USOO8664364B2

(12) United States Patent (10) Patent No.: US 8,664,364 B2 Schmidt et al. (45) Date of Patent: Mar. 4, 2014

(54) OPTICAL BIOSENSORS 7,741,128 B2 6, 2010 Su 7,939,313 B2 5/2011 Heyduket al. (75) Inventors: Brigitte F. Schmidt, Pittsburgh, PA 2004/0058881 A1 3/2004 Humphreys et al. (US); Christopher S. Szent-Gyorgyi, 2005, OO64512 A1 3/2005 Schirner et al.

2005/0214810 A1* 9/2005 Dallwig et al...... 435/6 Pittsburgh, PA (US); Alan S. Waggoner, 2005/0215770 A1* 9, 2005 Bell et al...... 30,388.22 Pittsburgh, PA (US); Peter B. Berget, 2006, OO19408 A1 1/2006 Waggoner et al. Glenshaw, PA (US); Marcel P. Bruchez, 2010, 004.1087 A1 2/2010 Wang et al. Pittsburgh, PA (US); Jonathan W. Jarvik, Pittsburgh, PA (US) FOREIGN PATENT DOCUMENTS CN 1766.623 A 5, 2006 (73) Assignee: Carnegie Mellon University, Pittsburgh, EP 1132397 A1 9, 2001 PA (US) JP O9-297135 * 11/1997 JP O9-297135 A 11, 1997 (*) Notice: Subject to any disclaimer, the term of this WO WO 2004-025268 A2 3, 2004 patent is extended or adjusted under 35 U.S.C. 154(b) by 127 days. OTHER PUBLICATIONS International Preliminary Report on Patentability issued for PCT/ (21) Appl. No.: 12/524,328 US2008/051962 on Jul. 28, 2009.* Farinas et al., “Receptor-mediated Targeting of Fluorescent Probes in (22) PCT Fled: Jan. 24, 2008 Living Cells.” The Journal of Biological Chemistry, vol. 274, No. 12, Issue of Mar. 19, pp. 7603-7606, 1999. (86) PCT NO.: PCT/US2O08/051962 Simeonov, et al., "Blue-Fluorescent Antibodies. Science, vol. 290, S371 (c)(1), pp. 307-313 (Oct. 13, 2000). (2), (4) Date: Feb. 3, 2010 Szent-Gyorgyi, et al., “Fluorogen-activating single-chain antibodies for imaging cell Surface proteins.” Nature Biotechnology, vol. 26, No. (87) PCT Pub. No.: WO2O08/092O41 2, pp. 235-240 (Feb. 2008). Valyukh I.V. et al., “Spectroscopic study of the fluorescent dyes PCT Pub. Date: Jul. 31, 2008 interaction with DNA.” Functional Materials, vol. 10, No. 3, pp. 528-533 (2003). (65) Prior Publication Data Yoo, et al., “Antibody-ligand interactions studied by fluorescence enhancement methods—I. Properties of the ligands US 2011 FO159519 A1 Jun. 30, 2011 4-anilinonaphthalene-1-sulfonate and 6-anilinonaphthalene-2- Sulfonate.” Immunochemistry, Pergamon Press 1970, vol. 7, pp. 627 Related U.S. Application Data 636. Armentano et al., “Expression of human factor IX in rabbit (60) Provisional application No. 61/013,098, filed on Dec. hepatocytes by retrovirus-mediated gene transfer: Potential for gene 12, 2007, provisional application No. 60/897,120, therapy of hemophilia B.” Proc. Natl. Acad. Sci. USA, vol. 87:6141 filed on Jan. 24, 2007. 6145 (1990). Ben-Bassat et al., “Processing of the Initiation Methionine from (51) Int. C. Proteins: Properties of the Escherichia coli Methionine GOIN33/50 (2006.01) Aminopeptidase and Its Gene Structure.” J. Bacteriol. vol. 169:751 GOIN33/53 (2006.01) 757 (1987). C07K I6/44 (2006.01) Haj-Ahmad and Graham, “Development of a Helper-Independent C09B 23/00 (2006.01) Human Adenovirus Vector and Its Use in the Transfer of the Herpes (52) U.S. C. Simplex Virus Thymidine Kinase Gene.” Journal of Virology, vol. 57:267-274 (1986). USPC ...... 530/387.3; 530/391.3; 435/7.1 Boder et al., “Directed evolution of antibody fragments with (58) Field of Classification Search monovalent femtomolar antigen-binding affinity.” Proc. Natl. Acad. None Sci USA. vol. 97: 10701-5 (2000). See application file for complete search history. (Continued) (56) References Cited Primary Examiner — Shafiqul Haq U.S. PATENT DOCUMENTS Assistant Examiner — Galina Yakovleva 4,222,744 A 9, 1980 McConnell (74) Attorney, Agent, or Firm — K&L Gates LLP 5,268.486 A 12/1993 Waggoner et al. 5,486,616 A 1/1996 Waggoner et al. (57) ABSTRACT 5,569,587 A 10/1996 Waggoner 5,569,766 A 10/1996 Waggoner et al. Provided are biosensors, compositions comprising biosen 5,597.696 A * 1/1997 Linn et al...... 435/6.12 sors, and methods of using biosensors in living cells and 5,616,502 A 4, 1997 Haugland et al. organisms. The biosensors are able to be selectively targeted 5,627,027 A 5/1997 Waggoner to certain regions or structures within a cell. The biosensors 6,008,373 A 12/1999 Waggoner et al. may provide a signal when the biosensor is targeted and/or in 6,048,982 A 4/2000 Waggoner 6,225,050 B1 5/2001 Waggoner response to a property of the cell or organism Such as mem 6,437,099 B1 8, 2002 Jibu brane potential, ion concentration or enzyme activity. 6,673,943 B2 1/2004 Waggoner et al. 6,716,994 B1 4/2004 Menchen et al. 26 Claims, 28 Drawing Sheets US 8,664,364 B2 Page 2

(56) References Cited McLaughlin et al., “Adeno-Asqociated Virus General Transduction Vectors: Analysis of Proviral Structures.”.J. Virol., vol. 62: 1963-1973 OTHER PUBLICATIONS (1988). Bujarski, J.J. and P. Kaesberg, “DNA inserted two bases down from Miller et al., “N-terminal methionine-specific peptidase in Salmo the initiation site of a SP6 polymerase transcription vector is tran nella typhimurium," Proc. Natl. Acad. Sci. USA, vol. 84:2718-2722 (1987). scribed efficiently in vitro.” Nucleic Acids Research, vol. 15: 1337 Miller, A.D., “Progress Toward Human Gene Therapy,” Blood, The (1987). Journal of the American Society of Hematology, vol. 76:271-278 Chao, G. et al., “Isolating and engineering human antibodies using (1990). yeast surface display.” Nat. Protocols, vol. 1, 755-768 (2006). Motulsky, H., “The GraphPad Guide to Analyzing Radioligand Bind Cheng, X. et al., “The structure of bacteriophage T7 lysozyme ing Data.” GraphPad Software, Inc., pp. 1-19 (1996). amidase and an inhibitor of T7 RNA polymerase.” Proc. Natl. Acad. Mujumdar, R.B., L. A. Ernst, S. R. Mujumdar, C. J. Lewis, A. S. Sci. USA, vol. 91:4034-4038 (1994). Waggoner, 'Cyanine Dye Labeling Reagents: Sulfoindocyanine Cristiano et al., “Hepatic gene therapy: Adenovirus enhancement of Succinimidyl Esters.” Bioconjug. Chem. vol. 4, 105-111 (Mar.-Apr. receptor-mediated gene delivery and expression in primary 1993). hepatocytes.” Proc. Natl. Acad. Sci. USA, vol.90:2122-2126 (1993). Neda et al., “Chemical Modification of an Ecotropic Murine Leuke Colby, D.W. et al., “Development of a Human Light Chain Variable miaVirus Results in Redirective of Its Target Cell Specificity.”J Biol Domain (VL) Intracellular Antibody Specific for the Amino Termi Chem., vol. 266:14143-14146 (1991). nus of Huntingtin via Yeast Surface Display.” J. Mol. Biol., vol. 342, Pack et al., “Tetravalent Miniantibodies with High Avidity Assem 901-912 (Sep. 17, 2004). bling in Escherichia coli,” J Mol Biol., vol. 246(1):28-34 (1995). Dai et al., “Gene therapy via primary myoblasts: Long-term expres Quantin et al., “Adenovirus as an expression vector in muscle cells in sion of factor IX protein following transplantation in vitro.” Proc. vivo..” Proc. Natl. Acad. Sci. USA, vol. 89:2581-2584 (1992). Natl. Acad. Sci. USA, vol. 89:10892-10895 (1992). Roux et al., “A versatile and potentially general approach to the Danos and Mulligan, “Safe and efficient generation of recombinant targeting of specific cell types by retroviruses: Application to the retroviruses with amphotropic and ecotropic host ranges.” Proc. Natl. infection of human cells by means of major histocompatibility com plex class I and class II antigens by mouse ecotropic murine leukemia Acad. Sci. USA, vol. 85:6460-6464 (1988). virus-derived viruses.” Proc. Natl. Acad. Sci. USA, vol. 86:9079 DeLorenzo, V. et al., “Operator Sequences of the Aerobactin Operon 9083 (1989). of Plasmid ColV-K30 Binding the Ferric Uptake Regulation (fur) Sagawa, H. et al., “A tightly regulated expression system in Repressor.” Journal of Bacteriology, vol. 169:2624-2630 (1987). Escherichia coli with SP6 RNA polymerase.” Gene, vol. 168:37-41 Ferry et al., “Retroviral-mediated gene transfer into hepatocytes in (1996). vitro.” Proc. Natl. Acad. Sci. USA, vol. 88:8377-8381 (1991). Sakata, et al., “Optical Switching of dipolar interactions on proteins.” Flotte et al., “Expression of the Cystic Fibrosis Transmembrane Proc. Natl. Acad. Sci. USA vol. 102(13):4759-4764 (2005). Conductance Regulator from a Novel Adeno-associated Virus Pro Samulski et al., "Helper-Free Stocks of Recombinant Adeno-Asso moter.” J. Biol. Chem., vol.268:3781-3790 (1993). ciated Viruses: Normal Integration Does Not Require Viral Gene Giudicelli, V. et al., “IMGT/LIGM-DB, the IMGTR) comprehensive Expression.” J. Virol., vol. 63:3822-3828 (1989). database of immunoglobulin and T cell receptor nucleotide Simeonov et al., "Blue-Flourescent Antibodies.” Science, vol. 290, sequences.” Nucleic Acids Res. vol. 34, D781-D784 (Jan. 1, 2006). 307-313 (Oct. 13, 2000). Goldberg, M.B. et al., “Transcriptional Regulation by Iron of a Vibrio Sims, P.J. A. S. Waggoner, C. H. Wang, J. F. Hoffman, “Studies on cholerae Virulence Gene and Homology of the Gene to the the Mechanism by Which Cyanine Dyes Measure Membrane Poten Escherichia coli Fur System.” Journal of Bacteriology, vol. tial in Red Blood Cells and Phosphatidylcholine Vesicles.” Biochem 172:6863-6870 (1990). istry vol. 13, 3315-3330 (Jul 30, 1974). Gregorevic, et al., “Systemic delivery of genes to striated muscles Skerra, “Engineered protein scaffolds for molecular recognition.” J. Mol. Recognition vol. 13:167-187 (2000). using adeno-associated viral vectors.” Nat Med. Author Manuscript Smith et al., “Molecular Engineering of the Autographa californica (16 pages); published in final form as Nat Med. (Aug. 2004; vol. Nuclear Polyhedrosis Virus Genome: Deletion Mutations Within the 10(8):828-34. Epub Jul. 25, 2004). Polyhedrin Gene.” J. Virol., vol. 46:584-593 (1983). Gurley et al., “Upstream Sequences Required for Efficient Expres Swers et al., "Shuffled antibody libraries created by in vivo homolo sion of a Soybean Heat Shock Gene.” Mol. Cell. Biol., vol. 6:559-565 gous recombination and yeast Surface display. Nucl. Acids. Res. (1986). 32(3):e36, 8 pages (2004). Hermonat et al., “Use of adeno-associated virus as a mammalian Tacal, O., L. Ozer, "Adduct-Forming Tendencies of Cationic DNA cloning vector: Transduction of neomycin resistance into mam Triarylmethane Dyes with Proteins: Metabolic and Toxicological malian tissue culture cells.” Proc. Natl. Acad. Sci. USA, vol. 81:6466 Implications.” J. Biochem. Mol. Toxicol. vol. 18, 253-256 (2004). 6470 (1984). Takamatsu et al., “Expression of bacterial chloramphenicol Herz and Gerard . “Adenovirus-mediated transfer of low density acetyltransferase gene in tobacco plants mediated by TMV-RNA.” lipoprotein receptor gene actutely accelerates cholesterol clearance The EMBOJournal, vol. 6(2):307-311 (1987). in normal mice.” Proc. Natl. Acad. Sci. USA, vol. 90:2812-2816 Tanaka, T., M. N. Lobato, T. H. Rabbitts, “Single Domain Intracel (1993). lular Antibodies: A Minimal Fragment for Direct InVivo Selection of Huber et al., “Retroviral-mediated gene therapy for the treatment of Antigen-specific Intrabodies,” J. Mol. Biol., vol. 331, 1109-1120 hepatocellular carcinoma: An innovative approach for cancer (Aug. 29, 2003). therapy.” Proc. Natl. Acad. Sci. USA, vol. 88:8039-8043 (1991). Tratschin et al., “Genetic Analysis of Adeno-Associated Virus: Prop Invitrogen Corporation, Chapter 7. “Theory of Binding Data Analy erties of Deletion Mutants Constructed In Vitro and Evidence for an sis, Fluorescence Polarization Technical Resource Guide.” Fourth Adeno-Associated Virus Replication Function.” J. Virol., vol. Edition, pp. 1-18 (2006). 51:611-619 (1984). Jadhav, J.P. S. P. Govindwar, “Biotransformation of malachite green Tratschin et al., “A Human Parvovirus, Adeno-Associated Virus, as a by Saccharomyces cerevisiae MTCC 463.” Yeast, vol. 23, 315-323 Eucaryotic Vector: Transient Expression and Encapsidation of the (Mar. 2006). Procaryotic Gene for Chloramphenicol Acetyltransferase.” Mol. Lemarchand et al., “Adenovirus-mediated transfer of a recombinant Cell. Biol., vol. 4:2072-2081 (1984). human O. 1-antitrypsin cDNA to human endothelial cells.” Proc. Natl. Tratschinet al., “Adeno-Associated Virus Vector for High-Frequency Acad. Sci. USA, vol. 89:6482-6486 (1992). Integration, Expression, and Rescue of Genes in Mammalian Cells.” Marks, K.M., M. Rosinov, G. P. Nolan, “In Vivo Targeting of Organic Mol. Cell. Biol., vol. 5:3251-3260 (1985). Calcium Sensors via Genetically Selected Peptides.” Chem Biol., vol. Tsien, R.Y., “Building and breeding molecules to spy on cells and 11, 347-356 (Mar. 2004). tumors.” FEBS Lett. vol. 579,927-932 (Feb. 7, 2005). US 8,664,364 B2 Page 3

