction and sample pre-treatment on detection of EAdV-2 in spiked faeces and PBS

Faecal samples are known to contain a high concentration of PCR inhibitors and it is important to choose an extraction method accordingly. While there are a range of commercial extraction kits and methods available for extraction of faecal samples (InnuSPEED Stool DNA kit, NucleoSpin®Virus, the Qiagen Stool DNA Kit or the QIAmp Viral RNA Mini Kit, PowerSoil® DNA isolation kit), many of these are optimised for samples from human faeces. Being from herbivores, equine faeces consists of mostly plant based matter, and several other studies have shown the PowerSoil DNA extraction kit to provide a useful method of extraction of DNA from such samples (Iker et al., 2013; Metzler-Zebeli et al., 2016; Reischer et al., 2013).

Faecal samples might be also a barrier for accurate qPCR detection if the optimum sample matrix pre-treatment is not used. Thus, we compared EAdV-2 detection from two sample matrices to determine the optimal dilution of faecal samples required for detection of EAdV-2 in clinical samples. As shown in Fig. 4.5, there were no significant difference in the mean DNA copies detected between spiked faeces and PBS when they are undiluted (p = 0.14) and diluted at 1/2 (p = 0.06). The mean log viral copy ± standard deviation (mean ± SD) in the undiluted faeces (4.46 ± 0.04) was similar to that of spiked PBS (4.55 ± 0.03). The undiluted faecal samples would likely have the highest level of inhibitors and hence lower level viral copies than the PBS sample. However, on subsequent dilutions, significantly higher concentration of viral DNA was detected in faeces than PBS (p < 0.05) (Fig. 4.5). The mean difference DNA copies/reaction was 0.34 (95% CI: 0.23 - 0.45), 0.53 (95% CI: 0.42 - 0.64) and 0.53 (95% CI: 0.30 - 0.76) for four-fold, eight-fold and sixteen-fold dilutions, respectively. The overall results indicated that dilution of the faecal sample before DNA extraction will improve the efficiency of detection of EAdV-2 in this qPCR.

Dissociation curve analysis of qPCR products from spiked faeces and PBS showed a specific single peak at Tm 83°C (Fig. 4.6A). There was no specific peak for the extraction controls and NTC, except in one replicate of un-spiked faeces.

Considering the pilot extraction study results, faecal samples from a case-control study of foal diarrhea were diluted to 16% (w/v) prior to extraction using the PowerSoil-htp™ 96 Well Soil DNA Isolation Kit. Older archived faecal samples were diluted to 50% (w/v) and a faecal suspension was made prior to DNA extraction using and phenol- chloroform extraction method, respectively, with aim to minimize inhibitor carry over (Section 2.7.9). Subsequently, the DNA extracts were tested using qPCR with the PCR conditions described in section 2.7.4.

4.2.6 Faecal specimens from diarrheic foals

The EAdV2-385/75.4 specific qPCR assay was applied to a case control set of samples (Section 2.7.9) containing 313 faecal specimens from three groups of foals including

100

168 with diarrhea, 119 non-diarrheic foals, and 26 foals admitted to hospital. A low level of EAdV-2 DNA was detected in four of the 168 specimens (2.4 %) from the diarrheic cases (mean age 24 days) and one specimen from the non-diarrheic foals (0.8%) (Fig. 4.7 and Table 4.3). The mean viral copies in positive samples range from 1.53 x 101 to 2.65 x 101 (Table 4.2).

4.2.7 Comparison of EAdV2-385/75.4 detection by qPCR and conventional PCR from archived faecal samples

Using archived faecal samples collected between 1990 and 1995 (Browning & Begg, 1996), the prevalence of EAdV-2 was previously examined in a subset of these samples (n = 40) by conventional PCR, where six of the 40 samples were positive for EAdV-2 (15%) (Reubel, 1996). Given that this is a much higher proportion of positives than detected in the case-control study samples (Section 4.2.6); the EAdV-2 qPCR was therefore also applied to this archive of samples, although a different sub-set of samples were used compared to those used previously (Reubel, 1996). As in the conventional EAdV-2 PCR study (Reubel, 1996), samples for the qPCR were extracted using phenol- chloroform. Five (6.7%) samples were positive by qPCR and none of these by the same conventional PCR used by Reubel (1996). None of the tested samples were positive by conventional PCR (Table 4.4). All positive samples detected by qPCR presented a fluorescence signal and Cq values between 31.0 and 37.4 (Table 4.4). Equine adenovirus-2 amplicons displayed melting temperatures (Tm) between 82.6 and 84.7°C for positive samples (83.2 ± 0.4°C). The viral copy number as measured by qPCR for positive samples ranges between 4.1 x 102 and 1.05 x 105 viral copies per reaction (Table 4.4), indicating very low viral load in the faecal specimens.

4.3 Discussion

To date, the use of quantitative PCR for the detection of equine adenovirus has not been reported. Sensitive and specific detection of EAdV-2 is essential to differentiate the virus from EAdV-1 and to assist in control. Despite EAdV-2 associations with gastrointestinal infections, limited data is available on EAdV-2 prevalence in horse populations. Any epidemiological investigation of EAdV will be reliant on sensitive and specific nucleic acid detection assays. A qPCR assay offers a higher sensitivity than

101 either the traditional labour intensive serologic assays or conventional PCR, allowing savings in both time and reagents.

In this study, an optimised quantitative PCR assay was developed to amplify a 109 bp fragment of EAdV-2 hexon gene using SYTO®9 for detection and specific identification of EAdV-2 nucleic acid in equine faecal samples, and for efficient and rapid screening of samples on a large scale. The hexon gene was targeted because there is considerable nucleotide sequence disparity between EAdV-2 and EAdV-1 in this region (Reubel & Studdert, 1997). The SYTO®9 chemistry has been chosen for this assay because of its relative low cost compared to TaqMan, chemistry which helps to limit the cost of testing large numbers of samples and allows a post-amplification verification of specificity of the amplicon. It also provides an advantage in allowing the use of only two primers. With the limited number of available EAdV-2 isolates for testing, the potential for sequence variation across this region is not properly understood, although it is known to contain some sequence variation among EAdV-1 strains and among other adenoviruses.

The developed assay was highly reproducible and capable of detecting low concentrations of EAdV-2 and showed satisfactory amplification efficiency and linearity. The high efficiency of the primers was also corroborated by the low intra- and inter- assay variations of less than 5%. The CVs of Cqs ≤ 3% and ≤ 5% for intra-assay and inter-assay variability, respectively, are considered acceptable (Moens et al., 2009; Muller et al., 2012). In addition, a qPCR assay allows post-amplification handling of samples to be avoided, in contrast to the conventional PCR which is currently used for diagnostic purposes. This assay would expand capabilities towards higher sensitivity and accurate quantification of viral loads in a reproducible and high throughput manner.

Arguably among the most critical performance characteristics for an assay is that related to the minimum amount of target that can be detected. Limit of detection for qPCR methods can be estimated from analysis of replicate standard curves (Burns & Valdivia, 2008). In this study, end-point analysis using serially diluted standards showed a LOD of approximately 27 copies of the genome/reaction that corresponded to a Cq of 38. Any Cq value above this defined limit would, therefore, be considered not reliable when they can be still detected. Commonly, high Cq values (Cq > 35) are interpreted as 102 fluorescence artifacts, or cross contaminations or non- specific amplification such as primer dimer (Burns (Burns & Valdivia, 2008; Caraguel et al., 2011). Investigation of products at Cq ≤ 38 using melting curve analysis methods did not show any non- specific products verifying absence of fluorescence artifacts.

The results obtained from examining the analytical sensitivity and specificity of the EAdV-2 primers was also confirmed by amplification of the target gene from clinical samples. In addition, no cross reactivity was observed when the assay was tested against DNA from selected equine viral pathogens, including the closest serotype, EAdV-1, indicating a high analytical specificity and capability in differentiating EAdV-2 from EAdV-1 (Fig. 4.3). The sensitivity of the qPCR assay is equivalent to the qPCR assay previously described in other animals and human adenoviruses (Balboni et al., 2015; Romanova et al., 2009; Watanabe et al., 2005) and ten times more sensitive than the conventional PCR (Dynon et al., 2001). The short amplicon in the qPCR assay used in this study likely resulted in more efficient amplification and higher analytical sensitivity.

Dilution of samples to minimise the inhibitory effects in faecal samples is a well- established method. However, dilution can lead into false-negatives by diluting the target gene concentration below the detectable limits of the assay. Our results have shown that EAdV-2 was detectable in spiked faecal samples to a maximum of 87.6% of spiked PBS by qPCR, following extraction using Qiagen viral RNA extraction kit. This indicated the inherent inhibitory effects of faecal samples in addition to DNA losses during the extraction. In one study, the direct qPCR results revealed only 0.3 - 9.5% of the spiked human adenovirus were detectable, resulting from DNA loss occurring at the extraction step (Bonot et al., 2010). Results from another study using a different extraction kit, including the QIAamp viral RNA mini kit, indicated a substantial loss of

DNA equal to or greater than 3log10 in stool samples spiked with adenovirus (Iker et al.,

2013). In the present work, up to 1log10 DNA loss was observed due to extraction process and possibly by inhibitors (Fig. 4.4). Therefore, LOD values presented in this qPCR assay should be interpreted in light of this knowledge. It should be noted that further dilution of the template significantly reduced the recovery rate (80.1%) in spiked faeces, indicating template dilution did not improve detection of EAdV-2 and inhibition of the qPCR was not a significant limitation. 103

With the intent of developing optimum sample pre-treatment to improve sample LOD values and address DNA losses during extraction, we compared the mean copy number of EAdV-2 detected in EAdV-2 spiked faecal samples in two-fold dilutions before DNA extraction using the high throughput DNA extraction kits normally used for DNA extraction from soil. The results from these experiments showed significant improvements when samples were diluted more than 1/2 prior to extraction (p < 0.05). The detection of higher copies of the virus spiked in faeces when compared to PBS was not expected, since in previous experiments, EAdV-2 spiked faeces have indicated the presence of inhibitors and low DNA extraction efficiency (Fig. 4.4). The reason behind this difference is not known, but shows the soil DNA extraction kit provided more efficient extraction or PCR inhibitor removal, consistent with other adenovirus studies (Iker et al., 2013). Taken together, this study showed the optimal method for extraction of suitable template DNA from equine faecal samples for EAdV-2 qPCR is that the sample should be diluted between 1/2 and 1/8 to get the maximum viral copy number with minimal inhibitory effects. These conditions were used for subsequent studies faecal where 1/6 w/v (case samples) and 1/2 w/v (archived samples) faecal suspensions were used.

Even though the role of EAdV-2 in enteric disease has not been shown experimentally, adenoviral enteritis was described in a foal with a history of diarrhea and progressive weight loss (Corrier et al., 1982). The results presented in this chapter showed the presence of EAdV-2 DNA in 2.4% (4/168) of diarrheic and 0.8% (1/119) (Fig. 4.7) non- diarrheic foals, with a mean viral copy number of 2.4 x 101 in all positive samples. Despite the case-control nature of the samples used in this investigation, no association between the detection of EAdV-2 and occurrence of diarrhea could be determined due to the low number of positive samples. The detection of viral DNA from one non- diarrheic foal is not surprising, since these viruses have been isolated from normal faeces (Benfield, 1990), which may have been the source for positive EAdV-2 PCR signal. In one study carried out using PCR in human adenovirus, 18% (9/50) and 25% (12/50) of specimens from the healthy and sick adults were found positive for adenovirus in stool specimens, respectively (Allard et al., 1992).

Given the low number of EAdV-2 positive samples in the case-control set, the feasibility of the qPCR was assessed and compared to conventional PCR by testing a 104 separate, archived set of equine faecal samples (Browning & Begg, 1996). Extraction of DNA from these faecal samples using phenol-chloroform have shown improvements in the detection rates, in which the qPCR has showed higher number of positive results (6.7%) (Table 4.4). Previous analyses of samples from the same set had shown 6/40 (15.0%) samples EAdV-2 positive after phenol chloroform extraction (Reubel, 1996). The observed decrease in detection could be attributed to storage time and individual samples included for analysis, as no records were available for the individual samples used in the study by Reubel (Reubel, 1996). Nevertheless, this finding together with serially diluted spiked sample data suggested that the qPCR appeared to be superior for detection of EAdV-2 although additional work would need to be performed to comprehensively compare the diagnostic sensitivity and specificity on a wide range of freshly obtained specimens between the two methods. In addition, it is suggested that this assay should be used as priority for detection of EAdV-2 in the future.

Those faecal samples that tested positive using the qPCR from diarrheal cases and archived samples collected in 2010 and between 1990 and 1995, respectively had a broad range of viral copy numbers. They contained low copy numbers ranging from 15.3 to 26.5 (Table 4.2) and 410 to 1.05 x 105 viral copies per reaction (Table 4.4), respectively, indicating the virus can be present in various loads. Those diarrheal specimens with lower copy numbers might either be co-infections with other diarrheal pathogens or induce diarrhea alone. Equine adenovirus-2 has been identified in foals with severe diarrhea with diagnosed rotavirus infections (Studdert et al., 1978). However, the results from testing of archival faecal samples may be affected by DNA losses due to multiple freeze-thawing cycles of samples stored at -80oC, infection status during sampling, and wide range of clinical situation might attribute to the low virus copy numbers.

Even though a high sero-prevalence of EAdV-2 antibodies demonstrated in in horses in New South Wales, the low level of EAdV-2 detection in faecal samples is not surprising. Little is known about the length of the time in which EAdV-2 is shed during infection and this time might be brief for this virus. Furthermore, a high prevalence might suggest foals, such as those sampled in the case-control study would be protected from infection by maternal antibody. Other factors such as the timing/season of sample

105 collection which might affect the rate of detection as well as viral load shedding as observed in human adenoviruses (Vetter et al., 2015) might partly explain this disparity.

In conclusion, the developed technique has shown greater analytical sensitivity which may provide the opportunity to potentially detect early, subclinical, or reservoir states of the disease, ultimately enhancing our understanding of EAdV-2 infection as well as simplifying the detection of the virus. Assessment of its diagnostic sensitivity and specificity on clinical specimens in the future studies would improve its diagnostic application. Improvements in the DNA extraction and appropriate sample pre-treatment (dilution) are likely to increase the sensitivity and accuracy of this assay. In addition, when false-negative results are expected, incorporation of a known concentration of inhibitory control target DNA should be included to determine the degree of inhibition in the clinical sample.

106

 Table 4.1: Optimisation of MgCl2 concentration and PCR primer ratio for SYTO 9 qPCR assay. Magnesium optimisation Primer ratio optimization MgCl2 concentration (mM/reaction) average Cq * Primer ratio average Cq 1.9 10.21 1F:1R 25.6 2.5 10.69 1F:2R 25.7 3.1 13.87 1F:5R 23.9 3.8 13.81 2F:1R 26.8 5F:1R 24.3 * average values from replicates

Table 4.2: The intra- and inter-assay variation of the EAdV-2 specific qPCR assay.

Copy Intra-assay variation Inter-assay variation Number Cq Mean Cq SD CV (%) 95% CI Cq Mean Cq SD CV (%) 95% CI (log10) 1.43 38.33 0.55 1.43 36.97, 39.69 37.65 0.64 1.70 36.,06, 39.25 2.43 36.00 0.67 1.86 34.34, 37.66 35.00 0.83 2.37 32.94, 37.06 3.43 32.18 0.30 0.93 31.43, 32.92 31.17 0.87 2.79 29.00, 33.34 4.43 29.03 0.09 0.31 28.81, 29.25 27.96 0.94 3.36 25.62, 30.29 5.43 26.12 0.30 1.15 25.39, 26.85 25.10 0.88 3.51 22.92, 27.28 6.43 22.42 0.13 0.58 22.10, 22.74 21.62 0.70 3.24 19.88, 23.36 7.43 18.08 0.29 1.60 17.36, 18.89 17.95 0.21 1.17 17.44, 18.46 8.43 16.11 0.44 2.73 15.00, 17.20 15.54 0.47 3.02 14.37, 16.72

107

Table: 4.3: Analysis of faecal sample detected by CYTO®9 qPCR assays.

Samples (ID) Cq value Mean viral genomic copies Tm (oC) Clinical Status 5 36.68 26.5 83.05 Non-diarrheic 014b 37.45 15.3 83.03 Diarrheic 22 37.14 19.1 83.59 Diarrheic 122 37.2 20.7 83.05 Diarrheic 230 36.94 38.7 84.33 Diarrheic

Table 4.4: Comparison between qPCR and conventional PCR in the analysis of faecal samples collected between 1990 and 1995.

Conventional PCR Samples detected positive for EAdV-2 Positive Negative Total Samples Viral genomic Cq Tm (oC) ID copies/reaction Values Quantitative PCR Positive 0 5 5 (6.7%) 68 1.05 x 105 31.0 83.17 Negative 0 70 70 (93.3%) 83 4.79 x 103 36.4 82.55 Total 0 75 75 (100%) 183 4.10 x 102 37.4 83.28 189 6.30 x 103 35.9 83.14 264 1.45 x 103 35.2 83.71

108

Figure 4.1: Performance of the EAdV-2 qPCR assay. (A) Standard curve obtained from 10-fold serial dilutions of amplicon cloned into plasmid DNA, showing an average efficiency of 103.8% and an R2 of 0.992 for three independent runs. (B) Amplification plot, showing duplicate amplification curves for each dilution from representative run; (C) Dissociation curve, showing the same single melting point for serially diluted replicates.

109

Figure 4.2: Relative detection using (A) EAdV-2 qPCR and (B) EAdV-2 conventional PCR (Dynon et al., 2001) using DNA extracted from EAdV-2 culture supernatant. Amplification in both assays was performed on serial 10-fold dilutions (from 10-1 to 10- 7, 1 to 7) of EAdV-2.385/75.4 DNA. These reactions contained from 104.9 (10-1 dilution, 0.08 -7 lane 1) to 10 (10 , lane 7) TCID50/ml equivalents per reaction. In panel (B) the conventional EAdV-2 PCR products (expected amplicon size = 570 bp) separated by electrophoresis on a 2% w/v agarose gel with lane M: Molecular marker (Hyperladder IV).

110

Figure 4.3: Amplification plot (A) and melting curve (B) of qPCR for a single EAdV2- 385/75.4 fragment product at a melting temperature of approximately 83.5°C. No specific peaks for the other viruses and NTC reactions were present, demonstrating the analytical specificity of the assay for detection of EAdV-2.

111

Figure 4.4: Evaluation of the effects of template dilution on quantification of EAdV2- 385/75.4 DNA. An EAdV-2 negative faecal sample or PBS were spiked with EAdV-2 (Section 2.7.8) prior to extraction with QVREK. Y-axis values correspond to the viral genomic copies detected in spiked faeces (in %) relative to the copy number detected in spiked PBS added into the sample. A higher yield of DNA was observed at undiluted spiked faeces, indicating subsequent dilutions did not improve detection of EAdV2- 385/75.4.

** ** *

Figure 4.5: Evaluation of EAdV-2 detection in faecal samples. An EAdV-2 negative faecal sample and PBS were spiked with EAdV-2 and serially diluted prior to extraction with a high throughput Soil DNA extraction kit (MoBio, Section 2.7.8). All samples were analysed in triplicates.*p < 0.05 and **p < 0.005.

112

Figure 4.6: Dissociation curve analysis of qPCR products from EAdV-2 spiked faecal and PBS samples (A) and agarose gel analysis of the same spiked samples using o conventional PCR (B), demonstrating a specific Tm at approximately 83 C and non- specific peak and Tm. The non-specific peak is present only in un-spiked faeces and non-template control, except in one un-spiked faeces replicate. This could not be detected on agarose analysis of conventional PCR products indicating a false-positive amplicon.

113

200 No. of foals 168 EAdV-2 positive 160

119 120

80 No faecal samples No 40 26

4 1 0 0 Diarrheic Non-diarrheic Hospitalized

Foal groups

Figure 4.7: Quantitative PCR detection of EAdV2-385/75.4 in faecal samples from diarrheic (n = 168), non-diarrheic (n=119) and hospitalized (n = 26) foals.

114

CHAPTER FIVE

CONSTRUCTION OF EQUINE ADENOVIRUS RECOMBINANT FIBRE

PROTEIN

5.1 Introduction

The two EAdV serotypes display distinct tropisms and virulence based on the clinical manifestations and types of clinical sample that they have been isolated from. It has been reported that differences in tissue tropism and virulence in human and other animal adenoviruses can be attributed to variations in fibre protein sequences (Beach et al., 2009; Gall et al., 1996; Pallister et al., 1996; Rasmussen et al., 1995). The fibre protein, along with the hexon and penton are major constituents of the adenovirus capsid. Adenovirus infection begins with the binding of virion to the surface of host cells. While the fibre protein is responsible for specific attachment to host cell receptors through its fibre knob domain (Xia et al., 1994), penton base interaction facilitates internalisation of the virus. Moreover, the fibre protein plays a substantial role in the immunogenicity of human recombinant adenovirus vectors (Nanda et al., 2005). The specific receptors involved in initial virion binding to the host cell, and the mechanisms of subsequent virion internalisation have not yet established in equine adenoviruses. To understand the mechanisms of the viral infection and specific binding to the host cell, it may be beneficial to consider the role of fibre knob in molecular pathogenesis of equine adenoviruses.

The baculovirus-insect cell expression system is well-established and has proven successful for the production of structurally, functionally and antigenically authentic recombinant proteins (Beljelarskaya, 2011; Summers & Smith, 1987). Baculovirus- insect cell system has some advantages over other bacterial and yeast expression systems to produce biologically active mammalian proteins, as insect cells are capable of performing post-translational modification such as glycosylation, acylation, and amidation (Kato et al., 2010; Merrington et al., 1997). Consequently, the over expressed protein consistently exhibits proper biological activity and function.

115

In this study, BEVS was employed to produce EAdV-1 and -2 his6-fibre knob fusion proteins to use it for specific infectivity assays. Recombinant bacmids for the expression of the EAdV fibre knob proteins were constructed and optimised for efficient production of recombinant antigen. A his6-tagged EAdV-2 fibre knob protein was produced, and its antigenicity and immunogenicity were analysed by Western blot. The EAdV-1 fibre knob protein was not able to be produced. Moreover, polyclonal antibodies against purified EAdV-1 and EAdV-2 virions were produced with intent of expanding the panel of available reagents we can use to further study these viruses.

5.2 Results 5.2.1 Design of the EAdV-2 and EAdV-1 fibre knob polypeptide

The amino acid sequence of EAdV-1 (GenBank: JN418926) and EAdV2-385/75.4 (see Chapter 3) fibre proteins were aligned with that of fully characterised HAdV-2 and analysed in silico to predict the structural domains and design his6 fusion proteins containing fibre knob region (Fig. 5.1). The protein sequence analysis suggests, like any HAdV-2 fibre, both EAdV-1 and EAdV-2 contain a short penton base attachment sequence (tail), a long shaft domain containing putative triple beta repeats and the head domain (Fig. 5.1). Hexa-histidine fusion proteins comprising fibre knob region that serves as a first contact to the host receptor were prepared for EAdV-2 (amino acid 275 - 473) and EAdV-1 (amino acid 600 - 835). Hydrophobicity plots were determined as described previously (Kyte & Doolittle, 1982) using the ExPASy protscale online tool (Gasteiger et al., 2005) and showed that the fibre knob regions of EAdV-2 and EAdV-1 were predominantly hydrophilic protein (Hydrophobicity value > 0) (Fig. 5.2A & B). When the plots were compared (Fig. 5.2), a large hydrophobic peak is present in EAdV- 2 protein (320 – 341 aa). Based on the location of these hydrophobicity regions, there were several hydrophilic domains distributed in the sequences selected for expression of both EAdV-2 (aa 275-473) and EAdV-1 (aa 600-835) fibre knob polypeptide. These results suggested that the proteins would be soluble, which would facilitate further EAdV-2 and EAdV-1 fibre knobs protein related studies.

