Suppressors of Oncogenic Cbl in the Drosophila Eye

Suppressors of oncogenic Cbl in the Drosophila eye.

Rowena Tenri Sannang ORCID identifier- 0000-0002-9259-5536

Master of Philosophy May 2018

Department of Anatomy and Neuroscience University of Melbourne Submitted in total fulfilment of the requirements of the degree ABSTRACT

Cbl is an E3 ligase, and downregulates several cellular signalling pathways, in this role by targeting receptor tyrosine kinases for endocytosis. Mammalian Cbl was first identified as the full-length isoform of v-Cbl, a C-terminal truncated dominant negative oncogene that permits binding of v-Cbl to Cbl targets but does not facilitate their ubiquitination. This results in constitutive activation of the receptor tyrosine kinase.

In this thesis, I used a Drosophila analogue of v-Cbl, named Dv-cbl. GMR>Dv-cbl had been used prior to the commencement of this study to screen for modifiers of its rough and overgrown eye phenotype using the Gene search system, a transposon-based inducible expression system. In this study, a subset of the suppressors of the GMR>Dv- cbl phenotype from that screen, and two other representative lines were further investigated.

The published interactions and functions of the genes implicated by the GS lines are discussed and a method of suppression of the GMR>Dv-cbl phenotype by each line is suggested. In the published work presented in this thesis, the Akap200 expressing lines EP2254 and GS2208 were further studied. Expression of Akap200 in EP2254 was confirmed via mRNA in situ hybridisation, and its ability to also suppress the Ras85DV12 phenotype was confirmed.

The ability of EP2254 to suppress GMR-Dv-cbl and sev-Ras85DV12 coexpression was confirmed. When GMR-Dv-cbl and sev-Ras85DV12 are coexpressed, a phenotype that is greater than the cumulative phenotype of each would suggest arises. In fact, GMR-Dv- cbl (where Dv-cbl was directly driven from the GMR promoter) was used instead of GMR-Gal4, UAS-Dv-cbl (GMR>Dv-cbl) as the coexpression of GMR>Dv-cbl and sev- Ras85DV12 results in lethality, and coexpression of GMR-Dv-cbl and sev-Ras85DV12 did not. Alone, each has a mildly rough eye. I showed that EP2254 was able to suppress this phenotype and that this suppression was partially independent of apoptosis. The endogenous function of Akap200 in the Drosophila eye was then investigated. An mRNA in situ hybridisation experiment showed that endogenous Akap200 is present in the eye disc, and a series of immunohistochemical stains showed that Akap200 was expressed in a subset of photoreceptor cells. Knockdown of Akap200 using RNAi lines

i showed that endogenous Akap200 was having a modifying effect on the GMR>Dv-cbl phenotype, as knockdown of Akap200 enhances the GMR>Dv-cbl phenotype. A recent study suggests that Notch is protected from internalisation by Cbl by Akap200, which is consistent with the results in this thesis.

PREFACE

Chapter 4 consists solely of the paper published with myself as the first author, Hannah Robertson and Nicole Siddall as second and third authors respectively, and Gary Hime as the senior author. This paper was published by Molecular and Cellular Biochemistry on 8 July 2012 (online) (and then in the October 2012 issue) and was titled: “Akap200 suppresses the effects of Dv-cbl expression in the Drosophila eye”. As stated in the declaration of thesis with publication form, I contributed 80% of the work towards this paper.

I designed and carried out the experiments under the advice of Hannah Robertson and Gary Hime, Nicole Siddall assisted with imaging of Figure 5, and the manuscript was prepared by myself with input from all authors.

This work was sponsored by the National Health and Medical Research Council Project Grant 350316 awarded to Gary Hime and Hannah Robertson.

ACKNOWLEDGEMENTS

I would first like to thank my supervisors, Gary Hime and Hannah Robertson, thanks for their guidance, encouragement, and patience through this entire process. I would also like to thank my advisory committee Robb De Iongh and Peter Kitchener, for their help and advice, and Franca Casagranda for help with molecular work. I would like to thank my family, especially my spouse Leo Bullimore, and my mother Meryl Martin, for always being there for me and supporting me.

Other family members who I would like to thank for their support and encouragement are: Amri Sannang, Beata Masternak, Neil Martin, Dawn Martin, Carol Bullimore, Brian Bullimore, Erin Dowdle, Joel Stevens, Gemma Stevens, Bronte Stevens, Callum Stevens, and Ava Stevens.

I’d also like to thank my friends- Lisa McLennan, Carina Heppell, Anna Johnson, Jessica Peters, Mia De Seram, Mirijana Cipetic, and Aggie Napodowski, and the current and former lab members of the Fly labs in the department during my time there, especially Rebecca Parsons, Marina Kalcina, Tricia Dominado, and Elena Savva for their help with fly care.

TABLE OF CONTENTS

ABSTRACT ...... i

DECLARATION ...... iii

PREFACE ...... iv

ACKNOWLEDGEMENTS ...... v

TABLE OF CONTENTS ...... vi

INDEX OF TABLES ...... x

INDEX OF FIGURES ...... xi

COMMON ABBREVIATIONS USED IN THIS THESIS ...... xii

1 INTRODUCTION ...... 1

1.1 The Cbl family of genes...... 2 1.2 Cbl mutants...... 3 1.3 Cbl function ...... 6 1.4 Cbl in Drosophila eye development ...... 7 1.5 The screen performed prior to this study identified a number of suppressors of Dv- Cbl ...... 11 1.6 Thesis Aims ...... 14 1.7 A short word on Drosophila ...... 14 1.8 Summary ...... 15

2 MATERIALS AND METHODS ...... 16

2.1 MATERIALS ...... 17 2.1.1 Chemicals and Reagents ...... 17 2.1.2 Nucleotides ...... 17 2.1.3 Antibodies ...... 18 2.1.4 Drosophila strains ...... 19 2.1.4.1 GAL4 lines ...... 19 2.1.4.2 Mutant and Transgenic lines ...... 20 2.1.4.3 Balancer Chromosomes ...... 21 2.1.4.4 Lines generated in the course of this project ...... 21 2.1.4.4.1 Mating scheme type 1 ...... 21

2.1.4.4.3 Mating scheme type 2 ...... 22 2.1.4.4.4 Mating scheme type 3, ‘clean up’ crosses...... 23 2.1.5 Media and Buffers ...... 23 2.1.5.1 Bacteria Media ...... 23 2.1.5.2 Buffers and Standard Solutions ...... 23 2.1.5.3 Drosophila culture medium...... 24 2.2 METHODS ...... 24 2.2.1 Drosophila culture and genetics ...... 24 2.2.1.1 Culture ...... 24 2.2.1.2 Genetics ...... 24 2.2.2 Histology, Microscopy, and Imaging ...... 25 2.2.2.1 Immunohistochemistry of larval tissues...... 25 2.2.2.2 mRNA in situ hybridisation to larval tissues ...... 25 2.2.2.3 Scanning electron microscopy ...... 28 2.2.2.4 Image manipulation ...... 28 2.2.3 Molecular Biology ...... 28 2.2.3.1 Isolation of RNA from adult fly heads...... 28 2.2.3.2 Quantitative Real time PCR ...... 28 2.2.4 An explanation of systems and collections used in this project- the tools...... 29 2.2.4.1 The GAL4/UAS system- Targeted expression of transgenes in Drosophila tissues...... 29 2.2.4.2 The EP and GS systems were used for finding novel genes ...... 31 2.2.4.2.1 The EP lines ...... 31 2.2.4.2.2 The Gene Search System ...... 31 2.2.4.3 RNAi lines ...... 32 2.2.4.3.1 The GD and KK Genome-wide RNAi libraries (Vienna) ...... 35 2.2.4.3.2 Transgenic RNAi project lines used ...... 35

3 RESULTS: Characterisation of genes that suppress the Dv-cbl phenotype...... 37

3.1 Introduction ...... 38 3.2 Suppression of Dv-cbl was confirmed using scanning electron microscopy of adult female eyes ...... 38

vii

3.2.1 Confirmation of suppression of the GMR>Dv-cbl heterozygote adult eye phenotypes by P-element strains ...... 39 3.2.2 Suppressors of both eye overgrowth and roughness...... 43 3.2.3 Suppressors of eye roughness...... 43 3.2.3 Suppressors of whole eye overgrowth only...... 43 3.2.4 Summary of SEM results ...... 43 3.3 Suppression of Dv-cbl was also examined during eye development using immunohistochemistry with anti-CUT ...... 44 3.3.1 Differential effects of GS10305, GS1120, and EP2254 ...... 45 3.3.2 Differential effects of GS2273, GS5217, GS2208, and GS8042 ...... 45 3.3.3 Differential effects of Lk6, GS2064, GS9841, and GS10268 ...... 46 3.4 Discussion ...... 49 3.4.1 The results of the assays are summarised in Tables 3.2 and 3.3...... 49 3.4.1 Cbl is involved in a myriad of cellular pathways ...... 66 3.4.2: Potential genes involved in suppression of Dv-cbl eye phenotypes ...... 66 3.4.2.1: Category 1 - GS10305, GS1120, and EP2254, suppressed both overgrowth and roughness in the adult eye ...... 66 3.4.2.1.1: Subcategory 1a- GS10305 suppressed cone cell roughness and cell size ...... 66 3.4.2.1.2: Subcategory 1b- GS1120 also suppressed or antagonised the Dv-cbl cone cell size phenotype ...... 67 3.4.2.1.3 Subcategory 1c- EP2254 was a suppressor of array order in cone cells...... 67 3.4.2.2 Category 2- Lk6, GS2064, GS9841, and GS10268 are suppressors of adult eye overgrowth ...... 67 3.4.2.2.1 Category 2a- GS10268 was also a suppressor of array order and suppressor or antagoniser of the Dv-cbl enlarged cell size phenotype in cone cells...... 67 3.4.2.2.2 Subcategory 2b-Lk6, GS2064, and GS9841 also suppressed cone cell size ...... 67 UAS-Lk6 was designed to ectopically express Lk6, ...... 67 3.4.2.3 Category 3- GS2273, GS5217, GS2208, and GS8042 were suppressors of roughness in the adult eye ...... 68 3.4.2.3.1 Subcategory 3a- GS5217 and GS2208 were suppressors of array order and cell size in cone cells ...... 68 3.4.2.3.2 Subcategory 3b- GS8042 is a suppressor of size in cone cells ...... 69

viii

3.4.2.3.3 Subcategory 3c- GS2273 suppressed array order in cone cells ...... 69 3.5 Conclusion ...... 69

4 RESULTS ...... 71

5 DISCUSSION ...... 83

5.1 Introduction ...... 84 5.2 An interaction map between Cbl and other genes investigated was generated ...... 84 5.2.1 From the interaction map, three nodes became apparent ...... 87 5.2.1.1 Dap160 ...... 87 5.2.1.2 Numb ...... 87 5.2.1.3 Akap200 was the final node identified in the interaction map ...... 88 5.3 Akap200 can suppress Dv-Cbl and Ras85DV12, and is expressed in a subset of photoreceptor cells ...... 89 5.4 The relationship of Akap200 with Notch ...... 90 5.5 Further Directions and final conclusions ...... 91

6 BIBLIOGRAPHY ...... 93

APPENDIX 1 ...... 108

APPENDIX 2 ...... 109

INDEX OF TABLES

Table 2.1: Chemicals and Reagents ...... 17 Table 2.2: Oligonucleotides ...... 18 Table 2.3: Primary Antibodies ...... 18 Table 2.4: Secondary Antibodies...... 19 Table 2.5: GAL4 driver lines ...... 19 Table 2.6 Mutant and Transgenic lines ...... 20 Table 2.7 Balancers ...... 21 Table 2.8: Lines made using mating scheme type 1 ...... 22 Table 2.9 Lines made using mating scheme type 2 ...... 22 Table 3.1 Visual scoring of adult eyes ...... 42 Table 3.2: Summary of results, with a potential mode of suppression ...... 51 Table 3.4 Pathways in common with Cbl and P element lines...... 59 Table 3.5: Cbl interactors (Drosophila and mammalian) that are also represented in the P-element lines or their interactors...... 62 Table 3.6: Common interactors within genes expressed by P element lines in this chapter (as identified in FlyBase, Gramates et al., 2017)...... 64

INDEX OF FIGURES

Figure 1.1: The Cbl family ...... 5 Figure 1.2: Cbl is involved in several cell processes, notably the MAPK pathway ...... 9 Figure 1.3: Drosophila eye development ...... 13 Figure 2.1: Location of probes ...... 27 Figure 2.2: The GAL4/UAS system ...... 30 (Brand and Perrimon, 1993) ...... 30 Figure 2.3: EP vector ...... 33 Figure 2.4: GSS vectors ...... 33 Figure 2.5: RNAi methods in Drosophila ...... 34 Figure 2.6: The VALIUM10 vector ...... 36 Figure 3.1: Suppression of the Dv-cbl adult phenotype in adult eyes ...... 41 Figure 3.2: Suppression of the Dv-cbl cone cell phenotype ...... 48 Figure 3.3: Insert maps of Chapter 3 lines...... 55 Figure 3.4: Summary of GMR>Dv-cbl suppression phenotypes ...... 65 Figure 5.1: Network of Cbl, known interactors and proteins that link their activities ... 86 Appendix 1-The pOT2 vector ...... 108 Appendix 2: Notch misexpression is enhanced by GS2208 and suppressed by Akap200RNAi ...... 109

COMMON ABBREVIATIONS USED IN THIS THESIS

Akap200 A-kinase anchoring protein 200 BDSC Bloomington Drosophila Stock Center bp base pairs cAMP Cyclic Adenosine Monophosphate Cbl Casitas B-lineage lymphoma CG Computed Gene Dap160 Dynamin associated protein 160kDa DGRC Kyoto Drosophila genetic resource centre EGFR Epidermal growth factor receptor EP Enhancer promoter ERK Extracellular Signal-Regulated Kinase GMR Glass Multimer Reporter GS gene search kb kilobase KSR Kinase suppressor of ras MAPK Mitogen-Activated Protein Kinase N Notch n number PBS Phosphate buffered saline PKA protein kinase A /cAMP-dependent protein kinase RAS85D Ras oncogene at 85D RET ret proto-oncogene RF ring finger RING Really Interesting New Gene RTK Receptor tyrosine kinase sev sevenless UAS Upstream Activation Sequence β-gal Beta-galactosidase

xii

1 INTRODUCTION

1 1.1 The Cbl family of genes.

Cbl family members are very well known for their roles as E3 ligases, where they target surface proteins for ubiquitination and subsequent internalisation (discussed in more detail in Section 1.3). Cbl family members are known to be involved in several different signalling networks, (summarised in Figure 1.2a). Of these, the Ras/MAPK pathway is focused on in this work, and its relevance will also be discussed in Section 1.3.

There are three known members of the Cbl family in mammals. In order of discovery, these are c-Cbl, Cbl-b and Cbl-c/Cbl-3. The three proteins vary somewhat in length and structure, and some have different areas of activity or speciality (see Figure 1.1a). All Cbl family members have a Tyrosine kinase binding (TKB) domain at the N terminal, consisting of a four-helix bundle, a calcium-binding EF-hand, and a variant SH2 domain which together allow for binding to phosphorylated tyrosine residues in target tyrosine kinases, which also requires binding to Grb2 (eg: EGFR, PDGFR) (reviewed in Swaminathan and Tsygankov, 2006; Thien and Langdon, 2001, 2005a; Tsygankov et al., 2001). Both c-Cbl and Cbl-b can downregulate EGFR signalling and are involved in immunity (reviewed in Mohapatra et al., 2013; Swaminathan and Tsygankov, 2006). It should be noted that proteins besides tyrosine kinases bind this region, but their identity is not relevant to this study (reviewed in Swaminathan and Tsygankov, 2006). C terminal to the TKB domain is a linker region which, as the name suggests, links the TKB and ring finger (RF) domains. This is a small but necessary region for E3 ligase activity. Mutations in the linker region can lead to Cbl becoming oncogenic (reviewed in Swaminathan and Tsygankov, 2006). The RF domain recruits E2, (the ubiquitin- conjugating enzyme or ubiquitin carrier enzyme). The recruitment of the E2 is needed for Cbl to carry out its function as an E3 ligase in cooperation with the TKB, which determines the target to be ubiquitylated (reviewed in Swaminathan and Tsygankov, 2006; Thien and Langdon, 2001). Independent of E3 ligase activity, Sprouty also binds the RING finger and is itself an antagoniser of EGFR and FGFR signalling (reviewed in Thien and Langdon, 2001). The 18aa ring finger tail (RFT) (Nau and Lipkowitz, 2008) is required for EGFR and Sprouty degradation (Visser and Lill, 2005). Truncations of Cbl at varying points in the ring finger can affect its binding to EGFR, suggesting that the intact RFT has a role in EGFR binding (Visser and Lill, 2005). It interacts with both

2 the E2 protein and TKB domain (Nau and Lipkowitz, 2008). It has been shown with truncations of human Cbl that residues 1-436 of c-Cbl are necessary and sufficient for E3 ligase activity (Visser and Lill, 2005), whereas others have additional C terminal domains. The amino acid sequence of D-CblS stops after the RFT.

After the RING finger tail is where the domains of Cbl family members start to diverge. The domain that immediately follows the RFT is the proline-rich region which is used for SH3 domain binding and 14-3-3 protein binding. Examples of SH3 domain- containing proteins that bind the proline-rich region are Fyn, Src, and Grb2 (reviewed in Thien and Langdon, 2001). Examples of proteins with 14-3-3 domains include protein kinases and proteins involved in cell cycle control and apoptosis and bind to specific phosphorylated serine residues in the proline-rich region (reviewed in Thien and Langdon, 2001). Cbl family members have some varying length in Proline-rich regions (reflected in Figure 1.1), and Cbl-3 and SLI-1 have a shortened Proline-rich region which contains their C terminus (reviewed in Schmidt and Dikic, 2005). Of the Cbl family members shown in Figure 1.1, c-Cbl, Cbl-B, D-CblL are the only endogenous proteins with the Ubiquitin ligase binding/leucine zipper domains. These domains are superimposed on each other but have independent functions. The so-named Ubiquitin-associated domain (UBA) can bind to ubiquitin, however, it is not vital for E3 ligase activity ubiquitylated (reviewed in Swaminathan and Tsygankov, 2006; Thien and Langdon, 2001). The leucine zipper promotes homodimerisation of Cbl and association with the EGFR and dimerization of several proteins ubiquitylated (reviewed in Swaminathan and Tsygankov, 2006; Thien and Langdon, 2001). The Drosophila Cbl family member D-Cbl is alternatively spliced to form two different proteins, called D- CblL and D-CblS (Robertson et al., 2000). D-CblL appears to be a condensed version of the c-Cbl and Cbl-b family members, containing all of the domains the others have, but in a shorter amino acid sequence (Thien and Langdon, 2005b).

1.2 Cbl mutants. v-Cbl (Figure 1.1b) was the first discovered mutant isoform of Cbl. It was isolated from a mouse with pre-B cell lymphoma. c-Cbl was found by probing the DNA of mice, rats and humans with the v-Cbl sequence (Langdon et al., 1989). The dominant negative Cbl oncogene, v-Cbl, binds RTKs in the place of endogenous Cbl, competes for binding

a Name Organism Notes Structure c-Cbl Mammals (including Expression: ubiquitous, higher levels in testis and TKB L RF RFT P-rich UBA/LZ humans, mice, rats, haemopoietic cells (reviewed in Thien and cows, and pigs) Langdon 2001). Active in the immune system (reviewed in (reviewed in Thien and Langdon, 2005) Some 906 Swaminathan and redundancy with Cbl-b (reviewed in Mohapatra et Tsygankov, 2006) al., 2013) Cbl-b Mammals (including Expression: mammary epithelial cells, humans, mice, rats, haemopoietic tissue, testis, spleen kidney lung cows, and pigs) (adult) foetal brain and liver (Keane 1995) . (reviewed in Has become known in later years for its role in 982 Swaminathan and the immune system (Fang et al., 2001). Tsygankov, 2006) Cbl-3 Mammals (including Expression: Ubiquitous, higher in salivary gland, humans, mice, rats, prostrate, adrenal gland and aerodigestive tract cows, and pigs) (Keane et al., 1999). (reviewed in 474 Swaminathan and Tsygankov, 2006) SLI-1 C. elegans Acts on LET-23 (EGFR homologue signalling). This was shown in genetic studies of C. elegans vulval development (Yoon et al., 1995). 582 D-CblL Drosophila Expression: low levels in 3rd instar, pupae and melanogaster adults (Robertson et al., 2000). Preferential regulator of EGFR (Wang et al., 878 2010).

D-CblS Drosophila Expression: early embryos, third instar melanogaster imaginal discs (Hime et al., 1997). 448 Preferentially regulates Notch (Wang et al., 2010). b

Name Organism Notes Structure

v-Cbl Mammals First discovered form of Cbl. Dominant Negative as it competes for binding to RTKs with endogenous Cbl 357 (reviewed in Thien and Langdon, 2001). 70Z/3-Cbl Mammals Originated in a murine B cell leukaemia line (Paige et al., (Δ366- 1978). Later mapped to c-Cbl (Blake et al., 1991). Δ366-382 382) CblΔY368 Humans Mutation of human c-Cbl. Deletion of this residue was transforming in NIH-3T3 fibroblasts (Andoniou et al., 1994). Δ368 CblΔY371 Humans Mutation of human c-Cbl. Deletion of this residue was transforming in NIH-3T3 fibroblasts (Andoniou et al., 1994). Δ371

D-CblF165 Drosophila Mutation of D-cbl gene, creates a null allele as the mutation melanogaster forms a stop codon at amino acid 116 (Pai et al., 2000). F165 mutation (creates a stop codon)

Dv-Cbl Drosophila Mutation of D-cbl gene generated by Hannah Robertson melanogaster (Robertson et al., 2000) as an analogue to v-Cbl. The UAS 306 vector was used so expression is dependent on the GMR driver it is crossed to.

Figure 1.1: The Cbl family and its mutants Known Cbl family members and some mutants, (a) wildtype, (b) mutants. Each of the mammalian, worm and fly Cbl family members are shown, alongside their domain structure. Then, several mutants are shown, beginning with the first isolated mutant, v-Cbl. Finally, two Drosophila mutants are shown, which are often utilised in genetic studies like this one. In this study, the mutant Dv-cbl is used.

The c-Cbl gene is labelled with its domains, which are conserved among most of the other genes. TKB (gray box)- Tyrosine kinase binding domain, L (region following TKB), linker region, RF (green box)- RING finger, RFT (region following RF)- RING finger tail, P- rich (light blue box)- Proline rich domain, UBA/LZ (yellow box) – Ubiquitin associated domain/Leucine Zipper. sites, and prevents endogenous Cbl from performing its E3 ligase activity (reviewed in Thien and Langdon, 2001). It was known that v-Cbl was oncogenic, but in a further effort to determine the transforming mutations in Cbl, the following mutations were studied in NIH-3T3 fibroblasts. 70Z/3-Cbl (Figure 1.1b) was first identified in a murine B cell leukaemia line produced by (Paige et al., 1978). (Andoniou et al., 1994) made a human analogue of 70Z/3-Cbl in NIH-3T3 fibroblasts, by mutating human c-Cbl via site-directed mutagenesis and deleting amino acids 366-382. (Andoniou et al., 1994) also found that the site-directed mutations of human cCbl, CblΔY368 and CblΔY371 (Figure 1.1) were transforming. These three mutations all disrupt the linker region, suggesting that doing so is transforming (reviewed in Thien and Langdon, 2001). (Pai et al., 2000) discovered D- cblF165 (Figure 1.1b) in a screen for genes involved in follicle cell patterning of the egg and embryo. D-cblF165 results in the mutation to a stop codon at amino acid 116 and is thought to result in a null allele. In this thesis, I used a dominant negative form of Drosophila Cbl called Dv-cbl (Robertson et al., 2000) (Figure 1.1), originally made as an analogue of v-Cbl. Dv-Cbl causes sustained activation of the receptor tyrosine kinase EGFR, leading to continual signalling through the pathway (Robertson et al., 2000). This is achieved by Dv-Cbl binding to RTKs via its tyrosine kinase binding domain, after which the protein is truncated, and the resulting protein does not allow the internalisation of the RTK as the protein is truncated in the linker region which lies between the tyrosine kinase binding domain and the RING finger domain. This truncation allows Dv-Cbl to fulfil the tyrosine kinase binding function of either of the D-cbl proteins, but as Dv-Cbl is missing vital regions needed for E3 ligase activity (namely the linker region, ring finger domain, and ring finger tail), this v-Cbl analogue is transforming for the same reasons as the protein it was based on (reviewed in Thien and Langdon, 2001).

1.3 Cbl function As Cbl family members share a common basic structure (Figure 1.1), it is to be expected that they exhibit similar functions. Apart from the classical E3 ligase functionality, Cbl proteins are involved in several other processes (Figure 1.2a). Cbl has many roles in the cell, shown in (Figure 1.2a) (adapted from Dikic et al., 2003), but in this thesis I am focussing on its role in attenuating EGFR signalling (Figure 1.2b), as the

6 control of EGFR signalling is vital to the development of the Drosophila eye (Freeman, 1996), my model of choice. A simplified version of the Ras/MAPK pathway is shown in (Figure 1.2b). In brief, the EGFR is activated by Spitz (Drosophila homologue of EGF), EGFR dimerises and autophosphorylates, which activates Ras, leading to the kinase cascade which activates Raf, MEK, and MAPK in turn. MAPK can then translocate to the nucleus and activate gene expression, some of which are involved in cell survival, division, growth, or activate other proteins outside the nucleus (reviewed in Alberts et al., 2002, 2004). In this thesis, however, I am focussed on the role of Cbl in downregulating the EGFR pathway (Figure 1.2b), as initially shown in C. elegans (Yoon et al., 1995). The downregulation of the EGFR via Cbl requires the action of three classes of ubiquitination proteins, the E1; E2; and E3; and the endocytosis machinery (reviewed in Thien and Langdon, 2001). The role of E1, the Ubiquitin- activating enzyme, is to initially transfer ubiquitin to the E2 (the ubiquitin-conjugating enzyme or ubiquitin carrier enzyme). Then, Cbl acts as an E3 ligase and recruits E2, and one or more ubiquitin moieties are transferred to the RTK target. Ubiquitylation of an RTK leads to its removal from the cell surface via endocytosis and either its eventual recycling to the cell membrane or degradation in a lysosome, depending on the number of ubiquitin moieties are present on the RTK target. Transfer of more than four Ub moieties is thought to lead to degradation (reviewed in Thien and Langdon, 2001). I am particularly interested in the downregulation of EGFR by Drosophila Cbl isoforms. In this work, extensive use is made of Dv-cbl, as mentioned in the previous section. Dv-Cbl results in constitutive activation of the EGFR, and continual activation of the Ras/MAPK pathway, and when expressed in the developing Drosophila eye, hijacks the careful regulation of EGFR activity that occurs there (Freeman, 1996). This causes a noticeable overgrowth in the eye. Later in this work, Dv-cbl is coupled with the misexpression of a constitutively active mutated Ras protein, which together cause massive overgrowth in the eye.