(56) References Cited Brown, S.D., et al., The promoter for the procyclic acidic repetitive protein (PARP) genes of Trypanosoma bruceii shares features with OTHER PUBLICATIONS RNA polymerase I promoters, Mol. Cell. Biol., vol. 12, No. 6 (1992). Carrero, Jenny and Edward W. Voss, Jr., “Temperature and pH van BeuSechem et al., "Long-term expression of human adenosine Dependence of Fluorescein Binding within the Monoclonal Anti deaminase in rhesus monkeys transplanted with retrovirus-infected body 9-40 Active Site as Monitored by Hydrostatic Pressure.” The bone-marrow cells. Proc. Natl. Acad. Sci. USA, vol. 89:7640-7644 Journal of Biological Chemistry, vol. 271, No. 10, pp. 5332-5337 (1992). (1996). Wagner et al., “Influenza virus hemagglutinin HA-2 N-terminal Cepko, Constance and Warren Pear, “Detection of Helper Virus in fusogenic peptides augment gene transfer by transferrin-polylysine Retrovirus Stocks.” Current Protocols in Molecular Biology, unit DNA complexes: Toward a synthetic virus-like gene-transfer 9. 13.1-9.13.6 (1996). vehicle.” Proc. Natl. Acad. Sci. USA, vol. 89:7934-7938 (1992). Cepko, Constance and Warren Pear, "Retrovirus Infection of Cells In Wilson et al., “Retrovirus-mediated transduction of adult Vitro and In Vivo.” Current Protocols in Molecular Biology, unit hepatocytes.” Proc. Natl. Acad. Sci. USA, vol. 85:3014-3018 (1988). 9.14.1-9. 14.6 (1996). Yeast Display sclv Antibody Library User's Manual (Pacific North Cepko, Constance and Warren Pear, “Transduction of Genes Using west National Laboratory, Richland, WA99352), pp. 1-44 (2003). Retrovirus Vectors.” Current Protocols in Molecular Biology, unit Portmann et al., “Anti-Fluorescein Antibody of High Affinity and 9.9.1-99.16 (2000). Restricted Heterogeneity as Characterized by Fluorescence Polariza Chamberlain, Chester and Klaus M. Hahn, “Watching Proteins in the tion and Quenching Equilibrium Techniques'. Biochemical and Bio Wild: Fluorescence Methods to Study Protein Dynamics in Living physical Research Communications, received Feb. 24, 1971, vol.43, Cells.” Traffic, vol. 1, pp. 755-762 (2000). No. 1, pp. 207-212. Chen, Gang, et al., “Isolation of high-affinity ligand-binding proteins Iwaki et al., “Antibodies for Fluorescent Molecular Rotors'. Bio by periplasmic expression with cytometric screening (PECS).” chemistry, 1993, 32, pp. 7589-7592. Nature Biotechnoloy, vol. 19, pp. 537-542 (2001). Bird et al., “Single-Chain Antigen-Binding Proteins', downloaded Chowdhury, J. Roy, et al., “Long-Term Improvement of from Science Magazine on Jul. 21, 2012, Oct. 21, 1988, vol. 242, pp. Hypercholesterolemia. After ex Vivo Gene Therapy in LDLR-Defi 423-426. Huston et al., “Protein Engineering of Antibody Binding Sites: cient Rabbits.” Science, vol. 254, pp. 1802-1805 (1991). Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Colby, David W., et al., “Engineering Antibody Affinity by Yeast Analogue Produced in Escherichia coli, Biochemistry, Proc. Natl. Surface Display.” Devices, Antibodies, and Vaccines, vol. 18, pp. Acad. Sci., USA, Aug. 1998, vol. 85, pp. 5879-5883. 348-358 (2004). Adams, Stephen R., et al., “New Biarsentical Ligands and Coloma, M. Josefina and Sherie L. Morrison, “Design and produc Tetracysteine Motifs for Protein Labeling in Vitro and in Vivo: Syn tion of novel tetravalent bispecific antibodies.” Nature Biotechnol thesis and Biological Applications.”.J. Am. Chem. Soc., vol. 124, pp. ogy, vol. 15, pp. 159-163 (1997). 6063-6076 (2002). Coruzzi, Gloria, et al., “Tissue-specific and light-regulated expres Babendure, Jeremy R. et al., "Aptamers Switch on Fluorescence of sion of a pea nuclear gene encoding the Small subunit of ribulose Triphenylmethane Dyes,” J. Am. Chem... vol. 125, pp. 14716-14717 1.5-biphosphate carboxylase.” The EMBOJournal, vol. 3, No. 8, pp. (2003). 1671-1679 (1984). Balint, Robert F. And James W. Larrick, "Antibody engineering by Culp, Sandra J., et al., “Toxicity and metabolism of malachite green parsimonious mutagenesis.” Gene, vol. 137, pp. 109-118 (1993). and leucomalachite green during short-term feeding to Fischer 344 Bark, Steven J. and Klaus M. Hahn, “Fluorescent Indicators of rats and B6C3F mice.” Chemico-Biological Interactions, vol. 122, Peptide Cleavage in the Trafficking Compartments of Living Cells: pp. 153-170 (1989). Peptides Site-Specifically Labeled with Two Dyes.” Methods, vol. Cunningham, Brian C. and James A. Wells, “High-Resolution 20, pp. 429-435 (2000). Epitope Mapping of hCGH-Receptor Interactions by Alanine-Scan Barker, Susan L. R. et al., “Cellular Applications of a Sensitive and ning Mutagenesis.” Science, vol. 244, pp. 1081-1085 (1989). Selective Fiber-Optic Nitric Oxide Biosensor Based on a Dye-La Cirten, Beate, et al., “Synthesis, Photophysical, Photochemical and beled Heme Domain of Soluble Guanylate Cyclase.” Anal. Chem. Biological Properties of Caged GABA, 42H-1-Benzopyran-2-one vol. 71, No. 9, pp. 2071-2075 (1999). 7amino-4-methoxy) carbonyl amino Butanoic Acid.” Photochem Barker, Susan L. R., et al., “Rationetric and Fluorescence-Lifetime istry and Photobiology, vol. 81, pp. 641-648 (2005). Based Biosensors Incorporating Cytochrome c and the Detection of Cwirla, Steven E., et al., “Peptides on Phage: A vast library of Extra- and Intracellular Macrophage Nitric Oxide.” Anal. Chem... vol. peptides for identifying ligands.” Proc. Natl. Acad. Sci., vol. 87, pp. 71 pp. 1767-1172 (1999). 6378-6382 (1990). Benhar, Itali. “Biotechnological applications of phage and cell dis Derossi, Daniele, et al., “Call Internalization of the Third Helix of the play,” Biotechnology Advances, vol. 19, pp. 1-33 (2001). Antennapedia Homeodomain Is Receptor-independent.” The Journal Berkner, Kathleen L., “Development of Adenovirus Vectors for the of Biological Chemistry, vol. 271, No. 30, pp. 18188-18193 (1996). Expression of Heterologous Genes.” BioTechniques, vol. 6, No.7, pp. Derossi, Daniele, et al., “The Third Helix of the Antennapedia 616-629 (1988). Homeodomain Translocates through Biological Membranes.” The Binz, H. Kaspar, et al., Engineering novel binding proteins from Journal of Biological Chemistry, vol. 269, No. 14, pp. 10444-10450 nonimmunoglobulin domains, Nature Biotechnology, vol. 23, No. (1994). 10, pp. 1257-1268 (2005). Devlin, James J., et al., “Ransom Peptide Libraries: A Source of Boder, Eric T. and K. Dane Wittrup, Optimal Screening of Surface Specific Protein Binding Molecules.” Science, vol. 249, pp. 404–406 Displayed Polypeptide Libraries, Biotechnol. Prog., vol. 14, pp. (1990). 55-62 (1998). Dooley, Colette T., et al., “Imaging Dynamic Redox Changes in Boder, Eric T. and K. Dane Wittrup, "Yeast Surface Display for Mammalian Cells with Green Fluorescent Protein Indicators.” The Directed Evolution of Protein Expression, Affinity, and Stability.” Journal of Biological Chemistry, vol. 279, No. 21, pp. 22284-22293 Methods in Enzymology, vol. 328, pp. 430-444 (2000). (2004). Bradbury, Andrew, “Selecting by microdialysis.” Nature Biotechnol Dubendorff, John W., and F. William Studier, “Controlling Basal ogy, vol. 10, pp. 528-529 (2001). Expression in an Inducible T7 Expression System by Blocking the Brisson, N., et al. "Expression of bacterial gene in plants by using a Target T7 Promoter with Iac Repressor.” J. Miol. Biol., vol. 219, pp. viral vector.” Nature, vol. 310 pp. 511-5.14 (1984). 45-59 (1991). Broach, James R., et al. “Vectors for High-Level, Inducible Expres Duckert, Peter, et al., “Prediction of preprotein convertase cleavage sion of Cloned Genes in Yeast.” Experimental Manipulation of Gene sites.” Protein Engineering, Design & Selection, vol. 17, No. 1, pp. Expression, pp. 83-117 (1983). 107-112 (2004). US 8,664,364 B2 Page 4