116

5.2.2 Generation of recombinant fibre knob baculoviruses

In this study, baculovirus infected insect cells were used to produce recombinant equine adenovirus fibre knobs. The baculoviral untagged vector pFastBack™ 1 was used to generate a recombinant expression Bacmid. The plasmid DNA was prepared by digesting with BamHI/SalI and Sal1/Xho for EAdV-2 and EAdV-1 fibre knob protein cloning, respectively.

5.2.3 Construction of his6-fibre knob tagged transfer vectors; EAdV-2 rpfastbac- fk2 (EAdV-2) and rpfastbac-fk1 (EAdV-1)

PCR primers EAdV2.BamHI.fibreExpnF and EAdV2.SalI.fibreExpnR (Table 2.5) were used to amplify the genome region encoding EAdV-2 fibre knob region including the last repeat shaft region. After cloning into the BamHI/SalI site of the pFastBac™ 1 vector, the insertion and orientation was confirmed by restriction digestion by BamHI and SalI, which released the fragments 597 bp EAdV-2 fibre knob and 4.2 kbp vector (Fig. 5.3). The open reading frame was correct, as verified by sequencing using pFastBac sequencing primers (data not shown). The EAdV-1 fibre knob was cloned in similar fashion, however, initial attempt to ligate the SalI/XhoI-digested PCR product with the baculovirus transfer vector, pFastBac™ 1 was not successful. As a result, the amplicon was cloned into the pGEM®T vector and successfully subcloned into pFastBac™ 1 transfer vector. The restriction digestion confirmed that the constructs contained the expected size of the insert DNA (708 bp) and vector (4.2 kb) (Fig. 5.3). Sequencing also verified the correct open reading frame and orientation (data not shown).

5.2.4 PCR analysis of recombinant genes encoding EAdV-2 and EAdV-1 fibre knobs

Transposition of EAdV-2 fibre knob and EAdV-1 fibre knob DNA insert into the Bacmid genome was confirmed using M13 specific primers (Section 2.8.6) and all the PCR products were separated by agarose gel electrophoresis. The PCR product size of the empty pFastBac™ 1 was 2300 bp, according to the manufacturer’s protocol (Invitrogen). With transposition, all the recombinant bacmids amplified with M13 primers produced an amplicon of 2897 bp for EAdV-2 and 3008 bp for EAdV-1. Both

117

PCR products have shown strong signal at the expected product size (Fig. 5.4), indicating the presence of each expression cassette in the Bacmid. Sequence analysis confirmed that all recombinant fibre knob expressing Bacmids were correct and in frame (data not shown).

5.2.5 Recombinant expression of EAdV-2 and EAdV-1 fibre knobs in baculovirus-infected insect cells

The recombinant baculovirus bearing the EAdV-2 and/or EAdV-1 fibre knob genes were obtained by recombination of the recombinant Bacmid, with a baculovirus genome in Sf-9 cells as described in section 2.8.7. The viral titre of the recombinant baculovirus 8 5 as determined by the plaque assay were 4 x 10 pfu/ml and 5 x 10 pfu/ml for his6-

EAdV-2 and his6-EAdV-1 fibre knobs, respectively.

5.2.6 Small scale testing of recombinant his6-tagged EAdV-1 and EAdV2- 385/75.4 fibre knob expression

Once the recombinant viruses were obtained, a small-scale time course analysis of the fibre knobs were performed for optimal expression in Sf-9 cells. The range of time for protein harvest generally ranged from 24 to 96 hrs infected at m.o.i of 5. Higher m.o.i (5 - 10) are usually recommended for the expression of proteins using BEVS (Summers & Smith, 1987).

Time course experiments were conducted to determine the time for optimal expression of EAdV-2 fibre knob domains after infection at 5 m.o.i. Cells were harvested at 24 hrs intervals after transfection up to 96 h.p.i. The cell density of Sf-9 cells began to decrease 48 hrs after transfection, reaching the lowest level at 96 h.p.i, whereas uninfected cells continued to divide (data not shown). Optimal expression of the EAdV-2 fibre knob domain occurred at 72 h.p.i., while maintaining higher cell density for subsequent large- scale expression. Morphologically, infected cells were elongated with rough surface appearance indicating the process of viral budding (Fig. 5.5). Expression of soluble recombinant EAdV-2 fibre knob protein production was assessed by Western blot and SDS-PAGE. Western blot analysis, using a polyclonal anti-his antibody detected protein that corresponded to the theoretical molecular weight of recombinant EAdV-2 fibre knob (23 kDa), thus confirming its identity (Fig. 5.6B). The analyses also revealed that

118 all expressed proteins were associated with total soluble proteins obtained from cell lysates, rather than from the media (Fig. 5.6B). The expressed protein yield was equivalent with a distinct band at the expected size of EAdV-2 fibre knob over the expression time course as visualised from the immunoblotting (Fig. 5.6B). However, the expressed protein was present in a very low level that was barely noticeable on the Coomassie blue stained gel (Fig. 5.6A). The recombinant EAdV-2 fibre knob protein was not expressed at 24 hrs after infection as shown in Fig. 5.6B. The presence of soluble recombinant EAdV-2 fibre knob protein, suggested that this protein could be purified utilising its C-terminal his6-tag.

Expression of recombinant EAdV-1 fibre knob was not successful despite successful in frame cloning of the correct DNA sequence and requires further investigation, since no protein expression was observed. Several attempts to express the protein in bacterial protein expression systems were also not successful prior to this experiment. To further confirm if the recombination was successful, total DNA from transfected Sf-9 cells and controls including DNA from overnight cultures of DH5α clone (rpFastBac-fk1), EAdV-1 infected tissue cultures, and bacmid alone as control, were tested using gene specific primers and PCR. Using this method, the EAdV-1 fibre knob sequence was detected in the baculovirus system with a PCR product of expected size 708 bp (data not shown). Possible reasons as to why the construct did not produce recombinant protein under culture conditions are explained in the discussion.

5.2.7 Purification of recombinant EAdV-2 fibre knob

After purification, SDS-PAGE analysis showed that the strong band eluted was at size corresponding to that expected for EAdV-2 fibre knob (Fig. 5.7A). The 23 kDa his6- tagged EAdV2-385/75.4 fibre knob was purified as elutions 1 to 7, to ensure the purity and sufficient concentration of the product. Elutions 2 to 7 were purer than elution 1, but much lower in concentration (Fig. 5.7A). A stronger band was observed in the eluted fractions than in the cell lysate fractions, which showed that the his6-tagged protein is enriched during Ni-NTA pull down. It could be noted that some level of protein was lost during washing steps as shown in the Fig. 5.8B. The elution 1 was contaminated by non-specific proteins of high molecular masses that reduced it purity (Fig 5.7A). However, Western blot analysis revealed that these contaminants were not

119 immuno-reactive to the anti-his antibody, indicating that the co-purification of the host proteins was not due to post purification modifications such as disulphide bond formation between the host and the recombinant protein. It is possible that these impurities are the result of insufficient washing steps. The estimated concentration for elution 1 and pooled elutions (E2 to E7) after dialysis and concentration (Amicon® ultrafiltration), was about 266 µg/ml and 250 µg/ml, respectively.

5.2.8 Polyclonal antibodies against purified EAdV-2 fibre knob protein, EAVd-1 and EAdV-2 whole virions

Purified EAdV-2 fibre knob protein, purified whole virion preparations of EAdV-1 and EAdV-2 were used to immunise rats to generate antiserum to (i) the EAdV-2 fibre knob, (ii) EAdV-1 virions and (iii) EAdV-2 virions (Section 2.3.1). Hyper-immune sera (pooled and individual) from rats immunised with purified EAdV-2 fibre knob protein were used to probe purified his6-fibre knob in a Western blot and showed that serum from both rats bound the immunogen (Fig. 5.8), whereas rat serum to an irrelevant hexa-his tagged glycoprotein G from herpesvirus 1(his-ΔgG, gift from Dr Mauricio Coppo, FVAS, University of Melbourne) did not. No such protein was detected by the pre-immune sera. The anti-fibre knob rat sera were also further tested on purified EAdV-2 whole virus using Western blot. The anti-fibre knob rat sera reacted with an approximately 50 kDa band equivalent to that of the expected molecular weight of EAdV-2 fibre protein (Fig. 5.9).

Hyper immune sera from rats immunised with purified EAdV-2 and EAdV-1 virions were tested for binding using ELISA and IFA. As shown in Fig. 5.10 (A and B), ELISA verified that antibody against EAdV-1 and EAdV-2 was elicited in rats while the pre- immune sera did not react against either virus. The EAdV-1 and EAdV-2 rat polyclonal sera were also subsequently used as a primary antibody in an IFA to detect the EAdV-1 and EAdV-2 antigens in infected cell monolayers, respectively (Fig. 5.11). EAdV-1 specific signals were detected in cells infected with EAdV-1 (Fig. 5.11; left panel); similarly, positive fluorescent signals are also detected for EAdV-2 antigen in cells infected with EAdV-2 (Fig. 5.11; right panel), while no positive signals for EAdV-1 and EAdV-2 were detected in the uninfected cells although some background fluorescence was noted. Pre-immune sera did not show any background staining in the cells infected

120 with EAdV-1 and EAdV-2. Furthermore, there was a difference in the intensity of background levels for both EAdV-1 and EAdV-2 antigens at 1/50 and 1/100 dilutions. Hence, the 1:100 polyclonal sera with less background levels were used for subsequent assays for both virus antigen detections.

5.3 Discussion

The goal of this study was to construct a recombinant baculovirus expressing the fibre knob domain of EAdV-1 and EAdV-2 and to produce the reagents necessary to test the possible role of fibre gene in the EAdV-1 and EAdV-2 interactions to the host cell. Although the fibre protein was involved in virus entry and implicated in virulence variation in human adenoviruses, its role in equine adenovirus pathogenesis is not well understood.

Upon commencement of this study, we focused on the expression of equine adenoviruses fibre knob as in other adenoviruses, the receptor attachment site would reside within the fibre knob rather than shaft (Louis et al., 1994). Results from both the SDS-PAGE and Western analyses have shown the presence of a protein band approximately the size of the expected EAdV-2 fibre knob protein (23 kDa). The results also suggested that substantial potential protein loses occurred during washing steps. The loss of protein in the first step washes is less likely to be due to unbound proteins as none of the protein was detected in the flow-through. The fact that no proteins were detected in flow-through (Fig. 5.7B) but rather in the washes could also be due to changes in the buffers from phosphate-based in the lysate to Tris-based in the wash. The baculovirus expressed fibre knob should also be detected using fibre knob specific antibody to confirm its specificity. Hence, Western blot analysis using a rat antibody that would directly target EAdV-2 his6-fibre knob was able to detect a 23 kDa protein, indicating the expression and purification methods had worked as expected. Therefore, it was possible to conclude that protein was highly expressed and SDS-PAGE and Western blot both indicated that the protein detected around 23 kDa was likely to be EAdV-2 fibre knob.

121

It was not clear why EAdV-1 fibre knob recombinant protein could not be produced in the baculovirus or bacterial expression systems. Many systems including eukaryotic and prokaryotic expression systems were available to produce recombinant proteins. The bacterial expression system is simple and efficient for production of high level of protein, with limitations including misfolding and inclusion body formation. In the initial experiments, several attempts were made to express EAdV-1 fibre knob in a bacterial expression system using pGEX vector in transformed E.coli. Even though EAdV-1 fibre knob was inserted into pGEX in correct orientation (data not shown), it was not possible to express the desired recombinant protein. Changes in the vector (into PGEMT), host and growth conditions did not improve the situation. This could be due to the toxic effect of the fibre knob to host cell E.coli. Studies have shown that expression of HAdV-2 fibre knob is toxic to thi-strains of E-coli, such as DH5α cells as were used in this experiment, which are defective in de novo synthesis of thiamine (Schulz et al., 2007). Fibre knob trimers isolated from thi+ strains are usually co- purified with thiamine diphosphate which functions as a chemical chaperone in the assembly of recombinant knob trimers in E. coli, possibly by stabilizing assembly intermediates (Schulz et al., 2007). The reason for lack of expression of the EAdV-1 recombinant fibre knob in baculovirus expression system is still not fully understood. Recombinant fibre knob was detected in the DNA extracted from transfected Sf-9 cells using EAdV-1 fibre knob gene specific primers. Hence, lack of retaining the DNA by the virus is the less likely reasons for its lack of expression. In addition, the fibre knob regions selected for expression was predominantly hydrophilic indicating that the solubility of the protein was less likely reasons. However, it is likely that lack of multiple post translational modifications that the proteins requires to fold contributed to the low expression and stability (Tokmakov et al., 2012).

To assess the ability of the EAdV-2 fibre knob protein produced by the recombinant baculovirus to elicit antibody, an antiserum from rats was produced using purified EAdV-2 fibre knob protein. As shown in the Fig. 5.8, polyclonal rat sera specifically detected the expected 23 kDa (including his6-tag) fibre knob using Western analysis. In addition, the polyclonal antibody recognized ~50 kDa protein with a similar molecular weight of EAdV-2 fibre. These data indicated that the baculovirus-expressed EAdV-2 fibre knob protein of EAdV-2 when used as an immunogen can stimulate an EAdV-2

122 virus specific response and the expressed protein was antigenically similar to the authentic EAdV-2 fibre produced in mammalian cells.

Immunisation of rats with sucrose gradient purified EAdV-1 and EAdV-2 resulted in production of antibodies that specifically bound to the respective native viruses in ELISA and IFA. These results indicate that both sera could detect homologous virus. Detection of the EAdV-1 and EAdV-2 proteins by both ELISA and IFA indicate that the sera could detect both native and denatured proteins. Furthermore, it demonstrates that both polyclonal antibodies can be used as standard positive sera for the antigen detection and protein identification of their respective viruses.

In conclusion, during this study, a soluble and stable EAdV-2 fibre knob protein capable of eliciting antibody production in rats was successfully produced. Furthermore, a recombinant baculovirus expression vector containing EAdV-1 fibre knob was constructed, however, further optimisation is required for expression of this protein. Both the protein and antisera obtained in this study are a step forward for the subsequent assays and might be useful as diagnostic reagent for detection of viral antigens.

123

Figure 5.1: Predicted domain organisation of EAdV2-385/75.4 and EAdV-1.M1 fibre protein. (A) Amino acid alignment of EAdV-2 and EAdV-1 fibre protein with that HAdV-2 (Acc No: AP_000190). (B) Schematic representation of the EAdV-2 and EAdV-1 fibre protein indicating the tail, the shaft and head domains. The predicted virus-binding tail (EAdV-2: 1 – 36 aa; EAdV-1: 1 - 40 aa) is shown in blue box, the shaft domain (EAdV-2: 37 – 291 aa; EAdV-1: 41 – 657 aa) and head domain (EAdV-2: 292 - 473 aa) and (EAdV-1: 658 – 835 aa) underlined. The beginning of the head domain is marked by consensus sequence, TLWT, indicated by the black box. The locations of the EAdV-2 and EAdV-1 his6 fusion proteins used in this study are indicated by black and red arrows, respectively. Amino acid numbering is from the first residue of fibre protein for each virus.

124

Figure 5.2: Hydrophobicity plots of the fibre proteins of (A) EAdV-2 and (B) EAdV-1 viruses. The amino-acid positions are indicated on the x-axis while the hydrophobicity scores indicated on the y-axis. Scores above 0 considered potential hydrophobic regions. Fibre knob regions are marked by box. The plot was generated using ExPASy protscale online tool (Gasteiger et al., 2005).

125

Figure 5.3: Plasmid DNA analysis of the pFastBac™ 1 constructs of fibre knob proteins by restriction enzyme digestion. Agarose gel electrophoresis showing BamHI/SalI digested rpFastBac-fk2 (A) and SalI/Xho digested rpFastBac-fk1 (B). The double digestion separated the DNA products into two fragments, pFastBac™ Bac-1 (4300 bp) and EAdV-2 fibre knob (597 bp) and EAdV-1 fibre knob (708 bp), confirming successful cloning of the target genes into the transfer vector. Lanes 1 and 3 contain hyperladder I (Bioline), Lanes 2 and 4: rpFastBac-fk2 and rpFastBac-fk1, respectively. The sizes of the DNA bands with in the marker are indicated in kbp.

Figure 5.4: Confirmation of the presence of EAdV-2 (A) and EAdV-1 (B) fibre knob protein expression cassettes in a Bacid using M13/pUC primers. Bacmid DNA was isolated from overnight cultures and the presence of recombinant genes were confirmed using PCR as described in section 2.8.6. Lanes 1 and 3: hyperladder I (Bioline), lane 2: EAdV-2 fibre knob recombinant Bacmid; lane 4: EAdV-1 fibre knob recombinant Bacmid. The size of EAdV-2 and EAdV-1 Bacmid products were 2897 bp (Black arrowhead) and 3008 bp (red arrowhead), respectively. The sizes of the DNA bands with in the marker are indicated in kbp.

126

Figure 5.5: Light photomicrographs of Sf-9 cells (x 200) after inoculation with recombinant baculovirus expressing EAdV-2 fibre knob (upper panel) and EAdV-1 fibre knob (lower panel). The morphology of baculovirus infected and uninfected cell control after 48 and 72 h.p.i was compared. Note the infected- cells marked by purple arrows, shows elongated cells with rough appearance. CTL = uninfected control

127

Figure 5.6: Time-course expression of the EAdV-2 recombinant fibre knob protein in Sf-9 cells analysed by SDS-PAGE (10%) and Coomassie brilliant blue staining (A) or by Western blot (B). Sf-9 cells were infected with recombinant baculovirus at a m.o.i of 5 and culture samples were collected at 24, 48, 72 and 96 h.p.i. Cells were separated from the supernatant (media) at low centrifugation, lysed and the soluble fractions (lysate supernatant) were loaded to SDS-PAGE gel (see Section 2.8.10). Recombinant fibre knob was detected from 48 to 96 h.p.i, as a band of approximately 23 kDa with equivalent protein yield, visualized from Western blot. Marker = PageRuler™ Prestained Protein Ladder (Fermentas) (A) and biotinylated protein ladder (Cell Signaling) (B).

128

Figure 5.7: (A) SDS-PAGE and (B) Western blot analysis of EAdV-2 recombinant fibre knob protein purification fractions. Cells expressing the recombinant protein lysed and the protein was bound to Ni-NTA beads, washed and eluted. Samples from whole cell lysis (lysate supernatant and pellet), culture media, flow-through, column wash fractions and elutions 1 to 7 were separated on 10% SDS-PAGE under reducing conditions and (A) stained with Coomassie Brilliant Blue or (B) transferred into PVDF membrane and probed with ant-his rabbit antibody (1/1000) (GE Health-care Life Science). Blots were subsequently probed with swine anti-rabbit HRP conjugated secondary antibody (1/1000) (Dako) and developed using ECL substrate. Markers: (A) PageRuler™ Prestained Protein Ladder and (B) Biotinylated protein ladder.

129

Figure 5.8: Western blot detection of EAdV-2 his6-fibre knob by rat polyclonal sera. Purified fibre knob protein was separated by 10% SDS-PAGE under reducing conditions and transferred into PVDF membrane and probed with rat antiserum to the EAdV-2 fibre knob (1/100) (pooled, rat 1 and 2) and pre-immune sera. Blots were subsequently probed with goat anti-rat HRP-conjugated secondary antibody (1/1000) and developed using ECL substrate.

Figure 5.9: Detection of the EAdV-2 fibre protein with rat anti his6-fibre knob polyclonal sera. Purified EAdV-2 virus was separated by 10% w/v SDS-PAGE under reducing conditions and stained with Coomassie blue, 250 (lane 1) and transferred into PVDF membrane and probed with rat anti-fibre knob sera (1/100) (lane 2). Blots subsequently probed with goat anti-rat HRP-conjugated secondary antibody (1/1000) and developed using ECL substrate. The anti-fibre knob rat sera recognized aproximately 50 kDa band equivalent to that of the theoretical molecular weight of EAdV-2 fibre protein. M= PageRuler™ Prestained Protein Ladder (Fermentas). The sizes of the protein bands with in the pre-stained marker are indicated in kDa.

130

Figure 5.10: Reactivity analysis of (A) EAdV-2 and (B) EAdV-1 rat hyper-immune sera to the homologous purified virus in ELISA. Wells were coated with 0.75 µg/ml purified (A) EAdV-2 or (B) EAdV-1 virions. Rat hyper immune and pre-immune sera from the two rats were titrated before detection with secondary HRP-conjugated goat anti-rat IgG (1:750). Serum 1 and serum 2, represents sera from rat 1 and rat 2, respectively.

131

Figure 5:11: Testing of polyclonal sera by IFA. EFK cell monolayers (200X) were infected with EAdV-1 (left) or EAdV-2 (right panel), or left uninfected. Different polyclonal sera raised in rats against EAdV-1, EAdV-2 (diluted 1:50 and 1:100) and pre-immune sera (diluted 1:50) were used as primary antibody followed by Alexa Fluor® 488-conjugated goat anti-rat secondary antibodies for detection. Arrow shows infected EFK cells expressing viral antigens. CTL = uninfected control.

132

CHAPTER SIX

CHARACTERISATION OF CELL SURFACE RECEPTORS FOR EQUINE

ADENOVIRUS INFECTION

6.1 Introduction

Adenovirus infection is initiated by a specific attachment of the virus particle at the surface of the host cell and subsequent internalisation of the virion via the involvement of a secondary receptor. Hence, receptors are important determinants of adenovirus tissue tropism and pathogenesis. Equine adenovirus 1 and EAdV-2 have been associated predominantly with upper respiratory tract and gastrointestinal infections in foals, respectively (Bell et al., 2006; Dunowska et al., 2002; Giles et al., 2010; Roberts et al., 1974; Wilks & Studdert, 1972). The distinct genomes of these viruses (Chapter 3) are consistent with their antigenic divergence and may explain differences in cell tropism for these viruses. In contrast to EAdV-1, EAdV-2 replicates slowly and poorly in primary EFK cell cultures (Horner & Hunter, 1982; Studdert & Blackney, 1982). Together with the preferential tropism of EAdV-1 for the respiratory tract and EAdV-2 for the digestive tract, these differences suggested that these adenoviruses might utilise distinct receptors. However, the in vitro cell tropisms of the serotypes are poorly understood.

Although CAR appears to be the major attachment receptor for most human adenovirus serotypes (Bergelson et al., 1997; Roelvink et al., 1998; Tomko et al., 1997), species B adenoviruses which primarily cause ocular and respiratory tract infections and/or renal disease use CD46 as cellular receptors (Gaggar et al., 2003; Marttila et al., 2005). Despite the fact that specific members of species D adenoviruses that cause epidemic kerato-conjunctivitis appear to have preference for sialic acid receptors, other adenoviruses associated with gastroenteritis such as HAdV-52 (Jones et al., 2007; Lenman et al., 2015), CAdV-2 that causes mild cough (Rademacher et al., 2012) and BAdV-3 that causes mild respiratory infections are known to utilise sialic acid receptors for their entry into host cells (Lehmkuhl et al., 1975; Li et al., 2009). The aim of this study is to describe the nature of the receptor(s) used by EAdV-1 and EAdV-2 to infect EFK cells and to compare any differences between viruses. Also, the initial event of

133 equine adenovirus attachment and infection, including the molecular basis of binding to its receptor, has not been described.