1.4 Cbl in Drosophila eye development The adult Drosophila eye is a neurocrystalline lattice that consists of approximately 800 hexagonal ommatidia (Ready et al., 1976). The eye develops from a sac like structure which consists of the peripodial epithelium, a lumen, and the disc proper (reviewed in Atkins and Mardon, 2009). The cells of the eye disc differentiate during the third instar

7 a b Cellular membrane Figure 1.2: Cbl is involved in several cell processes, notably

E E the MAPK pathway G G F F (a) Cbl family members are involved in a wide range of different R R pathways. Adapted from (Dikic et al. 2003). The EGFR is Ras circled, as it is the pathway most relevant to the current study. In Cbl (b) a simplified version of the Drosophila EGFR pathway is shown. It is an extremely well studied pathway, but in brief, the Raf EGFR is activated by Spitz (Drosophila homologue of EGF), which activates Ras, leading to the kinase cascade which activates Raf, MEK, and MAPK in turn. MAPK then activates

MEK other proteins in the cytoplasm or translocates to the nucleus and activates genes or other proteins involved in cell survival, division, growth, and other aspects of cell biology not within the Other processes scope of this work. Cbl can inactivate this pathway at the level MAPK of the EGFR by acting as an E3 ligase and guiding ubiquitination of the EGFR, which will lead to its removal from the cell membrane and thus cease its exposure to extracellular activators. Depending on the nature of the ubiquitination, Cbl may be destroyed or eventually returned to the cell membrane. This pathway is based on images from (Voas and Rebay 2004) and (Alberts et al., 2002). The DNA image is from MAPK Other proteins https://www.tes.com/lessons/WE5E9RncBhieAQ/dna.

Gene expression- leading to …Cell proliferation, prevention of apoptosis, Cell growth And more… larval stage in association with traverse of a morphological indentation across the disc known as the morphogenetic furrow. In the third instar eye disc, the morphogenetic furrow initiates at the posterior end of the disc and sweeps anteriorly associated with differentiation of the photoreceptors R1-R8. The interplay of Notch and Atonal are initially required for R8 specification just after the morphogenetic furrow (reviewed in Voas and Rebay, 2004). The interplay of several proteins, not just the EGFR are required in the determination of cell fates (reviewed in Kumar, 2012; Voas and Rebay, 2004), but this is beyond the scope of this thesis. A cartoon of ommatidial development is shown in (Figure 1.3). After the recruitment of R8, EGFR is required for the specification of all other cell types (Freeman, 1996). Following R8 recruitment, photoreceptors R2 and R5 are recruited together, then R3, R4, and the mystery cells. The mystery cells return to the pool of surrounding cells, leaving R8, R2, R5, R3, and R4 to make up the 5 cell precluster. Next, the second mitotic wave occurs. This is a tightly controlled mitosis of all undifferentiated cells. From the larger pool of cells, R1 and R6 are recruited. Following these, the last photoreceptor, R7 is recruited. It lies on top of the R8 photoreceptor. Next, the four lens-secreting cone cells are recruited, and this event coincides with the end of larval development (reviewed in Kumar, 2012), see also (Figure 1.3), this work). The following events occur in the pupa. Next to be recruited are two primary (1o) pigment cells, which surround the already determined cells. Then six secondary (2o) pigment cells are recruited. They make up the sides of the ommatidia’s characteristic hexagon shape and are shared with neighbouring ommatidia. The next two sets of cells to be recruited occupy the six vertices of the ommatidia, alternating between which type of cell occupies each vertex. Like the 2o pigment cells, the 3o pigment cells and the mechanosensory bristles are shared with neighbouring ommatidia. The 3o pigment cells are recruited first. Next come the bristles, which are made up of four cells, consisting of the socket, shaft, sheath (the tormogen, trichogen and thecogen respectively) and the sensory neuron, then apoptosis rids the developing eye of superfluous cells (reviewed in Kumar, 2012) see also (Figure 1.3), this work). The fully developed adult eye exhibits the 800 cell neurocrystalline lattice first described in (Ready et al., 1976). A cartoon is shown of the whole third instar larval disc showing the direction of the morphogenetic furrow. Pictures are oriented in their order in the disc, and in the orientation in which they are shown in this thesis. Only one

10 row of each recruitment stage is shown for clarity. At the third instar, there are several rows of cut cell staining, as shown in Figure 3 of (Pickup et al., 2009), and (Figure 3.2) of this thesis. This is also indicated in (Figure 1.3).

1.5 The screen performed prior to this study identified a number of suppressors of Dv-Cbl A screen was performed prior to the commencement of this study to find suppressors of the Drosophila v-Cbl analogue, Dv-Cbl. The Gene Search (GS) collection (Toba et al., 1999) was screened, which is comprised of transgenic animals generated from one of several transposon vectors, each containing several UAS sites (shown in Figure 2.4). UAS sites are binding sites for the GAL4 transcriptional activator and are arranged in the vectors such that they will activate a promoter that is oriented to drive transcription out of the vector into neighbouring genomic sequences. Hence if the transposon has inserted adjacent to a gene, the provision of GAL4 from a second transgene will initiate transcription into genomic gene sequences. This may be either a sense or antisense transcript depending upon the orientation and insertion site of the transposon. Some of these vectors contain dual promoters that drive expression from of both sides of the transposon, hence being able to potentially activate more than one gene from a single line, or make antisense sequences with the potential to knock down endogenous genes. Maps of each line and the genes it is likely to affect within 10Kb are shown in Figure 3.3. This is because 10Kb limit of effect suggested by the work of (Molnar et al., 2006). The GS lines were crossed to GMR-GAL4 and GMR-GAL4, UAS-Dv-cbl, which is hereafter referred to as GMR>Dv-cbl (Robertson et al., 2000). Approximately 2700 GS lines were crossed to GMR>Dv-cbl and its control GMR-GAL4. Of these GS lines, 48 caused suppression of the Dv-cbl heterozygote phenotype. In this study, a subset of 9 GS lines, one UAS line to that was a known suppressor of Ras85DV12, and an EP line (a related vector to the GS collection) that had partial redundancy to one of the GS lines were chosen for further analysis. In this work, these lines are collectively referred to as the P-element lines. This provided a manageable number of suppressors to analyse further. I wished to provide morphological evidence of the genetic suppression via adult eye scanning electron microscopy (SEM) and the pattern of cone cell differentiation in the eye discs of 3rd instar larvae. This is the aim of Chapter 3. Each of the assays chosen has a distinct GMR-GAL4 heterozygote and GMR>Dv-cbl heterozygote phenotype

28 rows behind furrow, end More differentiated cells to posterior of disc of larval development. 5 cell Larvae are dissected at this precluster Anterior Posterior 1/3 through Progression of morphogenetic furrow time. pupal life m l k j i h g f e d c b a

o 3o 3o 3 B B B B R3CR4 R3CR4 R3 R4 R3 R4 R3 R4 C C C C R8 R2 R8R7C R2 R2 R8R7C R2 R2 R8R7 R5 R2 R8 R5 R2 R8 R5 R2 R8 R5 o o o 1 R1 R6 1 R1 R6 R1 R6 R1 R6 o o o o 3 3o 3 3 3 3 … B B Second Mitotic wave

o Larval eye disc Morphogenetic Furrow

Adult eye is the final product

Posterior Anterior Cone cell recruitment occurs after photoreceptor cell C recruitment. Cut is a marker of cone cells.

Second Mitotic Wave Morphogenetic Furrow More differentiated cells Progression of the morphogenetic furrow Figure 1.3 : Drosophila eye development As in all of the micrographs of Drosophila eyes, the posterior of the eye is shown leftmost. This is where the morphogenetic furrow initiates, and it sweeps anteriorwise, initiating a new ommatidial cluster in its wake. (a) R8 is recruited just after the morphogenetic furrow. (b) R2/R5 are recruited next. (c) R3/R4 are recruited, and the mystery cells (not shown). Then the mystery cells return to the pool of surrounding cells, leaving the 5 cell precluster. (d) The second mitotic wave is a tightly controlled mitosis of all undifferentiated cells. (e) R1 and R6 are recruited from the new, larger pool of cells. (f) R7 is recruited. It lies on top of R8. (g) The four cone cells are recruited. This also marks the end of larval development. (h) In the pupa, two primary (1o) pigment cells are recruited. They surround the eight photoreceptor cells. (i) Then six secondary (2o) pigment cells are recruited. They make up the sides of the ommatidia’s characteristic hexagon shape, and are shared with neighbouring ommatidia. (j) Then three tertiary (3o) pigment cells are recruited at three of the vertices. (k) Mechanosensory bristles occupy the other three vertices. They are made up of four cells, the socket, shaft, sheath (tormogen, trichogen and thecogen respectively) and the sensory neuron. (l) Apoptosis rids the developing eye of unrecruited cells. (m) The final adult eye. (n) The markers used in the third chapter are adult eye morphology and cone cell arrangement. (o)View of whole third instar eye disc showing direction of morphogenetic furrow. Pictures are oriented in their order in the disc, and in the orientation in which they are shown in this thesis. Developing ommatidium series of images (a-l) based on a figure from (Voas and Rebay 2004). Whole eye disc (o) based on an image from: The interactive fly: http://www.sdbonline.org/sites/fly/aimorph/eye.htm (Figures 3.1 and 3.2). The SEM of the adult eye shows final eye size and roughness (which illustrates disorder of differentiation), and an antibody against cut marks the cone cells (which are recruited via EGFR pathway activity, as described in Section 1.4). 1.6 Thesis Aims This study aims to confirm suppression of a subset of the suppressors of Dv-cbl that were identified in the aforementioned screen. Using the pattern and size of the cone cells in the third instar eye disc, and high- resolution images of the adult eyes obtained by scanning electron microscopy, I aim to determine how the suppressors are suppressing the Dv-cbl eye phenotypes (Chapter 3), and test one for its ability to suppress the cooperation between Dv-cbl and Ras85DV12 as observed in the adult eye (Paper/Chapter 4). I also aim to study the function of this latter suppressor (Akap200) in more detail, including the endogenous expression of the gene in the third instar eye disc. (Paper/Chapter 4). 1.7 A short word on Drosophila One may wonder, why use flies? The answers to this question are relatively simple. Firstly, Drosophila have a short lifespan (10 days at 25oC from embryo to adult, (reviewed in Jennings, 2011) so large-scale screens like the one mentioned above can be carried out more swiftly than ones in mice. Other reasons include that Drosophila have many homologous genes and processes to humans, meaning that pathways are conserved, and often easier to look at, for example, in the case of Cbl family members, humans have 3, and Drosophila only have two, and in the case of Drosophila they are alternatively spliced from the same gene (Robertson et al., 2000). In general, there can be less redundancy in genes in Drosophila than mammals (reviewed in Brumby and Richardson, 2005), as the above example indicates. There are several tissues in the fly that are non-essential for development or fertility, such as the eye (as used in this study), wings, legs and others. Of particular use to the Drosophila researcher is the wealth of genetic tools available for manipulating gene expression in various tissues. Using the GAL4/UAS system (described in Section 2.2.4.1) one can study the effect of misexpression, knockdown, or endogenous expression levels with the careful choice of an appropriate driver attached to GAL4 and gene attached to UAS (reviewed in Jennings, 2011).

1.8 Summary The Cbl family was first discovered in mammals, and only the first few domains (up to and including the ring finger tail) are necessary for E3 ligase activity (Visser and Lill, 2005). E3 ligase activity is an important part of internalisation of RTKs and allows for Cbl to control cell signalling by the attenuation of signals received. Certain mutations of Cbl family members are oncogenic. These tend to obliterate the linker region in some fashion (reviewed in Thien and Langdon, 2001). Cbl interacts with many proteins, but in this study, I am primarily interested in its interactions with the EGFR, as it is what is used in our model system, the developing Drosophila eye. Prior to the commencement of this study, our lab performed a screen against GMR>Dv-cbl using the GS collection. Of the lines screened, 9/48 suppressors directly from the screen, and EP2254, and UAS- Lk6 (both with equivalents in the screen and reported as Ras85V12 suppressors in (Huang and Rubin, 2000), were chosen for further investigation in the current work. The sense and antisense genes of closest proximity to the vector insertion site are varied, and their known function may help in determining the method the GS line uses in suppressing Dv-cbl. From these 11 lines, I selected two that expressed Akap200 and studied them further. Presented in this thesis is a published work on that. Other work is shown on other aspects of Akap200 function. In conclusion, I found that Akap200 is a mild suppressor of the Dv-cbl and Ras85DV12 phenotypes separately but is a very effective suppressor of the cooperative phenotype that is caused by these two oncogenes.

2 MATERIALS AND METHODS

2.1 MATERIALS 2.1.1 Chemicals and Reagents The general laboratory chemicals and solvents used in this thesis were of reagent grade and obtained from Australian suppliers where possible. Table 2.1 lists the more specialised reagents with their supplier. Chemical /Reagent Source 50 % dextran sulphate Pharmacia Acetone Univar Agarose Scientifix Chloramphenicol Sigma Denhardts 50x Amresco Ethanol BDH Formamide BDH Gel Red Biotium Heparin x1000 MP Biomedicals Horse Serum, Donor herd hybridoma tested, sterile Sigma filtered. Normal Goat Serum Sigma Orange G Chroma-Gesellschaft Paraformaldehyde 16 % EM Grade Electron Microscopy Sciences Paraformaldehyde (powder) Acros Organics Phosphate buffered Saline 20x Amresco Polysorbate 20 (‘Tween 20’) Chem supply Prolong gold Molecular Probes Salmon sperm DNA Sigma Track it 1kb plus DNA ladder Invitrogen Triton X-100 (TX-100) Sigma TRIzol Invitrogen Yeast tRNA Sigma Table 2.1: Chemicals and Reagents 2.1.2 Nucleotides Primers were ordered from Sigma at a concentration of 100M, then diluted in milliQ water and used at 10M. The T7 RNA polymerase site is underlined where relevant.

Oligo Gene Chromosomal Length Sequence Position (Release 5 genome assembly (Hoskins et al., 2007) Akap200- Akap200 2L:8428284..84 20 GATCTCGCCAAGGA f-new 32303 TCTGAA Akap200- Akap200 2L:8428432..84 20 TTGCGTTCTTTTGTT r-new 32451 GTTGC T7- Akap200 with T7 2L:8428284..84 46 GGATCCTAATACGA Akap200f polymerase site 32303 CTCACTATAGGGGA -new TCTCGCCAAGGATC TGAA T7 Akap200 with T7 2L:8428432..84 46 GGATCCTAATACGA Akap200- polymerase site 32451 CTCACTATAGGG r-new TTGCGTTCTTTTGTT GTTGC GAPDH GAPDH 2A X:15760240..15 19 AGCCATCACAGTCG 2A 1-f 764258 ATTCC GAPDH GAPDH 2A X:15760516..15 21 GGTGCCCTTAAAAC 2A 1 r 764536 GTCCGTG Table 2.2: Oligonucleotides

2.1.3 Antibodies Primary Concentration Type 3rd instar eye disc Source antibody expression pattern Cut 1:1000 Mouse Cone cells and glial Developmental monoclonal cells (Blochlinger Studies et al., 1993). Hybridoma Bank Prospero 1:500 Mouse Cone cells, R7 DSHB (Pros) monoclonal (Kauffmann et al., 1996). embryonic 1:500 Rat Neuronal cells DSHB lethal (Photoreceptor abnormal cells) (Robinow vision (elav) and White, 1991). Beta- 1:500 Chicken Cells where lacZ Abcam galactosidase has driven (β-gal) expression of β-gal (Kalnins et al., 1983). Table 2.3: Primary Antibodies

Secondary antibody Concentration Source Goat anti mouse 594 1:500 Invitrogen Donkey anti rat 488 1:500 Invitrogen Donkey anti chicken 594 1:500 Jackson ImmunoResearch Donkey anti mouse 488 1:500 Invitrogen Table 2.4: Secondary Antibodies 2.1.4 Drosophila strains 2.1.4.1 GAL4 lines GAL4 line Chromosome Expression Source (Glass Multimer 2 Cells in and behind Dr M Freeman, Reporter) morphogenetic furrow MRC, GMR-GAL4 (Freeman, 1996) Cambridge UK (Sevenless) 2 Precursors of R7, R1/R6, Bloomington sev-GAL4 R3/R4 (Freeman, 1996), Drosophila Stock cone cells, and mystery Center (BDSC) cells. (Bowtell et al., 1989) GMR-GAL4, UAS- 2 Drives Dv-cbl in GMR Hime lab stock, Dv-cbl (Also termed expression pattern above. Dept of Anatomy ‘GMR>Dv-cbl’) and Neuroscience, University of Melbourne. Table 2.5: GAL4 driver lines

2.1.4.2 Mutant and Transgenic lines Mutation or Transgene Chromosome Strain name (as Source used in text) w1118 (designated as + or X w1118 BDSC wildtype in thesis) Discussed in text 2 EP2254 BDSC Discussed in text X GS1120 Kyoto Drosophila genetic resource centre (DGRC) Discussed in text 2 GS2064 Kyoto DGRC Discussed in text 2 GS2208 Kyoto DGRC Discussed in text 2 GS2273 Kyoto DGRC Discussed in text X GS5217 Kyoto DGRC Discussed in text 2 GS8042 Kyoto DGRC Discussed in text 2 GS8088 Kyoto DGRC Discussed in text 3 GS9841 Kyoto DGRC Discussed in text 3 GS10268 Kyoto DGRC Discussed in text 3 GS10305 Kyoto DGRC Lk6 3 UAS-Lk6 BDSC (stock 8708) Dv-cbl 3 GMR-Dv-cbl Hime lab stock, University of Melbourne. Akap200 RNAi 2 GD1207 v5647 Vienna Drosophila P{GD1207}v5647 Resource Center (VDRC): Stock V5647 Akap200 RNAi 2 KK111598 VIE- VDRC: Stock P{KK111598}VIE-260B 260B V102374

Akap200 RNAi 1,3 TRiP.HM05018 BDSC Stock BL y1 v1; 28532 P{TRiP.HM05018}attP2 P35 3 UAS-p35 Leonie Quinn, University of Melbourne. Ras85D 3 sev-Ras85DV12 Dr M. Simon, Stanford University, California, USA Akap200 2 BL10656 lacZ BDSC Akap200 stock Table 2.6 Mutant and Transgenic lines

2.1.4.3 Balancer Chromosomes Balancer Chromosomes (named by Chromosome Marker Mutation marker gene) CyO (aka SM6) 2 Curly wings MKRS 3 Stubble TM6B 3 Tubby, Humeral SM6.TM6B 2,3 Curly wings, Tubby, Humeral Table 2.7 Balancers 2.1.4.4 Lines generated in the course of this project No new transgenic lines were made, but several lines combining the transgenes in Tables 2.5 and 2.6 were generated via intercross. The lines, their purpose, and the relevant mating schemes are shown below. In all crosses, females are on the left side of the x in accordance with conventions. 2.1.4.4.1 Mating scheme type 1 This was the most common type of mating scheme used in this project. Using this scheme several lines that had one transgene on chromosome 2 and one on chromosome 3 were made. A typical scheme is shown below. For example, in order to make: GS2208 ; UAS-P35 SM6.TM6B

I w- ; IF ; MKRS x GS2208 w- ; IF ; MKRS x UAS-P35 CyO TM6B CyO TM6B

II GS2208 ; + x + ; UAS-P35 CyO MKRS IF TM6B

III rl x GS2208 ; UAS-P35 SM6.TM6B IF MKRS

IV Self GS2208 ; UAS-P35 SM6.TM6B In some cases, the fused SM6.TM6B chromosome was lost if the strain was healthy enough to become homozygous for the other two mutant chromosomes.

Mutations Chromosome(s) Strain name (as used in Purpose or text) Transgenes Ras85DV12 2.3 sev-GAL4;sev-Ras85DV12 To test suppression SM6.TM6B or enhancement of Ras85DV12 Akap200, 2,3 GS2208;UAS-P35 To test suppression CG13398, of Dv-cbl and P35 Ras85DV12 cooperation by Akap200 in the absence of apoptosis. Akap200, 2,3 EP2254;UAS-P35 To test suppression P35 of Dv-cbl and Ras85DV12 cooperation by Akap200 in the absence of apoptosis. Table 2.8: Lines made using mating scheme type 1 2.1.4.4.3 Mating scheme type 2 To make this line, the third chromosome was recombined, then mating scheme type 1 was attempted in order to complete the line, however, no flies of the correct genotype survived. A more roundabout way of building this line was then attempted, and it was balanced on two separate balancer chromosomes rather than the fused balancer used in mating scheme type 1.

Mutations Chromosome(s) Strain name (as used in text) Purpose or Transgenes GMR-Dv- 2,3 GMR-GAL4;GMR-Dv-cbl,sev-Ras85DV12 Test of cbl, rasV12 CyO MKRS suppression/e nhancement of Dv-cbl and Ras85DV12 cooperation Table 2.9 Lines made using mating scheme type 2

To make: GMR-GAL4 ; GMR-Dv-cbl , sev-Ras85DV12 CyO MKRS

I GMR-Dv-cbl x sev-Ras85DV12

GMR-Dv-cbl x w1118 II sev- Ras85DV12

III w- ; IF ; MKRS x GMR-GAL4 GMR-Dv-cbl, sev-Ras85DV12 x w- ; IF ; MKRS CyO TM6B + CyO TM6B

IV rl x GMR-GAL4 ; + w- ; IF ; MKRS x IF ; GMR-Dv-cbl, sev- Ras85DV12 SM6.TM6B CyO MKRS CyO TM6B + MKRS

V GMR-GAL4;MKRS x IF or + ; GMR-Dv-cbl, sev- Ras85DV12 SM6.TM6B CyO TM6B

VI Selfed GMR-GAL4 ; GMR-Dv-cbl , sev- Ras85DV12 CyO MKRS

Note: In generation V, it would have been impossible to tell if the male parents had irregular facets or not, due to the extremely rough eye caused by co-expression of GMR-Dv-cbl and sev-Ras85DV12. However, by selecting for CyO and MKRS in the next generation eliminates the possibility of having irregular facets and ensures selection of GMR-GAL4.

2.1.4.4.4 Mating scheme type 3, ‘clean up’ crosses. It was sometimes necessary to balance lines on the fused balancer SM6.TM6B in order to pick the correct genotype for third instar larval dissections. This was performed on GS10268 and GS9841. 2.1.5 Media and Buffers 2.1.5.1 Bacteria Media Luria Broth was prepared by the media kitchen at the Department of Microbiology and Immunology at the University of Melbourne. 2.1.5.2 Buffers and Standard Solutions PBS was obtained from Amresco in a 20x concentrate. TAE (Tris-acetate EDTA) buffer was obtained from Amresco. Tissues stained with the cut antibody were washed in PBT (PBS with 0.1% Triton X 100), and the antibody was incubated in PBTn (PBT with 5% Normal Goat Serum). Tissues stained with the elav, Pros, and β-gal antibodies were washed with PBT (PBS

23 with 0.2% Triton X 100) and the antibody was incubated in PBTH (PBT with 5% Horse Serum, Donor herd hybridoma tested, sterile filtered). 20x SSC buffer was obtained from Robb DeIongh’s lab in the Department of Anatomy and Neuroscience and had been made according to the recipe in (Sambrook and Russell, 2001). mRNA in situ hybridisation buffers were made to the following recipes: Hybridisation buffer 50 % Formamide 4x SSC 1x Denhardt’s 10g/ml yeast tRNA 250g/ml salmon sperm DNA 50g/ml heparin 0.1 % Tween 20 5 % dextran sulphate (added just before prehybridisation)

Wash buffer 50 % formamide 2x SSC (diluted 20x 1:10) 0.1 % Tween-20

AP buffer 100mM Tris Cl (pH 9.5) 100mM NaCl 50mM MgCl2 0.1 % Tween 20

2.1.5.3 Drosophila culture medium. Drosophila were cultured on Semolina and Molasses medium which was prepared by the research assistants of the Department of Anatomy and Neuroscience fly labs. 2.2 METHODS 2.2.1 Drosophila culture and genetics 2.2.1.1 Culture Stocks were maintained at room temperature on Semolina and Molasses medium. Crosses were performed at 25oC on Semolina and Molasses medium supplemented with live yeast. 2.2.1.2 Genetics All crosses were performed by intercross of virgin females to males of the appropriate genotypes, resulting in heterozygous progeny that were analysed. The genotypes are specified in the text.

24 2.2.2 Histology, Microscopy, and Imaging 2.2.2.1 Immunohistochemistry of larval tissues. Imaginal discs were dissected in PBS and fixed in 4% paraformaldehyde for 30 minutes at room temperature, then put back in PBS and washed 3 x for 10 minutes each in PBT (with either 0.1 or 0.2% Triton X 100 depending on the antibody as above). Samples were incubated in primary antibody diluted in either PBTn or PBTH (depending on the antibody as above) overnight at 4oC, washed for 3 x 10 minutes in PBT and incubated in secondary antibody for 2 hours at room temperature, then the discs were washed with PBT, again for 3 x 10 minutes, and mounted in Prolong Gold (Molecular Probes). The antibodies used are in Table 2.3. Confocal microscopy was performed on either the LSM 510 Meta or the LSM 5 Pascal confocal microscopes located in the Department of Anatomy and Neuroscience. Images were z stacked and scale bars added in Zeiss LSM Image Browser Version 4,2,0,121. 2.2.2.2 mRNA in situ hybridisation to larval tissues The pOT2 plasmid (Appendix 1) containing Akap200 cDNA LD42903 from the Berkeley Drosophila Genome Project (Lin et al., 2007) was used as the source for the DNA template to generate labelled RNA probes. Bacteria containing plasmid were grown in 25µg/ml chloramphenicol containing Luria broth overnight at 37oC then the plasmid was extracted using a QIAprep Spin Miniprep Kit (Qiagen) (according to the manufacturer’s instructions). Plasmid integrity was confirmed by DNA sequencing conducted by the Sequencing and Genotyping Facility in the Pathology Department of the University of Melbourne. To synthesise the template for the sense and antisense DNA probes, Touch-down PCR was performed using a Biorad DNA Engine Peltier Thermal Cycler. The cycles used were: Pre PCR 94 oC 5 min

Cycle 1 94 oC 1 min 65 oC 1 min 72 oC 1 min

Cycle 2 94 oC 1 min 64 oC 1 min* 72 oC 1 min

… *Decrease the second step of the cycle by 1 oC until… Cycle 11 94 oC 1 min

55 oC 1 min 72 oC 1 min

Cycle 12- 41 94 oC 1 min 55 oC 1 min 72 oC 1 min

Final Extension 72 oC 10 min 25 oC 15 min End.