(56) References Cited Inouye, Sumiko and Masayori Inouye, "Up-promoter mutations in the lipp gene of Escherichia coli," Nucleic Acids Research, vol. 13, OTHER PUBLICATIONS No. 9 (1985). Itakura, Keiichi, et al., Expression in Escherichia coli of a Chemi Duxbury, Debra Faye, “The Photochemistry and Photophysics of cally Synthesized Gene for the Hormone Somatostatin, Science, vol. Triphenylmethane Dyes in Solid and Liquid Media.” Chem Rev., vol. 198, pp. 1056-1063 (1977). 93, pp. 381-433 (1993). Itakura, Keiichi, et al., “Synthesis and Use of Synthetic Feldhaus, Michael J., et al., “Flow-cytometric isolation of human Oligonucleotides.” Ann. Rev. Biochem, vol. 53, pp. 323-356 (1984). antibodies from a nonimmune Saccharomyces cerevisae Surface dis Jones, Laurie J., et al., “Quenched BOPIDY Dye-Labeled Casein play library.” Nature Biotechnology, vol. 21, pp. 163-170 (2003). Substrates for the Assay of Protease Activity by Direct Fluorescence Flotte, Terence R. et al., “Gene Expression from Adeno-associated Measurement.” Analytical Biochemistry, vol. 251, pp. 144-152 Virus Vectors in Airway Epithelial Cells.” Am. J. Respir: Cell. Mol. (1997). Biol., vol. 7, pp. 349-356 (1992). Jones, Nicholas and Thomas Shenk, “Isolation of Adenovirus Type 5 Fürstenburg, Alexandra, et al., “Ultrafast Excited-State Dynamics of Host Range Deletion Mutants Defective for Transformation of Rat Embryo Cells”. Cell, vol. 17, pp. 683-689 (1979). DNA Fluorescent Intercalators: New Insight into the Fluorescence Jones, Peter T., et al., “Replacing the complementary-determining Enhancement Mechanism.” J. Am. Soc., vol. 128, pp. 7661-7669 regions in a human antibody with those from a mouse.” Nature, vol. (2006). 321, pp. 522-525 (1986). Giepmans, Ben N. G. et al., “The Flourescent Toolbox for Assessing Julan, Maryse Etienne, et al., The efficiency of cell targeting by Protein Location and Function.” Science, vol. 312, pp. 217-224 recombinant retroviruses depends on the nature of the receptor and (2006). the composition of the artificial cell-virus linker, vol. 73, pp. 3251 Goud, Bruno, et al., “Antibody-Mediated Binding of a Murine 3255 (1992). Ecotropic Moloney Retroviral Vector to Human Cells Allows Inter Kay, Mark A. et al., “Hepatic Gene Therapy: Persistent Expression nalization But Not the Establishment of the Proviral State.” Virology, of Human O. 1-Antitrypsin in Mice after Direct Gene Delivery In vol. 163, pp. 251-254 (1988). Vivo.” Human Gene Therapy, vol. 3, pp. 641-647 (1992). Graham, Frank L. and Ludvik Prevec, “Manipulation of Adenovirus Kerppola, Tom K. “Complementary methods for studies of protein Vectors.” Methods in Molecular Biology, vol. 7, pp. 109-128 (1991). interactions in living cells.” Nature Methods, vol. 3, No. 12, pp. Green, Maurice and Paul M. Loewenstein, "Autonomous Functional 969-971 (2006). Domains of Chemically Synthesized Human Immunodeficiency Kubin, R.F. and A.N. Fletcher, “Fluorescence Quantum Yields of Virus Tat Trans-Activator Protein.” Cell, vol. 55, pp. 1179-1188 Some Rhodamine Dyes,” Journal of Luminescence, vol. 27, pp. 455 (1988). 462 (1982). Greener, Alan, et al., “An Efficient Random Mutagenesis Technique Kunkel, Maya T. etal. "Spatio-temporal Dynamics of Protein Kinase B/Akt Signaling Revealed by a Genetically Encoded Fluorescent Using an E.coli Mutator Strain.” Molecular Biotechnology, vol.7. pp. Reporter.” The Journal of Biological Chemistry, vol. 280, No. 7, pp. 189-195 (1997). 5581-5587 (2005). Grodberg, Jennifer, et al., “Alanine Scanning mutagenesis of human Lowman, Henry B., et al., “Selecting High-Affinity Binding Proteins erythropoietin identifies four amino acids which are critical for bio by Monovalent Phage Display,” Biochemistry, vol. 30, pp. 10832 logical activity.” Eur: J. Biochem... vol. 218, pp. 597-601 (1993). 10838 (1991). Gustin, Kurt, et al., “Characterization of the Role of Individual Pro Magde, Douglas and Maurice W. Windsor, “Ficosecond Internal tein Binding Motifs within the Hepatitis B Virus Enhancer I on X Conversion in Crystal Violet.” Chemical Physics Letters, vol. 24. No. Promoter Activity Using Linker Scanning Mutagenesis.” Virology, 1, pp. 144-148 (1974). vol. 193, pp. 653-660 (1993). Marks, James D., et al., “By-passing Immunization Human Antibod Hahn, Klaus M., et al., “A Calcium-sensitive Fluorescent Analog of ies from V-gene Libraries Displayed on Phage.” J. Mol. Biol., vol. Calmodulin Based on a Novel Calmodulin-binding Fluorophore.” 222, pp. 581-597 (1991). The Journal of Biological Chemistry, vol. 265, No. 33, pp. 20335 Martin, Brent R. et al., “Mammalian cell-based optimization of the 20345 (1990). biarsentical-binding tetracysteine motif for improved fluorescence Headley, V., et al., “Expression of aerobactin genes by Shigella and affinity.” Nature Biotechnology, pp. 1-7 (2005). flexneri during extracellular and intracellular growth. Infection and Maynard, Jennifer, et al., “High-level bacterial secretion of single Immunity, vol. 65, No. 2, pp. 818-821 (1997). chain afl T-cell receptors,” Journal of Immunological Methods, vol. Hess, Samuel T., et al., “Fluorescence Photoconversion Kinetics in 306, pp. 51-67 (2005). Novel Green Fluorescent Protein pH Sensors (pHluorins).” J. Phys. Miesenböck, Gero, et al., “Visualizing secretion and synaptic trans Chem. B. vol. 108, pp. 10138-10148 (2004). mission with pH-sensitive green fluorescent proteins.” Nature, vo. Hochman, Jacob, et al., “An Active Antibody Fragment (Fv) Com 394, pp. 192-195 (1998). posed of the Variable Portions of Heavy and Light Chains.” Biochem Miller, Lawrence W. and Virginia W. Cornish, “Selective chemical istry, vol. 12, No. 6, pp. 1130-1135 (1973). labeling of proteins in living cells.” Current Opinion in Chemical Holt, Lucy J., et al. The use of recombinant antibodies in proteomics, Biology, vol. 9, pp. 56-61 (2005). Current Opinion in Biotechnolgy, vol. 11, pp. 445-449 (2000). Mizuno, Masaaki, et al., “Basic Research for Interferon Gene Hu, Wei-Gang, et al., “Humanization and mammalian expression of Therapy against Malignant Glioma. Neurol Surg., vol. 20, No. 5, pp. a murine monoclonal antibody against Venezuelan equine encepha 551-560 (1992). Abstract. litis virus.” Vaccine, vol. 25, pp. 3210-3214 (2007). Mizuno, Masaaki, et al., “Growth Inhibition of Glioma Cells by Hunt, M.D., “Promoter and operator determinants for fur-mediated Liposome-mediated Cell Transfection with Tumor Necrosis Fax iron regulation in the bidirectional fepA-fes control region of the tor-O. Gene.” Neurol Med Chir, vol. 32, pp. 873-876 (1992). Escherichia coli enterobactin gene system.” vol. 176, No. 13, pp. Mulligan, Richard C., “The Basic Science of Gene Therapy,” Sci 3944-3955 (1994). ence, vol. 260, pp. 926-932 (1993). Hwu, Patrick, et al., Functional and Molecular Characterization of Mujtaba, S., et al., “Structure and acetyl-lysine recognition of the Tumor-Infiltrating Lymphocytes Transduced with Tumor Necrosis bromodomain.” Oncogene, vol. 26, pp. 5521-5527 (2007). Factor-O.0 clDNA for the Gene Therapy of Cancer in Humans, vol. Muzyczka, N. “Use of Adeno-Associated Virus as a General 150, No. 9, pp. 4104-41 15 (1993). Transduction Vector for Mammalian Cells.” Current Topis in Ike, Yoshimasa, et al., “Solid phase synthesis of polynucleotides.” Microbiology and Immunology, vol. 158, pp. 97-129 (1992). Nucleic Acids Research, vol. 11, No. 2, pp. 477-488 (1983). Myers, Richard M., et al., “Fine Structure Genetic Analysis of a Iliades, Peter, et al., “Triabodies: single chain Fv fragments without B-Globin Promoter.” Science, vol. 232, pp. 613-618 (1986). a linker form trivalent trimers.” FEBS Letters, vol. 409, pp. 437-441 Nagashima, Mariko, et al., “Alanine-scanning Mutagenesis of the (1997). Epidermal Growth Factor-like Domains of Human Thrombomodulin US 8,664,364 B2 Page 5

(56) References Cited Schmitt, M.P. and S.M. Payne, “Genetic analysis of the enterobactin gene cluster in Shigella flexneri,’, Journal of Bacteriology, vol. 173, OTHER PUBLICATIONS No. 2, pp. 816-824 (1991). Scott, Jamie K. and George P. Smith, “Searching for Peptide Ligands Identifies Critical Residues for Its Cofactor Activity.” The Journal of with an Epitope Library.” Science, vol. 249, pp. 386-390. (1990). Biological Chemistry, vol. 268, No. 4, pp. 2888-2892 (1993). Sharon, Jacqueline and David Givol, "Preparation of Fv Fragment Narang, Saran A., “Tetrahedron Report No. 140 DNA Synthesis.” from the Mouse Myeloma XRPC-25 Immunoglobulin Possessing Tetrahedron, vol.39, No. 1, pp. 3-22 (1982). Anti-DinitrophenylActivity.” Biochemistry, vol. 15, No. 7, pp. 1591 Nygren, Jan, et al., “The Interactions Between the Fluorescent Dye Thiazole Orange and DNA.” Biopolymers, vol. 46, pp.39-51 (1998). 1594 (1976). Ochsner, U.A., et al. “Role of the ferric uptake regulator of Siegel, Robert W., et al., “High efficiency recovery and epitope Pseudomonas aeruginosa in the regulation of siderophores and specific sorting of an ScFv yeast display library,” Journal of Immu exotoxin A expression: purification and activity on iron-regulated nological Methods, vol. 286, pp. 141-153 (2004). promoters,” Journal of Bacteriology, vol. 177. No. 24, pp.7194-720.1 Silva, Gloria L., et al., “Experimental and Computational Investiga (1995). tion of Unsymmetrical Cyanine Dyes: Understanding Torsionally Patterson, George H. “Use of the Green Fluorescent Protein and Its Responsive Fluorogenic Dyes,” J. Am. Chem. Soc., vol. 129, pp. Mutants in Quantitative Fluorescence Microscopy,” Biophysical 5710-5718 (2007). Journal, vol. 73, pp. 2782-2790 (1997). Studier, F. William, et al., “Use of T7 RNA Polymerase to Direct Perez. F., et al., “Antennapedia homeobox as a signal for the cellular Expression of Cloned Genes.” Methods in Enzymology, vol. 185, pp. internalization and nuclear addressing of a small exogenous peptide.” 60-89, 1990. Journal of Cell Science, vol. 102, pp. 717-722 (1992). Sumner, James P. et al., “A fluorescent PEBBLE nanosensor for Pertz, Olivier and Klaus M. Hahn, “Designing biosensors for Rho intracellular free zinc.” The Analyst, vol. 127, pp. 11-16 (2002). family proteins—deciphering the dynamics of Rho family GTPase Svinarich, David M. and Sunil Palchaudhuri, "Regulation of the activation in living cells,” Journal of Cell Science, vol. 117, pp. SLT-1A Toxin Operon by a Ferric Uptake Regulatory Protein in 1313-1318 (2004). Toxinogenic Strains of Shigella dysenteria type 1.” Journal of Diar Pertz, Olivier, et al., “Spatiotemporal dynamics of RhoA activity in rhoeal Disease Research, vol. 10, pp. 139-145 (1992). migrating cells,” Journal of Cell Science, vol. 440, pp. 1069-1072 Tempest, Philip R. et al., “Reshaping A Human Monoclonal Anti (2006). Prince, R.W., et al., “Regulation of toxA and regA by the Escherichia body to Inhibit human respiratory Syncytial Virus Infection InVivo.” colifiur gene and identification of a Fur homologue in Pseudomonas Biotechnology, vol. 5, pp. 266-271 (1991). aeruginosa PA103 and PAOl.” Molecular Microbiology, vol. 5, pp. Tirat, Aline, et al., “Evaluation of two novel tag-based labeling tech 2823-2831 (1991). nologies for site-specific modification of proteins.” Int. J. Biol. Post, Penny L., et al., “A Genetically Engineered, Protein-based Macromol., vol.39, pp. 66-76 (2006). Optical Biosensor of Myosin II Regulatory Light Chain Viac, J., et al., An Immunoelectron Microscopic Localization of Wart Phosphorylation.” The Journal of Biological Chemistry, vol.269, No. Associated Antigens Present in Human Papilloma Virus (HPV) 17, pp. 12880-12887 (1994). Infected Cells, The Journal of Investigative Dermatology, vol. 70, Post, Penny L., et al., “A Fluorescent Protein Biosensor of Myosin II No. 5, pp. 263-266 (1978). Regulatory Light Chain Phosphorylation Reports a Gradient of Wang, Su and Steven B. Vik, "Single Amino Acid Insertions Probe Phosphorylated Myosin II in Migrating Cells.” Molecular Biology of the a Subunit of the Escherichia coli FF-ATP Synthase.” The Jour the Cell, vol. 6, pp. 1755-1768 (1995). nal of Biological Chemistry, vol. 269, No. 4, pp. 3095-3099 (1993). Ramjiawan, Bram, et al., “Noninvasive Localization of Tumors by Wagner, Peter, et. al., "Covalent Immobilization of Native Immunofluorescence Imaging Using a Single Chain Fv Fragment of Biomolecules onto Au(111) via N-Hydroxysuccinimide Ester a Human Monoclonal Antibody with Broad Cancer Specificity.” Functionalized Self-Assembled Monolayers for Scanning Probe Cancer, vol. 89, No. 5, pp. 1134-1344 (2000). Microscopy,” Biophysical Journal, vol. 70, pp. 2052-2066 (1996). Roberts, Bruce L, et al., “Directed evolution of a protein: Selection of Ward, E. Sally, et al., “Binding activities of a repertoire of single potent neutrophil elastase inhibitors displayed on M13 fusion phage.” immunoglobulin variable domains secreted from Escherichia coli,” Proc. Natl. Acad. Sci., vol. 89, pp. 2429-2433 (1992). Nature, vol. 341, pp. 544-546 (1989). Rosenfeld, Melissa A., et al., “Adenovirus-Mediated Transfer of a Wiseman, Paul W., et al., “Spatial mapping of integrin interactions Recombinant Ol-Antitrypsin Gene to the Lung Epithelium in Vivo.” and dynamics during cell migration by Image Correlation Micros Science, vol. 252, pp. 431-434 (1991). copy,” Journal of Cell Science, vol. 117, pp. 5521-5534 (2004). Rosenfeld, Melissa A. et al., “In Vivo Transfer of the Human Cystic Yao, Jie, etal. "Dynamics of heat shock factor association with native Fibrosis Transmembrane Conductance Regulator Gene to the Airway gene loci in living cells.” Nature, vol. 442, pp. 1050-1053 (2006). Epithelium.” Cell, vol. 68, pp. 143-155 (1992). Zhang, Jin, et al., “Genetically encoded reporters of protein kinase A Ruf, Wolfram, et al., “Mutational Mapping of Functional Residues in activity reveal impact of substrate tethering.” PNAS, vol. 98, No. 25. Tissue Factor: Identification of Factor VII Recognition Determinants pp. 14997-15002 (2001). in Both Structural Modules of the Predicted Cytokine Receptor Homology Domain.” Biochemistry, vol. 33, pp. 1565-1572 (1993). * cited by examiner U.S. Patent Mar. 4, 2014 Sheet 1 of 28 US 8,664,364 B2