The experiments in this chapter describe the biochemical characterisation of cell surface receptors for the attachment and infection of EAdV-1 or EAdV-2 using EFK cells. An immunofluorescent infectivity assay was developed to study the effect of biochemical treatments of EFK cells on viral infection using competition experiments.

6.2 Results

6.2.1 Data analysis methods

The biochemical characterisation of the receptors used by EAdV-1 and EAdV-2 were examined in an immunofluorescence infectivity assay (Section 2.2.3). EAdV-1 or EAdV-2 fluorescent foci were counted from the treated and mock treated cells as described in Section 2.2.3. As some fluorescent foci counts in the treated cells are greater than those of the mock treated in some assays, ratio was considered than proportions to measure the effect of treatment on EAdV-1 or EAdV-2 infectivity. Results are expressed as the ratio of the sum of fluorescent foci counts from the two replicates of the treated wells to the sum of fluorescent foci counts from the two-mock treated virus control wells. To provide a numerical example for EAdV-1 infectivity, if the fluorescent foci counts from heparan sulfate (100 µg/ml) treated cells were 8 (sum from duplicates) and 39 from mock treated cells, the ratio would be 8/39 (0.21). Hence, EAdV-1 infection was reduced to a ratio of 0.21 in the treated cells compared to mock treated cells in the first experiment. For the second or third experiment repeated for the same treatment, the counts were analysed in a similar manner. To quantify and statistically test the difference in the ratios of fluorescent foci for the treated and mock treated cells, multiple comparison tests were performed using general linear model Section 2.10). As an example, an excerpt from the analysis of HS treatment effect on the infectivity of EAdV-1 was shown in appendix A3. At each concentration of HS treatment (1, 10 and 100 µg/ml), the analyses yields point estimates adjusted for the effect of covariates such as concentration of treatments, replicates, experiments (assays). It is expected that the number of cells in the monolayers and growth conditions

134 will vary between different wells (replicates) and experiments (assays) ultimately serve as covariates.

6.2.2 Development of virus infectivity assays

To investigate the receptor used by the EAdVs, an assay was developed where the effect of various treatments (for example, enzymatic treatment of cells) on infection by either virus was measured. Infection was measured using immunofluorescence and detection of fluorescent foci 24 hrs after infection (Section 2.4.1). The titre and volume of virus inoculum, and the adsorption and incubation times necessary to generate a statistically reliable number of infected cells were optimised (Appendix A2). In this assay, there was a lack of detectable infection after 30 min of virus adsorption to cells prior to washing and incubation, which showed that both EAdV-1 and EAdV-2 required a longer period of time for attachment to the EFK cells. Also, at higher virus dilutions used for EAdV-1 (m.o.i > 0.2) and EAdV-2 (m.o.i > 0.3), either quite a large number of infected cells were generated or/and monolayers were completely lost, affecting the reproducibility of the assay. EAdV-1 and EAdV-2 at m.o.i = 0.2 and m.o.i = 0.3, respectively, produced a reliable number of infected cells (50 – 100). Finally, the optimal assay conditions were determined to be 60 min adsorption of EAdV-1 (m.o.i = 0.2) prior to 24 hrs incubation o at 37 C in 5% CO2 and 60 min adsorption of EAdV-2 (m.o.i = 0.3) before 48 hrs o incubation at 37 C in 5% CO2. These assays were then used to study the effects of competitors, inhibitors and biochemical pre-treatments on the infection of EAdV-1 and EAdV-2 in EFK cells.

6.2.3 Rat antisera and soluble his6-fibre knob protein inhibits the infectivity of EAdV-1 and EAdV-2

Polyclonal rat antisera raised against purified EAdV-1, EAdV-2 and recombinant EAdV-2 fibre knob protein were used to investigate attachment of intact virions to EFK monolayers to determine if these antisera would effectively block virus infectivity. The EAdV-1 infection was blocked in a dose dependent manner by sera raised against both the homologous and heterologous virions (Fig. 6.1A). Pre-incubation of the antiserum to EAdV-1 sera neutralised EAdV-1 infection to a maximum ratio of 0.06 (CI: 0.01 - 0.11) at 1/50 antibody dilution (Fig. 6.1A). Substantial inhibition of EAdV-1

135 infection was also observed by pre-incubation of the heterologous antiserum to EAdV-2 sera. Both 1/50 and 1/100 dilution of EAdV-2 rat serum completely neutralised EAdV-1 infection (Fig. 6.1A, upper and lower panel). Though, the EAdV-1 infection was inhibited by rat antiserum to EAdV-2 virus compared to the mock treated cells, rat antiserum to soluble fibre knob protein did not inhibit the infectivity of EAdV-1 in a dose dependent manner (Fig. 6.1A). The pre-immune sera from these rats also did not inhibit EAdV-1 infectivity, indicating that the inhibitory effects of the EAdV-1 and EAdV-2 sera were due to the function-blocking of anti-EAdV antibodies.

In parallel, similar experiments were performed examining the effects of these sera on the EAdV-2 infection (Fig. 6.1B). Dose dependent inhibition of EAdV-2 infection was observed by these rat sera. Complete neutralisation of EAdV-2 infection was achieved by both homologous and heterologous anti-viral rat sera at 1/50 dilutions (Fig. 6.2B). Even at the higher dilution of the EAdV-2 anti-serum (1/500), the estimated ratio of EAdV-2 infection reduced by 0.15 (CI: 0.03 - 0.28) compared to mock treated cells. In addition, EAdV-2 infection was also reduced to a range between 0 and 0.64 (CI: 0.54 - 0.76) by antiserum to the fibre knob protein when a 1/50 dilution was used (Fig. 6.1B). The pre-immune sera had no any effect on the infectivity of EAdV-2 (Fig. 6.1B). These results suggested that antibodies to EAdV-2 proteins, including those to the virion fibre protein, interfere with attachment, thereby reducing viral infection.

To investigate the distinct receptor usage of EAdV-1 and EAdV-2 on EFK cells, these cells were also pre-incubated with the purified recombinant EAdV-2 fibre knob protein prior to infection with EAdV-1 or EAdV-2. Pre-incubation of EFK cells with increasing amounts of EAdV-2 purified fibre knob, prior to infection by EAdV-2 showed a dose dependent inhibition of infection. Treatment of monolayers at a concentration of 10 µg/ml, significantly reduced EAdV-2 infection by a ratio estimate of 0.77 (CI: 0.41 - 1.1; p = 0.001) compared to mock treated (Fig. 6.2B). Whereas, competition experiments with EAdV-1 showed no dose dependent inhibition in the EAdV-1 infection (Fig. 6.2A). This experiment suggested that pre-treatment with EAdV-2 fibre knob protein inhibited EAdV-2 infection but did not inhibit EAdV-1 infection and it is likely that EAdV-1 uses a cell receptor that is distinct from EAdV-2.

136

6.2.4 Both EAdV-1 and EAdV-2 virion attachment and infection of EFK cells require carbohydrate moieties

Host cell receptors that allow viruses to bind and infect the cells includes all types of surface molecules including carbohydrates, proteins, proteoglycans and lipids. Sodium periodate (NaIO4) treatment cleaves carbohydrates moieties, without altering proteins or membranes, by oxidation of vicinal hydroxyl group of sugars into dialdehydes at acidic pH (Kim et al., 2014; Martinez-Barragan & del Angel, 2001; Woodward et al., 1985).

To investigate the role of cell surface carbohydrates, EFK cells were treated with

NaIO4, at increasing concentrations. A significant inhibition of EAdV-1 infection was observed in a dose dependent manner. At the highest concentration used (0.1 mM), the ratio of EAdV-1 infection to mock treated cells ranged between 0.04 (CI: 0.01 - 0.08) and 0.50 (CI: 0.3 - 0.8) (Fig. 6.3A). Pre-treatment of EFK cells with increasing concentrations of NaIO4 had a significant effect on the infection of EAdV-2, bringing the ratio of infection between 0.62 (CI: 0.52 - 0.74) and 0.85 (CI: 0.67 - 1.07) at 0.01 mM NaIO4 concentration (Fig. 6.3B). No significant inhibition was observed when 0.1 mM concentration was used (p = 0.35), which is not consistent with the dose dependent effect seems for this treatment with EAdV-1. At each concentration, NaIO4 treatment of EFK cells had a more significant effect on reducing infection by EAdV-1 than EAdV-2. Overall, these results indicated that both EAdV-1 and EAdV-2 utilises cell surface carbohydrates functional groups for attachment and infection; but they might have used different carbohydrate components infect EFK cells.

6.2.5 Sialic acid interacts with both EAdV-1 and EAdV-2 virions

To further characterise the nature of any carbohydrate component of the putative receptor used by equine adenoviruses, EFK cells were pre-treated with a broad range neuraminidase from Clostridium perfringens (CP) (0.1 - 10 mU) (Table 6.1) prior to infection with EAdV-1 or EAdV-2. The EAdV-1 infection was reduced by neuraminidase treatment in dose dependent manner (Fig. 6.4A). At the maximum neuraminidase concentration used (10 mU), infection was reduced significantly in the treated cells to a ratio range between 0.46 (CI: 0.26 - 0.75) and 0.63 (CI: 0.41 - 0.93) compared with the mock treated cells. This finding supports the observation that

137 removal of cell surface carbohydrates upon neuraminidase treatment significantly diminished EAdV-1 infectivity. Pre-treatment of EFK cells with neuraminidase also had a significant, dose dependent effect on the infection of EAdV-2 at all concentrations used. At the highest concentration (10 mU), a ratio of EAdV-2 infection between 0.55 (CI: 0.40 - 0.74) and 0.62 (CI: 0.43 - 0.87) was observed (Fig. 6.4B) when compared to the mock treated cells. To confirm this finding, a second type of assay was used where virus titres in treated and untreated cells were compared (Section 2.9.5). Consistent with the fluorescence assay, neuraminidase (10 mU) treatment of monolayers decreased the titres of EAdV-1 and EAdV-2 by 3 and 2 log10, respectively (Table 6.2). Overall the data indicated that cell surface sialic acid is a component of both EAdV-1 and EAdV-2 virus-receptor interactions. It can be noted that the treatment of cells with neuraminidase did not block infection of both viruses completely suggesting that more than one receptor may have been involved.

To further examine whether the sialic acid-containing component could inhibit the infectivity of EAdV-1 and EAdV-2 to EFK cells, EAdV-1 and EAdV-2 were pre- incubated with either saccharides (glucose or lactose) or NANA (sialic containing monosaccharide) before addition to the monolayers in the immunofluorescence infectivity assay. EAdV-1 infection was reduced to the ratio of 0.53 (CI: 0.40 to 0.69) in cells treated with 100 mM NANA compared to mock treated cells (Table 6.3). However, there was an increase in the infectivity of EAdV-2 in cells treated with NANA at all concentrations used (10 and 100 mM). The non-sialic containing saccharides, lactose and glucose had no effect on EAdV-1 and EAdV-2 infections, respectively; even at higher concentrations (200 mM) (Table 6.3). While glucose reduced the EAdV-1 infection to the level of 0.58 (CI: 0.44 - 0.76), lactose reduced the infection of EAdV-2 up to a ratio of 0.20 (CI: 0.12 - 0.29) (Table 6.3). Therefore, in addition to the sialic acids, monosaccharide and disaccharide sugars seem to be involved in blocking EAdV-1 and EAdV-2 infections, respectively.

138

6.2.6 Both α(2,3) and α(2,6)-linked sialyated glycoconjugates are involved in

EAdV-2 receptor attachment and infection

To further confirm the role of sialic-acid containing glycans in EAdV-1 and EAdV-2 attachment and hence infection, a sialic binding-molecule, WGA lectin (Table 6.1), was used to treat EFK cells prior to virus infection. Wheat germ agglutinin interacts with terminal sialic acid containing saccharides regardless of the type of glycosidic linkage between the sialic acid and the neighbouring saccharide (Bhavanandan & Katlic, 1979; Ganguly & Fossett, 1979).

Pre-incubation of EFK cells with WGA, showed a significant dose dependent inhibition of EAdV-2 infectivity. The ratio of EAdV-2 infection in treated compared to mock treated cells ranged from 0.38 (CI: 0.28 - 0.50) to 0.51 (CI: 0.39 -0.66), suggesting the importance of sialic containing glycoconjugates as cell surface receptor for EAdV-2 entry (Fig. 6.5B). By contrast, there was no inhibition in the infectivity of EAdV-1 when EFK cells were pre-incubated with WGA at similar concentrations. Instead, WGA (100 µg/ml) significantly increased the ratio of EAdV-1 infection, ranging between 4.7 and 4.1 (Fig. 6.5A). Consistent with this result, WGA (10 µg/ml) treatment of monolayers increased the titres of EAdV-1 by 0.5 log10 (Table 6.2). All the results from

NaIO4, neuraminidase and WGA taken together, strengthen the importance of cell surface sialic acid for EAdV-2 entry.

Sialic acid is attached to glycans via α(2,3), α(2,6) or α(2,8) linkages. The sialic acid linkage preferences (Table 6.1) of EAdV-2 and EAdV-1 were further investigated using linkage-specific lectins in the immunofluorescence infectivity assay. EFK cells were pre-incubated with either MAA or SNA prior to infection with either EAdV-1 or EAdV- 2. At the higher concentrations (100 and 200 µg/ml), SNA inhibited EAdV-1 infection, while the lowest concentration (10 µg/ml) enhanced EAdV-1 infection (Fig. 6.7A and 6.8). This result, however, could not be confirmed by the CPE inhibition assay in which, treatment of monolayers with SNA at 100 µg/ml concentrations did not affect the titre of EAdV-1 in treated cells compared to untreated cells (Table 6.2). By comparison, higher concentration (100 µg/ml) of MAA resulted in enhanced infection of EAdV-1 with a ratio ranged between 2.48 (CI: 1.90 - 3.37) and 2.5 (CI: 1.88 - 3.46) compared

139 with mock treated cells (Fig. 6.6A). The enhanced effect of MAA was also confirmed by increased EAdV-1 titre by 1 log10 unit compared to untreated control when 100 µg/ml MAA was used (Table 6.2). Overall, there seems to be no consistent evidence to clearly indicate that either α(2, 3) or α(2,6)-linked sialic acids acts as a functional receptor for EAdV-1 infections.

In parallel experiments, there was a significant dose-dependent inhibition of EAdV-2 infection when cells were treated with SNA and enhancement of infection when treated with MAA. Unlike EAdV-1 where SNA completely blocked infection; 200 µg/ml SNA treatments reduced the EAdV-2 infection to the lowest ratio of 0.36 (CI: 0.28 - 0.47) (Fig. 6.7B), relative to mock treated cells. This also accords with the CPE inhibition assay, which showed a decrease in the titre of EAdV-2 by 1 log10 and 2 log10 fold change compared to the untreated cells when 10 µg/ml and 100 µg/ml SNA were used, respectively (Table 6.2). Following 200 µg/ml MAA treatment, the ratio of EAdV-2 infection was significantly increased by 0.42 (CI: 0.16 - 0.69; p = 0.001) compared with mock treatment (Fig. 6.7B). Consistent with the fluorescence assay, MAA (100 µg/ml) treatment of monolayers increased the titres of EAdV-2 by 0.5 log10 (Table 6.2). Taken together, these results suggested that EAdV-2 might use α(2,3)-linked sialic acids. Given the strong response from the MAA treatment, however, it is not possible exclude the role of sialic acids with α(2, 3) linkage to the underlying sugar chains in the effectivity of EAdV-2.

In a similar assay, the lectin, ConA (200 µg/ml), which has affinity for α-mannose, α- glucose was also tested and reduced the ratio of EAdV-1 and EAdV-2 infection to a level of 0.5 (CI: 0.33 - 0.72) and 0.26 (CI: 0.17 - 0.39), respectively, compared to mock (Table 6.3). These results suggested that a terminal manose or glucose residue of the glycan branched chain or mannose residues within the branched sialyated structure are also involved in both EAdV-2 and EAdV-1 attachment and internalisation.

6.2.7 Heparan sulfate acts as a functional receptor for EAdV-1 but not EAdV-2

While sialic acid appears to be more significantly involved in EAdV-2 infection compared to EAdV-1, the infectivity of both viruses was significantly affected by

NaIO4 treatment. Sodium periodate is also known to oxidise and destroy the uronic acid

140 residues of heparan sulfate molecules (Fransson, 1978). Heparan sulfate is a co-polymer of sulfated glucosamine and sulfated glucoronic acid (Sasisekharan & Venkataraman, 2000). Heparan or heparan sulfate can act as receptors for many different viruses, and are able to act directly as a receptor or help to concentrate the viruses on the cell surface to facilitate the interaction (Germi et al., 2002).

The effect of different HS concentrations on EAdV-1 and EAdV-2 infection of EFKs was measured in the immunofluorescence infectivity assay, where HS was pre- incubated with virus prior to addition to cells. A significant, dose-dependent reduction in EAdV-1 infectivity was observed, with the ratio ranging between 0.21 (CI: 0.07 - 0.38) and 0.37 (CI: 0.20 - 0.60) when cells were treated with 100 µg/ml HS compared to mock treatment (Fig. 6.9A and Fig. 6.12). Parallel experiments demonstrated that EAdV-2 infection in the presence of HS was not affected (Fig. 6.9B and 6.12).

The HS inhibition outlined above suggested that HS-GAGs serves as a receptor for EAdV-1. To further examine this finding, EFK cells were pre-treated with heparinase I to remove heparin and highly sulfated HS domains, and heparinase III to remove HS. Pre-treatment with both heparinases inhibited infection significantly by EAdV-1 in a dose dependent manner but did not significantly inhibit EAdV-2 infection. In particular, treatment of cells with heparinise I and III at 5 U/ml significantly reduced EAdV-1 infection to the ratio of 0.47 (CI: 0.39 - 0.55) and 0.25 (CI: 0.15 - 0.39), respectively (Fig. 6.10 and Fig. 6.11) compared to the mock treated cells. As can be seen from Fig. 6.11 and 6.10, heparinase III inhibited EAdV-1 better than heparinase I. Thus, less sulfated glycosaminoglycans play a significant role in the EAdV-1 infection process compared to more sulfated glycosaminoglycans. Taken together, these results suggested that EAdV-1, but not EAdV-2 uses HS-GAG expressed on the cell surface as primary or co-receptors for multistep attachment to the EFK cells.

6.2.8 Equine adenovirus 2 interacts with α4β1 integrins but not with α4β7

The presence of potential ligand sequence for α4β1 and α4β7 in the penton base protein of EAdV-2 (see Chapter 3; Fig. 3.11) might also suggest the involvement of integrins in the infection process for EAdV-2. In comparison, absence of conserved RGD and LDV sequence in the penton base protein of EAdV-1 suggests an integrin-independent

141 infection process. In order to investigate if α4β1 and α4β7 integrins were playing a role in the infectivity of EAdV-2 or EAdV-1, function-blocking assays were performed using the natural integrin ligands, VCAM-1 and MAdCAM-1. EFK cells were pre-incubated with VCAM-1, which is recognized preferentially by α4β1 (Newham et al., 1997), for 30 min prior to addition of either EAdV-1 or EAdV-2 for adsorption. Pre-incubation of EFK cells with VCAM-1 reduced EAdV-2 infectivity in a dose dependent manner (Fig. 6.13B), while no significant reduction in infectivity of EAdV-1 was seen (Fig. 6.13A).

In contrast, treatment of cells with MAdCAM-1, which binds to α4β7 integrin but is a poor ligand for α4β1, did not appear to inhibit in a dose-dependent manner (Fig. 6.14). The significance of the observation that MAdCAM-1 treatment significantly reduced EAdV-1 infectivity at lower concentration (< 5 µg/ml) is unclear and yet to be elucidated (Fig. 6.14A). The results from the two independent assays have shown greater variability and hence, it would be helpful to include three more assays in the future if the inhibitions effect would be observed consistently at lower concentrations.

6.2.9 Both EAdV-1 and EAdV-2 infections of EFK are CAR-independent

The role of CAR molecules in the attachment and entry of EAdV-1 and EAdV-2 to EFK cells were further studied by blocking uptake of the whole virions with a CAR-specific antibody. A rabbit polyclonal antibody against human CAR (H-300) (Santa Cruz Biotechnology) was used for immunofluorescence infectivity assays and Western blot.

In order to conduct CAR blocking experiments, expression of CAR on EFK cells is required as well as the ability of the CAR antibody to bind equine CAR. When used in Western blots, this antibody detected a band of the expected size (46 kDa) in a human cell line (Hep2), detected a weaker 46 kDa band in the EFK cell lysates, and no or very little binding to a hamster cell line (BHK21) (Fig. 6.15).

When pre-incubated with cells in the immunofluorescence infectivity assay, the CAR antibody did not significantly affect the infectivity of either virus (Fig. 6.16). It has demonstrated that EAdV-1 and EAdV-2 infection in treated cells was reduced to a maximum ratio of 0.76 (CI: 0.53 - 1.1) and 0.70 (CI: 0.50 - 0.99), respectively compared to mock treated cells (Fig. 6.16). This observation and the fact that CAR is

142 expressed in the EFK cell lines, suggested that CAR might not play a significant role in the internalisation of EAdV-1 and EAdV-2. However, this finding should be interpreted cautiously as Western blot suggested low level of cross reactivity with equine CAR. No significant reduction in the ratio of EAdV-1 or EAdV-2 infection was observed in the group pre-incubated with rabbit immunoglobulin to goat IgG-HRP conjugated, as negative control, at a concentration of 10 µg/ml compared with mock treated group.

The effect of different biochemical treatments and ligands on equine adenovirus infections to EFK cells was summarised (Table 6.4).

6.3 Discussion

This study provides the first evidence that the two equine adenoviruses recognise different receptors that include sialic acids, heparan sulfates, and integrins on the surface of EFK cells. Results of the initial general characterisation studies suggested carbohydrate moieties were the most important component of the receptor complex for EAdV-1 and -2 entry and infection. Furthermore, removal of sialic acids from the surface of EFK cells with neuraminidase treatment led to dose-dependent reduction in the infectivity of EAdV-2 and had a significant effect on EAdV-1 infection, but only at the highest dose tested. For EAdV-2, the sialic acids and the α4β1 integrin appear to be involved in infection. For EAdV-1, HS appears important for infection, although sialic acids might also involve.

Adenovirus neutralising antibodies have been known to form adenovirus-immune complexes that prevent the virus from interacting with the target cells (Leopold et al., 2006; Shenk, 2001). While EAdV-1 and EAdV-2 specific immune responses were cross neutralising in the immunofluorescence assay, anti-fibre knob antibodies against EAdV- 2 fibre knob protein did not neutralise the heterologous virus (EAdV-1) infection. The observation that rat anti-EAdV-2 sera significantly inhibited EAdV-1 infection of EFK cells but that anti-EAdV-2 fibre knob sera did not, suggested that neutralising antibodies are primarily directed to other capsid proteins epitopes instead of the fibre protein.