The antisense probe was generated using the primers Akap200-f-new and T7 Akap200- r-new, and the sense probe made using the primers Akap200-r-new and T7-Akap200f- new. The primer sequences are in Table 2.2. The products were electrophoresed on a 1.5 % Agarose gel and purified using a PureLink® Quick Gel Extraction Kit (Invitrogen), according to the manufacturer’s instructions. RNA probes were made to the 3’ end of the transcript, thus recognising all Akap200 isoforms, using the Megascript T7 kit (Ambion). A map of the transcripts with the location to which the probe is directed against is shown in Figure 2.1. To synthesise the digoxygenin (DIG) labelled probes, 30l of DNA template was added to 4l DIG RNA labelling mix (Roche) 2l enzyme mix and 4l 10x reaction buffer and incubated at 37oC overnight, then treated with TURBO DNase (in T7 kit) 37oC for 15 minutes. The RNA was precipitated by adding 50l LiCl precipitation mix (in T7 kit) and 150l cold ethanol (-20oC), then put at -80oC for 1 hour. The pellet was washed with 70 % EtOH and then resolubilised in 30µl nuclease free deionised water. To perform the in situ hybridisation, 3rd instar imaginal eye discs were dissected in cold PBS then fixed in 4 % paraformaldehyde on ice for 20 minutes. The discs were next fixed at room temperature for 20 min in 4 % paraformaldehyde in PBS containing 0.6 % Triton X 100 and then washed three times with 0.6 % Triton X 100 in PBS. The tissues were pre-hybridised for 1 hour at 55oC in Hybridisation buffer, then hybridised overnight at 55oC in Hybridisation buffer (prewarmed) which contained 5g/ml of sense or antisense DIG-labelled RNA probe. The tubes were left on their sides. The following day the tissues were washed 4x in wash buffer at 55oC, where the washes were changed every 2-3 hours, and left in wash buffer overnight at 55oC. The next day the tissues

Figure 2.1: Location of probes

HSP(1) marks the location of probes with respect to the gene transcript. There is an antisense probe T7 site on forward primer, and a sense T7 site on reverse primer. The Genome map is from: http://flybase.org/cgi- bin/gbrowse2/dmel/?ref=2L;start=8428284;stop=8432303;add=2L%20BLAST%20HSP%281%29%208 430284..8430303;h_region=2L:8430284..8430303; were washed in PBS with 0.1 % Tween-20 PBS (PBS/Tween) for 30 min, which was followed by 2 hours incubation with anti-DIG antibody (Roche) 1:2000 in PBS/Tween with 5 % Normal goat serum at room temperature, then washed 4x 20 min in PBS/Tween, and then the PBS/Tween was removed and replaced with AP buffer. The signal was detected in AP buffer containing NBT/BCIP (Roche) at 37oC for approximately 45 minutes. Then the tissues were mounted in 80 % glycerol in PBS and imaged on a Zeiss Axioskop 2 Plus microscope.

2.2.2.3 Scanning electron microscopy Adult female flies were dehydrated through an acetone series (30, 50, 70, 100, 100 % ‘Dry’ acetone) then air dried in a fume hood, mounted on carbon stubs and sputter coated with an Edwards S150B Gold Sputter Coater. The eyes were then imaged on a Philips XL30 FEG field emission scanning electron microscope. In the course of selecting flies for SEM, several adult flies of each genotype were gassed with carbon dioxide and laid out, then scored by visual inspection on a dissecting microscope, comparing the consistency of phenotype within each genotype, and comparing each genotype to its appropriate control(s). 2.2.2.4 Image manipulation Images were cropped and arranged using Microsoft Office PowerPoint 2016, or Adobe Photoshop CS6, and brightness and contrast were adjusted in Microsoft Office

PowerPoint 2016. 2.2.3 Molecular Biology 2.2.3.1 Isolation of RNA from adult fly heads. 20 adult female fly heads were severed and ground using an autoclaved pestle in an Eppendorf tube containing 100µl of TRIzol (Invitrogen). Then RNA was extracted according to the manufacturer’s instructions. 2.2.3.2 Quantitative Real time PCR cDNA was produced by Reverse Transcriptase-PCR with Superscript III reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. Internal standards (GAPDH (housekeeping gene) and Akap200) were made by amplifying the cDNA using touch down PCR, then gel purified using the PureLink® Quick Gel Extraction Kit (Invitrogen) and diluted to the appropriate concentrations.

28 qRT-PCR was set up in triplicate using platinum Taq (Invitrogen) and Sybr Green (Fisher). qRT-PCR was performed on a Corbett Rotor-Gene 3000 in the Department of Physiology (The University of Melbourne). 2.2.4 An explanation of systems and collections used in this project- the tools. This project makes frequent use of the GAL4/UAS system of targeting expression of transgenes in Drosophila tissues. Lines from several collections of UAS, gene and RNAi stocks were used (see Table 2.6). 2.2.4.1 The GAL4/UAS system- Targeted expression of transgenes in Drosophila tissues. The GAL4/UAS system was developed by (Brand and Perrimon, 1993). It is a method of separating the elements needed for gene transcription, by using the yeast transcription activator protein GAL4, and its target sequence, the Upstream Activation Sequence (UAS). Both the GAL4 and the UAS sequences are required for transcription and can be separated into separate lines and remain transcriptionally inert as GAL4 does not have any endogenous fly targets, and UAS is not activated by any fly promoters (Brand and Perrimon, 1993, and reviewed in Duffy, 2002), and shown in Figure 2.2). GAL4 binds to and activates the UAS and any downstream genes. The UAS consists of five optimised GAL4 binding sites in tandem (Brand and Perrimon, 1993). Collections of lines with GAL4 linked to a promoter, and UAS linked to a gene of interest are readily available. By simply crossing a line with a promoter-GAL4 insertion to flies with a UAS-gene of interest results in the gene of interest being expressed in the pattern of the promoter linked to GAL4. With a collection of promoter-GAL4 and UAS-gene of interest lines, one could potentially test the effects of expressing a particular gene of interest under the control of all of the promoters, or test several different genes under the control of one promoter, without having to make a new line for each (Brand and Perrimon, 1993 and reviewed in Duffy, 2002). In addition, the use of reporter genes such as GFP and lacZ allow for discovery of where novel enhancers drive expression (Brand and Perrimon, 1993 and reviewed in Duffy, 2002). The separation of the promoter and the gene of interest allows for lethal genes to be investigated. This is achieved by placing the UAS upstream of the lethal gene and making a line from this. The lethal gene is only expressed when the UAS-

GAL4

Enhancer- GAL4 UAS -gene of interest

GAL4 GAL4

Enhancer- GAL4 UAS -gene of interest

Figure 2.2: The GAL4/UAS system In the parent, ‘Enhancer-GAL4’, GAL4 is made, but it is not able to activate anything as there are no UAS sites for it to bind. In the offspring, the enhancer is activated as in the parent, producing GAL4, which then travels to the UAS sites and activates transcription of the gene of interest. GAL4 is a yeast transcriptional activator and will not activate other Drosophila genes. Based on an image from (Brand and Perrimon, 1993). Knitted Drosophila pattern modified from ‘Not So Common House Fly’ by Christine Grant. lethal line is crossed to a GAL4 line. This method also allows testing for suppressors of lethality (Brand and Perrimon, 1993 and reviewed in Duffy, 2002). It was shown in an earlier study that the only sequences that were transcribed by GAL4 in flies were those in which a UAS sequence had been inserted by the researcher and that no endogenous transcription was present (Fischer et al., 1988). Once the GAL4/UAS system was developed, this facilitated several new screens. Several collections of lines were subsequently produced and made publicly available. These collections can be easily ordered, then crossed as required to the desired flies and any changes to the original phenotype examined. In this thesis fly lines from the following collections were used: Enhancer Promoter (EP), Gene Search (GS), phiC31 RNAi Library (KK), P-Element RNAi Library (GD), and the Transgenic RNAi Project (TRiP). In addition to flies from the aforementioned collections, two transgenic lines that had been developed previously (UAS-Dv-cbl, made by Hannah Robertson) and UAS-Lk6 (obtained from the Bloomington Drosophila Stock Centre) were also used in this study. 2.2.4.2 The EP and GS systems were used for finding novel genes 2.2.4.2.1 The EP lines Soon after (Brand and Perrimon, 1993) developed the GAL4/UAS system, (Rørth, 1996) developed a vector based on this system for conducting ectopic expression screens. (Rørth, 1996) made the EP lines, which used a P element vector named EP which contained several GAL4 binding sites, and a minimal promoter which directs transcription of genomic genes adjacent to the vector insertion site, (Figure 2.3) (Rørth, 1996). This generally drives gene overexpression as P elements frequently insert into the 5’ UTR of genes (Spradling et al., 1995). Most EP lines made a full-length sense transcript for this reason (Rørth et al., 1998). In this study, the EP line EP2254 is used. 2.2.4.2.2 The Gene Search System A later collection of P-transposable element lines is the Gene Search Collection, developed by (Toba et al., 1999). This used the Gene search system vector to screen genes, which is somewhat different to the EP vector. Several related vectors were generated, and some of them are represented in the lines used in this work, namely GSV1 (GS2208, GS2064, GS2273), GSV2 (GS5217), GSV3 (GS8042) and GSV6 (GS9841, GS10268, GS10305). The key differences in each vector are as follows: GSV1 has a UAS sequence at either end of the vector and can drive expression of nearby genes in both directions. GSV2 and GSV3 have only one UAS sequence, on the

31 opposite side to each other, each driving expression in only one direction. These two vectors are essentially the same. GSV6 has two UAS sequences, but one is linked to a GFP coding sequence and a stop codon following GFP. So only the genes on the opposite side to the GFP sequence will be driven by this driver, but the expression pattern will be marked by GFP staining (Figure 2.4). All GS lines and EP lines have several GAL4 acceptor sites (UAS sequences) inserted into a P element vector that can be used to drive expression of nearby genes (Rørth, 1996; Toba et al., 1999). Depending on the position of the insertion site, a partial transcript or antisense sequence may be made, rather than a complete copy of the gene. 2.2.4.3 RNAi lines First observed fortuitously in petunias and practically applied in C. elegans, RNAi has been used in several systems to knock down genes (reviewed in Sen and Blau, 2006). More recently, the development of transgenic Drosophila RNAi lines has been undertaken, wherein lines that encode inverted repeats designed to match the sequence of the mRNA that is produced by the gene that is the target for knock down. These transgenics are made using modified pUAST vectors and are thus controlled by the GAL4/UAS system, which was described in Section 2.2.4.1. When transcribed, these inverted repeats fold over on themselves forming a segment of double-stranded RNA (either a long or short hairpin RNA depending on the length of the inverted repeat) that be targeted by the cell’s RNAi machinery, and results in the knockdown of the target gene (Figure 2.5) (reviewed in Heigwer et al., 2018). Several libraries of RNAi lines have been produced, the first being the collection now held at the Vienna stock centre developed by (Dietzl et al., 2007). In this project, I used one line from the Vienna Drosophila Research Centre’s GD collection, and one from their KK collection. From the Transgenic RNAi project at Harvard Medical School, I also used one line.

Figure 2.3: EP vector Modified from (Rørth, 1996). This vector shows that there are several UAS sites (GAL4 binding site) in the enhancer, so that downstream genes will be transcribed.

Figure 2.4: GSS vectors (Toba et al., 1999) developed the gene search system, which was used in a misexpression screen of GMR>Dv-cbl. (Toba et al., 1999) used several vectors to develop their collection (taken from http://gsdb.biol.se.tmu.ac.jp/~dclust/gs_system/gs_system.html). GSV1 drives expression in both directions, GSV2 and GSV3 in one direction only. GSV6 drives expression in both directions, but only one flanking gene. The other side drives expression of GFP, hence the expression pattern of the driver will be marked with GFP. GSV7 was not represented in our experiments. (a) (b)

Figure 2.5: RNAi methods in Drosophila Modified from a figure from (Heigwer et al., 2018). (a) shows that the shRNA molecules are expressed by the UAS/GAL4 system. After expression, the shRNA is processed as shown in (b), which shows the degradation of shRNA molecules by dcr-2 and R2D2 and loading of single stranded RNAi into the RISC complex from where it targets complementary sequences and results in its breakdown, and subsequent knockdown of protein production. .

2.2.4.3.1 The GD and KK Genome-wide RNAi libraries (Vienna)

The GD library was created first and covers 91% of the protein-coding genes in Drosophila (http://stockcenter.vdrc.at/control/library_rnai). pMF3, a modified pUAST vector was used, containing 10 UAS sites. Inverted repeats 300-400bp long corresponding to the target gene were inserted into the vector, and the vector was allowed to insert anywhere in the genome. The lines were then tested for the potential of the inverted repeat to target any unintended genes (Dietzl et al., 2007). The GD RNAi line used in this thesis, GD1207 v5647 has no off targets. It targets Akap200. Later, the KK library was developed to cover some of the genome not yet served by the GD library and covers 69% of the genome (http://stockcenter.vdrc.at/control/library_rnai). The KK library uses the pKC26 vector, which also has 10 UAS sites and an attB site. Instead of allowing the vector to insert anywhere in the genome, the pKC26 vector was targeted to one site using the attB site which targeted it to the pKC43 landing site. It was later found that there were two potential target sites for vector insertion, affecting approximately 25% of the collection (Vissers et al., 2016). I have adequately controlled for KK111598 VIE-260B, the Akap200 KK line used, as I also used a GD line and a TRiP line (see below) against this gene. 2.2.4.3.2 Transgenic RNAi project lines used The third collection of RNAi lines were from The Transgenic RNAi Project (TRiP). These lines were made by (Ni et al., 2008), and are held at the DRSC Functional Genomics Resources Center in the Harvard Medical School. To make the TRiP collection, the phiC31 site-specific integration method was utilised, using one optimal site each on the second and third chromosomes, attP40 on the 2nd chromosome, attP2 on the third chromosome (Ni et al., 2008, 2009), and inserted a sequence that would produce a hairpin RNA molecule, using first the Vermilion-AttB-Loxp-Intron-UAS- MCS (VALIUM) vector they developed (Ni et al., 2008) (later named VALIUM1) and following that optimised it to make VALUIM10 and other vectors. The TRiP line used in this project TRiP.HM05018 attP2 (Akap200 RNAi) was made using VALIUM10 (Ni et al., 2009), see also (Figure 2.6), which makes long hairpin RNA (Perkins et al., 2015).

Figure 2.6: The VALIUM10 vector VALIUM10 was the second vector used developed in the TRiP project, and was more effective than VALIUM1, the first one developed. Both produce long double stranded RNA molecules. Vector image taken from: https://fgr.hms.harvard.edu/knockdown-vectors. 3 RESULTS: Characterisation of genes that suppress the Dv-cbl phenotype.

3.1 Introduction In Chapter 1, an enhancer/suppressor screen to modify the phenotype of the oncogenic Dv-cbl allele carried out prior to this study was described. In that screen, scoring by light microscopy did not provide a definitive result for the original screen, so they were rescreened in this work using light microscopy. In this chapter, a subset of the suppressors found in that screen were re-examined more closely. This subset and the known functions of genes identified in the screen can be found in Table 3.3. Except for UAS-LK6 and EP2254, all the lines investigated in this chapter were the original GS lines identified in the screen. UAS-Lk6 and EP2254 represented genes found in the screen that were also implicated as suppressors of Ras85DV12 (Huang and Rubin, 2000). Lk6 was identified as a suppressor of Dv-cbl as GS3037, but as a UAS-Lk6 line was available, it was used instead. In this chapter, the adult heterozygote phenotype of each line crossed to GMR-GAL4 and GMR>Dv-cbl was examined using scanning electron microscopy to assay the final adult phenotype of the eye in fine detail and then using the Cut antibody to mark developing cone cells in the 3rd larval instar. The figures associated with these data are presented such that the top row of each group consists of GMR-GAL4 (shown on the left) crossed to the strain listed above. In Table 3.3 at the end of this chapter, each mode of suppression is given one point each, an aggregate score of 0-4 is shown in the table, and a potential method of suppression is proposed based on the results of the assays and the previously known functions of the genes.

3.2 Suppression of Dv-cbl was confirmed using scanning electron microscopy of adult female eyes The first assay used was scanning electron microscopy (SEM) of the adult eye. Eyes were scored visually, then were taken through an acetone series and prepared for SEM. Several eyes from each genotype were examined by light microscopy and a subjective assessment was made as to whether they appeared to be suppressing the Dv-cbl phenotypes of overgrowth and roughness. Representative eyes were then imaged by SEM. Dv-cbl overgrowth is evident as an enlarged and bulgy eye as per (Robertson et al., 2000).

3.2.1 Confirmation of suppression of the GMR>Dv-cbl heterozygote adult eye phenotypes by P-element strains The GMR-GAL4 heterozygote phenotype (Figure 3.1a), (wildtype control) shows a clear demarcation of each ommatidial unit which are arranged in an organised lattice. In the Dv-cbl heterozygote mutant, outlined in yellow for clarity (Figure 3.1e), the ommatidial lattice was disturbed, in that the individual subunits were no longer neatly organised. Some ommatidia are larger, with extra R7 like cells, some are fused with their neighbours, the eye takes on a generally rough appearance (as originally described in Robertson et al., 2000), and the entire eye is overgrown compared to the wildtype control. Roughness reflects a disorder in the differentiation and arrangement of ommatidia and overgrowth indicates that excess tissue has been generated during eye differentiation. In this figure, I was looking for suppressors of this phenotype in the P element lines crossed to GMR>Dv-cbl.

Suppressors of overgrowth and roughness + GS10305 GS1120 EP2254 a b c d GAL4 - GMR

100µm

e f g h cbl - Dv GMR>

Suppressors of roughness only GS2273 GS5217 GS2208 GS8042 i j k l GAL4 - GMR

m n o p cbl - Dv GMR>

Suppressors of overgrowth only UAS-Lk6 GS2064 GS9841 GS10268 q r s t GAL4 - GMR

u v w x l cb - Dv GMR> Figure 3.1: Suppression of the Dv-cbl adult phenotype in adult eyes Scanning electron micrographs of female adult flies taken at 450x. These flies are the offspring of the females with the genotype in vertical text and males in horizontal text. The genotypes of the offspring are listed below with their corresponding letter identifier. The images are oriented so that the posterior side of the eye is on the left. The images are also sorted into three groups: suppressors of overgrowth and roughness, suppressors of roughness only, and suppressors of overgrowth only, which are colour coordinated accordingly. The bright blue text and line indicates the offspring that are not as overgrown or rough than the GMR>Dv-cbl/+ flies, which suggests that the genes expressed by the P element line suppress these elements of the GMR>Dv-cbl/+ phenotypes. Likewise, the flies coded in maroon were only able to suppress the roughness of the GMR>Dv- cbl phenotype, and in khaki are the flies only able to suppress the overgrowth of the GMR>Dv-cbl control fly. This coding is shown in the lines above each group, the text colour in the figure, and the legend. Each cross to GMR>Dv-cbl has an internal control where the male parent was instead crossed to GMR-GAL4. These samples phenotypically resemble the wildtype with the exception of (i). The wild type, internal controls and the Dv-cbl mutant are in black text. The Dv-cbl control, against which suppression is scored, is enclosed in a yellow box.

(a) GMR-GAL4/+, (b) GMR-GAL4/+ ; GS10305/+, (c) GS1120/X; GMR-GAL4/+, (d) GMR-GAL4/EP2254, (e) GMR>Dv-cbl/+, (f) GMR>Dv-cbl/+ ; GS10305/+, (g) GS1120/X ;GMR>Dv-cbl/+, (h) GMR>Dv-cbl/EP2254, (i) GMR-GAL4/GS2273, (j) GS5217/X; GMR- GAL4/+, (k) GMR-GAL4/GS2208, (l) GMR-GAL4/GS8042, (m) GMR>Dv-cbl/GS2273, (n) GS5217/X; GMR>Dv-cbl/+, (o) GMR>Dv- cbl/GS2208, (p) GMR>Dv-cbl/ GS8042, (q) GMR-GAL4/+; UAS- Lk6/+, (r) GMR-GAL4/GS2064, (s) GMR-GAL4/+; GS9841/+, (t) GMR-GAL4/+ ; GS10268/+, (u) GMR>Dv-cbl/+; UAS-Lk6/+, (v) GMR>Dv-cbl/GS2064, (w) GMR>Dv-cbl/+; GS9841, (x) GMR>Dv- cbl/+ ; GS10268/+. Genotype Suppression n Description Frequency of suppression GMR-GAL4/+ N/A n=163 wildtype N/A GMR>Dv-cbl/+ N/A n=288 Slightly rough eyed N/A orange eyed- slightly larger than GMR-GAL4/+ GMR>Dv-cbl/EP2254 SR, SO n=84 Bright red eyes slightly ++ rough GS1120/+;GMR>Dv- SR, SO n=66 Bright red eyes- wild type ++ cbl/+ looking suppressor. GMR>Dv-cbl/GS2064 SO n=25 All look same- seems ++ suppressed GMR>Dv-cbl/GS2208 SR n=36 Same size as GMR>Dv- ++ Cbl/+ a bit less rough. Slightly rough eyes- centre of ommatidia seem a bit translucent GMR>Dv-cbl/GS2273 SR n=80 Bright red eyes slight ++ suppressor of Dv-cbl GS5217/+ ;GMR>Dv- SR n=151 looks suppressed ++ cbl/+ GMR>Dv-cbl/GS8042 SR n=9 Slightly rough ++ GMR>Dv-cbl/+; SO n=16 all very rough ++ GS9841/+ GMR>Dv-cbl/+; SO n=60 Bright red rough eyes, ++ GS10268/+ probable Dv-cbl suppression GMR>Dv-cbl/+; SR, SO n=12 Red slightly rough eyes ++ GS10305/+ GMR>Dv-cbl/+; SO n=55 Eyes looked rough ++ UAS-Lk6/+ 13 had very slight deterioration --variance in phenotype Could not see suppression of Dv-cbl Table 3.1 Visual scoring of adult eyes Eyes were examined under a dissecting microscope, then scored by eye, and up to 10 were prepared for SEM. Key: ++ >75 % consistent, + >50 % consistent, SR= suppression of roughness, SO= suppression of overgrowth

3.2.2 Suppressors of both eye overgrowth and roughness. The controls for GS10305, GS1120, and EP2254 (Figure 3.1b, c, d) maintained a predominantly wildtype phenotype, almost identical to wildtype (Figure 3.1a), retaining a regular appearing array of ommatidia. GS10305, GS1120, and EP2254, (Figure 3.1f, g, h) showed the most effective suppression of the Dv-cbl mutant phenotype (Figure 3.1e), as the eyes were all less overgrown and the ommatidial array more ordered (less rough) than the Dv-cbl mutant. Therefore, the ability of GS10305 and GS1120 to suppress the adult Dv-cbl phenotype was confirmed, and it was established for EP2254. 3.2.3 Suppressors of eye roughness. The controls for GS2273, GS5217, and GS8042 (Figure 3.1i, j, l) had wildtype appearing eyes, whereas the control for GS2208 (Figure 3.1k) had the greatest effect on the wildtype phenotype, with a somewhat rough adult eye, and a slight increase in overgrowth above the wildtype, suggesting that GS2208 has some effects on eye development independent of Dv-cbl. GS2273, GS5217, and GS8042 (Figure 3.1m, n, p) were suppressors of the eye roughness caused by Dv-cbl overexpression (Figure 3.1e), as the neurocrystalline lattice was more organised in these samples, with fewer fused ommatidia, but the eye remained overgrown. GS2208 (Figure 3.1o) was also able to mitigate the roughness caused by Dv-cbl overexpression in the eye, but as the expression of GS2208 on its own (Figure 3.1k) caused roughness, this may be antagonism rather than suppression. Therefore, this result confirms suppression of the Dv-cbl phenotype by GS2273, GS5217, and GS8042, and suggests that antagonism may be occurring as a result of GS2208 and Dv-cbl co-expression. 3.2.3 Suppressors of whole eye overgrowth only. The internal controls for Lk6, GS2064, GS9841, and GS10268 (Figure 3.1q, r, s, t) had wildtype appearing eyes. Lk6, GS2064, GS9841, and GS10268, (Figure 3.1u, v, w, x) reduced the size of the adult eye compared to the Dv-cbl control (Figure 3.1e) but had minimal effect on the roughness associated with the Dv-cbl heterozygote. Therefore, suppression of the Dv-cbl phenotype: overgrowth was confirmed for GS2064, GS9841, and GS10268, and established for Lk6. 3.2.4 Summary of SEM results Three lines were able to suppress Dv-cbl mediated roughness and its associated overgrowth, four were able to suppress roughness only, however as one of the lines,

GS2208 was rough without the presence of Dv-cbl, the reduced roughness in (Figure 3.1m) was potentially caused by antagonism of Dv-cbl and the gene or genes expressed in GS2208. Four were suppressors of overgrowth only and did not appear to ameliorate the roughness associated with the GMR>Dv-cbl phenotype. This may be due to the limitations of light microscopy used for the initial screening. Under a light microscope, individual ommatidia cannot be discerned, and a suppression of either eye size or roughness (or both) would be interpreted as a suppression of the overall Dv-cbl phenotype. It is only using high-resolution imaging such as scanning electron microscopy that the adult eye can be clearly imaged at an ommatidial level and more fine measurements on differences in overgrowth and roughness of the eyes can be made. However, the original screen involved thousands of crosses, so performing SEM on all of them would have been expensive and impractical and was thus only performed on a subset of interesting flies, as shown in this work. 3.3 Suppression of Dv-cbl was also examined during eye development using immunohistochemistry with anti-CUT Following SEM, these lines were tested for the ability to suppress Dv-cbl earlier in development. With that in mind, I dissected and stained third instar eye discs, to visualise cone cells. Cone cells are recruited to the developing ommatidia after the photoreceptor cells, and before the pigment and bristle cells (Described in 1.4: Cbl in Drosophila eye development). The cone cells secrete the lens (Tomlinson, 1985), and are marked by the homeodomain transcription factor Cut (Blochlinger et al., 1993). Cut is expressed in all sensory organ precursors in the embryo, including presumptive glial cells (Blochlinger et al., 1990). It is also expressed in cone cells through the larval to adult stages (Blochlinger et al., 1993), and in the third instar eye disc in the carpet glia, wrapping glia and haemocytes (Bauke et al., 2015). In this experiment, I was only interested in the pattern and size of the cone cells in the third instar eye disc, which I could discern without issue as cone cells are not in the same focal plane as glial cells and haemocytes (Bauke et al., 2015), so only cone cells are shown in the following figure. The confocal micrographs shown in this figure are given in the order of the SEM micrographs of the same genotype shown in the previous figure. The categories the previous figure defined are shown in this figure, and the corresponding categories with respect to cone cell phenotype are also shown. Within the cone cell phenotypes, suppression of size refers to the suppression of the size of the individual cone cells. A

44 suppression of array order refers to the arrangement of the cone cells into discernible ommatidial groups of 4 cone cells each, and how ordered the groups are in relation to each other. The same set of crosses was performed as in the previous section, but instead of being analysed as adults, the offspring were dissected as third larval instars and the eye imaginal discs stained with an antibody against Cut. The cone cell pattern is very well ordered in the wildtype third instar eye disc with an orderly array of cone cells into 4-cell clusters that correspond to the nascent ommatidia, as marked by Cut staining (Figure 3.2a). Driving Dv-cbl under the control of GMR-GAL4 leads to an increase in cell size, a clear disruption of the ommatidial array, and the occasional addition of an extra cone cell to an ommatidium (Figure 3.2e). As in Figure 3.1, the GMR>Dv-cbl heterozygote is outlined in yellow for clarity. 3.3.1 Differential effects of GS10305, GS1120, and EP2254

The control for GS10305 (Figure 3.2b) had a somewhat disordered cone cell array and contained larger than wildtype cells. GS1120 (Figure 3.2c) had a cone cell array order that was almost wildtype and contained larger than wildtype cells. EP2254 (Figure 3.2d) resulted in a cone cell arrangement that was slightly disordered. Co-expression of GS10305 with GMR>Dv-cbl (Figure 3.2f) resulted in ommatidia that were tightly packed, with the ommatidia easy to discern, as they were in straight lines for the most part, and no ommatidia with 5 cone cells were observed thus having a suppressed array order compared to Dv-cbl (Figure 3.2e). As the control had enlarged cone cells, antagonization between Dv-cbl and any genes expressed by GS10305 may also be occurring. GS1120 co-expression with Dv-cbl (Figure 3.2g) results in a somewhat disordered phenotype, where most of the ommatidia have 5 or more cone cells per ommatidia, so GS1120 was a suppressor of the Dv-cbl mediated increase of cone cell size only. As with GS10305, the GS1120 control had enlarged cone cells, meaning that the suppression observed could also have been due to antagonisation. Finally, EP2254 (Figure 3.2h) only suppresses the disorder of the cone cell array mediated by Dv-cbl misexpression. 3.3.2 Differential effects of GS2273, GS5217, GS2208, and GS8042 The controls for GS2273, GS5217, and GS2208 (Figure 3.2i, j, k) mildly affected the cone cell arrangement, as the ommatidial array of cut cells was somewhat

45 disordered, and the cells were enlarged. The internal control for GS8042 (Figure 3.2l) displayed some disarray in the cone cell arrangement, but the cells appear to be a comparable size to the wildtype. GS2273 (Figure 3.2m) suppressed Dv-cbl mediated array disorder only but did not suppress cone cell size. However, GS5217 and GS2208 (Figure 3.2n, o) were both able to suppress both the array disorder and cell size phenotypes characteristic of Dv-cbl overexpression. Finally, GS8042 (Figure 3.2p) suppressed Dv-cbl mediated enlarged cone cell size only. The ommatidia remained in a state of severe disarray, some ommatidia have 5 cone cells apiece, and it was also hard to discern between individual ommatidia. 3.3.3 Differential effects of Lk6, GS2064, GS9841, and GS10268 GMR-GAL4 driven UAS-LK6 (Figure 3.2q) resulted in a cone cell arrangement that was slightly disordered. The cone cell size was much the same as the wildtype control. Next, GMR>GS2064 (Figure 3.2r) had somewhat ordered ommatidia, and the individual cone cells were enlarged. Finally, GMR>GS9841 and GMR>GS10268 (Figure 3.2s, t) caused a wildtype appearing ommatidial arrangement, though the individual cone cells were larger than the wildtype control. UAS-Lk6, GS2064, and GS9841 (Figure 3.2u, v, w) suppressed the Dv-cbl mediated increase in the size of the cone cells, but the cone cell array in both remained very disordered. GS10268 (Figure 3.2x) was able to suppress both the disorder of the array of cone cells and the individual cone cell size caused by Dv-cbl mis-expression. As there was an increase in cone cell size in the GS2064, GS9841, and GS10268 controls, the suppression observed may also be in part due to antagonisation of the genes driven by these lines with Dv-cbl.