FIGURE 1A SEQID NO: 1

cit Tr? 2AGR facAG TAir CGS (S ScAt Art Cor GAA, AGTCR recT AcGcc kash GCGA chAAAAGTTA thaka (SACA 51 ATC cc GACA GSAAC saf ACA GCG GA, Acc ACs AASEC ARA CGT COG KSir GAA TCGC ScGT GGG gll Cric CAC AGA Argh XGCCG FRCTC Tigr Cisco CAC ATF GAires GTGR Ract TG: GCGGc higG ARCA GTGc (ATG TAA 5 gsC AcGG GAs cities (AGG AS GAA AA CA chis cCGG resex Crce: Grific catcc Tc. Acri Arakr Sir GA 2 RCs arc GTA TGcGa tract ACCCXC CARC AACTA Sch, GECAS GA cast ATA Act. As east ASS Tig cost cost 25 CCCC TAC CCA GTATG 1's G3 cT, GCCG (X. gas (GGGG ATG (GG CATA Air reces GTAS esco risex circ 3. As cct AC Kecs coca crics cres cage AGG grass cyc ce Sac is to SRKic Sec ccs Act CC 35 ccs cos ss asses cres got cases as Sct cuts cACC &c. cACCA ccSC Atik AccA. CACC At Gig scCA to GA assig (MC TNAGs Cs sli, GA, CGGs retic GGA cGrce CC crge ACTC scic cat CCG GCCC RGGG CCACT 45 SSC acc's AG circ GSSG CAC 'cGc ach, TCA TC occas SA GTCX gag CCTC gigs SC3 ccs is AGK's 5d. GGGT SCGC RGCC CCTG ACRAG GGCT, GAGT's GATGG GAGGS Act Accoa scTG TGS Gate retic ccGA, CCA CTCC cliccC TGT SS1 cccs. N' c tec GC cc eccag cocas Aeck G&GA Rt. R. CCRNG C GC ccTest CTck RessTC cQG CG S. Cesar Cox esco AC is cog cac sca GCA is cita Tiscatts (co Sts. GCC Grote: GGAG ACC CSAC ccSCG 65 cigats actic GAC kicks CSIGT AC Torsif CTTST NSGAf Attract cc ecce TSecG eccA to acci GACA RCTA ross 70, TTGG trences Gesar Crict rigAc Tactics. GGGcc AGGGA Accer GGrch Asc XT, GTG. Ricks AA sco call cas 75 Coxsic CTS AKGA Sci, GSKY CT's GcGG GGCRs cosgcks Gtsar GGCR 6GAG (c. ARSR corag GCCAC CGCC CCGTC GCCGC kcCA St GerTNC (SGAs (3G3 GT Air Targ cost scist CCUCC critist ccAs stic cock coat RC grics ags siggs grc 851 Gorris CGAcc ccSG GCASA GG2c. Accer cTCT GNCT GGRAS CGGCT cast Crics ggcc Caic cascis GTA SASA chA CCC ccSA 98 CGA, RCGG Alic RTRA GAA CGGT CCR3 c6 CCCAG GACG Gcs AGCC regr T. CT (ACCA Testic Grctia (ccT cirgic 95 ccco CAAc TCC2C CA tref Arka, CAGCG GCCC cities GTCC isdGG GTG SGG TRST A2 TTA. GCGC (GGGA GTCCC CAGGS 20 to GAC TCGS CocCA GTKT giCAC CCAG CCCC GGC CATCR Acrg cit AGRC GAGGS SCASA, CCGG GRGC GGGG (GAccG GTAG 10s crgGG circCA Grcrg GGA, GAGGC Gafr ATTAC TGTGC kgCAF GGGAft c.ccc GAgf cigate txcCT CCG era SAAT ACACG TCG. CCCTA cc carsR trigg TArcs Ciscs (SAACT (SGAC CASC TeacC. TCCT. GC GST ACA ATAC, GGC (TEGA CCG SCG AGTGG (GGA 5 TCG GAAT CASA ACARA AGCTS ATC INGRAG SAC TGA, AEAGC thggxt tra GTCT rar TCGAR TRAG ACT2C NTG AACA. TATCG CGG, GCCS CAC GA GCCS ccGSC Grigo Chas. A

U.S. Patent US 8,664,364 B2

U.S. Patent Mar. 4, 2014 Sheet 4 of 28 US 8,664,364 B2

FIGURE 1D

3. sia cert car Ats retres AC regc cirrr car Air CNS G. AGA Arc AXN AG, GCA RAAB AGTA TRAA GAAA ise As 5. it cag Teas gets essac Ga Art A.Gces AGoak actic races AAGTC AR cases exis terr rc. TCG ricer Ass 2 G CoA cr TAG, RNR, excCs ISCC T COG CT. At Gises grg, ATC is estics is a GSGC GG AN re-em-sm-m 5 Geo Arcee GAGG As CAGG G rest a C CRSA ACCs recc (CTC GTA GCC CRA Art AAT (STR GTA A2. 2. c is a rics c oxcoc sca is goal, actics Aa Gao has esci sees g c tes s 2 Ks 25 cct AA crick GAS Tr fists. CAAA scies AcGA Gag ce Agg Gray cac RR arc Girl case NGA CNC ter were 3 Saga Ticci Tacts actor coag. 2Acts tricci caggc ragg grgest tic sce AGC Gese scC cadet scCG TAG ACCA

ar

w 35 testeg Targ GGT GGGGTTeres Sega GSTscs recrg Crst costST A coc CC cc 3cc Co. As Gisc sc epperworported are agaunrepreverwripperwerpolarperpretenegrwevery proproprietarrerogreerley s 6 case rests GAA. GG tige GT, GRico CGGG TCct GGGS Scis Rec TSG stric acc CAT cis GCC AssG CCAir memorrow earwygraveyawperc se G stic cer tigG CCT tests catcT Tc. AGA TGCA actic cG Agic GN GAGA cc Greg Srces TCG ACGRT Gog R2

tapwagercre --rearmer-rear st seGC Asco Ge icos GGC, Geri GS GSG AR A cecrg ccess Getc. TSC tea crick AC (St Atri wayvyyuyvywarpywrapprenewpuppygienever wwwynypwpfits s 5.5 x C scistAct AGC Act, GCACA Gigi FCCG GGCG Ast st AGAA tices TOG, TGG Gros CCF NGGTc {CGN rest U.S. Patent Mar. 4, 2014 Sheet 5 of 28 US 8,664,364 B2

FIGURE ID (cont)

4lawywww.yggregal is cost Accec Cieces to CG tag cA. As are sc A sects case age is or see T cT sc 3. isfy s vapyrroyseyarwaxy-warpyrgypergraphyagapriyyyyyyyyyyyyyappy is GActs Acres sere acco carcs first esser ess was its GRT G cates Goc CC re Cc (sic act is

awaywaryype 6. ANG TCG GRa cer fisc rig Gsc as EccT Stitch rac GC cc. AGA Ag Attic ccess Titcaia Ge ces

wgawywww.wawawr stice is coast circ Age c. cac cases see sec cag tes *sess AGGG car his cca Scott CGC, etc. etc.sc ticci, ar diar ace its g is so as it is exico at Cog GCCC GCS COAG A, Aic gates assG GSGGS AGCG Newaarleyww.prep-waggery Rwasy-www.paavywegy c ea 85). Grces GGRCC cc GG Gesta Gost Accat crite Grigs gag copics Ciss cess so set cle to GAs cat catc. c. wrwyersperwarraworryver-prwaywrywideR Fra sy a case A Cross Rs ess is scs cstas its as agre a Got as gree sistic rest fa. s sco s ss sect is acc car is As score cast cost as 3 s. Rica see ess, cc cases Fr. 1. 3D react sac Tcrges frtch, AGT sectic creats carce crgGc chaca actics crics is sca Asa care so GGGC gro asse

cks sts scies critic, ss is essess At sessic afic ess tec go cate a cres Act AsG is a cice, cera

anywswever-waysa is GAC circa 3G T GTG GRC (GSGC CAS3 ERC GCCT GTC Seski reca ATCA AA cisa Cecies sits its Casti,

•r re------251 reces GAArr taga acaa riser arge GAAG Agic rosta Risc RSE CAA gig Garr rcial, as trrot trcts AC Arses 20 CGG Gct? Acts xeric GCCG get GASC raci s. U.S. Patent US 8,664,364 B2

ZCHRIQ;ÐIH U.S. Patent US 8,664,364 B2

9GRIQ?IH

U.S. Patent Mar. 4, 2014 Sheet 8 of 28 US 8,664,364 B2

U.S. Patent US 8,664,364 B2

U.S. Patent Mar. 4, 2014 Sheet 10 of 28 US 8,664,364 B2

r U.S. Patent Mar. 4, 2014 Sheet 11 of 28 US 8,664,364 B2

t 2

U.S. Patent Mar. 4, 2014 Sheet 13 of 28 US 8,664,364 B2 U.S. Patent Mar. 4, 2014 Sheet 14 of 28 US 8,664,364 B2

V0][HIRIQÐIH

009

e3Ue3SbOn paZe ON U.S. Patent US 8,664,364 B2

C 89e3SeaCl pezieu. CN U.S. Patent Mar. 4, 2014 Sheet 16 of 28 US 8,664,364 B2

VII[HRIQ?INH

U.S. Patent Mar. 4, 2014 Sheet 17 of 28 US 8,664,364 B2

FIGURE 11B

O

33. 1O 4. cs 10. E 8 0

( 102 o o 530 nm (c-myc epitope)

FIGURE 11C

HL4-MG + dye 2 JAR200 + dye 2O JAR200 - dye

T se

X. 10 4OO 500 600 700

O 4OO 500 600 7OO Excitation wavelength (nm)

U.S. Patent Mar. 4, 2014 Sheet 19 of 28 US 8,664,364 B2

U.S. Patent Mar. 4, 2014 Sheet 20 of 28 US 8,664,364 B2

FIGURE 14

s ... -- aesare r------e aw

f ... O

t s 2 s to-2 ind As2 A)

s s t s AG-2s a G2 in

1. ass'r e w

w g s f -O1 g & s

4s s 2.

{ s 1. To12p in AG-2p in

aw an 1so

e 5

s

G2 is U.S. Patent Mar. 4, 2014 Sheet 21 of 28 US 8,664,364 B2

FIGURE 15

5 f Wavelength (nm)

4. 5 5 Wavelength (nm)

3.

on H. f.O.O. 2 - TO-2p

al s 7 Wavelength (nm) U.S. Patent Mar. 4, 2014 Sheet 22 of 28 US 8,664,364 B2

a y ess is a y vs wn v. e. (sacrisis

V9IGIRIQ?IH U.S. Patent Mar. 4, 2014 Sheet 23 of 28 US 8,664,364 B2

be 4 as 4 x 0.

LICHRI[10][H

{zio) uu O09 se ealueqJosqy U.S. Patent Mar. 4, 2014 Sheet 24 of 28 US 8,664,364 B2

FIGURE 18A

L5-MGWariable light Chain

eggaeisge Ešg:E35 ircII, SES

FIGURE 18B

HBMG Variable Heavy Chain

U.S. Patent Mar. 4, 2014 Sheet 25 of 28 US 8,664,364 B2

FIGURE 19A

H6-MG Wariable Heavy Chain

CDS1 \

FIGURE 19B

HL4-MGWariable Heavy Chain CS Linker HLA-MGWariable Light Chain

s SSS East

U.S. Patent Mar. 4, 2014 Sheet 26 of 28 US 8,664,364 B2

FIGURE 20A

CS HLi-T01 Wariable Heavy Chain

35 &Si3S355SESS&E

HL-TO1. 122 bp

FIGURE 20B

HLiD1-TOf Wariable Heavy Chain Sf linker HLt.Of-Toi Wariable light Chain

HL.O.1 TO 845bp U.S. Patent Mar. 4, 2014 Sheet 27 Of 28 US 8,664,364 B2

FIGURE 21A

HL11-OVariable Heavy Chair irker HL.1-01 Wariable light Chain SSSSSSSE3:3: ESSESzi:SEassisterocessagosiassassistsEE

HL, O, 864 bp

FIGURE 21B

SSESSESSESSES s EY s

U.S. Patent Mar. 4, 2014 Sheet 28 of 28 US 8,664,364 B2

FIGURE 22A

HL2-Toi Wariable Heavy Chain CDS inker HL2-TOVariable Light Chain 33S355as S. O

HL2-TO. 835bp

FIGURE 22B

HAL9-MGWariable Heavy Chain COS1 linker HL9-MGWariable light Chain Sitarisis sia::33 s:

S&EßSESSES US 8,664,364 B2 1. 2 OPTICAL BIOSENSORS strate is generally unsuited to multiple assays, or to miniatur ization, for handling multiple analyte assays from a small PRIORITY amount of body fluid sample. Biosensor devices integrate the assay Substrate and detec This application is a U.S. National Stage Application based tor Surface into a single device. One general type of biosensor on International Application Serial No. PCT/US2008/051962 employs an electrode Surface in combination with current or filed 24 Jan. 2008 and claims the benefit of U.S. Provisional impedance measuring elements for detecting a change in Application Ser. No. 60/897,120 filed Jan. 24, 2007 and U.S. current or impedance in response to the presence of a ligand Provisional Application Ser. No. 61/013,098 filed Dec. 12, receptor binding event. This type of biosensor is disclosed, 10 for example, in U.S. Pat. No. 5,567,301. Gravimetric biosen 2007, the contents of each of which are incorporated by sors employ a piezoelectric crystal to generate a Surface reference in their entirety. acoustic wave whose frequency, wavelength and/or reso GOVERNMENT SUPPORT nance state are sensitive to Surface mass on the crystal Sur face. The shift in acoustic wave properties is therefore indica 15 tive of a change in Surface mass, e.g.: due to a ligand-receptor The Subject invention was made in part with Support from binding event. U.S. Pat. Nos. 5,478,756 and 4,789,804 the U.S. Government under Grant Number 1-U54-RRO22241 describe gravimetric biosensors of this type. Biosensors awarded by the NIH. Accordingly, the U.S. Government has based on surface plasmon resonance (SPR) effects have also certain rights in this invention. been proposed, for example, in U.S. Pat. Nos. 5,485,277 and 5.492.840. These devices exploit the shift in SPR surface REFERENCE TO SEQUENCE LISTING reflection angle that occurs with perturbations, e.g., binding events, at the SPR interface. Finally, a variety of biosensors This Application contains a Sequence Listing in accor that utilize changes in optical properties at a biosensor Surface dance with 37 C.F.R. SS 1.821-1.825. The material in the are known, e.g., U.S. Pat. No. 5,268.305. Sequence Listing text file is herein incorporated by reference 25 All of the above analyte detection systems are character in its entirety in accordance with 37 C.F.R.S 1.52(e)(5). The ized by the requirement for a secondary detection system to Sequence Listing, entitled “070683PCTUS Jul. 24, 2012 monitor interactions between the analyte and the receptor. A ST25.txt, contains one 111 Kb text file and was created on need still exists for a direct, homogeneous assay for analyte Jul. 22, 2009 and amended on Jul. 24, 2012 using an IBM-PC detection, i.e., one that may be used in living cells, which will machine format. 30 be more versatile in terms of the range of applications and devices with which it can be used. BACKGROUND SUMMARY The identification, analysis and-monitoring of biological analytes (such as polypeptides, polynucleotides, polysaccha 35 Provided are biosensors, compositions comprising biosen rides and the like) or environmental analytes (such as pesti sors, and methods of using biosensors in living cells and cides, biowarfare agents, food contaminants and the like) has organisms. The biosensors are able to be selectively targeted become increasingly important for research and industrial to certain regions or structures within a cell. The biosensors applications. Conventionally, analyte detection systems are may provide a signal when the biosensor is targeted and/or in based on analyte-specific binding between an analyte and an 40 response to a property of the cell or organism Such as mem analyte-binding receptor. Such systems typically require brane potential, ion concentration or enzyme activity. In one embodiment, the biosensors comprise at least two complex multicomponent detection systems (such as ELISA components; (1) a selectivity component capable of interact sandwich assays) or electrochemical detection systems, or ing with a target molecule of interest and a (2) reporter mol require that both the analyte and the receptor are labeled with 45 ecule that produces a detectable change in signal upon inter detection molecules (for example fluorescence resonance action of the selectivity component with the target molecule. energy transfer or FRET systems). The reporter molecule may be covalently linked to the selec One method for detecting analyte-binding agent interac tivity component, or it may be able to noncovalently interact tions involves a solid phase format employing a reporter with the selectivity component. In certain embodiments, the labeled analyte-binding agent whose binding to or release 50 selectivity component is a ligand of a reporter molecule Such from a solid Surface is dependent on the presence of analyte. as a dye. In a typical Solid-phase Sandwich type assay, for example, the The selectivity component, which in certain embodiments analyte to be measured is an analyte with two or more binding is expressed within the cell or organism to be analyzed, may sites, allowing analyte binding both to a receptor carried on a be a polypeptide (including antibodies and non-antibody solid surface, and to a reporter-labeled second receptor. The 55 receptor molecules, and fragments and variants thereof), presence of analyte is detected based on the presence of the polynucleotide (including aptamers), template imprinted reporter bound to the solid surface. material, or organic and inorganic binding element. The A variety of devices for detecting analyte/receptor interac selectivity component may be biologically selected to favor tions are also known. The most basic of these are purely reporter molecule binding and sensitivity. The selectivity chemical/enzymatic assays in which the presence or amount 60 component may bind directly to a target molecule, or be fused of analyte is detected by measuring or quantitating a detect to a targeting moiety (Such as a protein) that binds to the target able reaction product, such as gold immunoparticles. Ana molecule. lyte/receptorinteractions can also be detected and quantitated The reporter molecule may be sensitive to changes in the by radiolabel assays. Quantitative binding assays of this type environment, including, for example, pH sensitive molecules, involve two separate components: a reaction Substrate, e.g., a 65 polarity sensitive molecules, restriction sensitive molecules, Solid-phase test strip and a separate reader or detector device, or mobility sensitive molecules. The reporter molecule may, Such as a Scintillation counter or spectrophotometer. The Sub in embodiments where in it noncovalently interacts with the US 8,664,364 B2 3 4 selectivity component, comprise an additional moiety that FIG. 8 contains a table listing the peptide sequences of the binds to the selectivity component. scEvs comprising the FBPs of Example 5 (SEQID NOS:3, 5, The biosensor may optionally comprise a chemical handle 7, 9, 11, 13, 15, 17, 19 and 21, corresponding to table entries suitable to facilitate isolation, immobilization, identification, >HL1-TO1, >HL2-TO1, >HL 1.0.1-TO1, >HL1.1-TO1, or detection of the biosensors and/or which increases the >HL4-MG, >L5-MG, >H6-MG, >HL7-MG, >H8-MG, and solubility of the biosensors. >HL9-MG, respectively). In one example, the selectivity component is a single chain FIG. 9 contains a table describing the composition and antibody (ScPV) that comprises amino acid sequences that properties of the FBPs of Example 5. lead to specific binding of certain reporter molecules such as FIGS. 10A and 10B are graphs depicting the fluorescence monomethin cyanine dyes (TO1 and its analogs). In yet other 10 characterization of purified FBPs. FIG. 10A depicts the fluo embodiments, the selectivity component is a single chain rescence spectra of FBP/fluorogen complexes. Excitation and antibody that comprises amino acid sequences that lead to emission spectra are determined in the presence of excess specific binding of a reporter molecule Such as Malachite purified FBP (2 MHL 1.0.1-TO 1 and 100 nM TO 1-2p;2 Green (and its analogs). The formation of Such protein-dye uM HL4-MG or L5-MG and 200 nM MG-2p). The relative complexes produces a large increase in fluorescence of the 15 fluorescence of FBP/fluorogen complexes and free fluorogen dye (i.e., fluorogen reporter molecule) when it is in the bound is determined at fixed excitation and emission on a microplate state, thereby allowing detection of binding. In other reader (the 488 nm laser excitation is shown as a dotted line). examples, the single chain antibody is coupled (e.g., as a FIG. 10B depicts fluorescence spectra of FBP/fluorogen fusion protein or chemical conjugate) to a molecule of inter complexes using different fluorogen analogs where the est, such as for example a cell cycle regulatory protein. depicted R-groups are substituted as the MG-2p R-group. The In certain other embodiments, a binary biosensor is used to excitation spectra are determined using 2 uM purified detect a molecule of interest. For example, a V chain of a HL4MG or L5-MG and 200 nM of indicated fluorogen ana dye-specific antibody can be conjugated to a lipid, Sugar, log: (I) malachite green diethylester; (II) crystal violet; (III) protein or polypeptide of interest, while the corresponding V, malachite green. Fluorescence intensity is normalized; actual chain can be coupled to another potential ligand or polypep 25 fluorescence signal varies, mainly due to differences in bind tide of interest. When the target and ligand are in close prox ing affinity. Depicted FBP/fluorogen complexes showed 70 to imity, the V and V chains become close enough to form a 12,000-fold fluorescence enhancement over free fluorogen. binding epitope for the dye, a detectable signal is produced. FIGS. 11A, 11B and 11C illustrate fluorogen embodiments The biosensors described herein are useful for both in vivo and their use with yeast displayed schvs. FIG. 11A depicts the and in vitro applications. In various embodiments, the bio 30 structure of the fluorogenic dyes thiazole orange derivative sensors may be used for detecting one or more target mol (TO1-2p) and malachite green derivative (MG-2p) used in ecules, detecting environmental pollutants, detecting chemi various embodiments. FIG. 11B is a graph depicting the cal or biological warfare agents, detecting food contaminants, isolation of FBPs using FACS. The Sorting screen shows and detecting hazardous Substances. In an exemplary separation of yeast cells bearing malachite green-activating embodiment, the biosensors may be used for intracellular 35 sch vs from a bulk yeast population. The horizontal axis monitoring of one or more target molecules. In such embodi shows distribution of cells by green fluorescence of antibody ments, at least one component of the biosensor may be reagent that labels the c-myc epitope; and the vertical axis expressed within the cell to be analyzed. depicts distribution of cells by red fluorescence generated by binding of MG fluorogen. Sorting window (I) collects cells BRIEF DESCRIPTION OF THE DRAWINGS 40 enriched for FBPs composed of heavy chain (VH), light chain (VL) and c-myc epitope (M). Sorting window (II) collects FIG. 1A depicts the DNA sequence of the construct encod cells enriched for FBPs composed only of the heavy chain. ing scFv1 (SEQ ID NO:1). FIG. 1B depicts the protein FIG. 11C is a graph depicting a homogenous format assay of sequence of the construct encoding schv1 (SEQ ID NO:2). live yeast cells displaying FBPs. The fluorescence excitation FIG. 1C is a schematic of the construct encoding schv 1. FIG. 45 spectrum of displayed HLA-MG is taken on a 96-well micro 1D depicts the DNA sequence (SEQ ID NO: 1) of FIG. 1A plate reader (10 yeast cells in 200 ml effective concentration with regions of the construct encoding scFv1 of FIG. 1C B10 nM scFv are treated with 200 nM MG-2p). The inset mapped onto the DNA sequence (SEQID NO:1). illustrates low levels of fluorescence background signal with FIG. 2 shows various fluorescent dye structures. JAR200 control cells that do not express FBPs. FIG.3 depicts a reporter-molecule localizing system based 50 FIG. 12 depicts the improvement of binding affinity and on SAb technology. intrinsic brightness of HL1-TO1 by directed evolution. Affin FIG. 4 depicts a photoreactive hapten with PEG linker and ity and total cellular brightness are measured using yeast cell reporter molecule X. surface displayed scFvs. Total cellular brightness is measured FIG. 5 depicts a photoreversible hapten with PEG linker at Saturating fluorogen concentration on a Tecan Safire 2 plate and reporter molecule X. 55 reader, and intrinsic brightness calculated by normalizing FIG. 6 depicts the structure of Malachite Green derivatized total signal to the relative number of scFVs, determined sepa with a PEG amine. In some embodiments, the amino group rately by FACS analysis of immunolabeled c-myc epitope. may be covalently modified with a biotin group for strepta The bar graph depicts relative intrinsic brightness for selected vidin coated magnetic bead enrichment of yeast bearing Schv sch vs employed after one or two generations of directed proteins that bind to the Malachite Green on the opposite end 60 evolution. Numbers on the bars represent cell surface binding of the PEG linker. K, (nM). The sequence alignments show the distribution of FIG. 7 depicts the structure of Thiazole Orange 1 (TO1) acquired mutations within the heavy chain variable region of derivatized with a PEG amine. In some embodiments, the HL1-TO1 (SEQ ID NO: 73, a fragment corresponding to amino group may be covalently modified with a biotin group residues 1-121 of SEQID NO:3). Complementarity Deter for streptavidin coated magnetic bead enrichment of yeast 65 mining Regions (“CDRs) within HL1-TO1 implicated in bearing schv proteins that bind to the TO1 on the opposite end antigen recognition are underlined and numbered 1, 2 and 3. of the PEG linker. (corresponding to SEQID NOS 76, 77 and 78, respectively) US 8,664,364 B2 5 6 as identified in the IMGT/V-QUEST database. Amino acid malian cells. NIH 3T3 cells stably expressing both HL4-MG replacements in bold depict residues found in multiple and HL1.1-TO1 simultaneously are isolated using FACS, and instances within each family of improved descendants (a grown as a layer on the optical window of 35 mm petri dishes. fragment of HL1.1-TO1, SEQID NO: 74 and a fragment of Bleaching experiments are carried out in PBS w/Ca and Mg HL1.0.1-TO1, SEQID NO: 75). The dominant replacements 5 using HQ620/60 excitation and HQ665 LP emission filters tend to accumulate in CDRs, wherein replacement CDRs (Chroma set #41024), total specimen plane irradiance is mea within the fragment of HL 1.1-TO1 shown to align with SEQ. Sured at 30 mW. IDNOs: 77 and 78 are represented by SEQID NOs: 79 and 80 FIG. 17 is a graph depicting the effect of fluorogens on and replacement CDRs within the fragment of HL 1.0.1-TO1 yeast cell growth. JAR200 cells are inoculated at ~10 cells/ shown to align with SEQ. ID NOs: 77 and 78 are represented 10 ml into 35 ml SD+CAA medium in 125 ml baffled flasks and by SEQID NOs: 81 and 82. For HL1-TO1, accumulation of allowed to grow at 30° C. at 300 RPM for 2 hours prior to dominant replacements occurs in the heavy chain rather than addition of fluorogens at the indicated concentrations. One ml the light chain. Among 16 unique second generation descen samples are removed at indicated time points, and growth dants that are analyzed, 8 positions in the heavy chain accu halted by addition of 75ul of 300 mM NaNs prior to reading mulate dominant mutations but only 1 position in the light 15 absorbance. Doubling time of about 1.9 hrs is unchanged by chain accumulates dominant mutations. For the selected most fluorogen treatments. For 500 nM MG-ester, the dou clones, it can be seen that the first generation replacements bling time is about 2.8 hrs; and for 500 nMMG, the doubling improve both affinity and brightness, whereas second genera time is over 24 hrs. tion replacements improve only affinity. FIG. 18A is a binding schematic for the FBPL5-MG. FIG. FIG. 13 is an SDS-PAGE gel of purified FBPs with 1 g of 20 18B is a binding schematic for the FBP H8-MG. BCA quantitated scFvloaded per lane, where lane-1 is loaded FIG. 19A is a binding schematic for the FBP H6-MG. FIG. with a MW standard; lane-2 is loaded with HL 1.0.1-TO1; 19B is a binding schematic for the FBP HL4-MG. lane-3 is loaded with HL4-MG; lane-4 is loaded with L FIG. 20A is a binding schematic for the FBP HL1-TO1. %-MG; and lane-5 is loaded with H6-MG. FIG. 20B is a binding schematic for the FBP HL1.0.1-TO1. FIG. 14 provides graphs illustrating fluorogen binding to 25 FIG. 21A is a binding schematic for the FBP HL1.1-TO1. yeast displayed FBPs (above dashed line) and soluble FBPs FIG.21B is a binding schematic for the FBP HL7-MG. (below dashed line). Provided are representative binding FIG. 22A is a binding schematic for the FBP HL2-TO1. curves with 95% confidence intervals for each. One-site FIG.22B is a binding schematic for the FBP HL9-MG. hyperbolic Saturation binding analysis was applied to all dis played FBPs (above dashed line) and soluble H6-MG and a 30 DETAILED DESCRIPTION saturation binding with ligand depletion algorithm was applied to other soluble FBPs (below dashed line). To provide an overall understanding, certain illustrative FIG. 15 provides graphs illustrating absorbance of fluoro embodiments will now be described; however, it will be gens and FBP/fluorogen complexes. Shown are samples used understood by one of ordinary