It has been recognised that the trimetric fibre knob is a primary receptor-seeking moiety in most adenoviruses and the purified fibre or fibre knob has been used effectively in

143 competitive inhibition assays to investigate the distinct receptor usage by various adenoviruses (Bangari et al., 2005; Bergelson et al., 1997; Henry et al., 1994; Louis et al., 1994; Roelvink et al., 1998). In this study, soluble EAdV-2 fibre knob protein efficiently inhibited infection by homologous virus, indicating that EAdV-2, like most adenoviruses, uses fibre knob domain for interaction with cell receptors. Equine adenovirus 2 fibre knob protein did not however reduce the EAdV-1 infection. Therefore, it is possible that the fibre knob, without the entire fibre protein, trimerises and is functionally capable of competing with the homologous but not the heterologous virion to block infection. Furthermore, EAdV-2 fibre knob antibodies inhibited EAdV-2 infection of the EFK cells, indicating that the fibre knob contains a specific receptor attachment site. Taken together, the findings indicated that the fibre knob protein plays a crucial role in the initial stage of EAdV-2 infection and a significant inhibition of infection was observed only in the homologous virus suggesting that the primary receptor for EAdV-1 and EAdV-2 are distinct.

Sialic acids are negatively charged sugar molecules found ubiquitously on the surface of mammalian cells. Sialic acids vary in their structure (NeuAc or GlcNAc) and specific linkage to a neighboring galactose or neighboring sialic acids (Schauer, 2004; Varki & Schauer, 2009). The findings presented here suggested that sialic acids are involved in EAdV-2 infection. When sialic acids were removed from the surface of EFK cells using neuraminidase, EAdV-2 infection was inhibited indicating that EAdV-2 was interacting with sialic acids containing cell surface receptors. The ability of WGA and SNA to inhibit EAdV-2 infection significantly, further suggested that a sialic acid with α(2, 6) linkage to the underlying sugar chain was the preferred linkage for EAdV-2 attachment and infection. In addition, ConA and WGA revealed broad inhibitory activity suggesting that underlying N-GlcNAc and core mannose residues potentially contribute to EAdV-2-glycan interactions.

It is logical to consider that the differences in the cell receptor used by different adenoviruses will significantly influence pathogenesis and ultimately affect disease outcomes. However, while there are good data to support this, the current level of knowledge shows that the association is not absolute. Several adenoviruses, such as viruses of subgroup D HAdVs (HAdVs 8,19 and 37) (Arnberg et al., 2000; Arnberg et al., 2002), HAdV-52 (Lenman et al., 2015), (BAdV-3) (Li et al., 2009), CAdV-2 144

(Rademacher et al., 2012) have been reported to recognise sialic acids, as their attachment receptors. All these viruses, except for HAdV-52, cause keratoconjunctivitis (HAdVs 8, 19 and 37) and respiratory infection (BAdV-3). This could suggest that interaction with sialic acid could be a common feature for adenoviruses that infect ocular and respiratory tracts. Nevertheless, HAdV-52, which is associated with gastroenteritis and is highly divergent from other HAdVs (Jones et al., 2007), uses sialic containing glycoproteins in addition to CAR. The unique feature of EAdV-2 and HAdV-52 being able to bind to sialic acid, indicates that the α(2, 6)-linked sialic acids may have a role in initiating infections in the digestive tract. Given the broad distribution of sialic acids in mammalian cells (Varki & Schauer, 2009), the reason for the limited tropism of EAdV-2 is likely to be a step in the replication cycle following virus attachment, or during cell to cell spread.

The possibility that EAdV-2 can have interactions with glycans containing α(2, 3) linked sialic acids, however, remain possible. In fact, the ability of the MAA, an α(2, 3) linked sialic acid binding lectin, to enhance both EAdV-1 and EAdV-2 infections was unexpected. These observations were somewhat consistent in the CPE inhibition assay in which titres of EAdV-2 increased by 0.5 log10 unit. The enhancement effect of MAA has yet to be investigated in detail. However, a possible explanation for these results might be due to the specific binding of MAA to EFK cell surfaces as well as EAdV-1 and/or EAdV-2. This might suggest that a MAA-binding cell surface sialic acid is available on EFK cells, which after interaction with MAA would concentrate EAdV-1 and EAdV-2 on the surface of EFK cells. Similar lectin-dependent enhancement of viral infectivity has been observed previously. For example, Maackia amurensis leukoagglutinin (MAL), a lectin that recognizes the α(2,3) linked sialic acids, was found to enhance Tulane virus infectivity by binding to both LLC-MK2 cells and Tulane virus (Tan et al., 2015). Similarly, mannose-binding lectin (MBL) is able to interact directly to N-linked glycan epitopes on Ebola virus surface and the transmembrane lectin receptors on host cells, which is necessary for enhanced Ebola virus infection (Brudner et al., 2013).

The observation that EAdV-2 infection is inhibited by VCAM-1 blocking experiment suggested that α4β1 integrins also facilitate EAdV-2 infection of the host cell, in addition to primary receptors. There have been studies in other viruses to investigate whether 145 integrins are used as primary or secondary receptors for internalisation. Integrin α4β1 is used by murine polyomavirus as secondary receptor (Caruso et al., 2003), whereas integrin α5β3 is used by foot and mouth disease virus (Jackson et al., 2000) and α5β5 is used by BAdV-3 and HAdV-5 (Bangari et al., 2005; Lyle & McCormick, 2010) as primary attachment receptors. In the case of EAdV-2, the order of receptor usage is not yet clear, although the integrin interaction may occur via LDV sequence present in the penton base of EAdV-2 protein. However, it is possible that the α4β1 integrins can be part of the sialic acid receptors due to the fact that both α4 and β1 subunits carry terminal sialic acids (Hemler et al., 1985; Hewish et al., 2000). As the α4β1 heterodimer expression is restricted to leukocytes, the usage of α4β1 suggests that EAdV-2 might use

α4β1 to interact with these cells. Human and murine rotavirus infections result in a + circulating memory T and B cells that express α4β7 , respectively (Rott et al., 1997; Williams et al., 1998). Hence, it is possible that intestinal-homing immune cells that express the α4 integrins contribute to EAdV-2 spread within the intestine and possibly to other lymphoid tissues. However, the fact that EAdV-2 recognizes the α4β1 but not α4β7, suggests that both the α4 and β1 subunit combinations are important a strategy different from human rotaviruses. It has also been shown that several human and monkey rotaviruses use α4β1 and α4β7 for cell binding, through recognition of the same α4- subunit domains (Graham et al., 2005).

Heparan sulfates are most abundant among glycosaminoglycans (GAG) on the cell surface and commonly used by many viruses, including adenoviruses, to bind to target cells (Germi et al., 2002; Tan et al., 2015; Tuve et al., 2008). The results in this study demonstrate that in addition to carbohydrate functional groups, cell surface HS mediate EAdV-1 entry based on the following evidence: (i) attachment and infection are competitively inhibited by pre-incubation of the virus with HS; in a dose-dependent manner; (ii) enzymatic removal of cell surface HS using heparinase I and III pre- treatment significantly reduced infection. Heparan sulphate is also used by members of adenoviruses (Dechecchi et al., 2000; Tuve et al., 2008), porcine circovirus-2 (PCV-2) (Misinzo et al., 2006), Coxsackievirus A24 variant (CVA24v) (Mistry et al., 2011), picornaviruses (Goodfellow et al., 2001; Jackson et al., 2000), papillomaviruses (Giroglou et al., 2001; Selinka et al., 2002), herpesviruses (Shukla & Spear, 2001) and respiratory syncytial virus (Hallak et al., 2000) for attachment. For example, HAdV-3 interacts with sulfated HS via its fibre knob and acted as low-affinity coreceptors. 146

Similarly, HAdV-35 causes sulfated HS dependent infection though, the primary receptor is CD46 (Tuve et al., 2008). The interaction in HAdV-35 was not however, via the fibre knob but rather was via other viral proteins. The observation that more inhibition of EAdV-1 was induced by heparinase III than by heparinase I pre-treatments suggests that EAdV-1 had a preference towards HS which has lower degree of sulfation than heparin (Laremore et al., 2009). Taken together, these data indicated that HS, which is abundantly expressed on cell surfaces, is likely to play a crucial role in promoting EAdV-1 infection of target cells.

More than one receptor moiety are used for infection by a range of viruses, thus complicating the identification of specific entry receptors due to the ability of the virus to enter cells via multiple pathways. In this study, HS was clearly involved in the interaction between EFK cells and EAdV-1 (as discussed above), and yet other cell surface components, such as sialic acids, also appear to be involved. The role of the sialic acids in the infectious process of EAdV-1 requires further investigation but a number of observations in these studies point to the involvement of sialic acids in

EAdV-1 attachment and infection. Firstly, NaIO4 and neuraminidase treatments demonstrated a broad inhibitory activity on EAdV-1 attachment and infections, suggesting that carbohydrate functional groups, more specifically sialyalted glycans, are involved in attachment. Secondly, the decreased titre indicated that the replication of EAdV-1 in EFK cells was decreased by neuraminidase treatment, compared with virus alone; strengthening the findings that neuraminidase treatment affects EAdV-1 infection. Thirdly, the results from experiments using NANA inhibitors clearly demonstrated that sialic acids containing monosacchride efficiently reduced infection.

Further characterising the cell surface sialic acids using lectins did not clearly indicate the nature of specific sialic acid linkages. The observed inhibitory effect of SNA treatment at a higher concentration, despite an enhancement effect at a lower concentration, could be due to a physical barrier obstructing virion engagement of the cell membrane, or aggregation of the virion at higher concentrations of SNA (Chen et al., 2014). SNA has strongly inhibited infection of cells by infectious bronchitis virus by clustering together into large aggregates and damaging the membrane, rendering the virus non-infectious (Chen et al., 2014). Similar to that of EAdV-2, the findings from MAA blocking experiment for EAdV-1 also did not provide sufficient rationale to 147 conclude that EAdV-1 employs α(2, 3)-linked sialic acids in the attachment process. Given the strong evidence for sialic acids playing a role in the EAdV-1 attachment, as indicated by NaIO4 and neuraminidase treatments, it may be useful to hypothesise that α(2, 3)-linked sialic acid-containing N-glycans from contribute to EAdV-1 attachment to and infection of EFK cells. However, it is likely that other types of sialic acid- containing glycans or sugar chains may also contribute. Further investigation into the interactions between EAdV-1 and glycans with an α(2, 8)-linked sialic acid or internal sialic acids would help to understand these specific interactions.

Unlike EAdV-2, EAdV-1 penton base lacks integrin-binding RGD or LDV motif and it appears that EAdV-1 recognition of α4β1 and α4β7 integrins was unaffected by a cellular treatment with both VCAM-1 and MAdCAM-1. These observations suggested that interaction with α4β1 and α4β7 integrin molecules may not be important for EAdV-1 infectivity or that other motifs in the EAdV-1 capsid probably aid attachment and internalisation (Hautala et al., 1998). Adenoviruses, such as CAdV-2, however, could bind integrins when tested in cells selectively expressing α5β5 and α5β3, even in the absence of the RGD motif (Soudais et al., 2000), indicating the possibilities of EAdV-1 interaction with other integrin subunits for infection.

In conclusion, the results presented in this chapter provide preliminary data on the types of receptor molecules that may be involved in EAdV-1.M1 and EAdV-2-385/75.4 infectious process in EFK cells and indicated that multiple cell surface receptors, either independently or in cooperation with each other are used by both viruses to infect the host cell. On subsequent assays, the types of cell surface receptors employed by the two viruses were found to be distinct. The results have shown clearly that HS and sialic acids are involved in EAdV-1 and EAdV-2 attachment, respectively, and these interactions probably occur via the primary fibre - receptor interaction, leading to subsequent engagement with other receptors required for virus entry. The hypothesis that EAdV-1 and EAdV-2 would require another cell entry receptor is supported by the fact that EAdV-1 and EAdV-2 infections were inhibited by NaIO4/neuraminidase and VCAM-1 treatments, respectively. Whether sialic acids or another glycan receptor is involved in EAdV-1 infection, and how MAA interacts with EAdV-1 and EAdV-2, remains to be explored in the future experiments. The attachment of EAdVs to sialic acid expressing and sialic acid defective CHO cells could also be evaluated. 148

Table 6.1: Summary of biochemical treatments, ligands used in this study.

Treatment Concentrations Incubation time, Side chain specificities temperature o Sodium periodate (NaIO4) 0.001, 0.01 or 0.1 mM 1hr, 37 C Neuraminidase (Clostridium 0.1, 1 or 10 mU 1hr, 37oC Neu5Acα2-3Gal> Neu5Acα2-6Gal =Neu5Acα2-8Gala perfringes) N-acetylneuraminic acid (NANA) 10, 40 mM 30 min, 4oC Neu5Ac Lactose 40, 200 mM 30 min, 4oC Glucose 40, 200 mM 30 min, 4oC Lectins o Wheat germ agglutinin (WGA) 10, 100 or 200 µg/ml 30 min, 4 C NeuAc,GlcNAc,(GlcNAc)n Mackia amurensis (MAA) 10, 100 or 200 µg/ml 30 min, 4oC NeuAcα2-3Gal/GalNAc Sambucus nigra agglutinin (SNA) 10, 100 or 200 µg/ml 30 min, 4oC NeuAcα2-6Gal/GalNAc Concanavalin A (ConA) 100 or 200 µg/ml 30 min, 4oC α-mannose, α-glucose Glycoconjugate Heparan sulfate (HS) 1, 10 or 100 µg/ml 30 min, 37oC Heparinase I 1, 2.5, or 5 U 30 min, 37oC heparin and heparan sulfate at the linkages between hexosamines and O-sulfated iduronic acids Heparinase III 1, 2.5, or 5 U 30 min, 37oC HS at the 1,4 linkages between hexosamine and glucuronic acid residues a sugar specificities of CP neuraminidase is listed in order of their cleavage preference (Kobata & Fukuda, 1993).

149

Table 6.1: Contd...

Ligands Concentrations Incubation time, temperature Integrin recognition o b Vascular cell adhesion molecule 1(VCAM-1) 1, 5, or 10 µg/ml 30 min, 37 C α4β1 > α4β7 o Mucosal adressin cell adhesion molecule 1, 5, or 10 µg/ml 30 min, 37 C α4β7 1(MAdCAM-1) Proteins Recombinant EAdV-2 fibre knob 0.1, 1,10 µg/ml 30 min, 37oC Anti-CAR antibodies 1, 5 or 10 µg/ml 30 min, 37oC b integrins were listed in order of their VCAM-1 recognition preference (Newham et al., 1997).

150

Table 6.2: Effect of different treatments on the titre of EAdV-2 and EAdV-1 in infected

EFK cells determined by TCID50/ml assay.

Biochemical TCID50 /ml * Log10 change in titre by

(concentration) (log10) treatment EAdV-1 EAdV-2 EAdV-1 EAdV-2

Untreated 8 8 -ᶲ -ᶲ Neuraminidase (10 mU) 5 6 -3 -2 MAA (10 µg/ml) 7.5 8.5 -0.5 +0.5 MAA (100 µg/ml) 9 8.5 +1 +0.5 SNA(10 µg/ml) 8 7 -ᶲ -1 SNA (100 µg/ml) 8 6 -ᶲ -2 WGA (10 µg/ml) 8.5 8 +0.5 -ᶲ

* represents the titre of virus (TCID50 /ml) in treated and untreated cells and was determined using Reed and Muench (Reed & Muench, 1938); ᶲ No titre change.

Table 6.3: Inhibition of EAdV-1 and EAdV-2 infectivity by different sugars and lectin.

Treatment Inhibitor concentration Infectivity (ratio compared to mock) * EAdV-1 EAdV-2

Glucose 200 mM 0.58 0.91 Lactose 200 mM 0.97 0.20 NANA 40 mM 0.53 1.46 ConA 200 µg/ml 0.50 0.26 * Result is expressed as a ratio of the amount of infectivity observed in treated cells over the mock treated control cells (refer Section 2.2.3).

151

Table 6.4: Summary of different treatments on equine adenovirus infections to EFK cells.

Pre-incubated with EAdV-1 EAdV-2 Antiviral antibody Rat antiserum to EAdV-1 virion Virus Reduced Reduced Rat antiserum to EAdV-2 virion Virus Reduced Reduced Rat antiserum to EAdV-2 fibre Virus No change Reduced knob Pre-immune rat serum Virus No change No change Treatments affecting sialic NaIO4 Cells Reduced Reduced acids Neuraminidase Cells Reduced/ Reduced* Reduced/ Reduced* WGA Cells Enhanced /Enhanced* Reduced/ Reduced* SNA Cells Enhanced/ No change* Reduced/ Reduced* MAA Cells Enhanced/ Enhanced* Enhanced/ Enhanced* NANA Cells Reduced Enhanced Treatments affecting HS- NaIO4 Cells Reduced Reduced GAG HS Cells Reduced No change Heparinase I Cells Reduced No change Heparinase III Cells Reduced No change *Results shown for both IFA and CPE inhibition assay in order (IFA/CPE)

152

Table 6.4: Contd… Pre-incubated with EAdV-1 EAdV-2 Treatments targeting VCAM-1 Cells No change Reduced integrins and CAR MAdCAM-1 Cells No change No change CAR-antibody Cells No change No change Others EAdV-2 fibre knob protein Cells No change Reduced Lactose Cells No change Reduced Glucose Cells Reduced No change ConA Cells Reduced Reduced

153

Figure 6.1: Inhibition of (A) EAdV-1 and (B) EAdV-2 infectivity in EFK cells using rat polyclonal sera against EAdV-1, EAdV-2, pre- immune or EAdV-2 fibre knob. Dilutions of sera were pre-incubated with (A) EAdV-1 or (B) EAdV-2 at 37°C for 1 hr, prior to incubation with EFKs for 1 hr with at 37°C and use in the immunofluorescence infectivity assay (Section 2.2.3). All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%).

154

Figure 6.2: The effect of fibre knob protein on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-incubated with fibre knob protein for 30 min at 37°C. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-incubated with and without fibre knob protein were analysed by immunofluorescence assay with rat antisera to (A) EAdV-1 and (B) EAdV-2 virion. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

155

Figure 6.3: The effect of NaIO4 pre-treatment of EFK cells on the infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-treated with increasing concentrations of NaIO4 (0.001, 0.01 and 0.1 mM) on ice for 30 min, prior to inactivation by glycerol, washing of monolayers and virus incubation. Mock treated cells are those treated with a solution where the NaIO4 was pre-incubated with the glycerol inactivation buffer prior to incubation with the cells. Cells mock-treated or NaIO4 treated were analysed by immunofluorescence assay with rat antiserum to (A) EAdV-1 and (B) EAdV-2 virions. Experiments were performed independently at least three times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

156

Figure 6.4: The effect of neuraminidase treatment on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were treated with increasing concentration of neuraminidase for 1 hr min at 37°C. (A) EAdV-1 or (B) EAdV-2 were then added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-treated with and without neuraminidase were analysed by immunofluorescence assay with rat antiserum to (A) EAdV-1 and (B) EAdV-2. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

157

Figure 6.5: The effect of WGA treatment on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were treated with increasing concentration of WGA for 30 min on ice. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-treated with and without WGA were analysed by immunofluorescence assay with rat antiserum to (A) EAdV-1 and (B) EAdV-2 virions. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio (ratio) ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

158

Figure 6.6: The effect of MAA treatment on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were treated with increasing concentration of WGA for 30 min on ice. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-treated with and without MAA were analysed by immunofluorescence assay with rat antiserum to (A) EAdV-1 and (B) EAdV-2 virions. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

159

Figure 6.7: The effect of SNA treatment on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were treated with increasing concentration of SNA for 30 min on ice. (A) EAdV-1 or (B) EAdV-2 virions were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-treated with and without SNA were analysed by immunofluorescence assay with rat antiserum to (A) EAdV-1 and (B) EAdV-2 virions. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

160

Figure 6.8: The effect of MAA or SNA treatment of EFK cells on the infection by EAdV-1 or EAdV-2. EFK cells were incubated with the indicated concentrations of MAA or SNA and infected with indicated viruses. At 24 hrs (EAdV-1) or 48 hrs (EAdV-2) post infection, the presences of infected cells were revealed by immunofluorescence using virus specific sera. The experiments were performed at least two times and representative images (x 200) are shown.

161

Figure 6.9: The effect of HS treatment on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-incubated with HS for 30 min at 37°C. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre- treated with and without HS were analysed by immunofluorescence assay with rat antiserum to (A) EAdV-1 and (B) EAdV-2 virion. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

162

Figure 6.10: The effect of heparinase I treatment on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-treated with heparinase I for 1 hr at 37°C. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-treated with and without of heparinase I were analysed by immunofluorescence assay with rat antisera to (A) EAdV-1 and (B) EAdV-2 virion. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

163

Figure 6.11: The effect of heparinase III treatment on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-treated with heparinase III for 1 hr at 37°C. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-treated with and without of heparinase III were analysed by immunofluorescence assay with rat polyclonal antibody against (A) EAdV-1 and (B) EAdV-2 virion. The experiment was performed once. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

164

Figure 6.12: The effect of HS treatment of EFK cells on the infection by EAdV-1 or EAdV-2. EFK cells were incubated with the indicated concentration of HS and infected with indicated viruses. At 24 hrs (EAdV-1) or 48 hrs (EAdV-2) post infection, the presences of infected cells were revealed by immunofluorescence using virus specific sera. The experiments were performed at least two times and representative images (x 200) are shown.

165

Figure 6.13: The effect of VCAM-1 on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-incubated with VCAM-1 for 30 min on ice. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre-treated with and without VCAM-1 were analysed by immunofluorescence assay with rat antisera to (A) EAdV-1 and (B) EAdV-2 virion. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

166

Figure 6.14: The effect of MAdCAM-1 on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-incubated with MAdCAM-1 for 30 min at 37°C. (A) EAdV-1 or (B) EAdV-2 were added and incubated further for 1 hr at 37°C and washed to remove unbound virions. Cells pre- treated with and without MAdCAM-1 were analysed by immunofluorescence assay with rat polyclonal antibody against (A) EAdV-1 and (B) EAdV-2 virion. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

167

Figure 6.15: Level of CAR expression in various cell lines. The cell lysates were separated by 12% SDS-PAGE under reducing conditions, transferred into PVDF membrane, and analysed by a Western blot using polyclonal mouse anti-human CAR antibody (H-300) (diluted 1:200) and a secondary HRP conjugated anti-mouse antibody. The signal was detected using the Molecular Imager®chemiDoc™XRS+ imaging system (Bio-Rad).

168

Figure 6.16: The effect of anti-CAR antibody on infectivity of (A) EAdV-1 and (B) EAdV-2. EFK cells were pre-incubated with anti-CAR (H- 300) antibody for 30 min at 37°C. (A) EAdV-1 and (B) EAdV-2 were then added and incubated further for 1 hr at 37°C. Cells pre-treated with and without anti-CAR antibody were analysed by immunofluorescence assay with rat antisera to (A) EAdV-1 and (B) EAdV-2 virion. All experiments were performed independently at least two times and presented separately. Error bars represent the ratio ± CI (95%). Asterisks show significant differences in the ratios between mock and treatment (*p < 0.05, ** p < 0.01 and ***p < 0.001).

169

CHAPTER SEVEN

GENERAL DISCUSSION

Although the first equine adenovirus was discovered in the 1960s, these viruses have not yet been comprehensively studied. This is particularly true for EAdV-2, with little or no information available on its occurrence, genetic information and tissue specificity. Thus, the primary focus of the work presented in this thesis was to develop and evaluate a serotype specific qPCR assay for the detection of EAdV-2, to characterise the full genome of EAdV-2 and to carry out biochemical characterisation of the host receptors used by EAdV-1 and EAdV-2. The studies undertaken and reported in this thesis have clearly indicated the unique nature of EAdV-2.385/75.4 genome among members of the Mastadenovirus genus. These studies have also demonstrated the low rate of EAdV-2 detection in clinical samples, as well as differences in the host receptors used by EAdV- 1 compared to EAdV-2.