Suppressors of overgrowth and roughness- adult + GS10305 GS1120 EP2254 a b c d GAL4 -

25µm GMR

e f g h cbl - Dv GMR>

Suppressors of size Suppressor of size Suppressors of and array order- only- cone cells array order only- cone cells cone cells

Suppressors of roughness only- adult GS2273 GS5217 GS2208 GS8042 i j k l GAL4 - GMR

m n o p cbl - Dv GMR>

Suppressors of Suppressors of size and array order- cone Suppressor of size array order only- cells only- cone cells cone cells Suppressors of overgrowth only- adult UAS-Lk6 GS2064 GS9841 GS10268 q r s t GAL4 - GMR

u v w x cbl - Dv GMR>

Suppressors of size only- cone cells Suppressors of size and array order- cone cells Figure 3.2: Suppression of the Dv-cbl cone cell phenotype. Third instar eye discs were stained with the cut antibody, which marks cone cells in the eye. Confocal micrographs were taken at 630x and then cropped further. The posterior of the disc is oriented to the left. The genotypes are presented in the same order as in the previous figure, which showed suppression of the Dv-cbl adult phenotype sorted into the following classes: suppressors of overgrowth and eye roughness, suppressors of roughness only, and suppressors of overgrowth only. The cone cell phenotypes were sorted into the following categories: suppressors of cell size and ommatidial array order, suppressors of ommatidial array order only, and suppressors of cell size only. The categories that the cone cell phenotypes fell into are marked underneath the images, in the text colour within the figure, and in the figure legend. As in the previous figure, each cross of GMR>Dv-cbl has an internal control where the male is crossed instead to GMR-GAL4. The wild type, internal controls and Dv-cbl mutant are in black text. The Dv-cbl control, against which suppression is scored, is enclosed in a yellow box.

(a) GMR-GAL4/+, (b) GMR-GAL4/+ ; GS10305/+, (c) GS1120/X; GMR-GAL4/+, (d) GMR-GAL4/EP2254, (e) GMR>Dv-cbl/+, (f) GMR>Dv-cbl/+ ; GS10305/+, (g) GS1120/X ;GMR>Dv-cbl/+, (h) GMR>Dv-cbl/EP2254, (i) GMR-GAL4/GS2273, (j) GS5217/X; GMR- GAL4/+, (k) GMR-GAL4/GS2208, (l) GMR-GAL4/GS8042, (m) GMR>Dv-cbl/GS2273, (n) GS5217/X; GMR>Dv-cbl/+, (o) GMR>Dv-cbl/GS2208, (p) GMR>Dv-cbl/ GS8042, (q) GMR- GAL4/+; UAS-Lk6/+, (r) GMR-GAL4/GS2064, (s) GMR-GAL4/+; GS9841/+, (t) GMR-GAL4/+ ; GS10268/+, (u) GMR>Dv-cbl/+; UAS-Lk6/+, (v) GMR>Dvcbl/GS2064, (w) GMR>Dvcbl/+; GS9841, (x) GMR>Dv-cbl/+ ; GS10268/+. 3.4 Discussion The aim of this chapter was to confirm the suppression of the subset of suppressors chosen for further analysis. While all of the lines did indeed suppress Dv-cbl in the eye, they did so with varying levels of efficacy. Tables 3.2 and 3.3 summarise the suppressive phenotypes and the gene or genes involved in suppression are discussed in Table 3.3 and the body text. In the following chapter, I went on to further investigate EP2254 and GS2208, two lines that are thought to drive expression of Akap200. While neither of these lines were the most effective suppressors of Dv-cbl, they were rich in possibilities for further analysis, due to the studies linking Akap200 to other genes involved with Cbl (Huang and Rubin, 2000; Jackson and Berg, 2002; Robertson et al., 2000 and reviewed in Thien and Langdon, 2001). 3.4.1 The results of the assays are summarised in Tables 3.2 and 3.3.

In Table 3.2 an attempt was made to determine when suppression occurs. In Table 3.3, the genomic insertion point of the GS or EP vector is noted, as is the most likely gene or genes causing the phenotype. Also given is a score out of four- one for each method of suppression measured: overgrowth of adult eye, roughness of adult eye, size of individual cone cells and disorder of cone cell array. Those with a cumulative score of 2 were designated moderate suppressors, 3 were good suppressors, and 4 were excellent suppressors. In Figure 3.3, gene maps up to 10kb either side of the vector insertion site are shown. A potential mechanism for the suppression of the Dv-cbl phenotype based on the function of the genes thought to be expressed by the P element lines is discussed in the body text. The relation of the genes back to Cbl and the multitude of pathways that Cbl is involved in are discussed in Tables 3.5 and 3.4 respectively. A list of pathways that human Cbl interacts with was obtained from Wikipathways, as well as a list of pathways that the genes implicated by the P-element lines. The pathways that Cbl holds in common to the P-element lines is shown in Table 3.4 and may provide some additional information to how some of the suppressors are enacting said suppression. For example, a line that has a pathway with Cbl in common may be diverting Cbl into one of these pathways and away from a growth pathway. If there is not a common pathway, perhaps the other gene is diverting other resources away from Cbl or growth in general. Table 3.5 provides a list of Cbl interactors that are also represented in the

Line Adult- SEM Cone cell- Explanation of mode of suppression (GMR-Dv- cut (GMR- Cbl) Dv-Cbl) (suppression (suppression of of phenotypes) phenotypes) EP2254 1 (SO, SR) 1 (A) Cone cell size is larger, but the array order is neater. Both overgrowth and roughness are suppressed in adults. There may be some suppression of cone cell size in pupal development or a compensation in the size of other cells to allow for a more ordered final eye phenotype. GS1120 2 (SO, SR) 1 (S) The array is disordered at cone cell stage, but cone cell size is suppressed. As the control also has enlarged cone cells, this may be antagonisation. Both overgrowth and roughness are suppressed in adults so if there are extra cells going into pupal development, they seem to be eliminated therein. GS2064 1 (SO) 1 (S) Size of cells is suppressed at cone cell stage. The control also had enlarged cone cells, so this may be due to antagonisation. Overgrowth is suppressed in adults. The Dv-cbl roughness and array disorder phenotypes are never suppressed. The reduction in overgrowth may be due to a decrease in cell size in the adult. GS2208 1 (SR) 2 (S, A) Size of cone cells and neatness of cone cell array are suppressed. Adult roughness is suppressed so there may be more ommatidia or larger ommatidia in the adult. However, as the adult control eye is also rough, antagonisation may be occuring. GS2273 1 (SR) 1 (A) Cone cell array and adult roughness are suppressed, and the adult eye remains overgrown. It may have enlarged cells that are well ordered. GS5217 1 (SR) 2 (S, A) Size of cone cells and neatness of cone cell array are suppressed. Adult roughness is suppressed so there may be more ommatidia or larger ommatidia in the adult, as overgrowth is not suppressed. GS8042 1 (SR) 1 (S) Size of cone cells is suppressed, as is roughness of adult eyes. Perhaps there were more cells that were put into order in a larger eye. GS9841 1 (SO) 1 (S) Size of cells is suppressed at cone cell stage. The control also had enlarged cone cells, so

this may be due to antagonisation. Overgrowth is suppressed in adults. The Dv-cbl roughness and array disorder phenotypes are never suppressed. The reduction in overgrowth may be due to a decrease in cell size in the adult. GS10268 1 (SO) 2 (S, A) Cone cell size and ommatidial array disorder are suppressed. The control also had enlarged cone cells, antagonism may be occcuring. Only eye overgrowth is suppressed in the adult. Perhaps more cells get recruited in the pupal stage, which makes the adult eye rough. GS10305 2 (SO, SR) 2 (S, A) All of the phenotypes measured are suppressed so it seems that GS10305 largely prevents the effects of Dv-cbl misexpression from taking place, however the cone cell control had enlarged cone cells, so the suppression of GS10305 in cone cells may be due to antagonisation. UAS- 1 (SO) 1 (S) Size of cells is suppressed at cone cell stage. Overgrowth is suppressed in adults. The Dv- Lk6 cbl roughness and array disorder phenotypes are never suppressed. The reduction in overgrowth may be due to a decrease in cell size in the adult. Table 3.2: Summary of results, with a potential mode of suppression This table summarises the results from Figures 3.1 and 3.2. A potential mode of suppression is given based on the elements of the Dv-cbl phenotype that the line suppresses. Adult: SO=suppressor of overgrowth, SR = suppressor of Roughness. Cone cells: S = suppressor of Size, A=suppressor of Array disorder

Strain and vector Closest open reading frame to Gene function Adult eye Larval (cone cell) Combined (Release 6 genome the insertion site phenotype phenotype rating adult and assembly (dos (Release 6 genome assembly (dos (rating) (0-2) (0-2) larval Santos et al., 2015) Santos et al., 2015) SO =suppressor of S = suppressor of rating overgrowth Size A=suppressor of (0-4), and SR = suppressor of Array disorder meaning Roughness EP2254 Akap200 Akap200 has roles in cAMP 2 (SO, SR) 1 (A) 3 2L:.8,415,648 (+) 2L:8,415,690..8,431,297 (+) 42bp signalling and oogenesis (Jackson Good EP vector (Rørth, downstream from EP2254 insertion and Berg, 2002; Li et al., 1999). suppressor 1996) site. GS1120 Hers Hers has roles in chromatin 2 (SO, SR) 1 (S) 3 X:19,866,129 X:19,866,146..19,908,108 (+) 17bp inactivation (Ito et al., 2012). Good GSV1 vector downstream from GS1120 insertion Other direction: suppressor (bidirectional) site. CG15618 is a THADA orthologue (Toba et al., 1999) Other direction: (Gramates et al., 2017), which has THADA, X:19,859,743..19,865,524 roles in the human thyroid (Kloth et (-) 605bp downstream from GS1120 al., 2011). insertion site. GS2064 The vector insert site falls inside the CR44784 is most likely a lncRNA 1 (SO) 1 (S) 2 2R:23,383,613 sequence of CR44784. gene, and it has a very low Moderate GSV1 vector 2R:23,383,483..23,384,177 (+) endogenous expression in the larval suppressor (bidirectional) The insert is 130bp downstream of salivary gland, pupal fat body and the (Toba et al., 1999) the 5’ end, so an antisense sequence accessory gland in mated 4-day old could be made of the 5’ 130bp. There males. Its function is unknown are 564bp downstream of the (Gramates et al., 2017), but lncRNAs insertion site which could also be have been shown to have a wide transcribed by GS2064, in the sense range of roles in gene regulation orientation. (Kung et al., 2013), and some play roles in male Drosophila fertility (Wen et al., 2016). As CR44784 is thought to be a regulatory RNA

sequence, the 564bp expressed may be sufficient to enact some or all of the normal functions of CR44784.

GS2208 Akap200 2L:8,415,690..8,431,297 As above for EP2254, Akap200 has 1 (SR) 2 (S, A) 3 2L:8,415,758 (+) Insert is 68bp downstream of 5’ roles in cAMP signalling (Li et al., Good GSV1 vector end (within 5’UTR) 1999) and oogenesis (Jackson and suppressor (bidirectional) Berg, 2002). (Toba et al., 1999) GS2273 Numb numb has roles in Notch, p53 and Hh 1 (SR) 1 (A) 2 2L:9,437,478 2L:9,437,469..9,464,184 (+) Insert is pathways and asymmetric cell Moderate GSV1 vector 9bp downstream of 5’end. division (Johnson et al., 2016) suppressor (bidirectional) The insert is within the 5’ UTR (reviewed in Bajaj et al., 2015 and (Toba et al., 1999) Pece et al., 2011).

GS5217 GS5217 had no genes within 10Kb of Atf3 has roles in gut cell defence, 1 (SR) 2 (S, A) 3 X:1,286,762 the insert. immune and metabolic homeostasis, Good GSV2 vector Atf3 X:1,242,740..1,275,284 [-] was starvation, suppression of suppressor (unidirectional) the closest gene from the insertion transcription, and possible roles in (Toba et al., 1999) site at 11478bp from vector insertion PKA and MAPK pathways (Chu et point to the 5’ end of the gene. al., 1994; Hai et al., 1999; Rynes et al., 2012; Sekyrova et al., 2010). GS8042 Dap160 Dap160 has roles in endocytosis 1 (SR) 1 (S) 2 2L:21,141,899 2L:21,134,439..21,142,347 (-) Insert (Roos and Kelly, 1998). Moderate GSV3 vector is 448bp downstream of the 5’end (in suppressor (unidirectional) the 5’UTR). (Toba et al., 1999) GS9841 Overexpressing last part of CR44522 CR44522 is a long intergenic 1 (SO) 1 (S) 2 3L:6,263,046 3L:6,263,008..6,263,399 [-] noncoding RNA (lincRNA), Moderate The vector insertion site is within the CR44522 is lincRNA.450 and is only suppressor GSV6 vector sequence, 353 downstream of the 5’ expressed in a small time window, expresses GFP on end. the embryo, 12-14 hours after egg

53 one end and the Ldh/ImpL3- overexpression laying (Young et al., 2012) In nearby gene on the 3L:6,259,105..6,262,694 [-] general. lincRNAs are thought to other (Toba et al., Insert is 352 bp upstream of 5’ end of have a role in Drosophila 1999) the gene development in general, and in the developing nervous system and the testes (Young et al., 2012). Ldh is lactate dehydrogenase, which converts pyruvate to lactate (JM Berg et al., 2002). GS10268 Whamy 3R:9,771,795..9,774,419 (-) Whamy bundles microtubules, F- 1 (SO) 2 (S, A) 3 3R:9,772,002 Insert is 207 bp downstream of actin, and Cdc42GFP in Drosophila Good GSV6 vector 3’end. (antisense) (Liu et al., 2009). It is expressed suppressor expresses GFP on highly in muscle, colocalises with one end and the mitochondria and may also have nearby gene on the some role in oogenesis (Rodriguez- other (Toba et al., Mesa et al., 2012). 1999) GS10305 CG9705 3L:16,780,100..16,782,419 CG9705 is a transcription factor 2 (SO, SR) 2 (S, A) 4 3L:16,780,137 (+) (Gramates et al., 2017). CG9705 also Excellent GSV6 vector Insert within the gene. 5’ end of gene has roles in the oocyte (Krauchunas suppressor expresses GFP on is 37bp upstream from insert. et al., 2012); and in C-IV neurons one end and the (Iyer et al., 2013). nearby gene on the other (Toba et al., 1999) UAS-LK6 Lk6 Lk6 has roles in translation initiation 1 (SO) 1 (S) 2 P element insertion Exact insertion site unknown and ERK signalling (Arquier et al., Moderate on Chromosome 3 2005; Huang and Rubin, 2000; Parra- suppressor Palau et al., 2005). Table 3.3: P-element lines tested in Chapter 3 This table includes the vector insertion site (if known), the relative position of the nearest gene, three rankings based on each line’s effectiveness as a suppressor of Dv-cbl. Adult: SO =suppressor of overgrowth, SR = suppressor of Roughness. Cone cells S = suppressor of Size, A=suppressor of Array disorder. Those with a cumulative score of 2 were designated moderate suppressors, 3 were good suppressors, and 4 were excellent suppressors.

a EP2254 (EP vector) f GS5217 (GSV2 vector) 2L X No genes within 10Kb of insert. +10kb -10kb Akap200 …

8415648 1286762

g b GS1120 (GSV1 vector) X GS8042 (GSV3 vector) X -10kbCG46307 -10kb +10kb … … Nup205 Hers … … Nhe2

… Dap160 THADA 19866129 21141899 h c GS2064 (GSV1 vector) 2R 3L GS9841 (GSV6 vector) -10kb +10kb yellow-d yellow- CR44784 eIF2B-delta -10kb d2 Best2 CG10163 Ldh/ImpL3 … CR44522 … … Golgin CG13551 CG30414 roh CG3530 245 23383613 6263046

d GS2208 (GSV1 vector) i GS10268 (GSV6 vector) 2L 3R… +10kb -10kb +10kb snoRNA:Psi18S-1275 emb topi CG12947 … Akap200 … … RpS29

… … asRNA:CR31514 CG13397 CG13398 9772002Whamy 8415758

e GS2273 (GSV1 vector) j GS10305 (GSV6 vector) 2R 3L +10kb -10kb CG3769 +10kb numb … CG9705 CG9706 … CG42847 Fbp2 scat Rps28-like

CG33723 … FucTB 16780137 9437478 Int6/eIF3e CG9674

Figure 3.3: Insert maps of Chapter 3 lines Shown are maps of the P element lines used in this chapter (with the exception of UAS-Lk6). Each line has the vector insert site marked with a vertical orange line, with the name of the GS or EP line listed above. As (Molnar et al., 2006) found that the most effective range of expression was 10kb from the insertion site, 10kb in the appropriate direction(s) from the insertion site are shown. The lines used were as follows: (A) EP2254, (B) GS1120, (C) GS2064, (D) GS2208, (E) GS2273, (F) GS5217, (G) GS8042, (H) GS9841, (I) GS10268, and (J) GS10305. Key: Black bar: measurement of 10kb, or 20kb in GSV1 vector lines Blue bar: DNA, 10Kb, or 20kb in GSV1 vector lines Green bars: sense genes Red bars: antisense genes

Cbl pathway Line Gene EGF/EGFR Signaling Pathway (Homo GS10305 CG9705 sapiens) (human homologue) calcium regulated heat stable protein 1 (Kandasamy et al., 2010; Slenter et al., 2018) https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) EP2254/GS2208 a kinase anchoring protein (human) IL-2 Signaling Pathway (Homo sapiens) GS10305 CG9705 (Kandasamy et al., 2010; Slenter et al., 2018) (human homologue) calcium regulated heat stable protein 1 https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) EP2254/GS2208 a kinase anchoring protein (human) IL-3 Signaling Pathway (Homo sapiens) GS10305 CG9705 (Kandasamy et al., 2010; Slenter et al., 2018) (human homologue) calcium regulated heat stable protein 1 https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) EP2254/GS2208 a kinase anchoring protein (human) IL-4 Signaling Pathway (Homo sapiens) GS10305 CG9705 (Kandasamy et al., 2010; Slenter et al., 2018) (human homologue) calcium regulated heat stable protein 1 https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) EP2254/GS2208 a kinase anchoring protein (human) Interleukin-3, 5 and GM-CSF signaling (Homo GS10305 CG9705 sapiens) (human homologue) calcium regulated heat stable protein 1 (Burns et al., 2000; Croft et al., 2014; Fabregat https://www.genenames.org/cgi- et al., 2018; Slenter et al., 2018) bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150

(linked from Gramates et al., 2017)

EP2254/GS2208 a kinase anchoring protein (human)

JAK/STAT (Homo sapiens) GS10305 CG9705 (Ali et al., 1996; Slenter et al., 2018) (human homologue) calcium regulated heat stable protein 1 Toll, IMD, JAK/STAT Pathways for Immune https://www.genenames.org/cgi- Response to Pathogens (Drosophila bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 melanogaster) (linked from Gramates et al., 2017) (Severo et al., 2013) EP2254/GS2208 Akap200

RANKL/RANK (Receptor activator of NFKB GS10305 CG9705 (ligand)) Signaling Pathway (Homo sapiens) (human homologue) calcium regulated heat stable protein 1 (Raju et al., 2011; Slenter et al., 2018) https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) EP2254/GS2208 a kinase anchoring protein (human) Signalling by EGFR (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; EP2254/GS2208 a kinase anchoring protein (human) Slenter et al., 2018)

Signalling by FGFR1 (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; Slenter et al., 2018) EP2254/GS2208 a kinase anchoring protein (human)

Signalling by FGFR2 (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; EP2254/GS2208 a kinase anchoring protein (human) Slenter et al., 2018)

Signalling by FGFR3 (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; Slenter et al., 2018) EP2254/GS2208 a kinase anchoring protein (human) Signalling by FGFR4 (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; EP2254/GS2208 a kinase anchoring protein (human) Slenter et al., 2018) Signalling by MET (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; EP2254/GS2208 a kinase anchoring protein (human) Slenter et al., 2018) Signalling by PTK6 (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; EP2254/GS2208 a kinase anchoring protein (human) Slenter et al., 2018) Signalling by SCF-KIT (Homo sapiens) UAS-LK6 Lk6 kinase (Croft et al., 2014; Fabregat et al., 2018; EP2254/GS2208 a kinase anchoring protein (human) Slenter et al., 2018) Signalling Pathways in Glioblastoma (Homo GS10305 CG9705 sapiens) (human homologue) calcium regulated heat stable protein 1 (Cancer Genome Atlas Research Network, https://www.genenames.org/cgi- 2008; Slenter et al., 2018) bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) UAS-LK6 Lk6 kinase EP2254/GS2208 a kinase anchoring protein (human) T-Cell antigen Receptor (TCR) pathway during GS10305 CG9705 Staphylococcus aureus infection (Homo (human homologue) calcium regulated heat stable protein 1 sapiens) https://www.genenames.org/cgi- (Slenter et al., 2018; Tomar and De, 2013) bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) GS10305 CG9705 (human homologue) cold shock domain containing C2 https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=30359

(linked from Gramates et al., 2017)

T-Cell antigen Receptor (TCR) Signaling GS10305 CG9705 Pathway (Homo sapiens) (human homologue) calcium regulated heat stable protein 1 (Kandasamy et al., 2010; Slenter et al., 2018) https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017) EP2254/GS2208 a kinase anchoring protein (human) Type 1 Papillary renal Cell Carcinoma (Homo GS10305 CG9705 sapiens) (human homologue) calcium regulated heat stable protein 1 (Slenter et al., 2018) https://www.genenames.org/cgi- bin/gene_symbol_report?q=data/hgnc_data.php&hgnc_id=17150 (linked from Gramates et al., 2017). Table 3.4 Pathways in common with Cbl and P element lines Wikipathways was used to generate a list of pathways that Cbl was involved in, as well as pathways that the genes expressed by the P elements used in this Chapter were involved in. A list of pathways in Drosophila with the gene (or its human homologue in some cases) is shown.

Cbl interactor- found in online References (for Cbl interactors) Representations databases or literature. in chapter 3 genes (expressed by line or listed as interactor on FlyBase) CDC42 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Numb interactor Biogrid: Human (Simmons et al., 2005; Stark et al., 2006; Wu et al., 2003a) Whamy interactor (Gramates et al., 2017) Dap160 (Robertson et al., 2000) Expressed by Drosophila from FlyBase (Gramates et al., 2017) GS8042 https://thebiogrid.org/64373/summary/drosophila-melanogaster/cbl.html Numb interactor Biogrid Drosophila (Stark et al., 2006) (Gramates et al., 2017) Fyn (reviewed in Thien and Langdon, 2001) (Mammalian ) Possible Dap160 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html interactor Biogrid: Human (Anderson et al., 1997; Andoniou et al., 2000; Boussiotis et al., (Gramates et al., 1997; Deckert et al., 1998; Fukazawa et al., 1995; Ghosh et al., 2004; 2017) Grossmann et al., 2015, 2004; Kaabeche et al., 2004; Nishio et al., 2002; Okabe et al., 2006; Panchamoorthy et al., 1996; Reedquist et al., 1996; Rellahan et al., 2003; Shishido et al., 2000; Stark et al., 2006; Taher et al., 2002; Tanaka et al., 1995; Tsygankov et al., 1996)

HRAS https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Akap200 Harvey rat sarcoma viral oncogene Biogrid: Human (Lito et al., 2008; Stark et al., 2006) interactor homolog (Gramates et al., 2017)

HSPA4 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Biogrid: Akap200 heat shock 70kDa protein 4 Human (Stark et al., 2006; Valiya Veettil et al., 2010) interactor (Gramates et al., 2017) ITSN1 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Biogrid: Dap160 intersectin 1 (SH3 domain protein) Human (Okur et al., 2012; Stark et al., 2006) homologue (Gramates et al., 2017) MAPK14 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Rl (is MAPK)- mitogen-activated protein kinase 14 Biogrid: Human (Erdreich-Epstein et al., 1997; Shen and Yen, 2009; Stark et Lk6 interactor al., 2006) (Gramates et al., 2017) MAPK8 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Rl (is MAPK)- mitogen-activated protein kinase 8 Biogrid: Human (Miao et al., 2002; Stark et al., 2006) Lk6 interactor (Gramates et al., 2017) NOTCH1 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Numb interactor Biogrid: Human (Jehn et al., 2002; Platonova et al., 2015; Stark et al., 2006) (Gramates et al., 2017) Ldh - GS9841 (Gramates et al., 2017) NOTCH3 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Numb interactor Biogrid: Human (Checquolo et al., 2010; Stark et al., 2006) (Gramates et al., . 2017) Ldh - GS9841 (Gramates et al., 2017) RAS85D (Robertson et al., 2000; Wang et al., 2008) Ras85D interactor Ras oncogene at 85D Drosophila from FlyBase (Gramates et al., 2017) of Akap200

https://thebiogrid.org/64373/summary/drosophila-melanogaster/cbl.html (Gramates et al., Biogrid Drosophila (Stark et al., 2006) 2017)

RET https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Possible ret proto-oncogene Biogrid: Human (Carniti et al., 2003; Scott et al., 2005; Stark et al., 2006) interactor of Akap200 (Gramates et al., 2017) shi https://thebiogrid.org/64373/summary/drosophila-melanogaster/cbl.html Shi- interactor of Biogrid Drosophila (Pai et al., 2006; Robertson et al., 2000; Stark et al., 2006). Dap160 Drosophila from FlyBase (Gramates et al., 2017) (Gramates et al., 2017) SRC (reviewed in Thien and Langdon, 2001) (Mammalian ) Akap200 https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html interactor Biogrid: Human (Hashimoto et al., 2006; Kassenbrock et al., 2002, 2002; Rafiq (Gramates et al., et al., 2011; Rellahan et al., 2003; Sanjay et al., 2006; Shishido et al., 2000; 2017) Song et al., 2010; Stark et al., 2006; Szymkiewicz et al., 2004; Tanaka et al., 1995; Vantler et al., 2006) WAS https://thebiogrid.org/107315/summary/homo-sapiens/cbl.html Whamy interactor Wiskott-Aldrich syndrome Biogrid: Human (Stark et al., 2006; Watanabe et al., 2013) (Gramates et al., . 2017)

Table 3.5: Cbl interactors (Drosophila and mammalian) that are also represented in the P-element lines or their interactors. A list of Cbl interactors was generated and was compared to the interactors of lines expressed by the P-element lines in this chapter, and the results of this table (and Table 3.6) will be used in Chapter 5 to draw a map of Cbl interactors.