skill in the art that the systems in quantum yield determinations. The absorbance of FBP/ 35 and methods described herein can be adapted and modified to fluorogen complexes is obtained on a dual beam PerkinElmer provide systems and methods for other Suitable applications Lambda 45 spectrophotometer using an equal concentration and that other additions and modifications can be made with of FBP without fluorogen as the reference. out departing from the scope of the systems and methods FIGS. 16A, 16B and 16C are graphs depicting pho described herein. tobleaching curves for FBPs. FIG. 16A is a graph of pho- 40 Unless otherwise specified, the illustrated embodiments tobleaching curves for TO1-FBP and EGFP displayed on can be understood as providing exemplary features of varying yeast. JAR200 yeast strains displaying HL 1.0.1-TO1 and detail of certain embodiments, and therefore unless otherwise EGFP are immobilized on concanavalin-A treated 35 mm specified, features, components, modules, and/or aspects of petridishes with 14 mm optical microwell (Mattek Corp) and the illustrations can be combined, separated, interchanged, bleached in 2 ml modified PBS using an Olympus IX50 45 and/or rearranged without departing from the disclosed sys inverted microscope equipped with a 100W Hg lamp, 40x1.3 tems or methods. NA oil objective and a Photometrics CoolSnap HQ camera 1. Introduction with HQ470/40 excitation and HQ500 LP emission filters For convenience, certain terms employed in the specifica (Chroma set #41018, total irradiance at the specimen plane tion, examples, and appended claims are collected here. was measured at 30 mW (13.6 LW/um2)). Each curve repre- 50 Unless defined otherwise, all technical and scientific terms sents an average of scans of 8-12 individual cells. Fluores used herein have the same meaning as commonly understood cence of EGFP is normalized (scaled down -2.5-fold) to by one of ordinary skill in the art. match HL 1.0.1-TO1 cells visualized with 375 nM TO1-2p. Other than in the examples herein, or unless otherwise FIG. 16B is a graph depicting the photobleaching lifetime of expressly specified, all of the numerical ranges, amounts, yeast displayed TO1-FBP and EGFP. JAR200 yeast cells 55 values and percentages, such as those for amounts of materi treated are bleached on a Leica DMI 6000B confocal micro als, elemental contents, times and temperatures of reaction, scope using 488 nm laser excitation at 100% power and ratios of amounts, and others, in the following portion of the monitoring emission with a 500-600 nm window. Data from specification and attached claims, may be read as if prefaced individual cells are averaged and the EGFP signal is normal by the word “about even though the term “about may not ized (scaled down -3-fold) to match initial HL 1.0.1-TO1 60 expressly appear with the value, amount, or range. Accord fluorescence. Plotted data points are displayed with a single ingly, unless indicated to the contrary, the numerical param exponential decay curve (Graphpad Prism 4.0 software). eters set forth in the following specification and claims are Lifetimes are corrected by comparing excitation intensities of approximations that may vary depending upon the desired these cells at 488 nm to the intensity at their excitation properties sought to be obtained by the present invention. At maxima (EGFP at 502 nm, HL1.0.1-TO1 at 512 nm), deter- 65 the very least, and not as an attempt to limit the application of mined on a Tecan Safire2 plate reader. FIG.16C is a graph the doctrine of equivalents to the scope of the claims, each depicting the photobleaching of MG-FBP displayed on mam numerical parameter should at least be construed in light of US 8,664,364 B2 7 8 the number of reported significant digits and by applying are bi-valent. The interaction between the variable regions of ordinary rounding techniques. heavy and light chain forms a binding site capable of specifi Notwithstanding that the numerical ranges and parameters cally binding an antigen. The term “V, refers to a heavy setting forth the broad scope of the invention are approxima chain variable region of an antibody. The term “V, refers to tions, the numerical values set forth in the specific examples a light chain variable region of an antibody. Antibodies may are reported as precisely as possible. Any numerical value, be derived from natural sources, or partly or wholly syntheti however, inherently contains error necessarily resulting from cally produced. An antibody may be monoclonal or poly the standard deviation found in its underlying respective test clonal. The antibody may be a member of any immunoglo ing measurements. Furthermore, when numerical ranges are bulin class, including any of the human classes: IgG, IgM, set forth herein, these ranges are inclusive of the recited range 10 end points (i.e., end points may be used). When percentages IgA, Ig|D, and IgE. In exemplary embodiments, antibodies by weight are used herein, the numerical values reported are used with the methods and compositions described herein are relative to the total weight. derivatives of the IgG class. Also, it should be understood that any numerical range The term “antibody fragment” refers to any derivative of an recited herein is intended to include all Sub-ranges Subsumed 15 antibody which is less than full-length. In exemplary embodi therein. For example, a range of “1 to 10” is intended to ments, the antibody fragment retains at least a significant include all Sub-ranges between (and including) the recited portion of the full-length antibody's specific binding ability. minimum value of 1 and the recited maximum value of 10, Examples of antibody fragments include, but are not limited that is, having a minimum value equal to or greater than 1 and to, Fab, Fab'. F(ab'). Fv, dsFv, scFv, diabody, and Fd frag a maximum value of equal to or less than 10. The articles “a” ments. The antibody fragment may be produced by any and “an are used herein to refer to one or to more than one means. For instance, the antibody fragment may be enzymati (i.e., to at least one) of the grammatical object of the article. cally or chemically produced by fragmentation of an intact By way of example, "an element’ means one element or more antibody, it may be recombinantly or partially synthetically than one element. produced. The antibody fragment may optionally be a single The term "amino acid' is intended to embrace all mol 25 chain antibody fragment. Alternatively, the fragment may ecules, whether natural or synthetic, which include both an comprise multiple chains which are linked together, for amino functionality and an acid functionality and capable of instance, by disulfide linkages. The fragment may also being included in a polymer of naturally-occurring amino optionally be a multimolecular complex. A functional anti acids. Exemplary amino acids include naturally-occurring body fragment will typically comprise at least about 50 amino amino acids; analogs, derivatives and congeners thereof. 30 acids and more typically will comprise at least about 200 amino acid analogs having variant side chains; and all stere amino acids. oisomers of any of any of the foregoing. The term “Fab' refers to an antibody fragment that is As used herein, the term “selectivity component” refers to essentially equivalent to that obtained by digestion of immu a molecule capable of interacting with a target molecule. noglobulin (typically IgG) with the enzyme papain. The Selectivity components having limited cross-reactivity are 35 heavy chain segment of the Fab fragment is the Fd piece. Such generally preferred. In certain embodiments, Suitable selec fragments may be enzymatically or chemically produced by tivity components include, for example, polypeptides, such as fragmentation of an intact antibody, recombinantly produced for example, antibodies, monoclonal antibodies, or deriva from a gene encoding the partial antibody sequence, or it may tives or analogs thereof, including without limitation: Fv be wholly or partially synthetically produced. Methods for fragments, single chain FV (ScPV) fragments, Fab' fragments, 40 preparing Fab fragments are known in the art. See, for F(ab')2 fragments, single domain antibodies, camelized anti example, Tijssen, Practice and Theory of Enzyme Immunoas bodies and antibody fragments, humanized antibodies and says (Elsevier, Amsterdam, 1985). antibody fragments, and multivalent versions of the forego The term “Fab' refers to an antibody fragment that is ing; multivalent binding reagents including without limita essentially equivalent to that obtained by reduction of the tion: monospecific or bispecific antibodies, such as disulfide 45 disulfide bridge or bridges joining the two heavy chain pieces stabilized FV fragments, scFV tandems (scFV) fragments), in the F(ab') fragment. Such fragments may be enzymati diabodies, tribodies or tetrabodies, which typically are cally or chemically produced by fragmentation of an intact covalently linked or otherwise stabilized (i.e., leucine Zipper antibody, recombinantly produced from a gene encoding the or helix stabilized) schv fragments; and other binding partial antibody sequence, or it may be wholly or partially reagents including, for example, aptamers, template 50 synthetically produced. imprinted materials (such as those of U.S. Pat. No. 6,131, The term “F(ab') refers to an antibody fragment that is 580), and organic or inorganic binding elements. In exem essentially equivalent to a fragment obtained by digestion of plary embodiments, a selectivity component specifically an immunoglobulin (typically IgG) with the enzyme pepsinat interacts with a single epitope. In other embodiments, a selec pH 4.0-4.5. Such fragments may be enzymatically or chemi tivity component may interact with several structurally 55 cally produced by fragmentation of an intactantibody, recom related epitopes. binantly produced from a gene encoding the partial antibody The term “ligand’ refers to a binding moiety for a specific sequence, or it may be wholly or partially synthetically pro target molecule. The molecule can be a cognate receptor, a duced. protein, a small molecule, a hapten, or any other relevant The term “Fv' refers to an antibody fragment that consists molecule. 60 of one V and one V, domain held together by noncovalent The term “antibody” refers to an immunoglobulin, deriva interactions. The term “dsFv is used herein to refer to an Fv tives thereof which maintain specific binding ability, and with an engineered intermolecular disulfide bond to stabilize proteins having a binding domain which is homologous or the V-V, pair. Methods for preparing Fv fragments are largely homologous to an immunoglobulin binding domain. known in the art. See, for example, Moore et al., U.S. Pat. No. AS Such, the antibody operates as a ligand for its cognate 65 4,462,334; Hochman et al., Biochemistry 12: 1130 (1973); antigen, which can be virtually any molecule. Natural anti Sharon et al., Biochemistry 15: 1591 (1976); and Ehrlich et bodies comprise two heavy chains and two light chains and al., U.S. Pat. No. 4,355,023. US 8,664,364 B2 9 10 The terms “single-chain Fvs’ and “scFvs' refers to recom “Interact’ is meant to include detectable interactions binant antibody fragments consisting of only the variable between molecules, such as may be detected using, for light chain (V) and variable heavy chain (V) covalently example, a hybridization assay. Interact also includes “bind connected to one another by a polypeptide linker. Either V, or ing interactions between molecules. Interactions may be, for V may be the NH2-terminal domain. The polypeptide linker example, protein-protein, protein-nucleic acid, protein-Small may be of variable length and composition so long as the two molecule or Small molecule-nucleic acid, and includes for variable domains are bridged without serious steric interfer example, antibody-antigen binding, receptor-ligand binding, ence. In exemplary embodiments, the linkers are comprised hybridization, and other forms of binding. In certain embodi primarily of stretches of glycine and serine residues with ments, an interaction between a ligand and a specific target Some glutamic acid or lysine residues interspersed for Solu 10 will lead to the formation of a complex, wherein the ligand bility. Methods for preparing scFVs are known in the art. See, and the target are unlikely to dissociate. Such affinity for a for example, PCT/US/87/02208 and U.S. Pat. No. 4,704,692. ligand and its target can be defined by the dissociation con The term “single domain antibody” or “Fa’ refers to an stant(K) as known in the art. A complex may include aligand antibody fragment comprising a V. domain that interacts for a specific dye and is referred to herein as a “ligand-dye' with a given antigen. An Fd does not contain a V, domain, but 15 complex. may contain other antigenbinding domains known to exist in The term “immunogen' traditionally refers to compounds antibodies, for example, the kappa and lambda domains. In that are used to elicit an immune response in an animal, and is certain embodiments, the Fd comprises only the F compo used as Such herein. However, many techniques used to pro nent. Methods for preparing Fds are known in the art. See, for duce a desired selectivity component, such as the phage dis example, Ward et al., Nature 341:644-646 (1989) and EP play and aptamer methods described below, do not rely O368684 A1. wholly, or even in part, on animal immunizations. Neverthe The term “single chain antibody” refers to an antibody less, these methods use compounds containing an "epitope.” fragment that comprises variable regions of the light and as defined above, to select for and clonally expand a popula heavy chains joined by a flexible linker moiety. Methods for tion of selectivity components specific to the “epitope.” These preparing single chain antibodies are known in the art. See, 25 in vitro methods mimic the selection and clonal expansion of for example, U.S. Pat. No. 4,946,778 to Ladner et al. immune cells in Vivo, and, therefore, the compounds contain The term "diabodies’ refers to dimeric schvs. The compo ing the "epitope' that is used to clonally expand a desired nents of diabodies typically have shorter peptide linkers than population of phage, aptamers and the like in vitro are most scvs and they show a preference for associating as embraced within the definition of “immunogens.” dimers. The term diabody is intended to encompass both 30 Similarly, the terms “hapten and “carrier have specific bivalent (i.e., a dimer of two scEvs having the same specific meaning in relation to the immunization of animals, that is, a ity) and bispecific (i.e., a dimer of two sclvs having different “hapten” is a small molecule that contains an epitope, but is specificities) molecules. Methods for preparing diabodies are incapable as serving as an immunogen alone. Therefore, to known in the art. See, for example, EP 404097 and WO93/ elicit an immune response to the hapten, the hapten is conju 11161. 35 gated with a larger carrier, such as bovine serum albumin or The term “triabody” refers to trivalent constructs compris keyhole limpet hemocyanin, to produce an immunogen. A ing 3 schv's, and thus comprising 3 variable domains (see, preferred immune response would recognize the epitope on e.g., Iliades et al., FEBS Lett. 4.09(3):43741 (1997)). Triabod the hapten, but not on the carrier. As used herein in connection ies is meant to include molecules that comprise 3 variable with the immunization of animals, the terms “hapten' and domains having the same specificity, or 3 variable domains 40 “carrier take on their classical definition. However, in the in wherein two or more of the variable domains have different vitro methods described herein for preparing the desired specificities. binding reagents, traditional “haptens' and “carriers’ typi The term “tetrabody” refers to engineered antibody con cally have their counterpartin epitope-containing compounds structs comprising 4 variable domains (see, e.g., Packet al., J affixed to Suitable Substrates or Surfaces, such as beads and Mol Biol. 246(1):28-34 (1995) and Coloma & Morrison, Nat 45 tissue culture plates. Biotechnol. 