At the time this study commenced, the availability of only a small amount of genome sequence information for EAdV-2 required the whole genome sequencing and analysis be performed to provide information on locations of putative virus genes and binding domains, as well as its relationship with other species of adenoviruses. Furthermore, animal adenoviruses are increasingly being considered as alternative biomedical tools, particularly as vectors for epitope and gene delivery, due to concerns of pre-existing neutralising antibodies to human adenoviruses, and also the possibility of recombination among human adenoviruses (Bangari & Mittal, 2004; Reddy et al., 1999b; Xu et al., 1997). The full genome sequence of EAdV2-385/75.4, which represents one of the two EAdV-2 isolated from diarrheic foals, was fully sequenced in this study and compared to the genome sequences of other adenoviruses. Looking broadly across the genome, regions coding for fibre, E3 as well as E4 transcription units were distinctly hypervariable. In addition, the 5’-end of the genome contains two additional ORFs, instead of the E1 transcription unit found in most mammalian adenoviruses. In the family Adenoviridae, a new adenovirus species can be assigned if it has a > 15% phylogenetic distance based on DNA polymerase protein compared with previously characterised adenovirus species (Harrach, 2011). Equine adenovirus 2 has comparable genome organisation with other members of the Mastadenovirus genus, and contains

170 conserved Mastadenovirus specific genes such as PV and 34K, and pIX fused to E1B- 55K. Also, EAdV2-385/75.4 has shown > 30% distance to any other predicted DNA pol amino acid sequence, suggesting that this adenovirus represents a unique species within the Mastadenovirus genus.

Homologous recombination plays a major role for the maintenance of genome fitness and diversity among HAdVs (Robinson et al., 2013; Walsh et al., 2009; Walsh et al., 2010) allowing exchange of those regions of the genome most susceptible to immune pressures from the host. Despite the absence of any detectable recombination event in the EAdV-2 sequence, the results from phylogenetic analysis demonstrated the closest evolutionary relationship between EAdV-2 and TsAdV-1. The genesis of this evolutionary relationship may occur from a common evolutionary ancestor, a species jumps or a recombination event. It is conceivable from this data that EAdV-2 underwent evolutionary changes to adapt to a new biological host and perhaps diverged at an earlier time point. A recombination event would require co-infection of the same host cell by at least two genotypes (McCarthy et al., 2009; Robinson et al., 2013). The limited number of available EAdV full genome sequences limits the ability to investigate recombination among equine adenoviruses. Hence, increased numbers of full genome EAdV sequences from clinical isolates may enable a more comprehensive analysis of recombination. Analysis of sequence data sets from an independent source of isolation and geographical location from all over the world, would address recombination events specifically.

The studies undertaken in this thesis will contribute to improved EAdV-2 detection capability. Cell culture and serology are used for detection and identification of equine adenoviruses from clinical samples. These diagnostic tests, however, have their own inherent advantages and limitations. Firstly, EAdV-2 has poor cultivability, so in vitro cultivation may fail to identify the virus. Secondly, as antibodies can circulate for a variable time, serology requires repeated sampling (acute and convalescent serum samples) to demonstrate seroconversion and confirm recent infection. Thirdly, antibodies to antigenically related agents may cause confusion due to false positive reactions. In some instances, the EAdV-2 virus have been shown to have some level of cross-reaction with other adenovirus, such as EAdV-1 (Giles et al., 2010). Nevertheless, cell culture still provides a useful means of EAdV-2 detection. An alternative method, 171 such as qPCR, that can detect pathogen-specific nucleic acid directly from faecal samples from a single time point may offer more sensitivity and specificity. The data from the current study indicates that using primers targeting regions of variation in the hexon gene, which is the main antigenic determinant, along with assay optimisation and performance evaluation provide a more robust method to detect virus directly from faecal samples. In addition, the association of EAdV-2 with foal diarrhea is directly attributed to the isolation this virus from faeces often from samples that also contained high level of equine rotavirus. It is possible that other organs such as lymphoid, respiratory and ocular tissues could be also involved in EAdV-2 pathogenesis, as observed for EAdV-1. The greater sensitivity provided by qPCR may enable the detection of EAdV-2 DNA from swab samples taken from respiratory and eye infections. By making use of high throughput and broader sample applications in the early or subclinical states of the disease, the use of qPCR to detect and quantitate EAdV-2 can ultimately enhance our understanding regarding EAdV-2 infections. Future studies utilising known EAdV-2 positive clinical samples to evaluate the qPCR diagnostic sensitivity and specificity would help to improve further its applications.

The development of effective therapeutics and vaccines depends on advances in understanding the molecular pathogenesis of viral and bacterial infections and better characterisation of the pathogen-host interactions. The work completed in this thesis has demonstrated that EAdV-1 and EAdV-2 use multiple receptors, including HS and sialic acids, to bind to their target cells. This has been previously demonstrated for several other adenoviruses, such as MAdV-1 (Raman et al., 2009), HAdV-2 and -5 (Dechecchi et al., 2001; Dechecchi et al., 2000), to bind to their target cells. With respect to EAdV- 1, HS is likely to play a crucial role in promoting EAdV-1 infection of EFK cells, as cleavage and competitive inhibition of HS reduces infection. While HS expressed on the surface of cells is sufficient for binding, leading to infection in some viruses such as HAdV-2/5 (Dechecchi et al., 2001), it was clearly demonstrated that HS was not a major receptor, but acted as low- affinity co-receptor in the infection of cells by herpes simplex virus type 1 (HSV-1) and adeno-associated parvovirus type 2 (Summerford & Samulski, 1998; WuDunn & Spear, 1989). It is possible that EAdV-1 uses HS to initiate respiratory and corneal infections as HS is also used by HAdV-3 and -35, which are increasingly associated with outbreaks of acute respiratory disease (Tuve et al., 2008). EAdV-1, like the above mentioned human adenovirus serotypes, infects respiratory and 172 corneal tissues. The role of cell surface HS-GAGs as a receptor, however, varies depending on the sulfation levels and patterns. The results observed following the removal of HS by enzymatic treatment of EFK cells led to a significant reduction in the level of EAdV-1 infection and indicated a requirement for low sulfation levels. Hepatitis E and respiratory syncytial viruses bind to HS as a function of their degree of sulfation (Kalia et al., 2009; Martinez & Melero, 2000). Future experiments, involving treatment of cells with sodium chlorate and chemically modified heparin, would help to substantiate the relevance of sulfation level and pattern for EAdV-1 infection, respectively (Chung et al., 1998; Herold et al., 1996; Kalia et al., 2009; Qiu et al., 2000). For EAdV-1, data suggested the involvement of sialic acid as a second receptor molecule, although the type of sialic acid used was not clarified in this study. Nevertheless, the involvement of carbohydrate functional groups seems likely, since enzymatic removal of sialic acids or blocking experiments, with exception of lectin- mediated blocking, has shown some level of inhibitory effect. In addition, none of the above treatments totally blocked EAdV-1 infection, indicating the involvement of multiple receptors.

The best characterised model of adenovirus infection requires binding to the primary receptor for subsequent interaction with integrins to initiate viral entry. The integrin blocking studies demonstrated the possibility that EAdV-2 requires a co-receptor, α4β1 integrin, for infection. However, it is possible that the integrin α4β1 could act alone as a primary receptor for EAdV-2. For example, using competition experiments between the whole virus and soluble viral fibre protein or integrin blocking peptides, HAdV-5 binding to the cells is not dependent on fibre binding to the primary receptor (CAR) but rather penton base binding to α5β5 integrins, previously described as the internalisation receptor (Lyle & McCormick, 2010). Future studies using cells which express little or no sialic acid containing molecules would be helpful to unravel whether the integrins are used by EAdV-2 as secondary receptors.

The work presented in this thesis has contributed to the development of a quantitative PCR method suitable for routine detection and epidemiologic investigation of EAdV-2 infections. Furthermore, the study complements the new knowledge on the full genome structure and putative genes of EAdV-2 through rigorous comparative sequence analysis. In doing so, it has also helped to produce recombinant protein (EAdV-2 fibre 173 knob protein) that would be useful as diagnostic reagent for detection of viral antigens. Finally, the thesis has elucidated the mechanisms by which EAdVs interact with their receptor using EFK cells, therefore advancing our knowledge of the EAdV-host interactions. Further works to determine cell types that can be transduced by EAdV-2 vector or exploring its bio-distribution in animal model would help to harness the potential of EAdV-2 as a vector for therapeutic use in human or other animals.

174

REFERENCES

Adair, B. M., & Fitzgerald, S. D. (2008). Group I adenovirus infections. In: Y. Saif, A. Fadly, J. Glisson, L. McDougald, L. Nolan, & D. Swayne (Eds.), Diseases of Poultry, 12th ed., pp. 251-266: Blackwell Publishing.

Afshar, A. (1969). Occurrence of precipitating antibodies to bovine adenovirus in sera of farm animals and man in Iran. Veterinary record, 84(23), 571-572.

Albinsson, B., & Kidd, A. H. (1999). Adenovirus type 41 lacks an RGD α v-integrin binding motif on the penton base and undergoes delayed uptake in A549 cells. Virus Research, 64(2), 125-136.

Ali, H., LeRoy, G., Bridge, G., & Flint, S. (2007). The adenovirus L4 33-kilodalton protein binds to intragenic sequences of the major late promoter required for late phase-specific stimulation of transcription. Journal of Virology, 81(3), 1327- 1338.

Allard, A., Albinsson, B., & Wadell, G. (1992). Detection of adenoviruses in stools from healthy persons and patients with diarrhea by two-step polymerase chain reaction. Journal of Medical Virology, 37(2), 149-157.

Allard, A., Girones, R., Juto, P., & Wadell, G. (1990). Polymerase chain reaction for detection of adenoviruses in stool samples. Journal of Clinical Microbiology, 28(12), 2659-2667.

Alvarez, R. D., Barnes, M. N., Gomez-Navarro, J., Wang, M., Strong, T. V., Arafat, W., Arani, R. B., Johnson, M. R., Roberts, B. L., Siegal, G. P., & Curiel, D. T. (2000). A cancer gene therapy approach utilizing an anti-erbB-2 single-chain antibody-encoding Adenovirus (AD21): A phase I trial. Clinical Cancer Research, 6(8), 3081.

Ardans, A. A., Pritchett, R. F., & Zee, Y. C. (1973). Isolation and characterization of an equine adenovirus. Infection and immunity, 7(4), 673-677.

Arnberg, N., Kidd, A. H., Edlund, K., Olfat, F., & Wadell, G. (2000). Initial interactions of subgenus D adenoviruses with A549 cellular receptors: sialic acid versus alpha(v) integrins. Journal of Virology, 74(16), 7691-7693.

Arnberg, N., Pring-Akerblom, P., & Wadell, G. (2002). Adenovirus type 37 uses sialic acid as a cellular receptor on Chang C cells. Journal of Virology, 76(17), 8834- 8841.

Athappily, F. K., Murali, R., Rux, J. J., Cai, Z., & Burnett, R. M. (1994). The refined crystal structure of hexon, the major coat protein of adenovirus type 2, at 2·9 å resolution. Journal of Molecular Biology, 242(4), 430-455.

Bai, M., Harfe, B., & Freimuth, P. (1993). Mutations that alter an Arg-Gly-Asp (RGD) sequence in the adenovirus type 2 penton base protein abolish its cell-rounding activity and delay virus reproduction in flat cells. Journal of Virology, 67(9), 5198-5205.

175

Balboni, A., Dondi, F., Prosperi, S., & Battilani, M. (2015). Development of a SYBR Green real-time PCR assay with melting curve analysis for simultaneous detection and differentiation of canine adenovirus type 1 and type 2. Journal of virological methods, 222, 34-40.

Bandara, L. R., & La Thangue, N. B. (1991). Adenovirus E1a prevents the retinoblastoma gene product from complexing with a cellular transcription factor. Nature, 351(6326), 494-497.

Bangari, D. S., & Mittal, S. K. (2004). Porcine adenoviral vectors evade preexisting humoral immunity to adenoviruses and efficiently infect both human and murine cells in culture. Virus Research, 105(2), 127-136.

Bangari, D. S., Sharma, A., & Mittal, S. K. (2005). Bovine adenovirus type 3 internalization is independent of primary receptors of human adenovirus type 5 and porcine adenovirus type 3. Biochemical and Biophysical Research Communications, 331(4), 1478-1484.

Bauer, H., & Wigand, R. (1963). Properties of adenovirus hemagglutinins. Zeitschrift für Hygiene und Infektionskrankheiten, 149, 96-113.

Beach, N., Duncan, R., Larsen, C., Meng, X.-J., Sriranganathan, N., & Pierson, F. W. (2009). Comparison of 12 turkey hemorrhagic enteritis virus isolates allows prediction of genetic factors affecting virulence. Journal of General Virology, 90(8), 1978-1985.

Beljelarskaya, S. N. (2011). Baculovirus expression systems for production of recombinant proteins in insect and mammalian cells. Molecular Biology, 45(1), 123-138.

Bell, S. A., Leclere, M., Gardner, I. A., & Maclachlan, N. J. (2006). Equine adenovirus 1 infection of hospitalised and healthy foals and horses. Equine Veterinary Journal, 38(4), 379-381.

Benfield, D. A. (1990). Enteric adenovirus infections of animals. Viral Diarrheas of Man and Animals, pp. 115-135: CRC Press Boca Raton.

Benko, M., Elo, P., Ursu, K., Ahne, W., LaPatra, S. E., Thomson, D., & Harrach, B. (2002). First molecular evidence for the existence of distinct fish and snake adenoviruses. Journal of Virology, 76(19), 10056-10059.

Benko, M., & Harrach, B. (2003). Molecular evolution of adenoviruses. Current Topics Microbiololgy and Immunolology, 272, 3-35.

Benkö, M., & Harrach, B. (1998). A proposal for a new (third) genus within the family Adenoviridae. Archives of Virology, 143(4), 829-837.

Benko, M., Harrach, B., Both, G., Russell, W., Adair, B., Adam, E., De Jong, J., Hess, M., Johnson, M., & Kajon, A. (2005). Adenoviridae. In: C. Fauquet, M. Mayo, J. Maniloff, U. Desselberger, & L. Ball (Eds.), Virus Taxonomy: Eighth report of the inetrnational committie on the taxonomy of viruses, pp. 213-228, San Diego: Academic Place.

176

Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L., & Finberg, R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science, 275(5304), 1320-1323.

Berk, A. J. (2007). Adenoviridae: the viruses and their replication. In: B. N. Fields, D. M. Knipe, & H. P.M (Eds.), Fields Virology, 5th ed., pp. 2355–2394, Philadelphia: Wolters Kluwer Health/Lippincott Williams &Wilkins.

Bewley, M. C., Springer, K., Zhang, Y. B., Freimuth, P., & Flanagan, J. M. (1999). Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science, 286(5444), 1579-1583.

Bhavanandan, V. P., & Katlic, A. W. (1979). The interaction of wheat germ agglutinin with sialoglycoproteins. The role of sialic acid. Journal of Biological Chemistry, 254(10), 4000-4008.

Bonot, S., Courtois, S., Block, J. C., & Merlin, C. (2010). Improving the recovery of qPCR-grade DNA from sludge and sediment. Applied Microbiology and Biotechnology, 87(6), 2303-2311.

Both, G. W. (2002). Identification of a Unique Family of F-Box Proteins in Atadenoviruses. Virology, 304(2), 425-433.

Both, G. W. (2004). Ovine atadenovirus: a review of its biology, biosafety profile and application as a gene delivery vector. Immunololgy and Cell Biolology, 82(2), 189-195.

Bremner, K. H., Scherer, J., Yi, J., Vershinin, M., Gross, S. P., & Vallee, R. B. (2009). Adenovirus transport via direct interaction of cytoplasmic dynein with the viral capsid hexon subunit. Cell host & microbe, 6(6), 523-535.

Browning, G. F., & Begg, A. P. (1996). Prevalence of G and P serotypes among equine rotaviruses in the faeces of diarrhoeic foals. Archives of Virology, 141(6), 1077- 1089.

Brudner, M., Karpel, M., Lear, C., Chen, L., Yantosca, L. M., Scully, C., Sarraju, A., Sokolovska, A., Zariffard, M. R., Eisen, D. P., Mungall, B. A., Kotton, D. N., Omari, A., Huang, I. C., Farzan, M., Takahashi, K., Stuart, L., Stahl, G. L., Ezekowitz, A. B., Spear, G. T., Olinger, G. G., Schmidt, E. V., & Michelow, I. C. (2013). Lectin-dependent enhancement of Ebola virus infection via soluble and transmembrane C-type lectin receptors. PLoS One, 8(4), e60838.

Büll, C., den Brok, M. H., & Adema, G. J. (2014). Sweet escape: Sialic acids in tumor immune evasion. Reviews on Cancer, 1846(1), 238-246.

Burmeister, W. P., Guilligay, D., Cusack, S., Wadell, G., & Arnberg, N. (2004). Crystal structure of species D adenovirus fiber knobs and their sialic acid binding sites. Journal of Virology, 78(14), 7727-7736.

177

Burns, M., & Valdivia, H. (2008). Modelling the limit of detection in real-time quantitative PCR. European Food Research and Technology, 226(6), 1513- 1524.

Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M. W., Shipley, G. L., Vandesompele, J., & Wittwer, C. T. (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clininical Chemistry, 55(4), 611-622.

Caillet-Boudin, M. L. (1989). Complementary peptide sequences in partner proteins of the adenovirus capsid. Journal of Molecular Biology, 208(1), 195-198.

Caraguel, C. G., Stryhn, H., Gagne, N., Dohoo, I. R., & Hammell, K. L. (2011). Selection of a cutoff value for real-time polymerase chain reaction results to fit a diagnostic purpose: analytical and epidemiologic approaches. Journal of Veterinary Diagnostic Investigation, 23(1), 2-15.

Caruso, M., Belloni, L., Sthandier, O., Amati, P., & Garcia, M.-I. (2003). α4β1 integrin acts as a cell receptor for Murine polyomavirus at the postattachment level. Journal of Virology, 77(7), 3913-3921.

Cassany, A., Ragues, J., Guan, T., Bégu, D., Wodrich, H., Kann, M., Nemerow, G. R., & Gerace, L. (2015). Nuclear import of adenovirus DNA involves direct interaction of hexon with an N-terminal domain of the nucleoporin Nup214. Journal of Virology, 89(3), 1719-1730.

Cavanagh, H. M., Mahony, T. J., & Vanniasinkam, T. (2012). Genetic characterization of equine adenovirus type 1. Veterinary Microbiolology, 155(1), 33-37.

Cepko, C. L., & Sharp, P. A. (1982). Assembly of adenovirus major capsid protein is mediated by a nonvirion protein. Cell, 31(2), 407-415.

Chen, C., Zuckerman, D. M., Brantley, S., Sharpe, M., Childress, K., Hoiczyk, E., & Pendleton, A. R. (2014). Sambucus nigra extracts inhibit infectious bronchitis virus at an early point during replication. BMC Veterinary Research, 10(1), 24.

Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V., & Cotten, M. (1996). The complete DNA sequence and genomic organization of the avian adenovirus CELO. Journal of Virology, 70(5), 2939-2949.

Chow, L., Lewis, J., & Broker, T. (1980). RNA transcription and splicing at early and intermediate times after adenovirus-2 infection. Cold Spring Harbor Symposia on Quantitative Biology, 401-414.

Chroboczek, J., Ruigrok, R. W. H., & Cusack, S. (1995). Adenovirus fiber. In: W. Doerfler & P. Böhm (Eds.), The molecular repertoire of adenoviruses I, pp. 163- 200: Springer Berlin Heidelberg.

Chung, C. S., Hsiao, J. C., Chang, Y. S., & Chang, W. (1998). A27L protein mediates vaccinia virus interaction with cell surface heparan sulfate. Journal of Virology, 72(2), 1577-1585.

178

Colby, W., & Shenk, T. (1981). Adenovirus type 5 virions can be assembled in vivo in the absence of detectable polypeptide IX. Journal of Virology, 39(3), 977-980.

Condezo, G. N., Marabini, R., Ayora, S., Carazo, J. M., Alba, R., Chillon, M., & San Martin, C. (2015). Structures of adenovirus incomplete particles clarify capsid architecture and show maturation changes of packaging protein L1 52/55k. Journal of Virology, 89(18), 9653-9664.

Corrier, D., Montgomery, D., & Scutchfield, W. (1982). Adenovirus in the intestinal epithelium of a foal with prolonged diarrhea. Veterinary Pathology Online, 19(5), 564-567.

Cortés-Hinojosa, G., Gulland, F. M. D., Goldstein, T., Venn-Watson, S., Rivera, R., Waltzek, T. B., Salemi, M., & Wellehan Jr, J. F. X. (2015). Phylogenomic characterization of California sea lion adenovirus-1. Infection, Genetics and Evolution, 31, 270-276.

Cotten, M., & Weber, J. M. (1995). The adenovirus protease is required for virus entry into host cells. Virology, 213(2), 494-502.

Crawford-Miksza, L., & Schnurr, D. P. (1996). Analysis of 15 adenovirus hexon proteins reveals the location and structure of seven hypervariable regions containing serotype-specific residues. J Virol, 70(3), 1836-1844.

Croyle, M. A., Anderson, D. J., Roessler, B. J., & Amidon, G. L. (1998). Development of a highly efficient purification process for recombinant adenoviral vectors for oral gene delivery. Pharmaceutical Development and Technology, 3(3), 365- 372.

Culp, J. S., Webster, L. C., Friedman, D. J., Smith, C. L., Huang, W. J., Wu, F. Y., Rosenberg, M., & Ricciardi, R. P. (1988). The 289-amino acid E1A protein of adenovirus binds zinc in a region that is important for trans-activation. Proceedings of the National Academy of Sciences, 85(17), 6450-6454.

Cusack, S. (2005). Adenovirus complex structures. Current Opinion in Structural Biology, 15(2), 237-243.

D’Halluin, J. C. (1995). Virus assembly. In: W. Doerfler & P. Böhm (Eds.), The Molecular Repertoire of Adenoviruses I: Virion Structure and Infection, pp. 47- 66, Berlin: Springer.

Darr, S., Madisch, I., Hofmayer, S., Rehren, F., & Heim, A. (2009). Phylogeny and primary structure analysis of fiber shafts of all human adenovirus types for rational design of adenoviral gene-therapy vectors. Journal of General Virology, 90(12), 2849-2854.

Davison, A. J. (2003). Genetic content and evolution of adenoviruses. Journal of General Virology, 84(11), 2895-2908.

Davison, A. J., Telford, E. A., Watson, M. S., McBride, K., & Mautner, V. (1993). The DNA sequence of adenovirus type 40. Journal of Molecular Biology, 234(4), 1308-1316.

179

Davison, A. J., Wright, K. M., & Harrach, B. (2000). DNA sequence of frog adenovirus. The Journal of general virology, 81, 2431-2439.

Davison, E., Diaz, R. M., Hart, I. R., Santis, G., & Marshall, J. F. (1997). Integrin alpha5beta1-mediated adenovirus infection is enhanced by the integrin- activating antibody TS2/16. Journal of Virology, 71(8), 6204-6207.

De Jong, R., & Van der Vliet, P. (1999). Mechanism of DNA replication in eukaryotic cells: cellular host factors stimulating adenovirus DNA replication. Gene, 236(1), 1-12. de Jong, R. N., Meijer, L. A., & van der Vliet, P. C. (2003). DNA binding properties of the adenovirus DNA replication priming protein pTP. Nucleic Acids Research, 31(12), 3274-3286.