Gene Interactors in common References P element lines Akt1 Ldh interactor Ldh GS9841 Akap200 interactor (Vinayagam et al., 2016) EP2254/GS2208 Akap200 (Vinayagam et al., 2016) aPKC numb interactor numb GS2273 Dap160 interactor (Haenfler et al., 2012; Wirtz-Peitz GS8042 et al., 2008) Dap160 (Chabu and Doe, 2008) aurA numb interactor numb GS2273 lk6 interactor (Lee et al., 2006; Wang et al., 2006) UAS-Lk6 lk6 (Galletta et al., 2016) Cdc42 Whamy interactor Whamy GS10268 numb interactor (Brinkmann et al., 2016; Liu et al., GS2273 2009) numb (Raymond et al., 2004) Chc Ldh interactor Ldh GS9841 Dap160 interactor (Guruharsha et al., 2011; Robertson GS8042 et al., 2000) Dap160 (Roos and Kelly, 1998) CG2852 CG9705 interactor CG9705 GS10305 Akap200 interactor (Guruharsha et al., 2011) EP2254/GS2208 Akap200 (Guruharsha et al., 2011) CG6084 CG9705 interactor CG9705 GS10305 Akap200 interactor (Guruharsha et al., 2011) EP2254/GS2208 Akap200 (Guruharsha et al., 2011) cib CG9705 interactor CG9705 GS10305 Akap200 interactor (Guruharsha et al., 2011) EP2254/GS2208 Akap200 (Guruharsha et al., 2011) Dap160 numb interactor numb GS2273 Expressed by a GS line (Tang et al., 2005) GS8042 directly Eps-15 numb interactor numb GS2273 Dap160 interactor (Tang et al., 2005) GS8042 Dap160 (Koh et al., 2007; Winther et al., 2015) fabp CG9705 interactor CG9705 GS10305 Akap200 interactor (Guruharsha et al., 2011) EP2254/GS2208 Akap200

(Guruharsha et al., 2011) Fkbp14 CG9705 interactor CG9705 GS10305 Akap200 interactor (Guruharsha et al., 2011) EP2254/GS2208 Akap200 (Guruharsha et al., 2011) numb Dap160 interactor Dap160 GS8042 Expressed by a GS line (Tang et al., 2005) GS2273 directly Notch Ldh interactor Ldh GS9841 numb interactor (Slaninova et al., 2016) GS2273 Akap200 interactor numb (Frise et al., 1996; Guo et al., 1996; Han and Bodmer, 2003; Ouyang et al., 2011) Akap200 (Bala Tannan et al., 2018) par-6 Dap160 interactor Dap160 GS8042 numb interactor (Chabu and Doe, 2008; Qin et al., GS2273 2004) numb (Wirtz-Peitz et al., 2008) PHGPx CG9705 interactor CG9705 GS10305 Akap200 interactor (Guruharsha et al., 2011) EP2254/GS2208 Akap200 (Guruharsha et al., 2011) Rac1 Whamy interactor Whamy GS10268 numb interactor (Brinkmann et al., 2016) GS2273 numb (Raymond et al., 2004) RacGAP84C numb interactor numb GS2273 Akap200 interactor (Raymond et al., 2004) EP2254/GS2208 RacGAP84C (Raymond et al., 2004) SERCA THADA interactor THADA GS1120 Ldh interactor (Moraru et al., 2017) GS9841 Ldh (Guruharsha et al., 2011) Sh3β CG9705 interactor CG9705 GS10305 Akap200 interactor (Guruharsha et al., 2011) EP2254/GS2208 Akap200 (Guruharsha et al., 2011) Table 3.6: Common interactors within genes expressed by P element lines in this chapter (as identified in FlyBase, Gramates et al., 2017). A list of the interactors of all of the genes expressed by the P element lines in this chapter was generated using FlyBase (Gramates et al., 2017), and the ones that had interactors in common are shown in this table. The results from this table will be used in Chapter 5 to form a map of interactors.

(1c (1b) (1a) text. bodythein discussion to facilitatebracketsin it belownumber a is givencategory Each result. suppression of different categorieseightaccount,intoTaking phenotypes suppression cellcone adultand the both Figure3.4: (3c) (3b) (3a) (2b) (2a) Cone cell Dv-cbl suppression Adult Dv-cbl suppression ) GS2273 GS5217 GS10268 EP2254 GS10305 GS8042 Lk6 GS1120 , (1a) GS10305 size and order arrayof Suppressor GS2064 Summary of of Summary suppressor of roughness and overgrowth (adult), suppressor of size (cone cells).(cone size of suppressor overgrowth(adult),and roughness of suppressor suppressor of roughness (adult), suppressor of array (cone cells).(cone array of suppressor (adult), roughnessof suppressor and cells). (conearrayof overgrowthsuppressor (adult),and roughnessof suppressor s , suppressor of roughness and overgrowth (adult), suppressor of array and size (cone cells). (coneand size array of suppressor overgrowth(adult),and roughness of suppressor , uppressor of roughness (adult), suppressor of cells).(conesizeof suppressor (adult), roughness uppressor of suppressor of overgrowth (adult), suppressor of array and size (cone cells).(conesize and array of suppressor overgrowthof (adult), suppressor Category 1 Category and overgrowth roughnessof Suppressor GS2208 , and , GS9841 (1b) GS1120 sizeof Suppressor GS2064 GS1120 GS10305 GMR> s uppressor of roughness (adult), suppressor of array and size (cone cells).(conesize and array of suppressor (adult), roughnessuppressor of s uppressor of overgrowth (adult), suppressor of size (cone cells). (conesizeof overgrowthsuppressor (adult), uppressor of Dv - cbl (1c) EP2254 order array of Suppressor suppression phenotypes suppression (2a) GS10268 size and order arrayof Suppressor Category 2 Category overgrowthof Suppressor GS10268 EP2254 GS9841 Lk6 (2b) GS9841 GS2064 Lk6 sizeof Suppressor (3a) GS2208 GS5217 size and order arrayof Suppressor Category 3 Category roughnessof Suppressor (3b) GS8042 size of Suppressor GS8042 GS2208 GS5217 GS2273 (3c) GS2273 order array of Suppressor P-element lines or their interactors. This table will be used to compile a Cbl interactor diagram in the discussion chapter, alongside Table 3.6, which provides a list of common interactors within genes expressed by P element lines in this chapter, which will provide links between the P-element interactors. The GS lines used in this chapter potentially allowed for the expression of more than one gene, or in some cases an antisense gene. In Table 3.3 and the following section, the genes thought most likely to be causing suppression are outlined, including a functionality of theirs that may allow suppression. In their GS screen, (Molnar et al., 2006) performed in situ hybridisation in wing discs to the genes nearby the insertion site. They found that the nearest gene in the sense orientation (or genes, in the case of the vector GSV1, which drives expression in both directions) is expressed, subsequent genes in the sense orientation could also be expressed, but with lower efficacy, and the antisense is not expressed. Furthermore, they found that genes within 10kb were most likely to be expressed. These findings were applied in this thesis, as such, the nearest sense gene(s) were thought most likely to be causing the effects on the Dv-cbl phenotype in almost all circumstances (see text for any exceptions). Likewise, only the genes within 10Kb of the insertion site are shown in Figure 3.3, which shows the maps of all of the lines analysed in this chapter except UAS-Lk6. 3.4.1 Cbl is involved in a myriad of cellular pathways Cbl affects many pathways (as alluded to in Chapter 1.3 and Figure 1.2a). Figure 1.2a, a modified figure from (Dikic et al., 2003), links mammalian Cbl with several growth factors (including the EGFR which is focussed on in this thesis), as well as cytokine, immune and hormone receptors. In this thesis, the peer curated database Wikipathways (Slenter et al., 2018) was used to gather information on pathways that utilise Cbl (Figure 3.4). Also collected was gene interaction data from FlyBase, Biogrid and the literature (Figures 3.5 and 3.6). 3.4.2: Potential genes involved in suppression of Dv-cbl eye phenotypes 3.4.2.1: Category 1 - GS10305, GS1120, and EP2254, suppressed both overgrowth and roughness in the adult eye 3.4.2.1.1: Subcategory 1a- GS10305 suppressed cone cell roughness and cell size When CG9705 was knocked down, it resulted in a decrease in neural length and branches in C-IV da (dendritic arborization) neurons (Iyer et al., 2013). CG9705 seemed

66 to be specific for this type of neuron, but overexpression in the eye may cause unknown effects on the neurons or other cells, or on Dv-cbl regulated pathways. CG9705 had seven interactors in common with Akap200 (Table 3.6), so it may be interacting via Akap200 which may account for the observed suppression. 3.4.2.1.2: Subcategory 1b- GS1120 also suppressed or antagonised the Dv-cbl cone cell size phenotype Hers causes repression of histone genes and chromatin inactivation (Ito et al., 2012). Therefore, the suppressive effects observed may be simply preventing transcription of genes and preventing overgrowth. The human homologue of THADA has roles in type 2 diabetes (Weber et al., 2012), and the thyroid (Kloth et al., 2011). THADA levels are lower in some thyroid cancers. (Moraru et al., 2017) found that Drosophila THADA knockouts were obese, so overexpression in our study may be suppressing growth. 3.4.2.1.3 Subcategory 1c- EP2254 was a suppressor of array order in cone cells. Over-recruitment of PKA may be caused by excess Akap200, which may divert PKA from other pathways. This method of suppression was also posited by (Huang and Rubin, 2000) to explain the ability of EP2254 to suppress eye phenotypes due to ectopic expression of Ras85DV12. Akap200 is also thought to be expressed by GS2208, and the same reasoning holds there.

3.4.2.2 Category 2- Lk6, GS2064, GS9841, and GS10268 are suppressors of adult eye overgrowth 3.4.2.2.1 Category 2a- GS10268 was also a suppressor of array order and suppressor or antagoniser of the Dv-cbl enlarged cell size phenotype in cone cells. Whamy bundles microtubules, F- actin, and Cdc42GFP in Drosophila (Liu et al., 2009). It also colocalises with mitochondria and may also have some role in oogenesis (Rodriguez-Mesa et al., 2012). Whamy may lead to a downregulation of growth and thus suppress the effects of Dv-cbl overexpression. 3.4.2.2.2 Subcategory 2b-Lk6, GS2064, and GS9841 also suppressed cone cell size UAS-Lk6 was designed to ectopically express Lk6, .Lk6 overexpression downregulates Ras85DV12 activity (Huang and Rubin, 2000). Expression of Lk6 under the Ubiquitin promoter causes mitotic defects, so expression driven by GMR-GAL4 may induce

67 similar phenotypes (Kidd and Raff, 1997). The reduction in mitosis due to ectopic Lk6 may be counteracting the increase in mitosis when Dv-cbl was over-expressed.

GS2064 could be overexpressing CG13351. However, the vector insertion site is inside the CR44784 sequence, so both a partial antisense and partial sense transcript may be made by this line. CR44784 is most likely a lncRNA gene with low levels of expression (Gramates et al., 2017). The role of lncRNAs is varied and appears to have varying roles in the regulation of cellular functions (Li et al., 2014), and some have roles in male Drosophila fertility (Wen et al., 2016). GS9841 may be overexpressing the last part of CR44522 and overexpressing Ldh/ImpL3. Either may be causing antagonisation of Dv-cbl in cone cells. CR44522 is a lincRNA and may be having subtle effects on development when it is potentially knocked down or over-expressed respectively. lincRNAs are thought to have roles in the testes, the developing nervous system and development in general (Young et al., 2012). Ldh is lactate dehydrogenase, which converts pyruvate to lactate. This is commonly upregulated in cancer cells when a lot of energy is needed (Warburg effect) (Dang, 2012). Ldh is also upregulated in response to endoplasmic reticulum stress in Drosophila S2 cells (Lee et al., 2015). This may potentially be suppressing Dv-cbl by upsetting the balance of metabolic pathways and interfering with growth. 3.4.2.3 Category 3- GS2273, GS5217, GS2208, and GS8042 were suppressors of roughness in the adult eye 3.4.2.3.1 Subcategory 3a- GS5217 and GS2208 were suppressors of array order and cell size in cone cells GS5217 potentially drives expression of Activating transcription factor 3 (Atf3). Atf3 is further away from the vector insertion site than 10kb (and is thus not shown on the map in Figure 3.3) but is 11478bp (11.478kb) away, so there is a possibility that it is being made. Atf3 homodimers suppress transcription whereas Atf3 heterodimers can either suppress or enhance transcription, depending on what the other protein is that makes up the dimer (reviewed in Hai et al., 1999). If Atf3 was being misexpressed in this line, therefore it would be supplying an excess of Atf3, and thus likely causing the formation of more Atf3 homodimers, thus repressing transcription. (Fan et al., 2002) showed that Atf3 overexpression suppressed growth in human cell lines.

GS2208 drives expression in both directions and has two genes nearby that could be driven, namely Akap200 and CG13398. Akap200 could be causing Dv-cbl suppression by the same means as suggested under EP2254. CG13398 has some similarity to human fibroblast growth factor receptor substrate 2 and 3 (Gramates et al., 2017). (Wu et al., 2003b) posit that FRS2 and ERK 1/2 are part of a negative feedback loop for the EGFR pathway. This may be contributing to suppression of Dv-cbl if the same is happening in Drosophila. FRS2 has a role in MAPK activation (Hadari et al., 1998). This may explain the roughness in adult GMR>GS2208. 3.4.2.3.2 Subcategory 3b- GS8042 is a suppressor of size in cone cells GS8042 is thought to drive the expression of Dap160. Dap160 localises proteins such as dynamin to the periactive zone of neurons for endocytosis (Marie et al., 2004), so Dap160 may be promoting proper endocytosis in general. This is interesting as Dv-cbl suppresses receptor endocytosis (Robertson et al., 2000). Our lab had previously found a link between D-Cbl and Dap160 (Robertson et al., 2000), as well as c-Cbl and the Dap160 homologue Ese1 (Robertson, 2000). Dap160 was found to enhance Dv-cbl (Robertson et al., 2000), whereas in this study it suppressed it. This is likely due to the different lines used in this study and in (Robertson et al., 2000). This may be due to Dap160 suppressing Dv-cbl via another pathway, perhaps enhancing endocytosis mediated by other pathways. 3.4.2.3.3 Subcategory 3c- GS2273 suppressed array order in cone cells GS2273 is thought to drive Numb. Mammalian Numb has been shown participates in endocytosis of Notch, with Itch as the E3 ligase. The Drosophila homologue of Itch is Suppressor of Deltex. Numb itself is not an E3 ligase but instead is thought to help recruit endocytosis machinery. Expression of Numb alone can upregulate Notch ubiquitination. (McGill and McGlade, 2003). Notch overexpression under the control of GMR has a rough eye (Hagedorn et al., 2006), as does Dv-cbl. (Wang et al., 2010) showed that DcblS downregulates Notch. So extra Numb may be compensating for a loss of active Cbl, resulting in a suppression of eye roughness. 3.5 Conclusion Re-examining a smaller number of lines from the original screen with more powerful microscopy methods can be useful for making finer measurements, the detail of which would not have been practicable in the original screen. Even by taking a small subset of

69 genes from a large screen, a number of similarities can be drawn. There were several common interactors within the set of lines examined (Table 3.6), and with Cbl interactors (Table 3.5). These interactions will be further explored in Chapter 5. The function of the most likely gene expressed in each line was considered, and a potential effect this gene may have on the Dv-cbl phenotype proposed (Section 3.4), and the mode of suppression was proposed in Table 3.2. Whilst GS10305 suppressed all of the phenotypes tested, it was not chosen for further study as it expressed CG9705 which is not well known, and there would not be many resources to draw upon. GS2208 and EP2254 were further investigated as there was evidence in the literature that Akap200, expressed by both lines, and interacted with Ras85D (Huang and Rubin, 2000), and Src64B (Jackson and Berg, 2002), both of which are oncogenes that interact with Cbl (Table 3.4). The next chapter looks further into the function of Akap200.

4 RESULTS

This chapter consists solely of the paper published in 2012 with myself as the first author, Hannah Robertson and Nicole Siddall as second and third authors respectively, and Gary Hime as the senior author. This paper was published in Molecular and Cellular Biochemistry, and was titled: “Akap200 suppresses the effects of Dv-cbl expression in the Drosophila eye”.

Author's personal copy

Mol Cell Biochem (2012) 369:135–145 DOI 10.1007/s11010-012-1376-x

Akap200 suppresses the effects of Dv-cbl expression in the Drosophila eye

Rowena T. Sannang • Hannah Robertson • Nicole A. Siddall • Gary R. Hime

Received: 22 December 2011 / Accepted: 20 June 2012 / Published online: 8 July 2012 Ó Springer Science+Business Media, LLC. 2012

Abstract The Drosophila melanogaster orthologue of the activity after ligand binding is endocytic removal of the c-Cbl proto-oncogene acts to downregulate signalling from activated receptor from the plasma membrane [1]. The Cbl receptor tyrosine kinases by enhancing endocytosis of family of proteins acts as E2-dependent ubiquitin ligases activated receptors. Expression of an analogue of the to ubiquitinate activated receptors, thereby stimulating C-terminally truncated v-Cbl oncogene, Dv-cbl, in the receptor endocytosis [2, 3]. The first characterised member developing Drosophila eye conversely leads to excess of the family, murine c-Cbl, was originally identified as the signalling and disruption to the well-ordered adult com- protein produced by the cellular counterpart of v-cbl, the pound eye. Co-expression of activated Ras with Dv-cbl transforming gene of the Cas NS-1 retrovirus [4]. Both leads to a severe disruption of eye development. We have the human and mouse genomes contain three Cbl family used a transposon-based inducible expression system to genes, c-Cbl, Cbl-b, and Cbl-3. c-Cbl and Cbl-b have been screen for molecules that can suppress the Dv-cbl pheno- shown to encode similar proteins containing an N-terminal type and have identified an allele that upregulates the SH2-like tyrosine kinase-binding (TKB) domain, a RING A-kinase anchoring protein, Akap200. Overexpression of finger, an SH3-binding region and a C-terminal UBA Akap200 not only suppresses the phenotype caused by domain that acts to down regulate activated receptors Dv-cbl expression, but also the severe disruption to eye [5–7]. The TKB domain corresponds to the truncated development caused by the combined expression of Dv-cbl protein expressed from the v-Cbl oncogene. The Caeno- and activated Ras. Akap200 is also endogenously expres- rhabditis elegans and Drosophila genomes each contain a sed in the developing Drosophila eye at a level that mod- single cbl orthologue, and mutations in each have shown ulates the effects of excessive signalling caused by that Cbl proteins also negatively regulate signalling from expression of Dv-cbl. the EGF receptor in these two organisms [8–12]. v-Cbl can bind to activated RTKs and interfere with the Keywords Cbl Ras Drosophila Akap200 ability of endogenous Cbl proteins to downregulate receptor activity. Genetic studies of a Drosophila analogue of v-Cbl have shown that it acts as a dominant-negative Introduction protein, enhancing signalling from the Drosophila epidermal growth factor receptor (Egfr) [11]. Phenotypes asso- Receptor tyrosine kinase (RTK) signalling must be pre- ciated with v-Cbl expression can be readily investigated in cisely modulated to allow transduction of appropriate lev- the Drosophila eye as all cells of the retina are dependent els and ensure appropriate timing of intracellular signals. upon Egfr signalling for correct differentiation and survival One of the key mechanisms to downregulate receptor [13]. The adult Drosophila compound eye is composed of *800 individual units, or ommatidia, arranged in a regular array. Each ommatidium consists of 8 light sensing pho- & R. T. Sannang H. Robertson N. A. Siddall G. R. Hime ( ) toreceptors, 4 lens-secreting cone cells, 8 optically insu- Department of Anatomy and Neuroscience, University of Melbourne, Parkville, VIC 3010, Australia lating pigment cells and a mechanosensory bristle cell. e-mail: [email protected] Perturbations to the array caused by aberrations in cell 123 Author's personal copy

136 Mol Cell Biochem (2012) 369:135–145 number or differentiation can be easily observed by light or Akap200 can suppress alleles of three different onco- scanning electron microscopy [14]. genes, rasV12, Src64B and Dv-cbl, making it an attractive c-Cbl has been shown to interact with a wide range of candidate for further analysis. receptors and cytoplasmic proteins including non-RTKs, In this paper, we show that ectopic expression of phosphatases, cytoskeletal proteins and signal transduction Akap200 suppresses the phenotype induced by v-Cbl and adaptors suggesting that the oncogenic capacity of v-Cbl that endogenous AKAP200 expression modulates v-Cbl could be mediated by multiple signal transduction path- activity. We also show that AKAP200 suppressed the ways [5]. The ability to conduct unbiased genetic screens cooperative phenotype produced by co-expression of in Drosophila allows the capacity to identify genes or Dv-cbl with rasV12. mutations that can modulate the activity of Drosophila v-Cbl (Dv-cbl). The use of screens for modifying mutations in Dro- Materials and methods sophila, that is, mutations that enhance or suppress the effect of known mutations, is illustrative of how a genetic Drosophila strains and culture analysis of a signalling pathway in flies can be of direct value to mammalian studies. The mechanism of signal Genetic experiments were performed at 25 °C on semolina transduction from Ras to the nucleus has been elucidated molasses media supplemented with live yeast. Drosophila by a combination of biochemical studies in mammalian alleles used were: w1118, GMR-GAL4, sev-GAL4, sev- cells and genetic analysis in C. elegans and the Drosophila Ras1V12, GS2208, EP2254, UAS-Dv-cbl, UAS-p35, eye [15]. A screen conducted for enhancers and suppres- Akap200k07118a (Akap200-lacZ), P{TRiP.HM05018}attP2 sors of an oncogenic Ras protein that was expressed in the (Akap200RNAi), P{KK111598}VIE-260B (Akap200R- Drosophila eye uncovered alleles of all the genes known at NAi) and P{GD1207}v5647 (Akap200RNAi). All stocks that time to be in the Ras pathway—including MEK, MAP were obtained from the Bloomington Stock Center, Kyoto kinase, Raf, and Ras prenylation enzymes—together with Drosophila Genetic Resource Center, Vienna Drosophila about a dozen previously uncharacterised genes [16]. RNAi Center or generated in our laboratory. Included amongst the uncharacterised proteins was kinase suppressor of ras (KSR), a component of the system that Scanning electron microscopy was not detected in biochemical studies. Subsequent identification and analysis of mammalian homologues of Adult female flies were dehydrated through an acetone ksr have shown that it modulates Ras signalling by aug- series (30, 50, 70, 100 and 100 %), then air dried in a fume menting Raf activity [17]. Systematic genetic screens such hood, mounted on carbon stubs and sputter coated with an as this are, therefore, an extremely powerful way of char- Edwards S150B gold sputter coater. The eyes were then acterising conserved signalling pathways and comple- imaged on a Philips XL30 FEG field emission scanning menting mammalian studies. electron microscope. We have used the gene search system (GSS) whereby random insertion of transposable elements containing an mRNA in situ hybridisation inducible promoter into the genome allows overexpression of genes neighbouring the insertion sites [18]. We DIG labelled mRNA probes for in situ hybridisation to have utilised this method to screen for genes that when sense and antisense strands were generated using the overexpressed can suppress the effects of Dv-cbl expres- Megascript T7 kit (Ambion), from a template formed from sion in the Drosophila eye. This class of gene is of par- the 30UTR of Akap200 using the following primer sets (T7 ticular interest as there is the potential for an oncogene polymerase site underlined). Antisense: GATCTCGC suppressor to suppress malignancies associated with CAAGGATCTGAA and GGATCCTAATACGACTCA oncogene activation. One of the genes that we identified CTATAGGG TTGCGTTCTTTTGTTGTTGC, sense: TTG was Akap200, a gene that was previously identified in the CGTTCTTTTGTTGTTGC and GGATCCTAATACGA screen for suppressors of rasV12 [20]. Little is known CTCACTATAGGGGATCTCGCCAAGGATCTGAA. about Akap200, except that it is a member of the Third instar imaginal eye discs were dissected in cold A-kinase anchoring protein (AKAP) family that interacts PBS then fixed in 4 % paraformaldehyde on ice for 20 min. with the regulatory subunits of protein kinase A (PKA) to The discs were fixed at room temperature for 20 min in anchor kinase activity to specific subcellular compart- 4 % paraformaldehyde in PBS containing 0.6 % Triton X ments. Studies in the Drosophila ovary showed that 100 and then washed 39 with 0.6 % Triton X 100 in PBS. mutations in Akap200 suppressed a phenotype associated Tissue was prehybridised for 1 h at 55 °C, then hybridised with loss of Src function [26]. Thus, it was known that overnight at 55 °C in hybridisation buffer (prewarmed) 123 Author's personal copy