15(2): 159-63 (1997)). Tetrabodies is meant to The term “aptamer' refers to a nucleic acid molecule that include molecules that comprise 4 variable domains having may selectively interact with a non-oligonucleotide molecule the same specificity, or 4 variable domains wherein two or or group of molecules. In various embodiments, aptamers more of the variable domains have different specificities. may include single-stranded, partially single-stranded, par The term “camelized antibody” refers to an antibody or 50 tially double-stranded or double-stranded nucleic acid variant thereofthat has been modified to increase its solubility sequences; sequences comprising nucleotides, ribonucle and/or reduce aggregation or precipitation. For example: otides, deoxyribonucleotides, nucleotide analogs, modified camelids produce heavy-chain antibodies consisting only of a nucleotides and nucleotides comprising backbone modifica pair of heavy chains wherein the antigen binding site com tions, branchpoints and normucleotide residues, groups or prises the N-terminal variable region or V (variable domain 55 bridges; synthetic RNA, DNA and chimeric nucleotides, of a heavy chain antibody). The V. domain comprises an hybrids, duplexes, heteroduplexes; and any ribonucleotide, increased number of hydrophilic amino acid residues that deoxyribonucleotide or chimeric counterpart thereof and/or enhance the Solubility of a V. domain as compared to a V corresponding complementary sequence. In certain embodi region from non-camelid antibodies. Camelization of an anti ments, aptamers may include promoter or primer annealing body or variant thereof involves replacing one or more amino 60 sequences that may be used to amplify, transcribe or replicate acid residues of a non-camelid antibody with corresponding all or part of the aptamer. amino residues from a camelid antibody. As used herein, the term “reporter molecule' refers to a As used herein, the term "epitope” refers to a physical molecule Suitable for detection, such as, for example, spec structure on a molecule that interacts with a selectivity com troscopic detection. Examples of reporter molecules include, ponent, Such as an antibody. In exemplary embodiments, 65 but are not limited to, the following: fluorescent labels, enzy epitope refers to a desired region on a target molecule that matic labels, biotinyl groups, and predetermined polypeptide specifically interacts with a selectivity component. epitopes recognized by a secondary reporter (e.g., leucine US 8,664,364 B2 11 12 Zipper pair sequences, binding sites for secondary antibodies, a negatively-charged group, consisting of Glu and Asp, (iv) an metal binding domains, epitope tags). Examples and use of aromatic group, consisting of Phe, Tyrand Trp, (v) a nitrogen such reporter molecules are described in more detail below. In ring group, consisting of His and Trp. (vi) a large aliphatic Some embodiments, reporter molecules are attached by nonpolar group, consisting of Val, Leu and Ile, (vii) a slightly spacer arms of various lengths to reduce potential steric hin polar group, consisting of Met and Cys, (viii) a small-residue drance. Reporter molecules may be incorporated into or group, consisting of Ser, Thr, Asp, ASn, Gly, Ala, Glu, Gln and attached (including covalent and non-covalent attachment) to Pro, (ix) an aliphatic group consisting of Val, Leu, Ile, Met a molecule, such as a selectivity component. Various methods and Cys, and (X) a small hydroxyl group consisting of Ser and of labeling polypeptides are known in the art and may be used. Thr. As used herein, the term “sensor dye' refers to a reporter 10 “Isolated, with respect to nucleic acids, such as DNA or molecule that exhibits an increase, decrease or modification RNA, refers to molecules separated from other DNAs, or of signal in response to a change in the environment. In RNAs, respectively, that are present in the natural source of exemplary embodiments, the sensor dye is a fluorescent mol the macromolecule. Isolated also refers to a nucleic acid or ecule that is responsive to changes in polarity and/or mobility peptide that is substantially free of cellular material, viral of the dye, as well as, the changes microenvironment pH 15 material, or culture medium when produced by recombinant and/or viscosity, or combinations thereof. DNA techniques, or chemical precursors or other chemicals A “fusion protein' or “fusion polypeptide' refers to a chi when chemically synthesized. Moreover, an "isolated nucleic meric protein as that term is known in the art and may be acid' is meant to include nucleic acid fragments which are not constructed using methods known in the art. In many naturally occurring as fragments and would not be found in examples of fusion proteins, there are two different polypep the natural state. “Isolated also refers to polypeptides which tide sequences, and in certain cases, there may be more. The are isolated from other cellular proteins and is meant to sequences may be linked in frame. A fusion protein may encompass both purified and recombinant polypeptides. include a domain which is found (albeit in a different protein) The term “mammal’ is known in the art, and exemplary in an organism which also expresses the first protein, or it may mammals include humans, primates, bovines, porcines, be an “interspecies”, “intergenic’, etc. fusion expressed by 25 canines, felines, and rodents (e.g., mice and rats). different kinds of organisms. In various embodiments, the The term “microenvironment” refers to localized condi fusion polypeptide may comprise one or more amino acid tions within a larger area. For example, association of two sequences linked to a first polypeptide. In the case where molecules within a solution may alter the local conditions more than one amino acid sequence is fused to a first polypep Surrounding the associating molecules without affecting the tide, the fusion sequences may be multiple copies of the same 30 overall conditions within the solution. sequence, or alternatively, may be different amino acid The term “nucleic acid refers to a polymeric form of sequences. The fusion polypeptides may be fused to the nucleotides, either ribonucleotides or deoxynucleotides or a N-terminus, the C-terminus, or the N- and C-terminus of the modified form of either type of nucleotide. The terms should first polypeptide. Exemplary fusion proteins include also be understood to include, as equivalents, analogs of polypeptides comprising a glutathione S-transferase tag 35 either RNA or DNA made from nucleotide analogs, and, as (GST-tag), histidine tag (His-tag), an immunoglobulin applicable to the embodiment being described, single domain or an immunoglobulin binding domain. Stranded (Such as sense or antisense) and double-stranded As used herein, the term “array refers to a set of selectivity polynucleotides. components immobilized onto one or more Substrates so that The term “polypeptide', and the terms “protein’ and "pep each selectivity component is at a known location. In an 40 tide' which are used interchangeably herein, refers to a poly exemplary embodiment, a set of selectivity components is mer of amino acids. immobilized onto a Surface in a spatially addressable manner The terms “polypeptide fragment' or “fragment, when so that each individual selectivity component is located at a used in regards to a reference polypeptide, refers to a polypep different and identifiable location on the substrate. tide in which amino acid residues are deleted as compared to The term “chemical handle' refers to a component that 45 the reference polypeptide itself, but where the remaining may be attached to a biosensor as described herein so as to amino acid sequence is usually identical to the corresponding facilitate its isolation, immobilization, identification, or positions in the reference polypeptide. Such deletions may detection and/or which increases its solubility. Suitable occur at the amino-terminus or carboxy-terminus of the ref chemical handles include, for example, a polypeptide, a poly erence polypeptide, or alternatively both. Fragments typi nucleotide, a carbohydrate, a polymer, or a chemical moiety 50 cally are at least 5, 10, 20, 50, 100, 500 or more amino acids and combinations or variants thereof. long. A fragment can retain one or more of the biological The term “conserved residue' refers to an amino acid that activities of the reference polypeptide. is a member of a group of amino acids having certain common The term “sequence homology” refers to the proportion of properties. The term “conservative amino acid substitution base matches between two nucleic acid sequences or the refers to the substitution (conceptually or otherwise) of an 55 proportion of amino acid matches between two amino acid amino acid from one such group with a different amino acid sequences. When sequence homology is expressed as a per from the same group. A functional way to define common centage, e.g., 50%, the percentage denotes the proportion of properties between individual amino acids is to analyze the matches over the length of sequence from a desired sequence normalized frequencies of amino acid changes between cor (e.g., SEQ. ID NO: 1) that is compared to some other responding proteins of homologous organisms. According to 60 sequence. Gaps (in either of the two sequences) are permitted Such analyses, groups of amino acids may be defined where to maximize matching; gap lengths of 15 bases or less are amino acids within a group exchange preferentially with each usually used, 6 bases or less are used more frequently, with 2 other, and therefore resemble each other most in their impact bases or less used even more frequently. The term "sequence on the overall proteinstructure. One example of a set of amino identity” means that sequences are identical (i.e., on a nucle acid groups defined in this manner include: (i) a charged 65 otide-by-nucleotide basis for nucleic acids or amino acid-by group, consisting of Glu and Asp, Lys, Arg and His, (ii) a amino acid basis for polypeptides) over a window of com positively-charged group, consisting of Lys, Arg and His, (iii) parison. The term "percentage of sequence identity” is US 8,664,364 B2 13 14 calculated by comparing two optimally aligned sequences In other embodiments, particularly where the biosensor is over the comparison window, determining the number of produced from an endogenous source rather than expressed in positions at which the identical amino acids occurs in both the cell or tissue to be analyzed, the biosensor may further sequences to yield the number of matched positions, dividing comprise a chemical handle. The chemical handle may be the number of matched positions by the total number of 5 used to facilitate isolation, immobilization, identification, or positions in the comparison window, and multiplying the detection of the biosensors and/or which increases the solu result by 100 to yield the percentage of sequence identity. bility of the biosensors. Methods to calculate sequence identity are known to those of In certain embodiments, the biosensor may be immobi skill in the art. lized onto a Substrate Surface, including, for example, Sub 2. Biosensors 10 Provided are biosensors, compositions comprising biosen strates such as silicon, silica, quartz, glass, controlled pore sors, and methods of using biosensors in living cells and glass, carbon, alumina, titania, tantalum oxide, germanium, organisms. The biosensors are able to be selectively targeted silicon nitride, Zeolites, gallium arsenide, gold, platinum, alu to certain regions or structures within a cell. The biosensors minum, copper, titanium, alloys, polystyrene, poly(tetra) may provide a signal when the biosensor is targeted and/or in 15 fluoroethylene (PTFE), polyvinylidenedifluoride, polycar response to a property of the cell or organism Such as mem bonate, polymethylmethacrylate, polyvinylethylene, brane potential, ion concentration or enzyme activity. polyethyleneimine, poly(etherether)ketone, polyoxymethyl In general, the biosensors comprise at least two compo ene (POM), polyvinylphenol, polylactides, poly nents; (1) a selectivity component capable of interacting with methacrylimide (PMI), polyalkenesulfone (PAS), polypropy a target molecule of interest and a (2) reporter molecule that lethylene, polyethylene, polyhydroxyethylmethacrylate produces a detectable change in signal upon interaction of the (HEMA), polydimethylsiloxane, polyacrylamide, polyimide, selectivity component with the target molecule. The reporter and block-copolymers. Such substrates may be in the form of molecule may be covalently linked to the selectivity compo beads, chips, plates, slides, strips, sheets, films, blocks, plugs, nent, or it may be able to noncovalently interact with the medical devices, Surgical instruments, diagnostic instru selectivity component. 25 ments, drug delivery devices, prosthetic implants, and other In various embodiments, the reporter molecule is respon Structures. sive to environmental changes, including for example, pH In another embodiment, the application provides a compo sensitive molecules, restriction sensitive molecules, polarity sition comprising one or more biosensors. The composition sensitive molecules, and mobility sensitive molecules. The may comprise a pharmaceutically acceptable carrier. The bio reporter molecule may be either fluorescent or chemilumi 30 sensors of the composition may be specific for different target nescent. In certain embodiments, the reporter molecule may molecules, and may be associated with the same or different interact with the selectivity component proximal to a region reporter molecules. that binds to the target molecule. In an exemplary embodi In another embodiment, two or more biosensors may be ment, the reporter molecule is covalently attached to the immobilized onto a Substrate at spatially addressable loca selectivity component proximal to a region that binds to the 35 tions. The biosensors may be specific for different target target molecule, optionally through an engineered reactive molecules and may be associated with the same or different site. The biosensor may respond to changes in the concentra reporter molecules. tion of the target molecule and may be useful for monitoring In another aspect, the application provides a method for the concentration of a target molecule over time. detecting at least one target molecule comprising providing at In certain embodiments, the biosensor may comprise two 40 least one biosensor comprising a selectivity component and a or more reporter molecules, which may be the same or dif reporter molecule and detecting the signal of the reporter ferent reporter molecules. The reporter molecule may be molecule, wherein interaction of the biosensor with the target detectable by a variety of methods, including, for example, a molecule produces a detectable change in the signal of the fluorescent spectrometer, filter fluorometer, microarray reporter molecule. In various other aspects, the biosensors of reader, optical fiber sensor reader, epifluorescence micro 45 the invention may be used for the detection of environmental Scope, confocal laser Scanning microscope, two photon exci pollutants, hazardous Substances, food contaminants, and tation microscope, or a flow cytometer. biological and/or chemical warfare agents. In certain embodiments, methods for preparing the biosen In various embodiments, the biosensors of the invention sors include generating selectivity components with an engi may be used to detect target molecules, including, for neered reporter molecule binding site using biological selec 50 example, cells, microorganisms (bacteria, fungi and viruses), tion methods. The reporter molecule binding site may be polypeptides, nucleic acids, hormones, cytokines, drug mol engineered to customize any of a number of properties, for ecules, carbohydrates, pesticides, dyes, amino acids, Small example, for optimal binding affinity to the reporter mol organic molecules and Small inorganic molecules. ecule, to enhance or otherwise change or tune the signal from Biosensors may be used for the detection of target mol the reporter molecule when it binds the selectivity compo 55 ecules both in vivo and in vitro. In certain embodiments, the nent, to provide a reactive site in the reporter molecule bind biosensor may be injected or implanted into a patient and the ing site so that the reporter molecule may covalently associate signal of the reporter molecule is detected externally. In one with the selectivity component upon binding in the binding exemplary embodiment, the biosensors of the application site, or to modulate or perturb the activity of the selectivity may be used for the detection of intracellular targets. In component when the reporter molecule binds to it. 60 another exemplary embodiment, the biosensors of the appli Accordingly, in certain embodiments, methods for gener cation may be attached to a fiber optic probe to facilitate ating a biosensor may comprise producing the selectivity position of the biosensor within a sample and readout from component by genetic selection, genetic engineering or a the biosensor through the optical fiber. combination of genetic selection and genetic engineering, so In still other embodiments, the biosensor may be expressed as to produce an engineered selectivity component. Methods 65 directly into the cell, tissue or subject to be analyzed. Using for producing the engineered selectivity components are molecular biology methods, a vector comprising at least a described further below. gene encoding a selectivity component is constructed and US 8,664,364 B2 15 16 inserted into the host, resulting in expression of the selectivity erence. These methods typically are much less cumbersome component, as described in more detail below. than preparation of hybridomas by traditional monoclonal Various, more detailed embodiments of and methods for antibody preparation methods. Binding epitopes may range producing the selectivity component and reporter molecule in size from Small organic compounds such as bromo uridine components are also further described below. and phosphotyrosine to oligopeptides on the order of 7-9 3. Selectivity Components amino acids in length. The selectivity component may be any molecule which is In another embodiment, the selectivity component may be capable of selectively interacting with a desired target mol an antibody fragment. Preparation of Antibody Fragments ecule, including, for example, cells, microorganisms (such as Maybe Accomplished by any Number of Well-Known meth bacteria, fungi and viruses), polypeptides, nucleic acids (such 10 ods. In one embodiment, phage display technology may be as oligonucleotides, cDNA molecules or genomic DNA frag used to generate antibody fragment selectivity components ments), hormones, cytokines, drug molecules, carbohydrates, that are specific for a desired target molecule, including, for pesticides, dyes, amino acids, or Small organic or inorganic example, Fab fragments, Fv's with an engineered intermo molecules. lecular disulfide bond to stabilize the V-V, pair, scFVs, or Exemplary target molecules include, for example, mol 15 diabody fragments. ecules involved in tissue differentiation and/or growth, cellu In certain embodiments, the selectivity component com lar communication, cell division, cell motility, and other cel prises a polypeptide sequence having at least about 85%, at lular functions that take place within or between cells, least about 90%, at least about 95%, about 96%, about 97%, including regulatory molecules such as growth factors, cytok about 98%, about 99% or about 100% sequence identity to the ines, morphogenetic factors, neurotransmitters, and the like. polypeptide sequence of SEQID NO: 2 (FIG. 1B). Vectors to In certain embodiments, target molecules may be bone mor produce the selectivity component may be prepared as phogenic protein, insulin-like growth factor (IGF), and/or described below with the nucleic acid encoding the polypep members of the hedgehog and Wnt polypeptide families. tide of SEQID NO:2 and its homologs (for example, SEQID Exemplary selectivity components include, for example, NO: 1 in FIG. 1A), and used to transfect host cells as pathway and network proteins (for example, enzymes such as 25 described further below. kinases or phosphatases), antibody fragments, non-antibody As an example, production of ScFV antibody fragments receptor molecules, aptamers, template imprinted materials, using phage display is described below. However, ScPV anti and organic or inorganic binding elements. Selectivity com body fragments for use in the selectivity components may be ponents having limited crossreactivity are generally pre generated by any method known in the art for doing so, ferred. 