Debbas, M., & White, E. (1993). Wild-type p53 mediates apoptosis by E1A, which is inhibited by E1B. Genes and Development, 7(4), 546-554.

Dechecchi, M., Melotti, P., Bonizzato, A., Santacatterina, M., Chilosi, M., & Cabrini, G. (2001). Heparan sulfate glycosaminoglycans are receptors sufficient to mediate the initial binding of adenovirus types 2 and 5. Journal of Virology, 75(18), 8772-8780.

Dechecchi, M. C., Tamanini, A., Bonizzato, A., & Cabrini, G. (2000). Heparan sulfate glycosaminoglycans are involved in adenovirus type 5 and 2-host cell interactions. Virology, 268(2), 382-390.

Dehghan, S., Seto, J., Liu, E. B., Walsh, M. P., Dyer, D. W., Chodosh, J., & Seto, D. (2013). Computational analysis of four human adenovirus type 4 genomes reveals molecular evolution through two interspecies recombination events. Virology, 443(2), 197-207.

Delcher, A. L., Bratke, K. A., Powers, E. C., & Salzberg, S. L. (2007). Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics, 23(6), 673-679.

Diouri, M., Keyvani-Amineh, H., Geoghegan, K. F., & Weber, J. M. (1996). Cleavage efficiency by adenovirus protease is site-dependent. Journal of Biological Chemistry, 271(51), 32511-32514.

Dogan, R. I., Getoor, L., Wilbur, W. J., & Mount, S. M. (2007). SplicePort--an interactive splice-site analysis tool. Nucleic Acids Research, 35, W285-291.

Dolph, P., Racaniello, V., Villamarin, A., Palladino, F., & Schneider, R. (1988). The adenovirus tripartite leader may eliminate the requirement for cap-binding protein complex during translation initiation. Journal of Virology, 62(6), 2059- 2066.

Doszpoly, A., Wellehan Jr, J. F. X., Childress, A. L., Tarján, Z. L., Kovács, E. R., Harrach, B., & Benkő, M. (2013). Partial characterization of a new adenovirus lineage discovered in testudinoid turtles. Infection, Genetics and Evolution, 17, 106-112.

180

Dunowska, M., Wilks, C. R., Studdert, M. J., & Meers, J. (2002). Equine respiratory viruses in foals in New Zealand. New Zeland Veterinary Journal, 50(4), 140- 147.

Dutta, S. K. (1975). Isolation and characterization of an adenovirus and isolation of its adenovirus-associated virus in cell culture from foals with respiratory tract disease. American journal of veterinary research, 36(3), 247-250.

Dynon, K., Black, W. D., Ficorilli, N., Hartley, C. A., & Studdert, M. J. (2007). Detection of viruses in nasal swab samples from horses with acute, febrile, respiratory disease using virus isolation, polymerase chain reaction and serology. Australian Veterinary Journal, 85(1-2), 46-50.

Dynon, K., Varrasso, A., Ficorilli, N., Holloway, S. A., Reubel, G. H., Li, F., Hartley, C. A., Studdert, M. J., & Drummer, H. E. (2001). Identification of equine herpesvirus 3 (equine coital exanthema virus), equine gammaherpesviruses 2 and 5, equine adenoviruses 1 and 2, equine arteritis virus and equine rhinitis A virus by polymerase chain reaction. Australian Veterinary Journal, 79(10), 695- 702.

El Bakkouri, M., Seiradake, E., Cusack, S., Ruigrok, R. W. H., & Schoehn, G. (2008). Structure of the C-terminal head domain of the fowl adenovirus type 1 short fibre. Virology, 378(1), 169-176.

ÉlŐ, P., Farkas, L. S., Dán, Á. L., & Kovács, M. G. (2003). The p32K Structural Protein of the Atadenovirus Might Have Bacterial Relatives. Journal of Molecular Evolution, 56(2), 175-180.

Enders, J. F., Bell, J. A., Dingle, J. H., Francis, T., Jr., Hilleman, M. R., Huebner, R. J., & Payne, A. M. (1956). Adenoviruses: group name proposed for new respiratory-tract viruses. Science, 124(3212), 119-120.

England, J. J., McChesney, A. E., & Chow, T. L. (1973). Characterization of an equine adenovirus. American Journal of Veterinary Research, 34(12), 1587-1590.

Eulitt, P. J., Park, M. A., Hamed, H. A., Cruikshanks, N., Yang, C., Dmitriev, I. P., Yacoub, A., Curiel, D. T., Fisher, P. B., & Dent, P. (2010). Enhancing mda- 7/IL-24 therapy in renal carcinoma cells by inhibiting multiple protective signaling pathways using sorafenib and by Ad.5/3 gene delivery. Cancer Biology & Therapy, 10(12), 1290-1305.

Evans, J. D., & Hearing, P. (2003). Distinct roles of the adenovirus E4 ORF3 protein in viral DNA replication and inhibition of genome concatenation. Journal of Virology, 77(9), 5295-5304.

Ewing, B., & Green, P. (1998). Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Research, 8(3), 186-194.

Fabry, C. M., Rosa-Calatrava, M., Moriscot, C., Ruigrok, R. W., Boulanger, P., & Schoehn, G. (2009). The C-terminal domains of adenovirus serotype 5 protein IX assemble into an antiparallel structure on the facets of the capsid. Journal of Virology, 83(2), 1135-1139. 181

Farkas, S. L., Benkő, M., Élő, P., Ursu, K., Dán, Á., Ahne, W., & Harrach, B. (2002). Genomic and phylogenetic analyses of an adenovirus isolated from a corn snake (Elaphe guttata) imply a common origin with members of the proposed new genus Atadenovirus. Journal of General Virology, 83(10), 2403-2410.

Farkas, S. L., Harrach, B., & Benkő, M. (2008). Completion of the genome analysis of snake adenovirus type 1, a representative of the reptilian lineage within the novel genus Atadenovirus. Virus Research, 132(1–2), 132-139.

Fechner, H., Haack, A., Wang, H., Wang, X., Eizema, K., Pauschinger, M., Schoemaker, R., van Veghel, R., Houtsmuller, A., & Schultheiss, H. (1999). Expression of coxsackie adenovirus receptor and alphav-integrin does not correlate with adenovector targeting in vivo indicating anatomical vector barriers. Gene Therapy, 6(9), 1520-1535.

Fessler, S. P., Chin, Y. R., & Horwitz, M. S. (2004). Inhibition of tumor necrosis factor (TNF) signal transduction by the adenovirus group C RID complex involves downregulation of surface levels of TNF receptor 1. Journal of Virology, 78(23), 13113-13121.

Fong, T. T., & Lipp, E. K. (2005). Enteric viruses of humans and animals in aquatic environments: health risks, detection, and potential water quality assessment tools. Microbiology and Molecular Biolology Review, 69(2), 357-371.

Frederick, J., Giguere, S., & Sanchez, L. C. (2009). Infectious agents detected in the feces of diarrheic foals: A retrospective study of 233 cases (2003-2008). Journal of Veterinary Internal Medicine, 23(6), 1254-1260.

Freimuth, P., Springer, K., Berard, C., Hainfeld, J., Bewley, M., & Flanagan, J. (1999). Coxsackievirus and adenovirus receptor amino-terminal immunoglobulin V- related domain binds adenovirus type 2 and fiber knob from adenovirus type 12. Journal of Virology, 73(2), 1392-1398.

Fuschiotti, P., Schoehn, G., Fender, P., Fabry, C. M., Hewat, E. A., Chroboczek, J., Ruigrok, R. W., & Conway, J. F. (2006). Structure of the dodecahedral penton particle from human adenovirus type 3. Journal of Molecular Biology, 356(2), 510-520.

Gaggar, A., Shayakhmetov, D. M., & Lieber, A. (2003). CD46 is a cellular receptor for group B adenoviruses. Nature Medicine, 9(11), 1408-1412.

Gall, J., Kass Eisler, A., Leinwand, L., & Falck Pedersen, E. (1996). Adenovirus type 5 and 7 capsid chimera: fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes. Journal of Virology, 70(4), 2116-2123.

Ganguly, P., & Fossett, N. G. (1979). Role of surface sialic acid in the interaction of wheat germ agglutinin with human platelets. Biochemical and Biophysical Research Communications, 89(4), 1154-1160.

Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M., Appel, R., & Bairoch, A. (2005). Protein identification and analysis tools on the ExPASy

182

server. In: J. M. Walker (Ed.), The Proteomics Protocols Handbook pp. 571-607, Totowa, NJ: Humana Press.

Gerba, C. P., Gramos, D. M., & Nwachuku, N. (2002). Comparative inactivation of enteroviruses and adenovirus 2 by UV light. Applied and Environmental Microbiololgy, 68(10), 5167-5169.

Germi, R., Crance, J. M., Garin, D., Guimet, J., Lortat-Jacob, H., Ruigrok, R. W., Zarski, J. P., & Drouet, E. (2002). Heparan sulfate-mediated binding of infectious dengue virus type 2 and yellow fever virus. Virology, 292(1), 162- 168.

Ghosh-Choudhury, G., Haj-Ahmad, Y., & Graham, F. (1987). Protein IX, a minor component of the human adenovirus capsid, is essential for the packaging of full length genomes. The EMBO Journal, 6(6), 1733.

Giles, C., Cavanagh, H. M., Noble, G., & Vanniasinkam, T. (2010). Prevalence of equine adenovirus antibodies in horses in New South Wales, Australia. Veterinary microbiology, 143(2-4), 401-404.

Giles, C., Vanniasinkam, T., Barton, M., & Mahony, T. J. (2015). Characterisation of the Equine adenovirus 2 genome. Veterinary microbiology, 179(3-4), 184-189.

Giroglou, T., Florin, L., Schafer, F., Streeck, R. E., & Sapp, M. (2001). Human papillomavirus infection requires cell surface heparan sulfate. J Virol, 75(3), 1565-1570.

Gleeson, L. J., Studdert, M. J., & Sullivan, N. D. (1978). Pathogenicity and immunologic studies of equine adenovirus in specific-pathogen-free foals. American Journal of Veterinary Research, 39(10), 1636-1642.

Goodfellow, I. G., Sioofy, A. B., Powell, R. M., & Evans, D. J. (2001). Echoviruses bind heparan sulfate at the cell surface. J Virol, 75(10), 4918-4921.

Gorman, J. J., Wallis, T. P., Whelan, D. A., Shaw, J., & Both, G. W. (2005). LH3, a “homologue” of the mastadenoviral E1B 55-kDa protein is a structural protein of atadenoviruses. Virology, 342(1), 159-166.

Graham, K. L., Fleming, F. E., Halasz, P., Hewish, M. J., Nagesha, H. S., Holmes, I. H., Takada, Y., & Coulson, B. S. (2005). Rotaviruses interact with alpha4beta7 and alpha4beta1 integrins by binding the same integrin domains as natural ligands. J Gen Virol, 86(Pt 12), 3397-3408.

Greber, U. F., Willetts, M., Webster, P., & Helenius, A. (1993). Stepwise dismantling of adenovirus 2 during entry into cells. Cell(3), 477.

Green, M., & Pina, M. (1963). Biochemical studies on adenovirus multiplication: IV. Isolation, purification, and chemical analysis of adenovirus. Virology, 20(1), 199-207.

183

Green, N. M., Wrigley, N. G., Russell, W. C., Martin, S. R., & McLachlan, A. D. (1983). Evidence for a repeating cross-beta sheet structure in the adenovirus fibre. The EMBO Journal, 2(8), 1357-1365.

Grgić, H., Yang, D.-H., & Nagy, É. (2011). Pathogenicity and complete genome sequence of a fowl adenovirus serotype 8 isolate. Virus Research, 156(1–2), 91- 97.

Guardado-Calvo, P., Llamas-Saiz, A. L., Fox, G. C., Langlois, P., & van Raaij, M. J. (2007). Structure of the C-terminal head domain of the fowl adenovirus type 1 long fiber. Journal of General Virology, 88(9), 2407-2416.

Guardado-Calvo, P., Muñoz, E. M., Llamas-Saiz, A. L., Fox, G. C., Kahn, R., Curiel, D. T., Glasgow, J. N., & van Raaij, M. J. (2010). Crystallographic structure of porcine adenovirus type 4 fiber head and galectin domains. Journal of Virology, 84(20), 10558-10568.

Hallak, L. K., Collins, P. L., Knudson, W., & Peeples, M. E. (2000). Iduronic acid- containing glycosaminoglycans on target cells are required for efficient respiratory syncytial virus infection. Virology, 271(2), 264-275.

Harden, T. J., Pascoe, R. R., Spradbrow, P. B., & Johnston, K. G. (1974). The prevalence of antibodies to adenoviruses in horses from queensland and New South Wales. Australian Veterinary Journal, 50(11), 477-482.

Harrach, B. (2011). Family Adenoviridae. In: A. M. Q. King, E. Lefkowitz, M. J. Adams, & E. Carstens (Eds.), Virus taxonomy: 9th report of the international committee on taxonomy of viruses, pp. 125-141, San Diego: Elsievier.

Harrach, B., Benko, M., Both, G., Brown, M., Davison, A., Echavarría, M., Hess, M., Jones, M., Kajon, A., & Lehmkuhl, H. (2011). Family adenoviridae (pp. 95- 111): Elsevier: San Diego, CA, USA.

Harrach, B., & Kaján, G. (2011). Aviadenovirus. In: C. Tidona & G. Darai (Eds.), The Springer Index of Viruses, pp. 13-28: Springer New York.

Hassell, J. R., Kimura, J. H., & Hascall, V. C. (1986). Proteoglycan core protein families. Annual Review of Biochemistry, 55, 539-567.

Hautala, T., Grunst, T., Fabrega, A., Freimuth, P., & Welsh, M. (1998). An interaction between penton base and αv integrins plays a minimal role in adenovirus- mediated gene transfer to hepatocytes in vitro and in vivo. Gene Therapy, 5(9).

Hemler, M. E., Jacobson, J. G., & Strominger, J. L. (1985). Biochemical characterization of VLA-1 and VLA-2. Cell surface heterodimers on activated T cells. Journal of Biological Chemistry, 260(28), 15246-15252.

Hemmi, S., Vidovszky, M. Z., Ruminska, J., Ramelli, S., Decurtins, W., Greber, U. F., & Harrach, B. (2011). Genomic and phylogenetic analyses of murine adenovirus 2. Virus Research, 160(1–2), 128-135.

184

Henry, L. J., Xia, D., Wilke, M. E., Deisenhofer, J., & Gerard, R. D. (1994). Characterization of the knob domain of the adenovirus type 5 fiber protein expressed in Escherichia coli. Journal of Virology, 68(8), 5239-5246.

Herold, B. C., Gerber, S. I., Belval, B. J., Siston, A. M., & Shulman, N. (1996). Differences in the susceptibility of herpes simplex virus types 1 and 2 to modified heparin compounds suggest serotype differences in viral entry. Journal of Virology, 70(6), 3461-3469.

Hess, M., Cuzange, A., Ruigrok, R. W., Chroboczek, J., & Jacrot, B. (1995). The avian adenovirus penton: two fibers and one base. Journal of Molecular Biology, 252(4), 379-385.

Hewish, M. J., Takada, Y., & Coulson, B. S. (2000). Integrins alpha2beta1 and alpha4beta1 can mediate SA11 rotavirus attachment and entry into cells. J Virol, 74(1), 228-236.

Hierholzer, J. C. (1973). Further Subgrouping of the Human Adenoviruses by Differential Hemagglutination. The Journal of infectious diseases, 128(4), 541- 550.

Higashi, T., & Harasawa, R. (1989). DNA restriction analysis of equine adenovirus serotype I. Journal of Veterinary Medicine, 36(6), 473-476.

Hilleman, M., & Werner, J. H. (1954). Recovery of new agent from patients with acute respiratory illness. Experimental Biology and Medicine, 85(1), 183-188.

Hodges, B., Evans, H., Everett, R., Ding, E., Serra, D., & Amalfitano, A. (2001). Adenovirus vectors with the 100K gene deleted and their potential for multiple gene therapy applications. Journal of Virology, 75(13), 5913-5920.

Hoffmann, D., Jogler, C., & Wildner, O. (2005). Effects of the Ad5 upstream E1 region and gene products on heterologous promoters. The Journal of Gene Medicine, 7(10), 1356-1366.

Hong, J. S., & Engler, J. A. (1996). Domains required for assembly of adenovirus type 2 fiber trimers. Journal of Virology, 70(10), 7071-7078.

Hong, S. S., Szolajska, E., Schoehn, G., Franqueville, L., Myhre, S., Lindholm, L., Ruigrok, R. W., Boulanger, P., & Chroboczek, J. (2005). The 100K-chaperone protein from adenovirus serotype 2 (Subgroup C) assists in trimerization and nuclear localization of hexons from subgroups C and B adenoviruses. Journal of Molecular Biology, 352(1), 125-138.

Horner, G. W., & Hunter, R. (1982). Isolation of two serotypes of equine adenovirus from horses in New Zealand. New Zeeland Veterinary Journal, 30(5), 62-64.

Horwitz, M. S. (2004). Function of adenovirus E3 proteins and their interactions with immunoregulatory cell proteins. The Journal of Gene Medicine, 6(S1), S172- S183.

185

Horwitz, M. S., Scharff, M. D., & Maizel, J. V. (1969). Synthesis and assembly of adenovirus 2. Virology, 39(4), 682-694.

Hothorn, T., Bretz, F., & Westfall, P. (2008). Simultaneous inference in general parametric models. Biom J, 50(3), 346-363.

Hsieh, J. C., Yoo, S. K., & Ito, J. (1990). An essential arginine residue for initiation of protein-primed DNA replication. Proceedings of the National Academy of Sciences of the United States of America, 87(21), 8665-8669.

Huang, W., & Flint, S. (1998). The tripartite leader sequence of subgroup C adenovirus major late mRNAs can increase the efficiency of mRNA export. Journal of Virology, 72(1), 225-235.

Hung-Yueh, Y., Pieniazek, N., Pieniazek, D., Gelderblom, H., & Luftig, R. B. (1994). Human adenovirus type 41 contains two fibers. Virus Research, 33(2), 179-198.

Huson, D. H., & Bryant, D. (2006). Application of phylogenetic networks in evolutionary studies. Molecular Biology Evolution, 23(2), 254-267.

Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., & Kitajima, M. (2013). Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. Journal of Virological Methods, 191(1), 24- 30.

Imperiale, M., Akusjnärvi, G., & Leppard, K. (1995). Post-transcriptional control of adenovirus gene expression. In: W. Doerfler & P. Böhm (Eds.), The molecular repertoire of adenoviruses II, pp. 139-171, Berlin Heidelberg: Springer.

Ishibashi, M., & Yasue, H. (1984). Adenoviruses of animals. In: H. S. Ginsberg (Ed.), The adenoviruses, pp. 497-562, New York: Springer.

Jackson, T., Sheppard, D., Denyer, M., Blakemore, W., & King, A. M. (2000). The epithelial integrin alphavbeta6 is a receptor for foot-and-mouth disease virus. Journal of Virology, 74(11), 4949-4956.

Jansen-Durr, P., Mondesert, G., & Kedinger, C. (1989). Replication-dependent activation of the adenovirus major late promoter is mediated by the increased binding of a transcription factor to sequences in the first intron. Journal of Virology, 63(12), 5124-5132.

Jiang, S. C. (2006). Human adenoviruses in water: occurrence and health implications: a critical review. Environmental Science & Technology, 40(23), 7132-7140.

Jolly, P. D., Fu, Z. F., & Robinson, A. J. (1986). Viruses associated with respiratory disease of horses in New Zealand: an update. New Zeland Veterinary Journal, 34(4), 46-50.

Jones, M., Harrach, B., Ganac, R., Gozum, M. M. A., Dela Cruz, W., Riedel, B., Pan, C., Delwart, E., & Schnurr, D. (2007). New adenovirus species found in a patient presenting with gastroenteritis. Journal of Virology, 81(11), 5978-5984.

186

Joseph, H. M., Ballmann, M. Z., Garner, M. M., Hanley, C. S., Berlinski, R., Erdélyi, K., Childress, A. L., Fish, S. S., Harrach, B., & Wellehan Jr, J. F. X. (2014). A novel siadenovirus detected in the kidneys and liver of Gouldian finches (Erythura gouldiae). Veterinary microbiology, 172(1–2), 35-43.

Kaján, G. L., Davison, A. J., Palya, V., Harrach, B., & Benkő, M. (2012). Genome sequence of a waterfowl aviadenovirus, goose adenovirus 4. Journal of General Virology, 93(11), 2457-2465.

Kaján, G. L., Stefancsik, R., Ursu, K., Palya, V., & Benkő, M. (2010). The first complete genome sequence of a non-chicken aviadenovirus, proposed to be turkey adenovirus 1. Virus Research, 153(2), 226-233.

Kalia, M., Chandra, V., Rahman, S. A., Sehgal, D., & Jameel, S. (2009). Heparan sulfate proteoglycans are required for cellular binding of the hepatitis E virus ORF2 capsid protein and for viral infection. Journal of Virology, 83(24), 12714- 12724.

Kalyuzhniy, O., Di Paolo, N. C., Silvestry, M., Hofherr, S. E., Barry, M. A., Stewart, P. L., & Shayakhmetov, D. M. (2008). Adenovirus serotype 5 hexon is critical for virus infection of hepatocytes in vivo. Proceedings of the National Academy of Sciences, 105(14), 5483-5488.

Kato, T., Kajikawa, M., Maenaka, K., & Park, E. (2010). Silkworm expression system as a platform technology in life science. Applied Microbiology and Biotechnology, 85(3), 459-470.

Katoh, K., Misawa, K., Kuma, K., & Miyata, T. (2002). MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research, 30(14), 3059-3066.

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12), 1647-1649.

Kelkar, S., De, B. P., Gao, G., Wilson, J. M., Crystal, R. G., & Leopold, P. L. (2006). A common mechanism for cytoplasmic dynein-dependent microtubule binding shared among adeno-associated virus and adenovirus serotypes. Journal of Virology, 80(15), 7781-7785.

Kelkar, S. A., Pfister, K. K., Crystal, R. G., & Leopold, P. L. (2004). Cytoplasmic dynein mediates adenovirus binding to microtubules. Journal of Virology, 78(18), 10122-10132.

Khatri, A., & Both, G. W. (1998). Identification of transcripts and promoter regions of ovine adenovirus OAV287. Virology, 245(1), 128-141.

Kidd, A. H., Chroboczek, J., Cusack, S., & Ruigrok, R. W. (1993). Adenovirus type 40 virions contain two distinct fibers. Virology, 192(1), 73-84.

187

Kim, D. S., Hosmillo, M., Alfajaro, M. M., Kim, J. Y., Park, J. G., Son, K. Y., Ryu, E. H., Sorgeloos, F., Kwon, H. J., Park, S. J., Lee, W. S., Cho, D., Kwon, J., Choi, J. S., Kang, M. I., Goodfellow, I., & Cho, K. O. (2014). Both alpha2,3- and alpha2,6-linked sialic acids on O-linked glycoproteins act as functional receptors for porcine Sapovirus. PLoS pathogens, 10(6), e1004172.

Kobata, A., & Fukuda, M. (1993). Glycobiology : a practical approach. New York: Oxford : IRL press.

Komoriya, A., Green, L. J., Mervic, M., Yamada, S. S., Yamada, K. M., & Humphries, M. J. (1991). The minimal essential sequence for a major cell type-specific adhesion site (CS1) within the alternatively spliced type III connecting segment domain of fibronectin is leucine-aspartic acid-valine. Journal of Biological Chemistry, 266(23), 15075-15079.