Mol Cell Biochem (2012) 369:135–145 137 which contained 5 lg/ml of sense or antisense DIG label- electron microscopy (Fig. 1a). Previous work by our lab- led RNA probe. Tissue was washed 49 in wash buffer at oratory [11] has shown that using the GAL4-UAS system 55 °C, where the washes were changed every 2–3 h, and to drive expression of the Dv-cbl transgene results in a left in the wash buffer overnight at 55 °C. The next day, the disordered ommatidial array and variation in size of tissue was washed in PBS with 0.1 % Tween-20 PBS individual ommatidial units (also Fig. 1b). In this experi- (PBS/Tween) for 30 min, which was followed by 2 h ment, GAL4 expression has been driven by the GMR incubation with anti DIG antibody 1:2,000 in PBS/Tween promoter which is active in and posterior to the mor- with 5 % goat serum at room temperature, then washed 49 phogenetic furrow, a late stage of development of the third 20 min in PBS/Tween, and then the PBS/Tween was instar larval eye imaginal disc during which there is removed and replaced with an AP buffer. The signal was limited mitosis and cells are being specified to take on detected in the AP buffer containing NBT/BCIP at 37 °C their adult fates. Expression of GAL4 alone at this stage for *45 min. Then, the tissues were mounted in 80 % of development does not result in an ommatidial pheno- glycerol in PBS. type (Fig. 1a), but when this strain is crossed to a strain carrying a Dv-cbl cDNA fused to the UAS promoter, the Immunostaining presence of GAL4 will drive expression of Dv-cbl in the GMR expression domain. This double transgenic animal is Imaginal discs were dissected in PBS and fixed for 30 min referred to as GMR [ Dv-cbl in this study and the het- at room temperature in 4 % paraformaldehyde, then erozygote is characterised by a mildly rough eye in which washed 39 10 min each in PBT. Samples were incubated ommatidia vary somewhat in size and shape (Fig. 1b). We in primary antibody diluted in PBT plus 5 % goat serum utilised this bipartite expression system to screen a set of overnight at 4 °C, washed 39 10 min and incubated in transgenic lines, known as the GSS, in which the UAS secondary antibody for 2 h at room temperature. Anti- promoter had been placed on a P-transposable element bodies used were: mouse anti-Elav (Developmental Studies that had been mobilised to generate a collection of lines Hybridoma Bank) and chicken anti-b-galactosidase with insertion sites throughout the genome. Hence, each (Abcam). strain had the potential to drive UAS-dependent expression of a gene adjacent to the transposon when crossed to Quantitative real-time PCR a strain expressing GAL4 under the control of an endogenous promoter [18]. We crossed these strains individually RNA was extracted from adult female heads using TRIzol to GMR [ Dv-cbl in order to identify GSS lines that could (Invitrogen) according to the manufacturer’s instructions. suppress the ommatidial defects exhibited by GMR [ Dv- cDNA was produced using superscript III reverse trans- cbl eyes. Crosses to GMR-GAL4 were used as controls. criptase (Invitrogen) according to the manufacturer’s Strain GS2208 exhibited a mild ommatidial disorganisa- instructions and qRT-PCR was performed in triplicate on a tion when crossed to GMR-GAL4 (Fig. 1c), but partially Corbett Rotor-Gene 3000 using Sybr Green (Fisher) and restored order to the ommatidial array when crossed to Platinum Taq Polymerase (Invitrogen). The primers used GMR [ Dv-cbl (Fig. 1d). The GSS set of strains have were Akap200-forward GATCTCGCCAAGGATCTGAA, been developed using several transgenic constructs, some Akap200-reverse TTGCGTTCTTTTGTTGTTGC, internal with bi-directional UAS promoters such that genes could control GAPDH2A-forward AGCCATCACAGTCGATT be expressed either side of the transposon insertion site CC, GAPDH 2A-reverse GGTGCCCTTAAAACGTCC [18]. GS2208 carries such a bi-directional element that has GTG. Mean mRNA levels were calculated by means of the inserted in the 50UTR of the longest isoform of the Standard curve method. The concentration of Akap200 Akap200 gene (Fig. 1g). Thus, the genetic suppression we mRNA in each of the samples was calculated relative to the observed could be due to co-expression of Akap200, the amount of GAPDH2A mRNA. Plots show one standard adjacent gene CG13398, or possibly an antisense effect deviation. from the Akap200 50UTR. We, therefore, repeated the experiment using another transposable element strain containing a single UAS promoter driving expression of Results Akap200. This strain, EP2254, was generated as part of the EP misexpression screen of Rorth et al. [19] using a Overexpression of Akap200 suppresses the rough eye different vector to the GSS strains. EP2254 is inserted phenotype exhibited by Dv-cbl transgenic flies 42 bp 50 of the Akap200 transcriptional start site and had previously been identified in a screen for suppressors of The Drosophila compound eye exhibits an ordered array activated Ras [20]. GMR driven expression of EP2254 of uniformly sized ommatidia when viewed by scanning had no effect on the ommatidial array (Fig. 1e) and when 123 Author's personal copy

138 Mol Cell Biochem (2012) 369:135–145

Fig. 1 Scanning electron microscopy of adult eyes. a Eyes from flies appearance, but also f mildly suppress the severity of GMR [ Dv-cbl. of genotype GMR-GAL4 have a normal appearance. b GMR [ Dv-cbl g The Akap200 gene generates four transcripts. The positions of the results in disruption to the ommatidial lattice and fusion of individual insertions of EP2254 and GS2208 are indicated (arrowheads show ommatidia. c GMR-GAL4/GS2208 causes a mild disruption to the direction of transcription from the transposon encoded UAS promot- ommatidial lattice, but d suppresses the severity of the GMR [ Dv- ers). g Is modified from http://flybase.org/cgi-bin/gbrowse/dmel/? cbl phenotype. e GMR-GAL4/EP2254 eyes not only have a normal Search=1;name=FBgn0027932

crossed to GMR [ Dv-cbl, the ommatidial variation in EP2254 results in upregulation of Akap200 expression size was suppressed and the order of the array somewhat restored (Fig. 1f) suggesting that Akap200 suppressed EP2254 has previously been reported to suppress the rough Dv-cbl. eye phenotype resulting from sevenless (sev) driven

123 Author's personal copy

Mol Cell Biochem (2012) 369:135–145 139

Fig. 2 mRNA in situ hybridisation of a probe specific to Akap200 to furrow. d qRT-PCR quantification of Akap200 expression shows an third instar eye imaginal discs. aa, as antisense and sense probe approximately fivefold upregulation in GMR-GAL4/EP2254 com- hybridisation to GMR-GAL4 eyes show a low level of Akap200 pared to the GAPDH2A normalised Akap200 mRNA expression expression across the eye disc that is also observed in GMR [ Dv-cbl levels in GMR-GAL4/? . The error bars represent ± one standard discs (ba, bs). GMR-GAL4/EP2254 discs ca, cs show strong deviation upregulation of Akap200 expression posterior to the morphogenetic expression of activated Ras (RasV12)[20]. We used mRNA demonstrated an approximately fivefold upregulation of in situ hybridisation with a probe synthesised from the Akap200 expression in tissue derived from GMR-GAL4, common Akap200 30UTR to determine whether this strain EP2254 animals compared to GMR-GAL4 animals overexpresses Akap200 when crossed to GMR-GAL4. (Fig. 2d). Thus, EP2254 contains a UAS insertion capable Discs expressing GMR-GAL4 alone showed a low level of of driving overexpression of Akap200 when crossed to a expression of Akap200 within the 3rd instar imaginal eye GAL4 driver line. disc (Fig. 2a) that was not altered in the GMR [ Dv-cbl strain (Fig. 2b). Eye imaginal discs derived from animals Overexpression of Akap200 also suppresses that carry GMR-GAL4 and EP2254 showed a strong the phenotype due to activated Ras upregulation of Akap200 in a stripe within and posterior to the morphogenetic furrow, in the region of the disc that A previous study [20] reported that EP2254 suppresses correlated with strong GMR promoter activity (Fig. 2c). the effects of constitutively activated Ras, but did not Quantification of this expression by qRT-PCR present images of the suppression of sev-driven RasV12 123 Author's personal copy

140 Mol Cell Biochem (2012) 369:135–145

(sev-RasV12). We repeated this experiment to determine intron to examine more closely Akap200 expression within whether Akap200 could suppress the RasV12 phenotype the eye disc. b-Galactosidase expression from this strain more effectively than the Dv-cbl phenotype. sev-GAL4 is was detected by means of immunofluorescence and found expressed in a more restricted pattern in differentiating to be present at a low level throughout the disc with a photoreceptors than GMR-GAL4 and also does not affect concentration within a subset of developing photoreceptor ommatidial development on its own (Fig. 3a). sev-RasV12 neurons (Fig. 5a) as observed by colocalisation with the results in a disorganised ommatidial lattice that is more neuron-specific marker Elav (Fig. 5b, c, e). Lack of colo- severe than the GMR [ Dv-cbl phenotype (Fig. 3b). sev- calisation with Prospero indicated that Akap200 was not GAL4-driven Akap200 does not result in any morphologi- expressed in cone cells or photoreceptor R7 (Fig. 5d). The cal abnormalities (Fig. 3c), but when co-expressed with low level of endogenous Akap200 expression within the RasV12, it moderately suppresses the ommatidial disorga- eye disc could be having a moderating effect on the phe- nisation caused by RasV12 (Fig. 3d). notype of the Dv-cbl transgene, so we used three independent shRNA constructs to downregulate endogenous The Akap200 suppression of Dv-cbl/RasV12 is levels of Akap200 by crossing strains containing UAS- independent of apoptosis Akap200 RNA intereference (RNAi) transgenes to GMR- GAL4. In each case, we saw very little effect of lowering We have previously reported that Dv-cbl can co-operate levels of Akap200 on eye development (Fig. 6a, c, e). with RasV12 to cause severe disruption to eye development When each of these strains was crossed to GMR [ Dv-cbl, [11]. The adult eyes of GMR-GAL4; GMR-Dv-cbl, sev- the level of eye disruption was more severe (Fig. 6b, d, f) RasV12 flies have significant tissue overgrowth, ommatidial than GMR [ Dv-cbl alone (Fig. 1b) suggesting that fusion and melanotic lesions (Fig. 4a; [11]). When EP2254 endogenous Akap200 does act to reduce excessive signal is introduced into this strain, it suppresses this phenotype to transduction caused by expression of GMR [ Dv-cbl. a remarkable degree (Fig. 4c). While the eye does not revert to a wildtype appearance, ommatidial fusion is much reduced and the ommatidia are much more ordered. Discussion The disordered phenotype of eyes co-expressing Dv-cbl and RasV12 is not a simple hyperplastic overgrowth, but is In this study, we have demonstrated that overexpression of suggestive of an increase in both mitosis and apoptosis. To Akap200 is capable of suppressing phenotypes generated determine whether part of the phenotype associated with by expression of Dv-cbl or activated Ras in the developing GMR-GAL4; GMR-Dv-cbl, sev-RasV12 is due to induction Drosophila eye. The suppression is most clear when Dv-cbl of apoptosis, we co-expressed the viral apoptosis inhibitor, and RasV12 are co-expressed and produce a severe disrup- p35, with Dv-cbl and RasV12. This moderated the pheno- tion to eye development. Akap200 is endogenously type; however, fusion and overgrowth were still present expressed in the third instar eye disc, being concentrated in (Fig. 4b). Furthermore, the strong suppression of the developing photoreceptor neurons, and this endogenous Dv-cbl RasV12 co-operative phenotype by ectopic expres- level of Akap200 appears to moderate the severity of sion of Akap200 is not simply due to a suppression of phenotypes generated from Dv-cbl expression. apoptosis as Akap200 expression is able to further suppress the GMR-GAL4; GMR-Dv-cbl, sev-RasV12/UAS-p35 phe- What is the function of Akap200? notype (Fig. 4d) producing a much more ordered eye than observed in Fig. 4b. Akap200 is, therefore, a good sup- AKAPs are a structurally diverse family of proteins that pressor of the Dv-cbl, RasV12 co-operative phenotype in a have been grouped based on their ability to bind to the Ser/ manner that is partially independent of blocking apoptosis. Thr kinase, (PKA or cAMP-dependent protein kinase). PKA is a tetrameric protein composed of two regulatory (of Endogenous Akap200 moderates Dv-cbl activity RI or RII subtypes) and two catalytic subunits. Most AK- APs bind to the regulatory subunits, but they do not play a The above experiments indicate that ectopic Akap200 can role in regulating enzymatic activity. Instead, they act as suppress phenotypes associated with expression of Dv-cbl, scaffolding proteins that co-localise components of a sig- but do not indicate that Akap200 has an endogenous nalling pathway. This can localise signalling to a specific function in eye development. The Akap200 mRNA in situ region of the cell, modulate propagation of signal trans- hybridisation (Fig. 2a) suggests that Akap200 is expressed duction responses or assist in generation of feedback (or at a low level throughout the third instar larval eye disc. feed forward) regulatory loops, reviewed in [21–23]. Antibodies directed against Akap200 were not available, so Akap200 encodes a PKA-RII binding site and a myri- we used an Akap200-lacZ enhancer trap inserted in the first stoylated alanine-rich C-kinase substrate (MARCKS) 123 Author's personal copy

Mol Cell Biochem (2012) 369:135–145 141

Fig. 3 Scanning electron microscopy of adult eyes. a sev-GAL4 has a wildtype morphology but b sev-GAL4, sev-RasV12 has a rough eye. c sev-GAL4/EP2254 has wildtype appearance but d EP2254 can suppress the roughness of sev-GAL4, sev-RasV12

123 Author's personal copy

142 Mol Cell Biochem (2012) 369:135–145

Fig. 4 Scanning electron microscopy of adult eyes. a GMR-GAL4; GMR-Dv-cbl, sev-RasV12 eyes have severely disrupted morphology that can be partially restored by suppression of apoptosis via UAS-p35 (b). c EP2254 effectively suppresses the disruption of GMR-GAL4; GMR-Dv-cbl, sev-RasV12 eyes, but this is not simply due to suppression of apoptosis as further suppression also occurs (d) in the presence of UAS-p35

123 Author's personal copy

Mol Cell Biochem (2012) 369:135–145 143 domain [24] and has been observed to bind to actin fila- can suppress the phenotypes derived from expression of ments, suggesting that it localises specific PKA complexes Dv-cbl and activated Ras, although we find that it is a very to the actin cytoskeleton [25]. Akap200 mutant Drosophila effective suppressor of the severe eye defects generated by exhibits slightly reduced viability and some bristle pat- co-expressing Dv-cbl and activated Ras. We have also terning defects. Akap200 localises PKA-RII to germ cell shown that this suppression ability is not simply a result of membranes and Akap200 mutants have multinucleate germ the high level ectopic expression of Akap200 from EP2254, cells and structural defects within the actin-rich ring canals but that endogenous Akap200 moderates signalling from that connect ovarian nurse cells and the oocyte [26]. the Dv-cbl transgene. Akap200 also mildly suppresses the eye phenotype asso- A recent study of the mammalian AKAP member, ciated with sev-driven RasV12 and mildly enhances the AKAP-Lbc, has shown that it interacts with KSR-1 and phenotype of sev-driven dominant-negative KSR [20]. PKA to enhance RAF signal transduction and thereby KSR is a scaffolding protein that facilitates transduction regulate MAPK signalling. AKAP-Lbc acts as a scaffold to through the RAF-MEK-MAPK cascade [17]. This study is promote a close association between RAF and MEK1, consistent with our findings that Akap200 overexpression thereby facilitating activation of MEK1 by RAF. It also

Fig. 5 Immunofluorescence of third instar eye imaginal discs. a b- binding protein Elav (b). A merged image is shown in c. Higher Galactosidase expression from Akap-lacZ is concentrated in photo- magnification images of Akap200-lacZ colocalisation with Prospero receptor neurons indicated by expression of the neural-specific RNA- (d–d00) and Elav (e–e00)

123 Author's personal copy

144 Mol Cell Biochem (2012) 369:135–145

123 Author's personal copy

Mol Cell Biochem (2012) 369:135–145 145 b Fig. 6 Scanning electron microscopy of adult eyes. GMR-GAL4 with the Drosophila EGF receptor in vivo, despite lacking crossed to transgenic strains carrying one of three independent C-terminal adaptor binding sites. Oncogene 14:2709–2719 Akap200 shRNA transgenes a P{GD1207}v5647, c P{KK111 10. Pai LM, Barcelo G, Schupbach T (2000) D-cbl, a negative reg- 598}VIE-260B or e P{TRiP.HM05018}attP2 all display wildtype ulator of the Egfr pathway, is required for dorsoventral patterning phenotypes, but each RNAi line (b, d, f) enhances the phenotype of in Drosophila oogenesis. Cell 103:51–61 GMR [ Dv-cbl 11. Robertson H, Hime GR, Lada H, Bowtell DD (2000) A Dro- sophila analogue of v-Cbl is a dominant-negative oncoprotein in enhances PKA-mediated phosphorylation of KSR-1, which vivo. Oncogene 19:3299–3308 12. Yoon CH, Lee J, Jongeward GD, Sternberg PW (1995) Similarity also facilitates MAPK activation [27]. Although AKAP- of sli-1, a regulator of vulval development in C. elegans, to the Lbc is not a direct orthologue of Akap200, and indeed mammalian proto-oncogene c-cbl. Science 269:1102–1105 Akap200 does not appear to have a closely related verte- 13. Freeman M (1996) Reiterative use of the EGF receptor triggers brate orthologue, our data suggest that Akap200 could play differentiation of all cell types in the Drosophila eye. Cell 87:651–660 a similar role in modulating signalling via the Ras-MAPK 14. Wolff T, Ready DF (1993) Pattern formation in the Drosophila cascade. This requires further investigation and raises the retina. In: Bate M, Martinez Arias A (eds) The development of possibility that regulation of AKAP activity may have Drosophila melanogaster. Cold Spring Harbor Press, Plainview, therapeutic potential for ameliorating the excessive Ras- pp 1277–1326 15. Chang HC, Karim FD, O’Neill EM, Rebay I, Solomon NM, MAPK activity exhibited by a wide range of human Therrien M, Wassarman DA, Wolff T, Rubin GM (1994) Ras tumours. signal transduction pathway in Drosophila eye development. Cold Spring Harb Symp Quant Biol 59:147–153 Acknowledgments The authors would like to thank the Bloom- 16. Karim FD, Chang HC, Therrien M, Wassarman DA, Laverty T, ington Stock Center, Kyoto Drosophila Genetic Resource Center, Rubin GM (1996) A screen for genes that function downstream of Vienna Drosophila RNAi Center and the Australian Drosophila Ras1 during Drosophila eye development. Genetics 143:315–329 Biomedical Research Support Facility for providing Drosophila 17. Therrien M, Chang HC, Solomon NM, Karim FD, Wassarman strains and the Developmental Studies Hybridoma Bank for providing DA, Rubin GM (1995) KSR, a novel protein kinase required for antibodies. We would like to thank Franca Casagranda for assistance RAS signal transduction. Cell 83:879–888 with qRT-PCR and Robb de Iongh for assistance with in situ 18. Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T hybridisation. This work was sponsored by the National Health and (1999) The gene search system. A method for efficient detection Medical Research Council Project Grant 350316 to GH and HR. and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151:725–737 19. Rorth P, Szabo K, Bailey A, Laverty T, Rehm J, Rubin GM, References Weigmann K, Milan M, Benes V, Ansorge W, Cohen SM (1998) Systematic gain-of-function genetics in Drosophila. Develop- ment 125:1049–1057 1. Bache KG, Slagsvold T, Stenmark H (2004) Defective down- 20. Huang AM, Rubin GM (2000) A misexpression screen identifies regulation of receptor tyrosine kinases in cancer. EMBO J genes that can modulate RAS1 pathway signaling in Drosophila 23:2707–2712 melanogaster. Genetics 156:1219–1230 2. Joazeiro CAP, Wing SS, Huang HK, Leverson JD, Hunter T, Liu 21. Carnegie GK, Means CK, Scott JD (2009) A-kinase anchoring YC (1999) The tyrosine kinase negative regulator c-Cbl as a proteins: from protein complexes to physiology and disease. RING-type, E2-dependent ubiquitin-protein ligase. Science IUBMB Life 61:394–406 286:309–312 22. Greenwald EC, Saucerman JJ (2011) Bigger, better, faster: 3. Waterman H, Levkowitz G, Alroy I, Yarden Y (1999) The RING principles and models of AKAP anchoring protein signaling. finger of c-Cbl mediates desensitization of the epidermal growth J Cardiovasc Pharmacol 58:462–469 factor receptor. J Biol Chem 274:22151–22154 23. Logue JS, Scott JD (2010) Organizing signal transduction 4. Langdon WY, Hartley JW, Klinken SP, Ruscetti SK, Morse HCd through A-kinase anchoring proteins (AKAPs). FEBS J (1989) v-cbl, an oncogene from a dual-recombinant murine ret- 277:4370–4375 rovirus that induces early B-lineage lymphomas. Proc Natl Acad 24. Li Z, Rossi EA, Hoheisel JD, Kalderon D, Rubin CS (1999) Sci USA 86:1168–1172 Generation of a novel A kinase anchor protein and a myristoy- 5. Swaminathan G, Tsygankov AY (2006) The Cbl family proteins: lated alanine-rich C kinase substrate-like analog from a single ring leaders in regulation of cell signaling. J Cell Physiol gene. J Biol Chem 274:27191–27200 209:21–43 25. Rossi EA, Li Z, Feng H, Rubin CS (1999) Characterization of the 6. Ettenberg SA, Keane MM, Nau MM, Frankel M, Wang LM, targeting, binding, and phosphorylation site domains of an A Pierce JH, Lipkowitz S (1999) cbl-b inhibits epidermal growth kinase anchor protein and a myristoylated alanine-rich C kinase factor receptor signaling. Oncogene 18:1855–1866 substrate-like analog that are encoded by a single gene. J Biol 7. Lupher ML Jr, Andoniou CE, Bonita D, Miyake S, Band H Chem 274:27201–27210 (1998) The c-Cbl oncoprotein. Int J Biochem Cell Biol 26. Jackson SM, Berg CA (2002) An A-kinase anchoring protein is 30:439–444 required for protein kinase A regulatory subunit localization and 8. Hime GR, Abud HE, Garner B, Harris KL, Robertson H (2001) morphology of actin structures during oogenesis in Drosophila. Dynamic expression of alternate splice forms of D-cbl during Development 129:4423–4433 embryogenesis. Mech Dev 102:235–238 27. Smith FD, Langeberg LK, Cellurale C, Pawson T, Morrison DK, 9. Hime GR, Dhungat MP, Ng A, Bowtell DD (1997) D-Cbl, the Davis RJ, Scott JD (2010) AKAP-Lbc enhances cyclic AMP Drosophila homologue of the c-Cbl proto-oncogene, interacts control of the ERK1/2 cascade. Nat Cell Biol 12:1242–1249

123 5 DISCUSSION

5.1 Introduction This work set out to determine if a subset of Dv-cbl suppressors identified in a modifier screen were able to suppress Dv-cbl under more rigorous criteria, and if two of these suppressors, chosen on the basis that the gene they express were able to suppress Ras85DV12, were also able to suppress the co-operation between Dv-cbl and Ras85DV12. Ras85DV12 is linked to Dv-cbl as both cause constitutive activation of the EGFR pathway, but when co-expressed in the Drosophila eye they cause a phenotype that is more than the additive effects of the two genes (Chapter 4/Paper: Figure 4a, and Robertson et al., 2000). 5.2 An interaction map between Cbl and other genes investigated was generated With the use of scanning electron microscopy on adult eyes, and immunohistochemistry against the cone cell marker Cut (in the developing 3rd instar eye disc), I was able to show that each of the lines I had chosen to study was able to suppress the GMR>Dv-cbl heterozygote eye phenotype. Each line was not equally effective, as was discussed in Chapter 3. In this chapter I show an interaction map (Figure 5.1) which is generated from Tables 3.5 and 3.6, listing Cbl interactors, and the interactors of the genes that are most likely expressed (or in one case, knocked down) respectively. From this map, three genes could be identified as common interactors: Dap160, Numb, and Akap200. The function of these genes will be discussed in more detail later in this chapter. Some genes were found to have pathways in common with Cbl (Table 3.4) - the CG9705 human homologue calcium regulated heat stable protein 1 (GS10305), Akaps in general (a kinase anchoring proteins) (EP2254/GS2208), Lk6 kinase (UAS-LK6), and Dap160 (GS8042) were all linked to Cbl directly (Figure 3.5), (Robertson et al., 2000). Several other genes were linked via other genes. These were Whamy (GS10268 antisense), Numb (GS2273), Thada (GS1120), Ldh (GS9841), Akap200 (EP2254 and GS2208), and CG9705 (GS10305) (Table 3.6). Some genes that were implicated by the P-element lines did not share any documented pathways or interactors with Cbl, its interactors, or any of the other genes implicated by

aurA

MAPK8/MAPK14/rl

lk6 Rac1 WAS Numb Whamy CDC42 Cbl aPKC RAS85D/HRAS

SRC Eps-15 Fyn RET HSPA4 par-6 PHGPx shi Thada

Dap160 Fkbp14 SERCA Akap200 Akt1 fabp Ldh

Chc cib

CG6084

CG9705 NOTCH1 / CG2852 NOTCH3 /N

Sh3β

RacGAP84C Figure 5.1: Network of Cbl, known interactors and proteins that link their activities This figure maps the known interactions of the Cbl and the other genes investigated in Chapter 3, and how they are connected to each other. The references for each gene are listed in Tables 3.5 and 3.6. Not all of the genes implicated in Chapter 3 are in this diagram. If they are present, they are more likely to be in the Cbl pathway, if not the gene may be diverting resources from the Cbl pathway hence was detected as a genetic suppressor. The Cbl and Akap200 interaction is from (Bala Tannan et al., 2018). Green highlighting=sense genes expressed by Chapter 3 lines, red=antisense the P-element lines or their interactors, and thus did not get shown on the interaction map. They were: Hers (GS1120), CR44784 (GS2064), Atf3 (GS5217) and, CR44522 (GS9841). These genes may be diverting resources to other pathways or affecting growth or homeostasis (see Table 3.3 for their functions). 5.2.1 From the interaction map, three nodes became apparent The three nodes of Chapter 3 were Dap160, Numb, and Akap200. These three genes stood out as having the most interactions in the network. 5.2.1.1 Dap160 Dap160 was discovered by (Roos and Kelly, 1998) (and named for its association with dynamin (Dynamin associated protein 160kDa)). Dynamin is also known also as shibire. Dap160 complexes with Dynamin and the plasma membrane (Roos and Kelly, 1998). On discovery, it was suggested that it was a part of the endocytosis scaffolding machinery, which was backed up by further evidence by (Koh et al., 2007), who hypothesised that Dap160 formed a complex with Eps15, Nervous wreck, and WASp. Dap160 was found to interact with D-cbl (Robertson et al., 2000), which linked D-cbl to endocytosis. Mammalian c-Cbl was also found to interact with Ese1 (Dap160 homologue) via a Y2H study (Robertson, 2000). Given that a link between D-Cbl and Dap160 had already been established, it was not surprising that Dap160 was identified as an interactor in this study as well. One way that ectopic Dap160 could be suppressing Dv-cbl is by upregulating endocytosis that is not related to Dv-cbl. Intersectin (a Dap160 homologue) has been implicated in actin assembly and the activation of mitogenic signals (reviewed in Polo et al., 2003). This could link Dap160 to Akap200 (via actin) and Cbl (via mitogenic pathways) respectively. 5.2.1.2 Numb Numb was discovered by (Uemura et al., 1989). Numb is well known for its role in antagonism of Notch during the specification of cell fates (reviewed in Schweisguth, 2015). Numb promotes endocytosis of Notch. This leads to Notch being more prevalent in one cell than its neighbour, leading to different fates in each of the cells and their progeny. Mutations in Numb cause tumours as cells fail to differentiate (reviewed in Kang and Reichert, 2015). Notch is also involved in specification of the photoreceptor R8 in the developing eye (reviewed in Voas and Rebay, 2004). As well as the Notch pathway, Numb also impacts the p53 and Hh pathways. Numb inhibits Hh signalling by

87 suppressing the mammalian Gli proteins (Drosophila homologue: cubitus interruptus), the transcription factors at the end of the Hh pathway. Gli proteins are targeted by Numb for degradation by Itch (Drosophila homologue: Suppressor of deltex), an E3 ligase. Numb also prevents the ubiquitination of p53 by the E3 ligase MDM2 (mammalian, Drosophila functional orthologue corp, Chakraborty et al., 2015) by forming a complex containing all three proteins, which prevents MDM2 activity in the human breast cell line MCF10A (Colaluca et al., 2008, also reviewed in Pece et al., 2011). Numb regulates pathways via acting as a regulator for E3 ligases and promotes endocytosis. It is also involved in the epithelial to mesenchymal transition (EMT), via the modulation of its interactions with tight junctions and adherens junctions, (the destabilisation of which is required to allow the EMT, which allows cells to migrate (reviewed in Pece et al., 2011). Asymmetrical division also plays a part in muscle development, with the cell that accumulates more Numb becoming the muscle cell (reviewed in Pece et al., 2011). Given the role of Cbl and Dap160 in endocytosis, it is unsurprising that another of the nodes in the interactor map (Figure 5.1) is also involved in endocytosis. This may provide an explanation of why numb may be a suppressor of Dv-cbl, in addition to numb being known as a tumour suppressor (reviewed in Pece et al., 2011). 5.2.1.3 Akap200 was the final node identified in the interaction map