Konishi, S., Harasawa, R., Mochizuki, M., Akashi, H., & Ogata, M. (1977). Studies on equine adenovirus. I. Characteristics of an adenovirus isolated from a thoroughbred colt with pneumonia. Japanese journal of veterinary science, 39, 117-125.

Kovács, E. R., & Benkő, M. (2011). Complete sequence of raptor adenovirus 1 confirms the characteristic genome organization of siadenoviruses. Infection, Genetics and Evolution, 11(5), 1058-1065.

Kovacs, G. M., LaPatra, S. E., D'Halluin, J. C., & Benko, M. (2003). Phylogenetic analysis of the hexon and protease genes of a fish adenovirus isolated from white sturgeon (Acipenser transmontanus) supports the proposal for a new adenovirus genus. Virus Res, 98(1), 27-34.

Kyte, J., & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology, 157(1), 105-132.

Laemmli, U. K. (1970). Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature, 227(5259), 680-685.

Laremore, T., Zhang, F., Dordick, J., Liu, J., & Linhardt, R. (2009). Recent progress and applications in glycosaminoglycan and heparin research. Current Opinion in Chemical Biology, 13(5), 633-640.

Lehmkuhl, H. D., Smith, M. H., & Dierks, R. E. (1975). A bovine adenovirus type 3: Isolation, characterization, and experimental infection in calves. Archives of Virology, 48(1), 39-46.

Lenman, A., Liaci, A. M., Liu, Y., Årdahl, C., Rajan, A., Nilsson, E., Bradford, W., Kaeshammer, L., Jones, M., Frängsmyr, L., Feizi, T., Stehle, T., & Arnberg, N. (2015). Human adenovirus 52 uses sialic acid-containing glycoproteins and the coxsackie and adenovirus receptor for binding to target cells. PLoS pathogens, 11(2), e1004657.

Leong, K., Lee, W., & Berk, A. J. (1990). High-level transcription from the adenovirus major late promoter requires downstream binding sites for late-phase-specific factors. Journal of Virology, 64(1), 51-60. 188

Leopold, P. L., & Pfister, K. K. (2006). Viral strategies for intracellular trafficking: motors and microtubules. Traffic, 7(5), 516-523.

Leopold, P. L., Wendland, R. L., Vincent, T., & Crystal, R. G. (2006). Neutralized adenovirus-immune complexes can mediate effective gene transfer via an Fc receptor-dependent infection pathway. Journal of Virology, 80(20), 10237- 10247.

Leppard, K. N. (1997). E4 gene function in adenovirus, adenovirus vector and adeno- associated virus infections. Journal of General Virology, 78(9), 2131-2138.

Li, E., Brown, S. L., Stupack, D. G., Puente, X. S., Cheresh, D. A., & Nemerow, G. R. (2001). Integrin αvβ1 is an adenovirus coreceptor. Journal of Virology, 75(11), 5405-5409.

Li, X., Bangari, D. S., Sharma, A., & Mittal, S. K. (2009). Bovine adenovirus serotype 3 utilizes sialic acid as a cellular receptor for virus entry. Virology, 392(2), 162- 168.

Liszewski, M. K., Post, T. W., & Atkinson, J. P. (1991). Membrane cofactor protein (MCP or CD46): newest member of the regulators of complement activation gene cluster. Annual Review of Immunology, 9, 431-455.

Liu, G. Q., Babiss, L. E., Volkert, F. C., Young, C. S., & Ginsberg, H. S. (1985). A thermolabile mutant of adenovirus 5 resulting from a substitution mutation in the protein VIII gene. Journal of Virology, 53(3), 920-925.

Liu, H., Jin, L., Koh, S. B., Atanasov, I., Schein, S., Wu, L., & Zhou, Z. H. (2010). Atomic structure of human adenovirus by cryo-EM reveals interactions among protein networks. Science, 329(5995), 1038-1043.

Logan, J., & Shenk, T. (1984). Adenovirus tripartite leader sequence enhances translation of mRNAs late after infection. Proceedings of the National Academy of Sciences, 81(12), 3655-3659.

Lole, K. S., Bollinger, R. C., Paranjape, R. S., Gadkari, D., Kulkarni, S. S., Novak, N. G., Ingersoll, R., Sheppard, H. W., & Ray, S. C. (1999). Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. Journal of Virology, 73(1), 152-160.

Louis, N., Fender, P., Barge, A., Kitts, P., & Chroboczek, J. (1994). Cell-binding domain of adenovirus serotype 2 fiber. Journal of Virology, 68(6), 4104-4106.

Lutz, P., Rosa-Calatrava, M., & Kedinger, C. (1997). The product of the adenovirus intermediate gene IX is a transcriptional activator. Journal of Virology, 71(7), 5102-5109.

Lyle, C., & McCormick, F. (2010). Integrin αvβ5 is a primary receptor for adenovirus in CAR-negative cells. Virology journal, 7(1), 148.

189

Madhusudan, S., Tamir, A., Bates, N., Flanagan, E., Gore, M. E., Barton, D. P., Harper, P., Seckl, M., Thomas, H., Lemoine, N. R., Charnock, M., Habib, N. A., Lechler, R., Nicholls, J., Pignatelli, M., & Ganesan, T. S. (2004). A multicenter Phase I gene therapy clinical trial involving intraperitoneal administration of E1A-lipid complex in patients with recurrent epithelial ovarian cancer overexpressing HER-2/neu oncogene. Clinical Cancer Research, 10(9), 2986- 2996.

Majhen, D., Stojanović, N., Špeljko, T., Brozovic, A., De Zan, T., Osmak, M., & Ambriović-Ristov, A. (2011). Increased expression of the coxsackie and adenovirus receptor downregulates αvβ3 and αvβ5 integrin expression and reduces cell adhesion and migration. Life Sciences, 89(7–8), 241-249.

Marek, A., Kosiol, C., Harrach, B., Kaján, G. L., Schlötterer, C., & Hess, M. (2013). The first whole genome sequence of a Fowl adenovirus B strain enables interspecies comparisons within the genus Aviadenovirus. Veterinary microbiology, 166(2), 250-256.

Marek, A., Nolte, V., Schachner, A., Berger, E., Schlötterer, C., & Hess, M. (2012). Two fiber genes of nearly equal lengths are a common and distinctive feature of Fowl adenovirus C members. Veterinary microbiology, 156(3–4), 411-417.

Martin, D. P., Murrell, B., Golden, M., Khoosal, A., & Muhire, B. (2015). RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evolution, 1(1).

Martinez-Barragan, J. J., & del Angel, R. M. (2001). Identification of a putative coreceptor on Vero cells that participates in dengue 4 virus infection. J Virol, 75(17), 7818-7827.

Martinez, I., & Melero, J. A. (2000). Binding of human respiratory syncytial virus to cells: implication of sulfated cell surface proteoglycans. Journal of General Virology, 81(11), 2715-2722.

Marttila, M., Persson, D., Gustafsson, D., Liszewski, M. K., Atkinson, J., Wadell, G., & Arnberg, N. (2005). CD46 is a cellular receptor for all species B adenoviruses except types 3 and 7. Journal of Virology, 79(22), 14429-14436.

McCarthy, T., Lebeck, M. G., Capuano, A. W., Schnurr, D. P., & Gray, G. C. (2009). Molecular typing of clinical adenovirus specimens by an algorithm which permits detection of adenovirus coinfections and intermediate adenovirus strains. Journal of Clinical Virology, 46(1), 80-84.

McChesney, A., England, J., & Rich, L. (1973). Adenoviral infection in foals. Journal of the American Veterinary Medical Association, 162(7), 545.

McChesney, A. E., & England, J. J. (1978). Equine adenoviral infection: pathogenesis of experimentally and naturally transmitted infection. In: J. T. Bryans & H. Gerber (Eds.), Equine Infectious Diseases, pp. 144-145, New Jersey: Vet Publications Inc.

190

McChesney, A. E., England, J. J., Adcock, J. L., Stackhouse, L. L., & Chow, T. L. (1970). Adenoviral infection in suckling Arabian foals. Pathologia Veterinaria, 7(6), 547-564.

McChesney, A. E., England, J. J., Whiteman, C. E., Adcock, J. L., Rich, L. J., & Chow, T. L. (1974). Experimental transmission of equine adenovirus in Arabian and non-Arabian foals. American journal of veterinary research, 35(8), 1015-1023.

McMullen, J., & Richard, J. (2005). Equine keratitis and the possible involvement of equine adenovirus type 1 (EAdV1) and type 2 (EAdV2). (Doctoral dissertation), Universität München, Munich.

Meissner, J. D., Hirsch, G. N., LaRue, E. A., Fulcher, R. A., & Spindler, K. R. (1997). Completion of the DNA sequence of mouse adenovirus type 1: Sequence of E2B, L1, and L2 (18–51 map units). Virus Research, 51(1), 53-64.

Merrington, C., Bailey, M., & Possee, R. (1997). Manipulation of baculovirus vectors. Molecular Biotechnology, 8(3), 283-297.

Metzler-Zebeli, B., Lawlor, P., Magowan, E., & Zebeli, Q. (2016). Effect of freezing conditions on fecal bacterial composition in pigs. Animals, 6(3), 18.

Miller, J. S., Ricciardi, R. P., Roberts, B. E., Paterson, B. M., & Mathews, M. (1980). Arrangement of messenger RNAs and protein coding sequences in the major late transcription unit of adenovirus 2. Journal of Molecular Biology, 142(4), 455- 488.

Misinzo, G., Delputte, P. L., Meerts, P., Lefebvre, D. J., & Nauwynck, H. J. (2006). Porcine circovirus 2 uses heparan sulfate and chondroitin sulfate B glycosaminoglycans as receptors for its attachment to host cells. Journal of Virology, 80(7), 3487-3494.

Mistry, N., Inoue, H., Jamshidi, F., Storm, R. J., Oberste, M. S., & Arnberg, N. (2011). Coxsackievirus A24 variant uses sialic acid-containing O-linked glycoconjugates as cellular receptors on human ocular cells. Journal of Virology, 85(21), 11283-11290.

Mittal, S. K., Prevec, L., Babiuk, L. A., & Graham, F. L. (1992). Sequence analysis of bovine adenovirus type 3 early region 3 and fibre protein genes. Journal of General Virology, 73(12), 3295-3300.

Moens, B., Lopez, G., Adaui, V., Gonzalez, E., Kerremans, L., Clark, D., Verdonck, K., Gotuzzo, E., Vanham, G., Cassar, O., Gessain, A., Vandamme, A. M., & Van Dooren, S. (2009). Development and validation of a multiplex real-time PCR assay for simultaneous genotyping and human T-lymphotropic virus type 1, 2, and 3 proviral load determination. Journal of clinical microbiology, 47(11), 3682-3691.

Muller, E. E., Venter, J. M., Magooa, M. P., Morrison, C., Lewis, D. A., & Mavedzenge, S. N. (2012). Development of a rotor-gene real-time PCR assay for the detection and quantification of Mycoplasma genitalium. Journal of Microbiological Methods, 88(2), 311-315. 191

Mun, K. (2014). Study on the alternative splicing in the human adenovirus Serotype 5 E1B region. Retrieved from http://files.webb.uu.se/uploader/271/BIOMSc-14- 022-Mun-Kwangchol-report.pdf

Mysiak, M. E., Holthuizen, P. E., & van der Vliet, P. C. (2004). The adenovirus priming protein pTP contributes to the kinetics of initiation of DNA replication. Nucleic Acids Research, 32(13), 3913-3920.

Nagy, M., Nagy, E., & Tuboly, T. (2002). Sequence analysis of porcine adenovirus serotype 5 fibre gene: evidence for recombination. Virus Genes, 24(2), 181-185.

Nagy, M., Nagy, É., & Tuboly, T. (2001). The complete nucleotide sequence of porcine adenovirus serotype 5. Journal of General Virology, 82(3), 525-529.

Nanda, A., Lynch, D., Goudsmit, J., Lemckert, A. A. C., Ewald, B., Sumida, S., Truitt, D., Abbink, P., Kishko, M., Gorgone, D., Lifton, M., Shen, L., Carville, A., Mansfield, K., Havenga, M. J. E., & Barouch, D. (2005). Immunogenicity of recombinant fiber-chimeric adenovirus serotype 35 vector-based vaccines in mice and rhesus monkeys. Journal of Virology, 79(22), 14161-14168.

Newham, P., Craig, S. E., Seddon, G. N., Schofield, N. R., Rees, A., Edwards, R. M., Jones, E. Y., & Humphries, M. J. (1997). α4 integrin binding interfaces on VCAM-1 and MAdCAM-1: Integrin binding footprints identify accessory binding sites that play a role in integrin specificity. Journal of Biological Chemistry, 272(31), 19429-19440.

Nguyen, T. H., Vidovszky, M. Z., Ballmann, M. Z., Sanz-Gaitero, M., Singh, A. K., Harrach, B., Benkő, M., & van Raaij, M. J. (2015). Crystal structure of the fibre head domain of bovine adenovirus 4, a ruminant atadenovirus. Virology journal, 12(1), 1-11.

Nicklin, S. A., Wu, E., Nemerow, G. R., & Baker, A. H. (2005). The influence of adenovirus fiber structure and function on vector development for gene therapy. Molecular Therapy, 12(3), 384-393.

Ostapchuk, P., Almond, M., & Hearing, P. (2011). Characterization of empty adenovirus particles assembled in the absence of a functional adenovirus IVa2 protein. Journal of Virology, 85(11), 5524-5531.

Ostapchuk, P., & Hearing, P. (2005). Control of adenovirus packaging. Journal of cellular biochemistry, 96(1), 25-35.

Ovcharenko, I., Loots, G. G., Hardison, R. C., Miller, W., & Stubbs, L. (2004). zPicture: dynamic alignment and visualization tool for analyzing conservation profiles. Genome Research, 14(3), 472-477.

Pallister, J., Wright, P. J., & Sheppard, M. (1996). A single gene encoding the fiber is responsible for variations in virulence in the fowl adenoviruses. Journal of Virology, 70(8), 5115-5122.

Parks, R. J. (2005). Adenovirus protein IX: A new look at an old protein. Molecular Therapy, 11(1), 19-25.

192

Pehler-Harrington, K., Khanna, M., Waters, C. R., & Henrickson, K. J. (2004). Rapid detection and identification of human adenovirus species by adenoplex, a multiplex PCR-enzyme hybridization assay. Journal of Clinical Microbiology, 42(9), 4072-4076.

Penzes, J. J., Menendez-Conejero, R., Condezo, G. N., Ball, I., Papp, T., Doszpoly, A., Paradela, A., Perez-Berna, A. J., Lopez-Sanz, M., Nguyen, T. H., van Raaij, M. J., Marschang, R. E., Harrach, B., Benko, M., & San Martin, C. (2014). Molecular characterization of a lizard adenovirus reveals the first atadenovirus with two fiber genes and the first adenovirus with either one short or three long fibers per penton. Journal of Virology, 88(19), 11304-11314.

Perryman, L. E. (2000). Primary immunodeficiencies of horses. Veterinary Clinics of North America: Equine Practice, 16(1), 105-116.

Philipson, L., & Pettersson, R. F. (2004). The coxsackie adenovirus receptor : A new receptor in the immunoglobulin family involved in cell adhesion. In: W. Doerfler & P. Böhm (Eds.), Adenoviruses: Model and Vectors in Virus-Host Interactions, pp. 87-111: Springer Berlin Heidelberg.

Pitcovski, J., Mualem, M., Rei-Koren, Z., Krispel, S., Shmueli, E., Peretz, Y., Gutter, B., Gallili, G. E., Michael, A., & Goldberg, D. (1998). The complete DNA sequence and genome organization of the avian adenovirus, hemorrhagic enteritis virus. Virology, 249(2), 307-315.

Powell, D. G., Burrows, R., & Goodridge, D. (1974). Respiratory viral infections among thoroughbred horses in training during 1972. Equine veterinary journal, 6(1), 19-24.

Pring-Akerblom, P., Heim, A., & Trijssenaar, F. E. J. (1998). Molecular characterization of hemagglutination domains on the fibers of subgenus D adenoviruses. Journal of Virology, 72(3), 2297-2304.

Qiu, J., Handa, A., Kirby, M., & Brown, K. E. (2000). The interaction of heparin sulfate and adeno-associated virus 2. Virology, 269(1), 137-147.

Rademacher, C., Bru, T., McBride, R., Robison, E., Nycholat, C., Kremer, E., & Paulson, J. (2012). A Siglec-like sialic-acid-binding motif revealed in an adenovirus capsid protein. Glycobiology, 22(8), 1086-1091.

Raman, S., Hsu, T. H., Ashley, S. L., & Spindler, K. R. (2009). Usage of integrin and heparan sulfate as receptors for mouse adenovirus type 1. Journal of Virology, 83(7), 2831-2838.

Rasmussen, U. B., Schlesinger, Y., Pavirani, A., & Mehtali, M. (1995). Sequence analysis of the canine adenovirus 2 fiber-encoding gene. Gene, 159(2), 279-280.

Reddy, P. S., Chen, Y., Idamakanti, N., Pyne, C., Babiuk, L. A., & Tikoo, S. K. (1999a). Characterization of early region 1 and pIX of bovine adenovirus-3. Virology, 253(2), 299-308.

193

Reddy, P. S., Ganesh, S., Knowles, N. J., Kaleko, M., Connelly, S., & Bristol, A. (2006). Complete sequence and organization of the human adenovirus serotype 46 genome. Virus Research, 116(1-2), 119-128.

Reddy, P. S., Idamakanti, N., Chen, Y., Whale, T., Babiuk, L. A., Mehtali, M., & Tikoo, S. K. (1999b). Replication-defective bovine adenovirus type 3 as an expression vector. Journal of Virology, 73(11), 9137-9144.

Reddy, P. S., Idamakanti, N., Song, J. Y., Lee, J. B., Hyun, B. H., Park, J. H., Cha, S. H., Bae, Y. T., Tikoo, S. K., & Babiuk, L. A. (1998a). Nucleotide sequence and transcription map of porcine adenovirus type 3. Virology, 251(2), 414-426.

Reddy, P. S., Idamakanti, N., Zakhartchouk, A. N., Baxi, M. K., Lee, J. B., Pyne, C., Babiuk, L. A., & Tikoo, S. K. (1998b). Nucleotide sequence, genome organization, and transcription map of bovine adenovirus type 3. Journal of Virology, 72(2), 1394-1402.

Reed, L. J., & Muench, H. (1938). A simple method of estimating fifty per cent endpoints. American Journal of Epidemiology, 27(3), 493-497.

Reis, T. A. V., Assis, A. S. F., do Valle, D. A., Barletta, V. H., de Carvalho, I. P., Rose, T. L., Portes, S. A. R., Leite, J. P. G., & da Rosa e Silva, M. L. (2016). The role of human adenoviruses type 41 in acute diarrheal disease in Minas Gerais after rotavirus vaccination. Brazilian Journal of Microbiology, 47(1), 243-250.

Reischer, G. H., Ebdon, J. E., Bauer, J. M., Schuster, N., Ahmed, W., Astrom, J., Blanch, A. R., Bloschl, G., Byamukama, D., Coakley, T., Ferguson, C., Goshu, G., Ko, G., de Roda Husman, A. M., Mushi, D., Poma, R., Pradhan, B., Rajal, V., Schade, M. A., Sommer, R., Taylor, H., Toth, E. M., Vrajmasu, V., Wuertz, S., Mach, R. L., & Farnleitner, A. H. (2013). Performance characteristics of qPCR assays targeting human- and ruminant-associated bacteroidetes for microbial source tracking across sixteen countries on six continents. Environmental Science & Technology, 47(15), 8548-8556.

Reubel, G. H., & Studdert, M. J. (1997). Sequence analysis of equine adenovirus 2 hexon and 23K proteinase genes indicates a phylogenetic origin distinct from equine adenovirus 1. Virus Research, 50(1), 41-56.

Reubel, H., Gerhard. (1996). Diagnosis of equine herpesvirus infections by polymerase chain reaction and studies of the molecular biology of equine adenoviruses. (PhD Thesis), The university of Melbourne, Melbourne.

Richards, A. J., Kelly, D. F., Knottenbelt, D. C., Cheeseman, M. T., & Dixon, J. B. (2000). Anaemia, diarrhoea and opportunistic infections in Fell ponies. Equine Veterinary Journal, 32(5), 386-391.

Rivera, S., Wellehan, J. F., Jr., McManamon, R., Innis, C. J., Garner, M. M., Raphael, B. L., Gregory, C. R., Latimer, K. S., Rodriguez, C. E., Diaz-Figueroa, O., Marlar, A. B., Nyaoke, A., Gates, A. E., Gilbert, K., Childress, A. L., Risatti, G. R., & Frasca, S., Jr. (2009). Systemic adenovirus infection in Sulawesi tortoises

194

(Indotestudo forsteni) caused by a novel siadenovirus. Journal of Veterinary Diagnostic Investigation, 21(4), 415-426.

Roberts, A. W., Whitenack, D. L., & Carter, G. R. (1974). Recovery of adenoviruses and slow herpesviruses from horses having respiratory tract infection. American Journal of Veterinary Research, 35(9), 1169-1172.

Robinson, C. M., Singh, G., Lee, J. Y., Dehghan, S., Rajaiya, J., Liu, E. B., Yousuf, M. A., Betensky, R. A., Jones, M. S., Dyer, D. W., Seto, D., & Chodosh, J. (2013). Molecular evolution of human adenoviruses. Scientific Reports, 3, 1812.

Roden, R. B., Weissinger, E. M., Henderson, D. W., Booy, F., Kirnbauer, R., Mushinski, J. F., Lowy, D. R., & Schiller, J. T. (1994). Neutralization of bovine papillomavirus by antibodies to L1 and L2 capsid proteins. Journal of Virology, 68(11), 7570-7574.

Roelvink, P. W., Lee, G. M., Einfeld, D. A., Kovesdi, I., & Wickham, T. J. (1999). Identification of a conserved receptor-binding site on the fiber proteins of CAR- recognizing adenoviridae. Science, 286(5444), 1568-1571.

Roelvink, P. W., Lizonova, A., Lee, J. G. M., Li, Y., Bergelson, J. M., Finberg, R. W., Brough, D. E., Kovesdi, I., & Wickham, T. J. (1998). The coxsackievirus- adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E, and F. Journal of Virology, 72(10), 7909-7915.

Romanova, N., Corredor, J. C., & Nagy, E. (2009). Detection and quantitation of fowl adenovirus genome by a real-time PCR assay. Journal of Virological Methods, 159(1), 58-63.

Rosa-Calatrava, M., Grave, L., Puvion-Dutilleul, F., Chatton, B., & Kedinger, C. (2001). Functional analysis of adenovirus protein IX identifies domains involved in capsid stability, transcriptional activity, and nuclear reorganization. Journal of Virology, 75(15), 7131-7141.

Rosen, L. (1960). Hemagglutination-lnhibition Technique for Typing Adenoviruses. American Journal of Hygiene, 71(1), 120-128.

Rott, L. S., Rose, J. R., Bass, D., Williams, M. B., Greenberg, H. B., & Butcher, E. C. (1997). Expression of mucosal homing receptor alpha4beta7 by circulating CD4+ cells with memory for intestinal rotavirus. Journal of Clinical Investigation, 100(5), 1204-1208.

Rowe, W. P., Huebner, R. J., Gilmore, L. K., Parrott, R. H., & Ward, T. G. (1953). Isolation of a cytopathogenic agent from human adenoids undergoing spontaneous degeneration in tissue culture. Proceedings of the Society for Experimental Biology and Medicine, 84(3), 570-573.