Akaps, in general, are known to localise Protein Kinase A (PKA). The PKA holoenzyme is made up of two regulatory and two catalytic subunits. Akaps bind to its regulatory subunits and render the catalytic subunits inert until they are bound by cAMP and released. As PKA is capable of interacting with a wide range of substrates, such as those involved in a diverse range of processes such as embryogenesis, larval development, and oogenesis (Jackson and Berg, 2002; Lane and Kalderon, 1993). It is thought that the substrate is directed by the Akaps, which due to their structure are directed to different subcellular locations, thus able to place PKA in close vicinity to its target substrates such as ion channels (reviewed in Gray et al., 1998) whilst in an inactive state (reviewed in Feliciello et al., 2001; Michel and Scott, 2002). Akap200 was first reported in a twin set of papers (Li et al., 1999; Rossi et al., 1999). Drosophila Akap200 is alternatively spliced, resulting in two proteins, Akap200 and ΔAkap200. Both are targeted to the plasma membrane by virtue of being MARCKS

88 proteins, with the N terminal myristate and phosphorylation site domain (PSD) characteristic of this class of proteins, which allow them to interact with the plasma membrane and F-actin (Li et al., 1999; Rossi et al., 1999). Of the two isoforms, only Akap200 retains the PKA-R2 binding site, allowing it to bind to and localise the PKA holoenzyme, which is made up of two PKA-R2 (regulatory) subunits, and two PKA-C1 (catalytic) subunits. Akap200 localises PKA-C1 via binding to PKA-R2. Only when the PKA-C1 subunits are released from the holoenzyme by cAMP binding as mentioned above can they catalyse downstream targets involved in processes such as embryogenesis, larval development and oogenesis (Jackson and Berg, 2002; Lane and Kalderon, 1993). (Li et al., 1999) posited that as MARCKS proteins, Akap200 ΔAkap200 are regulated by diacylgycerol (cytoskeleton remodelling) and calcium (actin binding). Akap200 is present in all stages of development but is 3-4 fold higher in pupae and ΔAkap200 is present at 7 fold higher levels in the Drosophila head (Li et al., 1999). ΔAkap200 differs in amino acid sequence from Akap200 because it is missing exon 5 due to alternative splicing and is thus made up of Akap200 residues 1-344 and 726-753 (missing 345-725). Akap200 residues 345-725 contain the SH3 docking sites and R2 binding site, so these functions are missing in ΔAkap200. ΔAkap200 may be a cAMP-independent signalling protein. (Rossi et al., 1999). A role for ΔAkap200 in protecting Notch from internalisation by D-Cbl was recently discovered (Bala Tannan et al., 2018) and will be discussed in a later section of this chapter. 5.3 Akap200 can suppress Dv-Cbl and Ras85DV12, and is expressed in a subset of photoreceptor cells GS2208 and EP2254 were further investigated as there was evidence in the literature that Akap200 (which was expressed by both lines) interacted with Ras85DV12 (Huang and Rubin, 2000), and Src64B (Jackson and Berg, 2002), both of which are oncogenes that interact with Cbl (Table 3.5) (Robertson et al., 2000; Wang et al., 2008 and reviewed in Thien and Langdon, 2001). The results of this study were published in the paper presented in this work (Sannang et al., 2012). The key findings were as follows: Akap200 was able to suppress the cooperation of Dv-cbl and Ras85DV12 in the eye, and this was not solely due to apoptosis, as suppressing apoptosis allowed for further suppression of the cooperation phenotype (Paper/Chapter 4, Figure 4). Endogenous Akap200 was shown to be expressed in photoreceptor cells (colocalization with Elav)

89 but was not expressed in cone cells or R7 (no colocalization with Prospero) (Paper/Chapter 4, Figure 5). Three separate Akap200RNAi lines enhanced the GMR>Dv-cbl phenotype, which infers that the presence of endogenous Akap200 has an effect on the GMR>Dv-cbl phenotype (Paper/Chapter 4, Figure 6). 5.4 The relationship of Akap200 with Notch The results in Chapter 4/the paper implied that Akap200 may be capable of suppressing other oncogene combinations, so GMR>GS2208, and GMR> TRiP.HM05018(Akap200 RNAi) lines were generated (mating schemes not shown). These lines were crossed to a selection of oncogenes, but with varying results (data not shown). The recent work of (Bala Tannan et al., 2018), which found that Akap200 protects Notch from D-Cbl mediated degradation prompted me to revisit this data. When I crossed GMR>GS2208, and GMR>TRiP.HM05018 to UAS-N (Appendix 2) the results were consistent with that of (Bala Tannan et al., 2018). Namely, when I crossed GMR>GS2208 to UAS- Notch, resulting in ectopic expression of both Akap200 and Notch, the GMR>Notch phenotype was enhanced. When GMR> TRiP.HM05018 was crossed to UAS-Notch, the GMR>Notch phenotype was suppressed. This is consistent with the work of (Bala Tannan et al., 2018), which reported that a loss of endogenous Akap200 caused a decrease in endogenous Notch and that an increase in Akap200 activity caused an increase in Notch activity. Their work also specifically reports Akap200 as being an antagoniser of Cbl. This is also consistent with my own findings. In Figure 3.1k, the GMR>GS2208 adult eye is rough. It was originally thought that this roughness was due to the expression of CG13398 or a short antisense transcript made against the Akap200 5’UTR, but it may be because Akap200 also has a role in promoting MAPK signalling, as was shown in the mammalian Akap-Lbc (Smith et al., 2010). Then the suppression of the GMR>Dv-cbl phenotype by GS2208 (Figure 3.1o) may be an example of antagonization, which fits with the roles of D-Cbl and Akap200 determined by (Bala Tannan et al., 2018). It is also possible that the effects of Akap200 overexpression observed in this thesis are due to its interactions with Notch. Notch expression is involved in the determination of the proneural cluster, from which the R8 photoreceptor will be determined, and the lateral inhibition of Atonal, which determines which of the cells will become the R8 photoreceptor (reviewed in Voas and Rebay, 2004). The expression of a constitutively active Notch mutant under the sev promoter resulted in a

90 severe disorder of the ommatidial array (Bala Tannan et al., 2018). Following on from that logic, it is also possible that the overexpression of Akap200 could be resulting in a rough eye (Figure 3.1k) due to its Notch stabilising effects, and the apparent suppression of the GMR>Dv-cbl phenotype actually an antagonization of Notch and D- Cbl. As for the suppression of the Dv-cbl Ras85DV12 phenotype, stabilisation of Notch via Akap200 overexpression may be suppressing this phenotype as well, though the scaffolding of the MAPK pathway elements in a similar fashion to AKAP-Lbc (Smith et al., 2010) may also be in play.

5.5 Further Directions and final conclusions While it was clear that Akap200 was able to modify the Dv-cbl and Ras85DV12 phenotypes both independently and in co-operation, it is unclear what the exact mechanisms behind these results are. The data from (Bala Tannan et al., 2018) showing that Akap200 has an effect on both Notch and D-Cbl suggest that the results observed in this work with Akap200 suppression of GMR>Dv-cbl may be due to the antagonization observed between Akap200 and D-Cbl in (Bala Tannan et al., 2018). Other factors may be at play, such as other Akap200 targets in the cell being hyperactivated, or a scaffolding effect as in AKAP-Lbc (Smith et al., 2010). There is a regulator of the Akap200 transcript present in the developing eye, as the ectopically expressed transcript expressed by GMR>EP2254 is clearly downregulated in the posterior section of the disc (Paper/Chapter 4, Figure 2c(a)). Further investigations would include finding out what this interactor is, and further investigating the interaction of Notch, D-Cbl, and Akap200. A particularly interesting question would be if Akap200 stabilises any other targets of D-Cbl. The results of (Bala Tannan et al., 2018) suggest that Akap200 is not directly involved with EGFR. Src is also an interactor of Cbl (reviewed in Thien and Langdon, 2001), and (Jackson and Berg, 2002) found a genetic interaction between Drosophila Src64B and Akap200. I made an attempt to determine if Akap200 overexpression or knockdown could rescue GMR>Src64B overexpression mediated lethality, but no rescue was observed (data not shown). Another experiment to test this concept, perhaps using different drivers or looking at coimmunoprecipitation could be attempted. Another direction this work could be expanded upon is to investigate the

91 function of CG9705 (GS10305), as it had so many interactors in common with Akap200 and was a suppressor of all of the GMR>Dv-cbl phenotypes tested. In conclusion, this work took a small selection of suppressors from a large screen for modifiers of the GMR>Dv-cbl phenotype, and after investigating the suppressors in further detail, I then turned my attention to two lines that were likely to express the Akap200 gene. Evidence of expression was shown for one of the lines (EP2254) via mRNA in situ hybridisation, and the ability of EP2254 to partially suppress the severe roughness and overgrowth caused by Dv-cbl and Ras85DV12 cooperation was established, and this was also shown be partially independent from apoptosis. The exact mechanism for the suppression of this phenotype is yet to be determined. Finally, endogenous Akap200 was identified in a subset of the photoreceptor cells and was able to modify the GMR>Dv-cbl phenotype.

6 BIBLIOGRAPHY

Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002). Molecular Biology of the Cell (Garland Science).

Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2004). Cell Communication. In Essential Cell Biology, (Garland Science), p. 559.

Ali, S., Chen, Z., Lebrun, J.J., Vogel, W., Kharitonenkov, A., Kelly, P.A., and Ullrich, A. (1996). PTP1D is a positive regulator of the prolactin signal leading to beta-casein promoter activation. EMBO J. 15, 135–142.

Anderson, S.M., Burton, E.A., and Koch, B.L. (1997). Phosphorylation of Cbl following stimulation with interleukin-3 and its association with Grb2, Fyn, and phosphatidylinositol 3-kinase. J. Biol. Chem. 272, 739–745.

Andoniou, C.E., Thien, C.B., and Langdon, W.Y. (1994). Tumour induction by activated abl involves tyrosine phosphorylation of the product of the cbl oncogene. EMBO J. 13, 4515–4523.

Andoniou, C.E., Lill, N.L., Thien, C.B., Lupher, M.L., Ota, S., Bowtell, D.D., Scaife, R.M., Langdon, W.Y., and Band, H. (2000). The Cbl proto-oncogene product negatively regulates the Src-family tyrosine kinase Fyn by enhancing its degradation. Mol. Cell. Biol. 20, 851–867.

Arquier, N., Bourouis, M., Colombani, J., and Léopold, P. (2005). Drosophila Lk6 kinase controls phosphorylation of eukaryotic translation initiation factor 4E and promotes normal growth and development. Curr. Biol. CB 15, 19–23.

Atkins, M., and Mardon, G. (2009). Signaling in the third dimension: the peripodial epithelium in eye disc development. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 238, 2139– 2148.

Bajaj, J., Zimdahl, B., and Reya, T. (2015). Fearful symmetry: subversion of asymmetric division in cancer development and progression. Cancer Res. 75, 792–797.

Bala Tannan, N., Collu, G., Humphries, A.C., Serysheva, E., Weber, U., and Mlodzik, M. (2018). AKAP200 promotes Notch stability by protecting it from Cbl/lysosome- mediated degradation in Drosophila melanogaster. PLoS Genet. 14, e1007153.

Bauke, A.-C., Sasse, S., Matzat, T., and Klämbt, C. (2015). A transcriptional network controlling glial development in the Drosophila visual system. Dev. Camb. Engl. 142, 2184–2193.

Blake, T.J., Shapiro, M., Morse, H.C., and Langdon, W.Y. (1991). The sequences of the human and mouse c-cbl proto-oncogenes show v-cbl was generated by a large truncation encompassing a proline-rich domain and a leucine zipper-like motif. Oncogene 6, 653–657.

Blochlinger, K., Bodmer, R., Jan, L.Y., and Jan, Y.N. (1990). Patterns of expression of cut, a protein required for external sensory organ development in wild-type and cut mutant Drosophila embryos. Genes Dev. 4, 1322–1331.

Blochlinger, K., Jan, L.Y., and Jan, Y.N. (1993). Postembryonic patterns of expression of cut, a locus regulating sensory organ identity in Drosophila. Dev. Camb. Engl. 117, 441–450.

Boussiotis, V.A., Freeman, G.J., Berezovskaya, A., Barber, D.L., and Nadler, L.M. (1997). Maintenance of human T cell anergy: blocking of IL-2 gene transcription by activated Rap1. Science 278, 124–128.

Bowtell, D.D., Kimmel, B.E., Simon, M.A., and Rubin, G.M. (1989). Regulation of the complex pattern of sevenless expression in the developing Drosophila eye. Proc. Natl. Acad. Sci. U. S. A. 86, 6245–6249.

Brand, A.H., and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401–415.

Brinkmann, K., Winterhoff, M., Önel, S.-F., Schultz, J., Faix, J., and Bogdan, S. (2016). WHAMY is a novel actin polymerase promoting myoblast fusion, macrophage cell motility and sensory organ development in Drosophila. J. Cell Sci. 129, 604–620.

Brumby, A.M., and Richardson, H.E. (2005). Using Drosophila melanogaster to map human cancer pathways. Nat Rev Cancer 5, 626–639.

Burns, K., Clatworthy, J., Martin, L., Martinon, F., Plumpton, C., Maschera, B., Lewis, A., Ray, K., Tschopp, J., and Volpe, F. (2000). Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell Biol. 2, 346–351.

Cancer Genome Atlas Research Network (2008). Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 455, 1061–1068.

Carniti, C., Perego, C., Mondellini, P., Pierotti, M.A., and Bongarzone, I. (2003). PP1 inhibitor induces degradation of RETMEN2A and RETMEN2B oncoproteins through proteosomal targeting. Cancer Res. 63, 2234–2243.

Chabu, C., and Doe, C.Q. (2008). Dap160/intersectin binds and activates aPKC to regulate cell polarity and cell cycle progression. Dev. Camb. Engl. 135, 2739–2746.

Chakraborty, R., Li, Y., Zhou, L., and Golic, K.G. (2015). Corp Regulates P53 in Drosophila melanogaster via a Negative Feedback Loop. PLoS Genet. 11, e1005400.

Checquolo, S., Palermo, R., Cialfi, S., Ferrara, G., Oliviero, C., Talora, C., Bellavia, D., Giovenco, A., Grazioli, P., Frati, L., et al. (2010). Differential subcellular localization regulates c-Cbl E3 ligase activity upon Notch3 protein in T-cell leukemia. Oncogene 29, 1463–1474.

Chu, H.M., Tan, Y., Kobierski, L.A., Balsam, L.B., and Comb, M.J. (1994). Activating transcription factor-3 stimulates 3’,5’-cyclic adenosine monophosphate-dependent gene expression. Mol. Endocrinol. Baltim. Md 8, 59–68.

Colaluca, I.N., Tosoni, D., Nuciforo, P., Senic-Matuglia, F., Galimberti, V., Viale, G., Pece, S., and Di Fiore, P.P. (2008). NUMB controls p53 tumour suppressor activity. Nature 451, 76–80.

Croft, D., Mundo, A.F., Haw, R., Milacic, M., Weiser, J., Wu, G., Caudy, M., Garapati, P., Gillespie, M., Kamdar, M.R., et al. (2014). The Reactome pathway knowledgebase. Nucleic Acids Res. 42, D472-477.

Dang, C.V. (2012). Links between metabolism and cancer. Genes Dev. 26, 877–890.

Deckert, M., Elly, C., Altman, A., and Liu, Y.C. (1998). Coordinated regulation of the tyrosine phosphorylation of Cbl by Fyn and Syk tyrosine kinases. J. Biol. Chem. 273, 8867–8874.

Dietzl, G., Chen, D., Schnorrer, F., Su, K.-C., Barinova, Y., Fellner, M., Gasser, B., Kinsey, K., Oppel, S., Scheiblauer, S., et al. (2007). A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151–156.

Dikic, I., Szymkiewicz, I., and Soubeyran, P. (2003). Cbl signaling networks in the regulation of cell function. Cell. Mol. Life Sci. CMLS 60, 1805–1827.

Duffy, J.B. (2002). GAL4 system in Drosophila: a fly geneticist’s Swiss army knife. Genes. N. Y. N 2000 34, 1–15.

Erdreich-Epstein, A., Liu, M., Liu, Y., and Durden, D.L. (1997). Protein tyrosine phosphatase inhibitors in Fc gamma RI-induced myeloid oxidant signaling. Exp. Cell Res. 237, 288–295.

Fabregat, A., Jupe, S., Matthews, L., Sidiropoulos, K., Gillespie, M., Garapati, P., Haw, R., Jassal, B., Korninger, F., May, B., et al. (2018). The Reactome Pathway Knowledgebase. Nucleic Acids Res. 46, D649–D655.

Fan, F., Jin, S., Amundson, S.A., Tong, T., Fan, W., Zhao, H., Zhu, X., Mazzacurati, L., Li, X., Petrik, K.L., et al. (2002). ATF3 induction following DNA damage is regulated by distinct signaling pathways and over-expression of ATF3 protein suppresses cells growth. Oncogene 21, 7488–7496.

Fang, D., Wang, H.Y., Fang, N., Altman, Y., Elly, C., and Liu, Y.C. (2001). Cbl-b, a RING-type E3 ubiquitin ligase, targets phosphatidylinositol 3-kinase for ubiquitination in T cells. J. Biol. Chem. 276, 4872–4878.

Feliciello, A., Gottesman, M.E., and Avvedimento, E.V. (2001). The biological functions of A-kinase anchor proteins. J. Mol. Biol. 308, 99–114.

Fischer, J.A., Giniger, E., Maniatis, T., and Ptashne, M. (1988). GAL4 activates transcription in Drosophila. Nature 332, 853–856.

Freeman, M. (1996). Reiterative use of the EGF receptor triggers differentiation of all cell types in the Drosophila eye. Cell 87, 651–660.

Frise, E., Knoblich, J.A., Younger-Shepherd, S., Jan, L.Y., and Jan, Y.N. (1996). The Drosophila Numb protein inhibits signaling of the Notch receptor during cell-cell interaction in sensory organ lineage. Proc. Natl. Acad. Sci. U. S. A. 93, 11925–11932.

Fukazawa, T., Reedquist, K.A., Trub, T., Soltoff, S., Panchamoorthy, G., Druker, B., Cantley, L., Shoelson, S.E., and Band, H. (1995). The SH3 domain-binding T cell tyrosyl phosphoprotein p120. Demonstration of its identity with the c-cbl protooncogene product and in vivo complexes with Fyn, Grb2, and phosphatidylinositol 3-kinase. J. Biol. Chem. 270, 19141–19150.

Galletta, B.J., Fagerstrom, C.J., Schoborg, T.A., McLamarrah, T.A., Ryniawec, J.M., Buster, D.W., Slep, K.C., Rogers, G.C., and Rusan, N.M. (2016). A centrosome interactome provides insight into organelle assembly and reveals a non-duplication role for Plk4. Nat. Commun. 7, 12476.

Ghosh, A.K., Reddi, A.L., Rao, N.L., Duan, L., Band, V., and Band, H. (2004). Biochemical basis for the requirement of kinase activity for Cbl-dependent ubiquitinylation and degradation of a target tyrosine kinase. J. Biol. Chem. 279, 36132– 36141.

Gramates, L.S., Marygold, S.J., Santos, G.D., Urbano, J.-M., Antonazzo, G., Matthews, B.B., Rey, A.J., Tabone, C.J., Crosby, M.A., Emmert, D.B., et al. (2017). FlyBase at 25: looking to the future. Nucleic Acids Res. 45, D663–D671.

Gray, P.C., Scott, J.D., and Catterall, W.A. (1998). Regulation of ion channels by cAMP-dependent protein kinase and A-kinase anchoring proteins. Curr. Opin. Neurobiol. 8, 330–334.

Grossmann, A., Benlasfer, N., Birth, P., Hegele, A., Wachsmuth, F., Apelt, L., and Stelzl, U. (2015). Phospho-tyrosine dependent protein-protein interaction network. Mol. Syst. Biol. 11, 794.

Grossmann, A.H., Kolibaba, K.S., Willis, S.G., Corbin, A.S., Langdon, W.S., Deininger, M.W.N., and Druker, B.J. (2004). Catalytic domains of tyrosine kinases determine the phosphorylation sites within c-Cbl. FEBS Lett. 577, 555–562.

Guo, M., Jan, L.Y., and Jan, Y.N. (1996). Control of daughter cell fates during asymmetric division: interaction of Numb and Notch. Neuron 17, 27–41.

Guruharsha, K.G., Rual, J.-F., Zhai, B., Mintseris, J., Vaidya, P., Vaidya, N., Beekman, C., Wong, C., Rhee, D.Y., Cenaj, O., et al. (2011). A protein complex network of Drosophila melanogaster. Cell 147, 690–703.

Hadari, Y.R., Kouhara, H., Lax, I., and Schlessinger, J. (1998). Binding of Shp2 tyrosine phosphatase to FRS2 is essential for fibroblast growth factor-induced PC12 cell differentiation. Mol. Cell. Biol. 18, 3966–3973.

Haenfler, J.M., Kuang, C., and Lee, C.-Y. (2012). Cortical aPKC kinase activity distinguishes neural stem cells from progenitor cells by ensuring asymmetric segregation of Numb. Dev. Biol. 365, 219–228.

Hagedorn, E.J., Bayraktar, J.L., Kandachar, V.R., Bai, T., Englert, D.M., and Chang, H.C. (2006). Drosophila melanogaster auxilin regulates the internalization of Delta to control activity of the Notch signaling pathway. J. Cell Biol. 173, 443–452.

Hai, T., Wolfgang, C.D., Marsee, D.K., Allen, A.E., and Sivaprasad, U. (1999). ATF3 and stress responses. Gene Expr. 7, 321–335.

Han, Z., and Bodmer, R. (2003). Myogenic cells fates are antagonized by Notch only in asymmetric lineages of the Drosophila heart, with or without cell division. Dev. Camb. Engl. 130, 3039–3051.

Hashimoto, S., Hirose, M., Hashimoto, A., Morishige, M., Yamada, A., Hosaka, H., Akagi, K., Ogawa, E., Oneyama, C., Agatsuma, T., et al. (2006). Targeting AMAP1 and cortactin binding bearing an atypical src homology 3/proline interface for prevention of breast cancer invasion and metastasis. Proc. Natl. Acad. Sci. U. S. A. 103, 7036–7041.

Heigwer, F., Port, F., and Boutros, M. (2018). RNA Interference (RNAi) Screening in Drosophila. Genetics 208, 853–874.

Hoskins, R.A., Carlson, J.W., Kennedy, C., Acevedo, D., Evans-Holm, M., Frise, E., Wan, K.H., Park, S., Mendez-Lago, M., Rossi, F., et al. (2007). Sequence finishing and mapping of Drosophila melanogaster heterochromatin. Science 316, 1625–1628.

Huang, A.M., and Rubin, G.M. (2000). A misexpression screen identifies genes that can modulate RAS1 pathway signaling in Drosophila melanogaster. Genetics 156, 1219– 1230.

Ito, S., Fujiyama-Nakamura, S., Kimura, S., Lim, J., Kamoshida, Y., Shiozaki-Sato, Y., Sawatsubashi, S., Suzuki, E., Tanabe, M., Ueda, T., et al. (2012). Epigenetic silencing of core histone genes by HERS in Drosophila. Mol. Cell 45, 494–504.

Iyer, E.P.R., Iyer, S.C., Sullivan, L., Wang, D., Meduri, R., Graybeal, L.L., and Cox, D.N. (2013). Functional genomic analyses of two morphologically distinct classes of Drosophila sensory neurons: post-mitotic roles of transcription factors in dendritic patterning. PloS One 8, e72434.

Jackson, S.M., and Berg, C.A. (2002). An A-kinase anchoring protein is required for protein kinase A regulatory subunit localization and morphology of actin structures during oogenesis in Drosophila. Development 129, 4423–4433.

Jehn, B.M., Dittert, I., Beyer, S., von der Mark, K., and Bielke, W. (2002). c-Cbl binding and ubiquitin-dependent lysosomal degradation of membrane-associated Notch1. J. Biol. Chem. 277, 8033–8040.

Jennings, B.H. (2011). Drosophila – a versatile model in biology & medicine. Mater. Today 14, 190–195.

JM Berg, JL Tymoczko, and Stryer, L. (2002). Section 16.1 Glycolysis Is an Energy- Conversion Pathway in Many Organisms. In Biochemistry, (New York: W. H. Freeman), p.

Johnson, S.A., Zitserman, D., and Roegiers, F. (2016). Numb regulates the balance between Notch recycling and late-endosome targeting in Drosophila neural progenitor cells. Mol. Biol. Cell 27, 2857–2866.

Kaabeche, K., Lemonnier, J., Le Mée, S., Caverzasio, J., and Marie, P.J. (2004). Cbl- mediated degradation of Lyn and Fyn induced by constitutive fibroblast growth factor receptor-2 activation supports osteoblast differentiation. J. Biol. Chem. 279, 36259– 36267.

Kalnins, A., Otto, K., Rüther, U., and Müller-Hill, B. (1983). Sequence of the lacZ gene of Escherichia coli. EMBO J. 2, 593–597.

Kandasamy, K., Mohan, S.S., Raju, R., Keerthikumar, S., Kumar, G.S.S., Venugopal, A.K., Telikicherla, D., Navarro, J.D., Mathivanan, S., Pecquet, C., et al. (2010). NetPath: a public resource of curated signal transduction pathways. Genome Biol. 11, R3.

Kang, K.H., and Reichert, H. (2015). Control of neural stem cell self-renewal and differentiation in Drosophila. Cell Tissue Res. 359, 33–45.

Kassenbrock, C.K., Hunter, S., Garl, P., Johnson, G.L., and Anderson, S.M. (2002). Inhibition of Src family kinases blocks epidermal growth factor (EGF)-induced activation of Akt, phosphorylation of c-Cbl, and ubiquitination of the EGF receptor. J. Biol. Chem. 277, 24967–24975.

Kauffmann, R.C., Li, S., Gallagher, P.A., Zhang, J., and Carthew, R.W. (1996). Ras1 signaling and transcriptional competence in the R7 cell of Drosophila. Genes Dev. 10, 2167–2178.

Keane, M.M., Rivero-Lezcano, O.M., Mitchell, J.A., Robbins, K.C., and Lipkowitz, S. (1995). Cloning and characterization of cbl-b: a SH3 binding protein with homology to the c-cbl proto-oncogene. Oncogene 10, 2367–2377.

Keane, M.M., Ettenberg, S.A., Nau, M.M., Banerjee, P., Cuello, M., Penninger, J., and Lipkowitz, S. (1999). cbl-3: a new mammalian cbl family protein. Oncogene 18, 3365– 3375.

Kidd, D., and Raff, J.W. (1997). LK6, a short lived protein kinase in Drosophila that can associate with microtubules and centrosomes. J. Cell Sci. 110 ( Pt 2), 209–219.

Kloth, L., Belge, G., Burchardt, K., Loeschke, S., Wosniok, W., Fu, X., Nimzyk, R., Mohamed, S.A., Drieschner, N., Rippe, V., et al. (2011). Decrease in thyroid adenoma associated (THADA) expression is a marker of dedifferentiation of thyroid tissue. BMC Clin. Pathol. 11, 13.

Koh, T.-W., Korolchuk, V.I., Wairkar, Y.P., Jiao, W., Evergren, E., Pan, H., Zhou, Y., Venken, K.J.T., Shupliakov, O., Robinson, I.M., et al. (2007). Eps15 and Dap160 control synaptic vesicle membrane retrieval and synapse development. J. Cell Biol. 178, 309–322.

Krauchunas, A.R., Horner, V.L., and Wolfner, M.F. (2012). Protein phosphorylation changes reveal new candidates in the regulation of egg activation and early embryogenesis in D. melanogaster. Dev. Biol. 370, 125–134.

Kumar, J.P. (2012). Building an ommatidium one cell at a time. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 241, 136–149.

Kung, J.T.Y., Colognori, D., and Lee, J.T. (2013). Long noncoding RNAs: past, present, and future. Genetics 193, 651–669.

Lane, M.E., and Kalderon, D. (1993). Genetic investigation of cAMP-dependent protein kinase function in Drosophila development. Genes Dev. 7, 1229–1243.

Langdon, W.Y., Hartley, J.W., Klinken, S.P., Ruscetti, S.K., and Morse, H.C. (1989). v- cbl, an oncogene from a dual-recombinant murine retrovirus that induces early B- lineage lymphomas. Proc Natl Acad Sci U A 86, 1168–1172.

Lee, C.-Y., Andersen, R.O., Cabernard, C., Manning, L., Tran, K.D., Lanskey, M.J., Bashirullah, A., and Doe, C.Q. (2006). Drosophila Aurora-A kinase inhibits neuroblast self-renewal by regulating aPKC/Numb cortical polarity and spindle orientation. Genes Dev. 20, 3464–3474.

Lee, J.E., Oney, M., Frizzell, K., Phadnis, N., and Hollien, J. (2015). Drosophila melanogaster activating transcription factor 4 regulates glycolysis during endoplasmic reticulum stress. G3 Bethesda Md 5, 667–675.

Li, X., Wu, Z., Fu, X., and Han, W. (2014). lncRNAs: insights into their function and mechanics in underlying disorders. Mutat. Res. Rev. Mutat. Res. 762, 1–21.

Li, Z., Rossi, E.A., Hoheisel, J.D., Kalderon, D., and Rubin, C.S. (1999). Generation of a Novel A Kinase Anchor Protein and a Myristoylated Alanine-rich C Kinase Substrate- like Analog from a Single Gene. J. Biol. Chem. 274, 27191–27200.

Lin, M.F., Carlson, J.W., Crosby, M.A., Matthews, B.B., Yu, C., Park, S., Wan, K.H., Schroeder, A.J., Gramates, L.S., St Pierre, S.E., et al. (2007). Revisiting the protein- coding gene catalog of Drosophila melanogaster using 12 fly genomes. Genome Res. 17, 1823–1836.

Lito, P., Mets, B.D., Kleff, S., O’Reilly, S., Maher, V.M., and McCormick, J.J. (2008). Evidence that sprouty 2 is necessary for sarcoma formation by H-Ras oncogene- transformed human fibroblasts. J. Biol. Chem. 283, 2002–2009.

Liu, R., Abreu-Blanco, M.T., Barry, K.C., Linardopoulou, E.V., Osborn, G.E., and Parkhurst, S.M. (2009). Wash functions downstream of Rho and links linear and branched actin nucleation factors. Dev. Camb. Engl. 136, 2849–2860.

Marie, B., Sweeney, S.T., Poskanzer, K.E., Roos, J., Kelly, R.B., and Davis, G.W. (2004). Dap160/intersectin scaffolds the periactive zone to achieve high-fidelity endocytosis and normal synaptic growth. Neuron 43, 207–219.

McGill, M.A., and McGlade, C.J. (2003). Mammalian numb proteins promote Notch1 receptor ubiquitination and degradation of the Notch1 intracellular domain. J. Biol. Chem. 278, 23196–23203.

Miao, H., Yuan, S., Wang, Y., Tsygankov, A., and Chien, S. (2002). Role of Cbl in shear-activation of PI 3-kinase and JNK in endothelial cells. Biochem. Biophys. Res. Commun. 292, 892–899.

Michel, J.J.C., and Scott, J.D. (2002). AKAP MEDIATED SIGNAL TRANSDUCTION. Annu. Rev. Pharmacol. Toxicol. 42, 235–257.

Mohapatra, B., Ahmad, G., Nadeau, S., Zutshi, N., An, W., Scheffe, S., Dong, L., Feng, D., Goetz, B., Arya, P., et al. (2013). Protein tyrosine kinase regulation by ubiquitination: critical roles of Cbl-family ubiquitin ligases. Biochim. Biophys. Acta 1833, 122–139.

Molnar, C., López-Varea, A., Hernández, R., and de Celis, J.F. (2006). A gain-of- function screen identifying genes required for vein formation in the Drosophila melanogaster wing. Genetics 174, 1635–1659.

Moraru, A., Cakan-Akdogan, G., Strassburger, K., Males, M., Mueller, S., Jabs, M., Muelleder, M., Frejno, M., Braeckman, B.P., Ralser, M., et al. (2017). THADA Regulates the Organismal Balance between Energy Storage and Heat Production. Dev. Cell 41, 72-81.e6.

Nau, M., and Lipkowitz, S. (2008). In Cbl Proteins, A. Tsygankov, ed. (Nova Science), p.

Ni, J.-Q., Markstein, M., Binari, R., Pfeiffer, B., Liu, L.-P., Villalta, C., Booker, M., Perkins, L., and Perrimon, N. (2008). Vector and parameters for targeted transgenic RNA interference in Drosophila melanogaster. Nat. Methods 5, 49–51.

Ni, J.-Q., Liu, L.-P., Binari, R., Hardy, R., Shim, H.-S., Cavallaro, A., Booker, M., Pfeiffer, B.D., Markstein, M., Wang, H., et al. (2009). A Drosophila resource of transgenic RNAi lines for neurogenetics. Genetics 182, 1089–1100.

Nishio, H., Otsuka, M., Kinoshita, S., Tokuoka, T., Nakajima, M., Noda, Y., Fukuyama, Y., and Suzuki, K. (2002). Phosphorylation of c-Cbl protooncogene product following ethanol administration in rat cerebellum: possible involvement of Fyn kinase. Brain Res. 950, 203–209.

Okabe, S., Tauchi, T., Ohyashiki, K., and Broxmeyer, H.E. (2006). Stromal-cell-derived factor-1/CXCL12-induced chemotaxis of a T cell line involves intracellular signaling through Cbl and Cbl-b and their regulation by Src kinases and CD45. Blood Cells. Mol. Dis. 36, 308–314.

100

Okur, M.N., Ooi, J., Fong, C.W., Martinez, N., Garcia-Dominguez, C., Rojas, J.M., Guy, G., and O’Bryan, J.P. (2012). Intersectin 1 enhances Cbl ubiquitylation of epidermal growth factor receptor through regulation of Sprouty2-Cbl interaction. Mol. Cell. Biol. 32, 817–825.

Ouyang, Y., Petritsch, C., Wen, H., Jan, L., Jan, Y.N., and Lu, B. (2011). Dronc caspase exerts a non-apoptotic function to restrain phospho-Numb-induced ectopic neuroblast formation in Drosophila. Dev. Camb. Engl. 138, 2185–2196.

Pai, L.-M., Barcelo, G., and Schüpbach, T. (2000). D-cbl, a Negative Regulator of the Egfr Pathway, Is Required for Dorsoventral Patterning in Drosophila Oogenesis. Cell 103, 51–61.

Pai, L.M., Wang, P.Y., Chen, S.R., Barcelo, G., Chang, W.L., Nilson, L., and Schupbach, T. (2006). Differential effects of Cbl isoforms on Egfr signaling in Drosophila. Mech. Dev. 123, 450–462.

Paige, C.J., Kincade, P.W., and Ralph, P. (1978). Murine B cell leukemia line with inducible surface immunoglobulin expression. J. Immunol. Baltim. Md 1950 121, 641– 647.

Panchamoorthy, G., Fukazawa, T., Miyake, S., Soltoff, S., Reedquist, K., Druker, B., Shoelson, S., Cantley, L., and Band, H. (1996). p120cbl is a major substrate of tyrosine phosphorylation upon B cell antigen receptor stimulation and interacts in vivo with Fyn and Syk tyrosine kinases, Grb2 and Shc adaptors, and the p85 subunit of phosphatidylinositol 3-kinase. J. Biol. Chem. 271, 3187–3194.

Parra-Palau, J.L., Scheper, G.C., Harper, D.E., and Proud, C.G. (2005). The Drosophila protein kinase LK6 is regulated by ERK and phosphorylates the eukaryotic initiation factor eIF4E in vivo. Biochem. J. 385, 695–702.

Pece, S., Confalonieri, S., R Romano, P., and Di Fiore, P.P. (2011). NUMB-ing down cancer by more than just a NOTCH. Biochim. Biophys. Acta 1815, 26–43.

Perkins, L.A., Holderbaum, L., Tao, R., Hu, Y., Sopko, R., McCall, K., Yang-Zhou, D., Flockhart, I., Binari, R., Shim, H.-S., et al. (2015). The Transgenic RNAi Project at Harvard Medical School: Resources and Validation. Genetics 201, 843–852.

Pickup, A.T., Ming, L., and Lipshitz, H.D. (2009). Hindsight modulates Delta expression during Drosophila cone cell induction. Dev. Camb. Engl. 136, 975–982.

Platonova, N., Manzo, T., Mirandola, L., Colombo, M., Calzavara, E., Vigolo, E., Cermisoni, G.C., De Simone, D., Garavelli, S., Cecchinato, V., et al. (2015). PI3K/AKT signaling inhibits NOTCH1 lysosome-mediated degradation. Genes. Chromosomes Cancer.

Polo, S., Confalonieri, S., Salcini, A.E., and Di Fiore, P.P. (2003). EH and UIM: endocytosis and more. Sci. STKE Signal Transduct. Knowl. Environ. 2003, re17.

101

Qin, H., Percival-Smith, A., Li, C., Jia, C.Y.H., Gloor, G., and Li, S.S.-C. (2004). A novel transmembrane protein recruits numb to the plasma membrane during asymmetric cell division. J. Biol. Chem. 279, 11304–11312.

Rafiq, K., Guo, J., Vlasenko, L., Guo, X., Kolpakov, M.A., Sanjay, A., Houser, S.R., and Sabri, A. (2011). C-CBL ubiquitin ligase regulates focal adhesion protein turnover and myofibril degeneration induced by neutrophil protease cathepsin G. J. Biol. Chem.

Raju, R., Balakrishnan, L., Nanjappa, V., Bhattacharjee, M., Getnet, D., Muthusamy, B., Kurian Thomas, J., Sharma, J., Rahiman, B.A., Harsha, H.C., et al. (2011). A comprehensive manually curated reaction map of RANKL/RANK-signaling pathway. Database J. Biol. Databases Curation 2011.

Raymond, K., Bergeret, E., Avet-Rochex, A., Griffin-Shea, R., and Fauvarque, M.-O. (2004). A screen for modifiers of RacGAP(84C) gain-of-function in the Drosophila eye revealed the LIM kinase Cdi/TESK1 as a downstream effector of Rac1 during spermatogenesis. J. Cell Sci. 117, 2777–2789.

Ready, D.F., Hanson, T.E., and Benzer, S. (1976). Development of the Drosophila retina, a neurocrystalline lattice. Dev. Biol. 53, 217–240.

Reedquist, K.A., Fukazawa, T., Panchamoorthy, G., Langdon, W.Y., Shoelson, S.E., Druker, B.J., and Band, H. (1996). Stimulation through the T cell receptor induces Cbl association with Crk proteins and the guanine nucleotide exchange protein C3G. J. Biol. Chem. 271, 8435–8442.

Rellahan, B.L., Graham, L.J., Tysgankov, A.Y., DeBell, K.E., Veri, M.-C., Noviello, C., and Bonvini, E. (2003). A dynamic constitutive and inducible binding of c-Cbl by PLCgamma1 SH3 and SH2 domains (negatively) regulates antigen receptor-induced PLCgamma1 activation in lymphocytes. Exp. Cell Res. 289, 184–194.

Robertson, H. (2000). A Biochemical and Genetic Analysis of cbl Genes and Gene Products. PhD. The University of Melbourne.

Robertson, H., Hime, G.R., Lada, H., and Bowtell, D.D. (2000). A Drosophila analogue of v-Cbl is a dominant-negative oncoprotein in vivo. Oncogene 19, 3299–3308.

Robinow, S., and White, K. (1991). Characterization and spatial distribution of the ELAV protein during Drosophila melanogaster development. J. Neurobiol. 22, 443– 461.

Rodriguez-Mesa, E., Abreu-Blanco, M.T., Rosales-Nieves, A.E., and Parkhurst, S.M. (2012). Developmental expression of Drosophila Wiskott-Aldrich Syndrome family proteins. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 241, 608–626.

Roos, J., and Kelly, R.B. (1998). Dap160, a neural-specific Eps15 homology and multiple SH3 domain-containing protein that interacts with Drosophila dynamin. J. Biol. Chem. 273, 19108–19119.

102

Rørth, P. (1996). A Modular Misexpression Screen in Drosophila Detecting Tissue- Specific Phenotypes. Proc. Natl. Acad. Sci. 93, 12418–12422.

Rossi, E.A., Li, Z., Feng, H., and Rubin, C.S. (1999). Characterization of the Targeting, Binding, and Phosphorylation Site Domains of an A Kinase Anchor Protein and a Myristoylated Alanine-rich C Kinase Substrate-like Analog That Are Encoded by a Single Gene. J. Biol. Chem. 274, 27201–27210.

Rynes, J., Donohoe, C.D., Frommolt, P., Brodesser, S., Jindra, M., and Uhlirova, M. (2012). Activating transcription factor 3 regulates immune and metabolic homeostasis. Mol. Cell. Biol. 32, 3949–3962.

Sambrook, J., and Russell, D. (2001). Appendix 1: Preparation of Reagents and Buffers Used in Molecular Cloning. In Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor, New York, USA: Cold Spring Harbor Laboratory Press), p. 2344.

Sanjay, A., Miyazaki, T., Itzstein, C., Purev, E., Horne, W.C., and Baron, R. (2006). Identification and functional characterization of an Src homology domain 3 domain- binding site on Cbl. FEBS J. 273, 5442–5456.

Sannang, R.T., Robertson, H., Siddall, N.A., and Hime, G.R. (2012). Akap200 suppresses the effects of Dv-cbl expression in the Drosophila eye. Mol. Cell. Biochem. 369, 135–145. dos Santos, G., Schroeder, A.J., Goodman, J.L., Strelets, V.B., Crosby, M.A., Thurmond, J., Emmert, D.B., Gelbart, W.M., and FlyBase Consortium (2015). FlyBase: introduction of the Drosophila melanogaster Release 6 reference genome assembly and large-scale migration of genome annotations. Nucleic Acids Res. 43, D690-697.

Schmidt, M.H.H., and Dikic, I. (2005). The Cbl interactome and its functions. Nat Rev Mol Cell Biol 6, 907–919.

Schweisguth, F. (2015). Asymmetric cell division in the Drosophila bristle lineage: from the polarization of sensory organ precursor cells to Notch-mediated binary fate decision. Wiley Interdiscip. Rev. Dev. Biol. 4, 299–309.

Scott, R.P., Eketjäll, S., Aineskog, H., and Ibáñez, C.F. (2005). Distinct turnover of alternatively spliced isoforms of the RET kinase receptor mediated by differential recruitment of the Cbl ubiquitin ligase. J. Biol. Chem. 280, 13442–13449.

Sekyrova, P., Bohmann, D., Jindra, M., and Uhlirova, M. (2010). Interaction between Drosophila bZIP proteins Atf3 and Jun prevents replacement of epithelial cells during metamorphosis. Dev. Camb. Engl. 137, 141–150.

Sen, G.L., and Blau, H.M. (2006). A brief history of RNAi: the silence of the genes. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 20, 1293–1299.

Severo, M.S., Sakhon, O.S., Choy, A., Stephens, K.D., and Pedra, J.H.F. (2013). The “ubiquitous” reality of vector immunology. Cell. Microbiol. 15, 1070–1078.

103

Shen, M., and Yen, A. (2009). c-Cbl tyrosine kinase-binding domain mutant G306E abolishes the interaction of c-Cbl with CD38 and fails to promote retinoic acid-induced cell differentiation and G0 arrest. J. Biol. Chem. 284, 25664–25677.

Shishido, T., Akagi, T., Ouchi, T., Georgescu, M.M., Langdon, W.Y., and Hanafusa, H. (2000). The kinase-deficient Src acts as a suppressor of the Abl kinase for Cbl phosphorylation. Proc. Natl. Acad. Sci. U. S. A. 97, 6439–6444.

Simmons, A., Gangadharan, B., Hodges, A., Sharrocks, K., Prabhakar, S., García, A., Dwek, R., Zitzmann, N., and McMichael, A. (2005). Nef-mediated lipid raft exclusion of UbcH7 inhibits Cbl activity in T cells to positively regulate signaling. Immunity 23, 621–634.

Slaninova, V., Krafcikova, M., Perez-Gomez, R., Steffal, P., Trantirek, L., Bray, S.J., and Krejci, A. (2016). Notch stimulates growth by direct regulation of genes involved in the control of glycolysis and the tricarboxylic acid cycle. Open Biol. 6, 150155.

Slenter, D.N., Kutmon, M., Hanspers, K., Riutta, A., Windsor, J., Nunes, N., Mélius, J., Cirillo, E., Coort, S.L., Digles, D., et al. (2018). WikiPathways: a multifaceted pathway database bridging metabolomics to other omics research. Nucleic Acids Res. 46, D661– D667.

Smith, F.D., Langeberg, L.K., Cellurale, C., Pawson, T., Morrison, D.K., Davis, R.J., and Scott, J.D. (2010). AKAP-Lbc enhances cyclic AMP control of the ERK1/2 cascade. Nat. Cell Biol. 12, 1242–1249.

Song, J.J., Kim, J.-H., Sun, B.K., Alcala, M.A., Bartlett, D.L., and Lee, Y.J. (2010). c- Cbl acts as a mediator of Src-induced activation of the PI3K-Akt signal transduction pathway during TRAIL treatment. Cell. Signal. 22, 377–385.

Spradling, A.C., Stern, D.M., Kiss, I., Roote, J., Laverty, T., and Rubin, G.M. (1995). Gene disruptions using P transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. U. S. A. 92, 10824–10830.

Stark, C., Breitkreutz, B.-J., Reguly, T., Boucher, L., Breitkreutz, A., and Tyers, M. (2006). BioGRID: a general repository for interaction datasets. Nucleic Acids Res. 34, D535-539.

Swaminathan, G., and Tsygankov, A.Y. (2006). The Cbl family proteins: ring leaders in regulation of cell signaling. J. Cell. Physiol. 209, 21–43.

Szymkiewicz, I., Destaing, O., Jurdic, P., and Dikic, I. (2004). SH3P2 in complex with Cbl and Src. FEBS Lett. 565, 33–38.

Taher, T.E.I., Tjin, E.P.M., Beuling, E.A., Borst, J., Spaargaren, M., and Pals, S.T. (2002). c-Cbl is involved in Met signaling in B cells and mediates hepatocyte growth factor-induced receptor ubiquitination. J. Immunol. Baltim. Md 1950 169, 3793–3800.

104

Tanaka, S., Neff, L., Baron, R., and Levy, J.B. (1995). Tyrosine phosphorylation and translocation of the c-cbl protein after activation of tyrosine kinase signaling pathways. J. Biol. Chem. 270, 14347–14351.

Tang, H., Rompani, S.B., Atkins, J.B., Zhou, Y., Osterwalder, T., and Zhong, W. (2005). Numb proteins specify asymmetric cell fates via an endocytosis- and proteasome-independent pathway. Mol. Cell. Biol. 25, 2899–2909.

Thien, C.B.F., and Langdon, W.Y. (2001). Cbl: many adaptations to regulate protein tyrosine kinases. Nat Rev Mol Cell Biol 2, 294–307.

Thien, C.B.F., and Langdon, W.Y. (2005a). Negative regulation of PTK signalling by Cbl proteins. Growth Factors Chur Switz. 23, 161–167.

Thien, C.B.F., and Langdon, W.Y. (2005b). c-Cbl and Cbl-b ubiquitin ligases: substrate diversity and the negative regulation of signalling responses. Biochem. J. 391, 153–166.

Toba, G., Ohsako, T., Miyata, N., Ohtsuka, T., Seong, K.H., and Aigaki, T. (1999). The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151, 725–737.

Tomar, N., and De, R.K. (2013). A model of an integrated immune system pathway in Homo sapiens and its interaction with superantigen producing expression regulatory pathway in Staphylococcus aureus: comparing behavior of pathogen perturbed and unperturbed pathway. PloS One 8, e80918.

Tomlinson, A. (1985). The cellular dynamics of pattern formation in the eye of Drosophila. J. Embryol. Exp. Morphol. 89, 313–331.

Tsygankov, A.Y., Mahajan, S., Fincke, J.E., and Bolen, J.B. (1996). Specific association of tyrosine-phosphorylated c-Cbl with Fyn tyrosine kinase in T cells. J. Biol. Chem. 271, 27130–27137.

Tsygankov, A.Y., Teckchandani, A.M., Feshchenko, E.A., and Swaminathan, G. (2001). Beyond the RING: CBL proteins as multivalent adapters. Oncogene 20, 6382– 6402.

Uemura, T., Shepherd, S., Ackerman, L., Jan, L.Y., and Jan, Y.N. (1989). numb, a gene required in determination of cell fate during sensory organ formation in Drosophila embryos. Cell 58, 349–360.

Valiya Veettil, M., Sadagopan, S., Kerur, N., Chakraborty, S., and Chandran, B. (2010). Interaction of c-Cbl with Myosin IIA Regulates Bleb Associated Macropinocytosis of Kaposi’s Sarcoma-Associated Herpesvirus. PLoS Pathog. 6, e1001238.

Vantler, M., Huntgeburth, M., Caglayan, E., Ten Freyhaus, H., Schnabel, P., and Rosenkranz, S. (2006). PI3-kinase/Akt-dependent antiapoptotic signaling by the PDGF alpha receptor is negatively regulated by Src family kinases. FEBS Lett. 580, 6769– 6776.

105

Vinayagam, A., Kulkarni, M.M., Sopko, R., Sun, X., Hu, Y., Nand, A., Villalta, C., Moghimi, A., Yang, X., Mohr, S.E., et al. (2016). An Integrative Analysis of the InR/PI3K/Akt Network Identifies the Dynamic Response to Insulin Signaling. Cell Rep. 16, 3062–3074.

Visser, G.D., and Lill, N.L. (2005). The Cbl RING finger C-terminal flank controls epidermal growth factor receptor fate downstream of receptor ubiquitination. Exp. Cell Res. 311, 281–293.

Vissers, J.H.A., Manning, S.A., Kulkarni, A., and Harvey, K.F. (2016). A Drosophila RNAi library modulates Hippo pathway-dependent tissue growth. Nat. Commun. 7, 10368.

Voas, M.G., and Rebay, I. (2004). Signal integration during development: insights from the Drosophila eye. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 229, 162–175.

Wang, H., Somers, G.W., Bashirullah, A., Heberlein, U., Yu, F., and Chia, W. (2006). Aurora-A acts as a tumor suppressor and regulates self-renewal of Drosophila neuroblasts. Genes Dev. 20, 3453–3463.

Wang, Y., Werz, C., Xu, D., Chen, Z., Li, Y., Hafen, E., and Bergmann, A. (2008). Drosophila cbl Is Essential for Control of Cell Death and Cell Differentiation during Eye Development. PLoS ONE 3, e1447.

Wang, Y., Chen, Z., and Bergmann, A. (2010). Regulation of EGFR and Notch signaling by distinct isoforms of D-cbl during Drosophila development. Dev. Biol. 342, 1–10.

Watanabe, Y., Sasahara, Y., Ramesh, N., Massaad, M.J., Yeng Looi, C., Kumaki, S., Kure, S., Geha, R.S., and Tsuchiya, S. (2013). T-cell receptor ligation causes Wiskott- Aldrich syndrome protein degradation and F-actin assembly downregulation. J. Allergy Clin. Immunol. 132, 648-655.e1.

Weber, A.L., Khan, G.F., Magwire, M.M., Tabor, C.L., Mackay, T.F.C., and Anholt, R.R.H. (2012). Genome-wide association analysis of oxidative stress resistance in Drosophila melanogaster. PloS One 7, e34745.

Wen, K., Yang, L., Xiong, T., Di, C., Ma, D., Wu, M., Xue, Z., Zhang, X., Long, L., Zhang, W., et al. (2016). Critical roles of long noncoding RNAs in Drosophila spermatogenesis. Genome Res. 26, 1233–1244.

Winther, Å.M.E., Vorontsova, O., Rees, K.A., Näreoja, T., Sopova, E., Jiao, W., and Shupliakov, O. (2015). An Endocytic Scaffolding Protein together with Synapsin Regulates Synaptic Vesicle Clustering in the Drosophila Neuromuscular Junction. J. Neurosci. Off. J. Soc. Neurosci. 35, 14756–14770.

Wirtz-Peitz, F., Nishimura, T., and Knoblich, J.A. (2008). Linking cell cycle to asymmetric division: Aurora-A phosphorylates the Par complex to regulate Numb localization. Cell 135, 161–173.

106

Wu, W.J., Tu, S., and Cerione, R.A. (2003a). Activated Cdc42 sequesters c-Cbl and prevents EGF receptor degradation. Cell 114, 715–725.

Wu, Y., Chen, Z., and Ullrich, A. (2003b). EGFR and FGFR signaling through FRS2 is subject to negative feedback control by ERK1/2. Biol. Chem. 384, 1215–1226.

Yoon, C.H., Lee, J., Jongeward, G.D., and Sternberg, P.W. (1995). Similarity of sli-1, a regulator of vulval development in C. elegans, to the mammalian proto-oncogene c-cbl. Science 269, 1102–1105.

Young, R.S., Marques, A.C., Tibbit, C., Haerty, W., Bassett, A.R., Liu, J.-L., and Ponting, C.P. (2012). Identification and properties of 1,119 candidate lincRNA loci in the Drosophila melanogaster genome. Genome Biol. Evol. 4, 427–442.

WikiPathways - WikiPathways.

107

Appendix 1: The pOT2 vector. LD42903 (the pOT2 vector containing Akap200) was obtained from The Berkeley Drosophila Genome Project (Lin et al., 2007) and was used as the source of Akap200 DNA for in situ hybridisation. Taken from http://www.bdgp.org/about/methods/pOT2vector.html. GMR-GAL4 , GMR-GAL4 ; GMR-GAL4 GS2208 Akap200 RNAi 3 a b c

d e f N - UAS

Appendix 2: Notch misexpression is enhanced by GS2208 and suppressed by Akap200RNAi Scanning electron micrographs of female adult flies taken at 450x. These flies are the offspring of the females with the genotype in horizontal text, and males in vertical text. The genotypes of the offspring are listed below with their corresponding letter identifier. The images are oriented so that the posterior side of the eye is on the left. Notch misexpression causes an extremely rough eye, when Akap200 is misexpressed the eye is even rougher, and when Akap200 isFknocked down, the Notch phenotype is somewhat suppressed. (a) GMR-GAL4/+, (b) GMR-GAL4,GS2208/+, (c) GMR-GAL4/+ ; Akap200 RNAi 3/+, (d) GMR-GAL4/UAS-N, (e) GMR-GAL4, GS2208, UAS-N/+, (f) GMR-GAL4/UAS-N ;Akap200 RNAi 3/+.

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Sannang, Rowena Tenri

Title: Suppressors of oncogenic Cbl in the Drosophila eye.

Date: 2018

Persistent Link: http://hdl.handle.net/11343/218164

File Description: Complete Thesis

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.