Russell, W. C. (2000). Update on adenovirus and its vectors. Journal of General Virology, 81(11), 2573-2604.

195

Russell, W. C. (2009). Adenoviruses: update on structure and function. Journal of General Virology, 90(1), 1-20.

Rux, J. J., & Burnett, R. M. (2004). Adenovirus structure. Human gene therapy, 15(12), 1167-1176.

Rux, J. J., Kuser, P. R., & Burnett, R. M. (2003). Structural and phylogenetic analysis of adenovirus hexons by use of high-resolution x-ray crystallographic, molecular modeling, and sequence-based methods. Journal of Virology, 77(17), 9553- 9566.

Saitou, N., & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4), 406- 425.

Salone, B., Martina, Y., Piersanti, S., Cundari, E., Cherubini, G., Franqueville, L., Failla, C. M., Boulanger, P., & Saggio, I. (2003). Integrin alpha3beta1 is an alternative cellular receptor for adenovirus serotype 5. Journal of Virology, 77(24), 13448-13454.

San Martin, C. (2012). Latest insights on adenovirus structure and assembly. Viruses, 4(5), 847-877.

San Martin, C., Glasgow, J. N., Borovjagin, A., Beatty, M. S., Kashentseva, E. A., Curiel, D. T., Marabini, R., & Dmitriev, I. P. (2008). Localization of the N- terminus of minor coat protein IIIa in the adenovirus capsid. Journal of Molecular Biology, 383(4), 923-934.

Saphire, A. C., Guan, T., Schirmer, E. C., Nemerow, G. R., & Gerace, L. (2000). Nuclear import of adenovirus DNA in vitro involves the nuclear protein import pathway and hsc70. Journal of Biological Chemistry, 275(6), 4298-4304.

Savage, C., Middleton, D., & Studdert, M. J. (2013). Adeno, hendra, and equine rhinitis viral respiratory diseases. In: D. C. Sellon & M. Long (Eds.), Equine Infectious Diseases, 2 ed., pp. 189-197: Elsevier Science.

Schauer, R. (2004). Sialic acids: fascinating sugars in higher animals and man. Zoology, 107(1), 49-64.

Schneider-Brachert, W., Tchikov, V., Merkel, O., Jakob, M., Hallas, C., Kruse, M. L., Groitl, P., Lehn, A., Hildt, E., Held-Feindt, J., Dobner, T., Kabelitz, D., Kronke, M., & Schutze, S. (2006). Inhibition of TNF receptor 1 internalization by adenovirus 14.7K as a novel immune escape mechanism. Journal of Clinical Investigation, 116(11), 2901-2913.

Schneider-Schaulies, J. (2000). Cellular receptors for viruses: links to tropism and pathogenesis. Journal of General Virology, 81(6), 1413-1429.

Schondorf, E., Bahr, U., Handermann, M., & Darai, G. (2003). Characterization of the complete genome of the Tupaia (tree shrew) adenovirus. Journal of Virology, 77(7), 4345-4356.

196

Schulz, R., Zhang, Y. B., Liu, C. J., & Freimuth, P. (2007). Thiamine diphosphate binds to intermediates in the assembly of adenovirus fiber knob trimers in Escherichia coli. Protein Science, 16(12), 2684-2693.

Segerman, A., Atkinson, J. P., Marttila, M., Dennerquist, V., Wadell, G., & Arnberg, N. (2003). Adenovirus type 11 uses CD46 as a cellular receptor. Journal of Virology, 77(17), 9183-9191.

Seiradake, E., Lortat-Jacob, H., Billet, O., Kremer, E. J., & Cusack, S. (2006). Structural and mutational analysis of human Ad37 and canine adenovirus 2 fiber heads in complex with the D1 domain of coxsackie and adenovirus receptor. Journal of Biological Chemistry, 281(44), 33704-33716.

Selinka, H. C., Giroglou, T., & Sapp, M. (2002). Analysis of the infectious entry pathway of human papillomavirus type 33 pseudovirions. Virology, 299(2), 279- 287.

Shayakhmetov, D. M., & Lieber, A. (2000). Dependence of adenovirus infectivity on length of the fiber shaft domain. Journal of Virology, 74(22), 10274-10286.

Shenk, T. (2001). Adenoviridae:The viruses and their replication. In: D. M. Knipe & P. M. Howley (Eds.), Field's Virology, pp. 2265-2300, Philadelphia: Lippincott- Raven Press.

Short, J. J., Pereboev, A. V., Kawakami, Y., Vasu, C., Holterman, M. J., & Curiel, D. T. (2004). Adenovirus serotype 3 utilizes CD80 (B7. 1) and CD86 (B7. 2) as cellular attachment receptors. Virology, 322(2), 349-359.

Short, J. J., Vasu, C., Holterman, M. J., Curiel, D. T., & Pereboev, A. (2006). Members of adenovirus species B utilize CD80 and CD86 as cellular attachment receptors. Virus Research, 122(1–2), 144-153.

Shukla, D., & Spear, P. G. (2001). Herpesviruses and heparan sulfate: an intimate relationship in aid of viral entry. Journal of Clinical Investigation, 108(4), 503- 510.

Singh, A. K., Menendez-Conejero, R., San Martin, C., & van Raaij, M. J. (2014). Crystal structure of the fibre head domain of the Atadenovirus Snake Adenovirus 1. PLoS One, 9(12), e114373.

Singh, M., Krajewski, M., Mikolajka, A., & Holak, T. A. (2005a). Molecular determinants for the complex formation between the retinoblastoma protein and LXCXE sequences. Journal of Biological Chemistry, 280(45), 37868-37876.

Singh, M., Shmulevitz, M., & Tikoo, S. K. (2005b). A newly identified interaction between IVa2 and pVIII proteins during porcine adenovirus type 3 infection. Virology, 336(1), 60-69.

Sirena, D., Lilienfeld, B., Eisenhut, M., Kalin, S., Boucke, K., Beerli, R. R., Vogt, L., Ruedl, C., Bachmann, M. F., Greber, U. F., & Hemmi, S. (2004). The human membrane cofactor CD46 is a receptor for species B adenovirus serotype 3. Journal of Virology, 78(9), 4454-4462.

197

Smart, J. E., & Stillman, B. W. (1982). Adenovirus terminal protein precursor. Partial amino acid sequence and the site of covalent linkage to virus DNA. Journal of Biological Chemistry, 257(22), 13499-13506.

Snijder, J., Benevento, M., Moyer, C. L., Reddy, V., Nemerow, G. R., & Heck, A. J. (2014). The cleaved N-terminus of pVI binds peripentonal hexons in mature adenovirus. Journal of Molecular Biology, 426(9), 1971-1979.

Soudais, C., Boutin, S., Hong, S. S., Chillon, M., Danos, O., Bergelson, J. M., Boulanger, P., & Kremer, E. J. (2000). Canine adenovirus type 2 attachment and internalization: coxsackievirus-adenovirus receptor, alternative receptors, and an RGD-independent pathway. Journal of Virology, 74(22), 10639-10649.

Stencel-Baerenwald, J. E., Reiss, K., Reiter, D. M., Stehle, T., & Dermody, T. S. (2014). The sweet spot: defining virus-sialic acid interactions. Nature Review Microbiology, 12(11), 739-749.

Stevenson, R. A., Huang, J.-a., Studdert, M. J., & Hartley, C. A. (2004). Sialic acid acts as a receptor for equine rhinitis A virus binding and infection. Journal of General Virology, 85(9), 2535-2543.

Stewart, P. L., Fuller, S. D., & Burnett, R. M. (1993). Difference imaging of adenovirus: bridging the resolution gap between X-ray crystallography and electron microscopy. The EMBO Journal, 12(7), 2589-2599.

Stewart, P. L., & Nemerow, G. R. (2007). Cell integrins: commonly used receptors for diverse viral pathogens. Trends in Microbiology, 15(11), 500-507.

Studdert, M. J. (1978). Antigenic homogeneity of equine adenoviruses. Australian Veterinary Journal, 54(5), 263-264.

Studdert, M. J. (1996). Equine adenoviruses. In: M. J. Studdert (Ed.), Virus infections of equines, pp. 67-80, Amsterdam: Elsevier.

Studdert, M. J., & Blackney, M. H. (1982). Isolation of an adenovirus antigenically distinct from equine adenovirus type 1 from diarrheic foal feces. American Journal of Veterinary Research, 43(3), 543-544.

Studdert, M. J., Mason, R. W., & Patten, B. E. (1978). Rotavirus diarrhoea of foals. Australian Veterinary Journal, 54(7), 363-364.

Sumida, S. M., Truitt, D. M., Lemckert, A. A. C., Vogels, R., Custers, J. H. H. V., Addo, M. M., Lockman, S., Peter, T., Peyerl, F. W., Kishko, M. G., Jackson, S. S., Gorgone, D. A., Lifton, M. A., Essex, M., Walker, B. D., Goudsmit, J., Havenga, M. J. E., & Barouch, D. H. (2005). Neutralizing Antibodies to Adenovirus Serotype 5 Vaccine Vectors Are Directed Primarily against the Adenovirus Hexon Protein. The Journal of Immunology, 174(11), 7179.

Summerford, C., & Samulski, R. J. (1998). Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. Journal of Virology, 72(2), 1438-1445.

198

Summers, M., & Smith, G. E. (1987). A manual of methods for baculovirus vectors and insect cell culture procedures. Texas: Texas Agricultural Experiment Station.

Tamura, K., Nei, M., & Kumar, S. (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences of the United States of America, 101(30), 11030-11035.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30(12), 2725-2729.

Tan, M., Wei, C., Huang, P., Fan, Q., Quigley, C., Xia, M., Fang, H., Zhang, X., Zhong, W., & Klassen, J. S. (2015). Tulane virus recognizes sialic acids as cellular receptors. Scientific Reports, 5.

Tarassishin, L., Szawlowski, P., Kidd, A. H., & Russell, W. C. (2000). An epitope on the adenovirus fibre tail is common to all human subgroups. Archives of Virology, 145(4), 805-811.

Täuber, B., & Dobner, T. (2001). Adenovirus early E4 genes in viral oncogenesis. Oncogene, 20(54), 7847-7854.

Teodoro, J. G., Halliday, T., Whalen, S. G., Takayesu, D., Graham, F. L., & Branton, P. E. (1994). Phosphorylation at the carboxy terminus of the 55-kilodalton adenovirus type 5 E1B protein regulates transforming activity. Journal of Virology, 68(2), 776-786.

Thomas, G. P., & Mathews, M. B. (1980). DNA replication and the early to late transition in adenovirus infection. Cell, 22(2), 523-533.

Thompson, D. B., Spradbrow, P. B., & Studdert, M. J. (1976). Isolation of an Adenovirus from an Arab foal with a combined immunodeficiency disease. Australian veterinary journal, 52(10), 435-437.

Timoney, P. J. (1971). Adenovirus precipitating antibodies in the sera of some domestic animal species in Ireland. The British Veterinary Journal, 127(12), 567-571.

Todd, J. D. (1969). Comments on rhinoviruses and parainfluenza viruses of horses. Journal of the American Veterinary Medical Association, 155(2), 387.

Tokmakov, A. A., Kurotani, A., Takagi, T., Toyama, M., Shirouzu, M., Fukami, Y., & Yokoyama, S. (2012). Multiple post-translational modifications affect heterologous protein synthesis. The Journal of biological chemistry, 287(32), 27106-27116.

Tollefson, A. E., Scaria, A., Hermiston, T. W., Ryerse, J. S., Wold, L. J., & Wold, W. (1996). The adenovirus death protein (E3-11.6 K) is required at very late stages of infection for efficient cell lysis and release of adenovirus from infected cells. Journal of Virology, 70(4), 2296-2306.

Tomko, R. P., Xu, R., & Philipson, L. (1997). HCAR and MCAR: The human and mouse cellular receptors for subgroup C adenoviruses and group

199

B coxsackieviruses. Proceedings of the National Academy of Sciences of the United States of America, 94(7), 3352-3356.

Toogood, C. I. A., Crompton, J., & Hay, R. T. (1992). Antipeptide antisera define neutralizing epitopes on the adenovirus hexon. Journal of General Virology, 73(6), 1429-1435.

Tribouley, C., Lutz, P., Staub, A., & Kedinger, C. (1994). The product of the adenovirus intermediate gene IVa2 is a transcriptional activator of the major late promoter. Journal of Virology, 68(7), 4450-4457.

Tuve, S., Wang, H., Jacobs, J. D., Yumul, R. C., Smith, D. F., & Lieber, A. (2008). Role of cellular heparan sulfate proteoglycans in infection of human adenovirus serotype 3 and 35. PLoS Pathogens, 4(10), e1000189.

Ursu, K., Harrach, B., Matiz, K., & Benko, M. (2004). DNA sequencing and analysis of the right-hand part of the genome of the unique bovine adenovirus type 10. Journal of General Virology, 85(3), 593-601. van Oostrum, J., & Burnett, R. M. (1985). Molecular composition of the adenovirus type 2 virion. Journal of Virology, 56(2), 439-448. van Raaij, M. J., Louis, N., Chroboczek, J., & Cusack, S. (1999). Structure of the human adenovirus serotype 2 fiber head domain at 1.5 A resolution. Virology, 262(2), 333-343.

Varki, A. (2009). Multiple changes in sialic acid biology during human evolution. Glycoconjugates Journal, 26(3), 231-245.

Varki, A., & Schauer, R. (2009). Sialic Acids. In: A. Varki, R. D. Cummings, J. D. Esko, H. H. Freeze, P. Stanley, C. R. Bertozzi, G. W. Hart, & M. E. Etzler (Eds.), Essentials of Glycobiology, Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press, La Jolla, California.

Vellinga, J., Van der Heijdt, S., & Hoeben, R. C. (2005). The adenovirus capsid: major progress in minor proteins. Journal of General Virology, 86(6), 1581-1588.

Vetter, M. R., Staggemeier, R., Vecchia, A. D., Henzel, A., Rigotto, C., & Spilki, F. R. (2015). Seasonal variation on the presence of adenoviruses in stools from non- diarrheic patients. Brazilian Journal of Microbiology, 46, 749-752.

Vrati, S., Boyle, D., Kocherhans, R., & Both, G. W. (1995). Sequence of ovine adenovirus homologs for 100K hexon assembly, 33K, pVIII, and fiber genes: early region E3 is not in the expected location. Virology, 209(2), 400-408.

Waddington, S. N., McVey, J. H., Bhella, D., Parker, A. L., Barker, K., Atoda, H., Pink, R., Buckley, S. M., Greig, J. A., Denby, L., Custers, J., Morita, T., Francischetti, I. M., Monteiro, R. Q., Barouch, D. H., van Rooijen, N., Napoli, C., Havenga, M. J., Nicklin, S. A., & Baker, A. H. (2008). Adenovirus serotype 5 hexon mediates liver gene transfer. Cell, 132(3), 397-409.

200

Walsh, M. P., Chintakuntlawar, A., Robinson, C. M., Madisch, I., Harrach, B., Hudson, N. R., Schnurr, D., Heim, A., Chodosh, J., Seto, D., & Jones, M. S. (2009). Evidence of molecular evolution driven by recombination events influencing tropism in a novel human adenovirus that causes epidemic keratoconjunctivitis. PLoS One, 4(6), e5635.

Walsh, M. P., Seto, J., Jones, M. S., Chodosh, J., Xu, W., & Seto, D. (2010). Computational analysis identifies human adenovirus type 55 as a re-emergent acute respiratory disease pathogen. Journal of Clinical Microbiology, 48(3), 991-993.

Walsh, M. P., Seto, J., Liu, E. B., Dehghan, S., Hudson, N. R., Lukashev, A. N., Ivanova, O., Chodosh, J., Dyer, D. W., Jones, M. S., & Seto, D. (2011). Computational analysis of two species C human adenoviruses provides evidence of a novel virus. Journal of Clinical Microbiology, 49(10), 3482-3490.

Watanabe, M., Kohdera, U., Kino, M., Haruta, T., Nukuzuma, S., Suga, T., Akiyoshi, K., Ito, M., Suga, S., & Komada, Y. (2005). Detection of adenovirus DNA in clinical samples by SYBR Green real-time polymerase chain reaction assay. Pediatrics International, 47(3), 286-291.

Webster, A., Hay, R. T., & Kemp, G. (1993). The adenovirus protease is activated by a virus-coded disulphide-linked peptide. Cell, 72(1), 97-104.

Webster, A., Russell, W. C., & Kemp, G. D. (1989). Characterization of the adenovirus proteinase: development and use of a specific peptide assay. Journal of General Virology, 70 ( Pt 12)(12), 3215-3223.

Weiss, R. S., Lee, S. S., Prasad, B. V., & Javier, R. T. (1997). Human adenovirus early region 4 open reading frame 1 genes encode growth-transforming proteins that may be distantly related to dUTP pyrophosphatase enzymes. Journal of Virology, 71(3), 1857-1870.

Weitzman, M. D., & Ornelles, D. A. (2005). Inactivating intracellular antiviral responses during adenovirus infection. Oncogene, 24(52), 7686-7696.

Wickham, T. J., Filardo, E. J., Cheresh, D. A., & Nemerow, G. R. (1994). Integrin αvβ5 selectively promotes adenovirus mediated cell membrane permeabilization. The Journal of Cell Biology, 127(1), 257-264.

Wickham, T. J., Mathias, P., Cheresh, D. A., & Nemerow, G. R. (1993). Integrins αvβ3 and αvβ5 promote adenovirus internalization but not virus attachment. Cell, 73(2), 309-319.

Wiethoff, C. M., Wodrich, H., Gerace, L., & Nemerow, G. R. (2005). Adenovirus protein VI mediates membrane disruption following capsid disassembly. Journal of Virology, 79(4), 1992-2000.

Wilks, C. R., & Studdert, M. J. (1972). Isolation of an equine adenovirus. Australian Veterinary Journal, 48(10), 580-581.

201

Wilks, C. R., & Studdert, M. J. (1973). The characterisation of an equine adenovirus. Australian Veterinary Journal, 49(10), 456-459.

Williams, M. B., Rose, J. R., Rott, L. S., Franco, M. A., Greenberg, H. B., & Butcher, E. C. (1998). The memory B cell subset responsible for the secretory IgA response and protective humoral immunity to rotavirus expresses the intestinal homing receptor, alpha4beta7. Journal of Immunology, 161(8), 4227-4235.

Wodrich, H., Guan, T., Cingolani, G., Von Seggern, D., Nemerow, G., & Gerace, L. (2003). Switch from capsid protein import to adenovirus assembly by cleavage of nuclear transport signals. The EMBO Journal, 22(23), 6245-6255.

Woodward, M. P., Young, W. W., & Bloodgood, R. A. (1985). Detection of monoclonal antibodies specific for carbohydrate epitopes using periodate oxidation. Journal of Immunological Methods, 78(1), 143-153.

Wu, E., Pache, L., Von Seggern, D. J., Mullen, T. M., Mikyas, Y., Stewart, P. L., & Nemerow, G. R. (2003). Flexibility of the adenovirus fiber is required for efficient receptor interaction. Journal of Virology, 77(13), 7225-7235.

WuDunn, D., & Spear, P. G. (1989). Initial interaction of herpes simplex virus with cells is binding to heparan sulfate. Journal of Virology, 63(1), 52-58.

Xia, D., Henry, L. J., Gerard, R. D., & Deisenhofer, J. (1994). Crystal structure of the receptor-binding domain of adenovirus type 5 fiberprotein at 1.7 Å resolution. Structure, 2(12), 1259-1270.

Xu, Z. Z., Hyatt, A., Boyle, D. B., & Both, G. W. (1997). Construction of ovine adenovirus recombinants by gene insertion or deletion of related terminal region sequences. Virology, 230(1), 62-71.

Zakhartchouk, A., Bout, A., Woods, W. L., Lehmkuhl, D. H., & Havenga, E. M. J. (2002). Odocoileus hemionus deer adenovirus is related to the members of Atadenovirus genus. Archives of Virology, 147(4), 841-847.

Zakhartchouk, A. N., Reddy, P. S., Baxi, M., Baca-Estrada, M. E., Mehtali, M., Babiuk, L. A., & Tikoo, S. K. (1998). Construction and characterization of E3-deleted bovine adenovirus type 3 expressing full-length and truncated form of bovine herpesvirus type 1 glycoprotein gD. Virology, 250(1), 220-229.

Zhang, W., & Imperiale, M. J. (2003). Requirement of the adenovirus IVa2 protein for virus assembly. Journal of Virology, 77(6), 3586-3594.

Zhang, W., Low, J. A., Christensen, J. B., & Imperiale, M. J. (2001). Role for the adenovirus IVa2 protein in packaging of viral DNA. Journal of Virology, 75(21), 10446-10454.

Zhang, Y., & Bergelson, J. M. (2005). Adenovirus receptors. Journal of Virology, 79(19), 12125-12131.

202

Zhou, Y., Reddy, P. S., Babiuk, L. A., & Tikoo, S. K. (2001). Bovine adenovirus type 3 E1B(small) protein is essential for growth in bovine fibroblast cells. Virology, 288(2), 264-274.

Zubieta, C., Schoehn, G., Chroboczek, J., & Cusack, S. (2005). The structure of the human adenovirus 2 penton. Molecular Cell, 17(1), 121-135.

203

APPENDICES

Appendix A1: Nucleotide percent identity heat map of selected adenoviruses in comparison with EAdV2-385/75.4 *.

* Distance calculation was performed using Geneious software (V,7.1.9).The distances were represented by shades of gray, with a darker grey (84 - 100%) indicating viruses that are genetically closer and lighter grey (21 - 30%) indicating viruses that are genetically further apart.

204

Appendix A1: Nucleotide percent identity heat map of selected adenoviruses in comparison with EAdV2-385/75.4 continued.

* Distance calculation was performed using Geneious software (V,7.1.9).The distances were represented by shades of grey, with a darker grey (84 - 100%) indicating viruses that are genetically closer and lighter grey (21 - 30%) indicating viruses that are genetically further apart.

205

Appendix A2: Summary of a virus infectivity assay development.

Virus Inoculum No. of fluorescent cells a Cytopathic effect (CPE) dilution 30ˈ b, 30ˈ, 60ˈ, 60ˈ, 30ˈ, 30ˈ, 60ˈ, 60ˈ, 12 b 24 12 24 12 24 12 24 EAdV-1 Undiluted 0 0 0 52 - - - +

1/10 0 0 0 48 - - - + 1/100 0 0 0 6 - - - + 1/1000 0 0 0 0 - - - - 30ˈ, 30ˈ, 60ˈ, 60ˈ, 30ˈ, 30ˈ, 60ˈ, 60ˈ, 24 48 24 48 24 48 24 48 EAdV-2 Undiluted 0 0 0 TMCc - - + 1/10 0 0 0 82 - - + 1/100 0 0 0 8 - - - 1/1000 0 0 0 0 - - -

6.6 7.2 Note that the undiluted inoculum contained 10 TCID50/ml for EAdV-1 and 10 TCID50/ml for EAdV-2. a average number of infected cells from two independent experiments. b viral binding and replication incubation time in min and hrs, respectively. c TMC, too many to count.

206

Appendix A3: Multiple comparison tests using Tukey’s procedure for heparan sulfate treatment effect on EAdV-1 infectivity.

207

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Mekonnen, Ayalew Berhanu

Title: Equine adenovirus: molecular and host cell receptor characterisation

Date: 2017

Persistent Link: http://hdl.handle.net/11343/194382

File Description: Equine adenovirus: molecular and host cell receptor characterisation

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.