30 including genetic selection methods from a library of yeast 3.A. Exemplary Polypeptide Selectivity Components cells (see Boder and Wittrup (2000) Meth. Enzymol. 328:430 In certain embodiments, the selectivity component may be 33: Boder, et al. (2000) Proc. Natl. Acad. Sci USA 97: 10701 an antibody oran antibody fragment. For example, selectivity 5; and Swers, et al. (2004) Nucl. Acids. Res. 32:e36). components may be monoclonal antibodies, or derivatives or For phage display, an immune response to a selected analogs thereof, including without limitation: Fv fragments, 35 immunogen is elicited in an animal (Such as a mouse, rabbit, single chain FV (ScPV) fragments, Fab' fragments, F(ab') goat or other animal) and the response is boosted to expand fragments, single domain antibodies, camelized antibodies the immunogen-specific B-cell population. Messenger RNA and antibody fragments, humanized antibodies and antibody is isolated from those B-cells, or optionally a monoclonal or fragments, and multivalent versions of the foregoing; multi polyclonal hybridoma population. The mRNA is reverse Valent selectivity components including without limitation: 40 transcribed by known methods using either a poly-Aprimer monospecific or bispecific antibodies, such as disulfide sta or murine immunoglobulin-specific primer(s), typically spe bilized FV fragments, scEvtandems (scFV) fragments), dia cific to sequences adjacent to the desired V and V, chains, to bodies, tribodies or tetrabodies, which typically are yield cDNA. The desired V and A chains are amplified by covalently linked or otherwise stabilized (i.e., leucine Zipper polymerase chain reaction (PCR) typically using V and A or helix stabilized) scFv fragments; receptor molecules which 45 specific primer sets, and are ligated together, separated by a naturally interact with a desired target molecule. linker. V. and V specific primer sets are commercially avail In one embodiment, the selectivity component may be an able, for instance from Stratagene, Inc. of La Jolla, Calif. antibody. Preparation of antibodies may be accomplished by Assembled V-linker-V product (encoding an ScFV frag any number of well-known methods for generating mono ment) is selected for and amplified by PCR. Restriction sites clonal antibodies. These methods typically include the step of 50 are introduced into the ends of the V-linker-V, product by immunization of animals, typically mice; with a desired PCR with primers including restriction sites and the schv immunogen (e.g., a desired target molecule-or fragment fragment is inserted into a suitable expression vector (typi thereof). Once the mice have been immunized, and preferably cally a plasmid) for phage display. Other fragments, such as boosted one or more times with the desired immunogen(s), an Fab' fragment, may be cloned into phage display vectors monoclonal antibody-producing hybridomas may be pre 55 for Surface expression on phage particles. The phage may be pared and screened according to well known methods (see, any phage. Such as lambda, but typically is a filamentous for example, Kuby, Janis, IMMUNOLOGY.. Third Edition, phage, such as fa and M 13, typically M13. pp. 131-139, W.H. Freeman & Co. (1997), for a general In phage display vectors, the V-linker-V, Sequence is overview of monoclonal antibody production, that portion of cloned into a phage surface protein (for M 13, the surface which is incorporated herein by reference). 60 proteins g3p (pHI) org8p, most typically g3p). Phage display Over the past several decades, antibody production has systems also include phagemid systems, which are based on become extremely robust. In vitro methods that combine a phagemid plasmid vector containing the phage Surface pro antibody recognition and phage display techniques allow one tein genes (for example, g3p and g8p of M13) and the phage to amplify and select antibodies with very specific binding origin of replication. To produce phage particles, cells con capabilities. See, for example, Holt, L. J. et al., “The Use of 65 taining the phagemid are rescued with helperphage providing Recombinant Antibodies in Proteomics. Current Opinion in the remaining proteins needed for the generation of phage. Biotechnology 2000, 11:445-449, incorporated herein by ref Only the phagemid vector is packaged in the resulting phage US 8,664,364 B2 17 18 particles because replication of the phagemid is grossly plates in an N-terminal to C-terminal direction. Other affinity favored over replication of the helper phage DNA. Phagemid methods for isolating phage having a desired specificity packaging systems for production of antibodies are commer include affixing the immunogen to beads. The beads may be cially available. One example of a commercially available placed in a column and phage may be bound to the column, phagemid packaging system that also permits production of 5 washed and eluted according to standard procedures. Alter soluble Sclv fragments in bacteria cells is the Recombinant natively, the beads may be magnetic so as to permit magnetic Phage Antibody System (R.PAS), commercially available separation of the binding particles from the non-binding par from Amersham Pharmacia Biotech, Inc. of Piscataway, N.J. ticles. The immunogen also may be affixed to a porous mem and the pSKAN Phagemid Display System, commercially brane or matrix, permitting easy washing and elution of the available from MoBiTec, LLC of Marco Island, Fla. Phage 10 binding phage. display systems, their construction and screening methods are described in detailin, among others, U.S. Pat. Nos. 5,702, In certain embodiments, it may be desirable to increase the 892, 5,750,373, 5,821,047 and 6,127,132, each of which are specificity of the selectivity component for a given target incorporated herein by reference in their entirety. molecule or reporter molecule using a negative selection step Typically, once phage are produced that display a desired 15 in the affinity selection process. For example, selectivity com antibody fragment, epitope specific phage are selected by ponent displaying phage may be contacted with a Surface their affinity for the desired immunogen and, optionally, their functionalized with immunogens distinct from the target mol lack be used for physically separating immunogen-binding ecule or reporter molecule. Phage are washed from the sur phage from non-binding phage. Typically the immunogen is face and non-binding phage are grown to clonally expand the fixed to a surface and the phage are contacted with the Surface. population of non-binding phage thereby de-selecting phage Non-binding phage are washed away while binding phage that are not specific for the desired target molecule. In certain remain bound. Bound phage are later eluted and are used to embodiments, random synthetic peptides may be used in the re-infect cells to amplify the selected species. A number of negative selection step. In other embodiments, one or more rounds of affinity selection typically are used, often increas immunogens having structural similarity to the target mol ingly higher stringency washes, to amplify immunogen bind 25 ecule or reporter molecule may be used in the negative selec ing phage of increasing affinity. Negative selection tech tion step. For example, for a target molecule comprising a niques also may be used to select for lack of binding to a polypeptide, structurally similar immunogens may be desired target. In that case, un-bound (washed) phage are polypeptides having conservative amino acid Substitutions, amplified. including but not limited to the conservative substitution Although it is preferred to use spleen cells and/or B-lym 30 groups such as: (i) a charged group, consisting of Glu and phocytes from animals preimmunized with a desired immu Asp, Lys, Arg and His, (ii) a positively-charged group, con nogen as a source of cDNA from which the sequences of the sisting of Lys, Arg and His, (iii) a negatively-charged group, V, and V, chains are amplified by RT-PCR, naive (un-immu consisting of Glu and Asp, (iv) an aromatic group, consisting nized with the target immunogen) splenocytes and/or B-cells of Phe, Tyr and Trp., (v) a nitrogen ring group, consisting of may be used as a source of cDNA to produce a polyclonal set 35 His and Trp. (vi) a large aliphatic nonpolar group, consisting of V, and V, chains that are selected in vitro by affinity, of Val, Leu and Ile, (vii) a slightly polar group, consisting of typically by the above-described phage display (phagemid) Met and Cys, (viii) a small-residue group, consisting of Ser, method. When naive B-cells are used, during affinity selec Thr, Asp, Asn., Gly, Ala, Glu, Gln and Pro, (ix) an aliphatic tion, the washing of the first selection step typically is of very group consisting of Val, Leu, Ile, Met and Cys, and (X) a small high Stringency so as to avoid loss of any single clone that may 40 hydroxyl group consisting of Ser and Thr. Conservative Sub be present in very low copy number in the polyclonal phage stitutions also may be determined by one or more methods, library. By this naive method, B-cells may be obtained from such as those used by the BLAST (Basic Local Alignment any polyclonal source, B-cell or splenocyte cDNA libraries Search Tool) algorithm, such as a BLOSUM Substitution also are a source of cDNA from which the V and V, chains Scoring Matrix; such as the BLOSUM62 matrix, and the like. may be amplified. For example, Suitable murine and human 45 A functional way to define common properties between indi B-cell, lymphocyte and splenocyte cloNA libraries are com vidual amino acids is to analyze the normalized frequencies mercially available from Stratagene, Inc. and from Clontech of amino acid changes between corresponding proteins of Laboratories, Inc. of Palo Alto, Calif. Phagemid antibody homologous libraries and related screening services are provided commer Screening of selectivity components will best be accom cially by Cambridge Antibody Technology of the U.K. or 50 plished by high throughput parallel selection, as described in MorphoSys USA, Inc., of Charlotte, N.C. Holt et al. Alternatively, high throughput parallel selection The selectivity components do not have to originate from may be conducted by commercial entities, such as by Cam biological sources. Such as from naive or immunized immune bridge Antibody Technologies or MorphoSys USA, Inc. cells of animals or humans. The selectivity components may Alternatively, selection of a desired selectivity component be screened from a combinatorial library of synthetic pep 55 displaying phage may be carried out using the following tides. One such method is described in U.S. Pat. No. 5,948, method: 635, incorporated herein by reference, which described the Step 1: Affinity purify phage under low stringency condi production of phagemid libraries having random amino acid tions for their ability to bind to an immunogen fixed to a solid insertions in the plII gene of M13. These phage may be Support (for instance, beads in a column). clonally amplified by affinity selection as described above. 60 Step 2: Elute the bound phage and grow the eluted phage. Panning in a culture dish or flask is one way to physically Steps 1 and 2 may be repeated with more stringent washes in separate binding phage from non-binding phage. Panning Step 1. may be carried out in 96 well plates in which desired immu Step 3: Absorb the phage under moderate stringency with a nogen structures have been immobilized. Functionalized 96 given protein mixture digested with a proteolytic agent of well plates, typically used as ELISA plates, may be purchased 65 interest. Wash away the unbound phage with a moderately from Pierce of Rockwell, Ill. Polypeptides immunogens may stringent wash and grow the washed phage. Step 3 may be be synthesized directly on NH or COOH functionalized repeated with less stringent washes. US 8,664,364 B2 19 20 Step 4: Affinity purify phage under high Stringency for teolysis of an immunoglobulin molecule using the protease their ability to bind to the immunogen fixed to a solid support. papain. Papain digestion yields two identical antigen-binding Elute the bound phage and grow the eluted phage. fragments, termed "Fab fragments', each with a single anti Step 5: Plate the phage to select single plaques. Indepen gen-binding site, and a residual “Fe fragment'. In an exem dently grow phage selected from each plaque and confirm the plary embodiment, papain is first activated by reducing the specificity to the desired immunogen. Sulfhydryl group in the active site with cysteine, mercaptoet This is a general-guideline for the clonal expansion of hanol or dithiothreitol. Heavy metals in the stock enzyme immunogen-specific selectivity components. Additional may be removed by chelation with EDTA (2 mM) to ensure steps of varying stringency may be added at any stage to maximum enzyme activity. Enzyme and Substrate are nor optimize the selection process, or steps may be omitted or 10 mally mixed together in the ratio of 1:100 by weight. After re-ordered. One or more steps may be added where the phage incubation, the reaction can be stopped by irreversible alky population is selected for its inability to bind to other immu lation of the thiol group with iodoacetamide or simply by nogens by absorption of the phage population with those dialysis. The completeness of the digestion should be moni other immunogens and amplification of the unbound phage tored by SDS-PAGE and the various fractions separated by population. That step may be performed at any stage, but 15 protein A-Sepharose or ion exchange chromatography. typically would be performed after step 4. In still another embodiment, the selectivity component is a In certain embodiments, it may be desirable to mutate the F(ab')2 fragment. F(ab') antibody fragments may be prepared binding region of the selectivity component and select for from IgG molecules using limited proteolysis with the selectivity components with Superior binding characteristics enzyme pepsin. Exemplary conditions for pepsin proteolysis as compared to the un-mutated selectivity component. This are 100 times antibody excess w/w in acetate buffer at pH 4.5 may be accomplished by any standard mutagenesis tech and 37° C. Pepsin treatment of intact immunoglobulin mol nique. Such as by PCR with Taq polymerase under conditions ecules yields an F(ab') fragment that has two antigen-com that cause errors. In such a case, the PCR:primers could be bining sites and is still capable of crosslinking antigen. Fab' used to amplify sclv-encoding sequences of phagemid plas antibody fragments may be obtained by reducing F(ab')2 frag mids under conditions that would cause mutations. The PCR 25 ments using 2-mercaptoethylamine. The Fab' fragments may product may then be cloned into a phagemid vector and be separated from unsplit F(ab')2 fragments and concentrated screened for the desired specificity, as described above. by application to a Sephadex G-25 column (MT=46,000-58, In other embodiments, the selectivity components may be 000). In other embodiments, the selectivity component may modified to make them more resistant to cleavage by pro be a non-antibody receptor molecule, including, for example, teases. For example, the stability of the selectivity compo 30 receptors which naturally recognize a desired target mol nents of the present invention that comprise polypeptides may ecule, receptors which have been modified to increase their be increased by substituting one or more of the naturally specificity of interaction with a target molecule, receptor occurring amino acids in the (L) configuration with D-amino molecules which have been modified to interact with a acids. In various embodiments, at least 1%, 5%, 10%, 20%, desired target molecule not naturally recognized by the recep 50%, 80%, 90% or 100% of the amino acid residues of the 35 tor, and fragments of Such receptor molecules (see, e.g., selectivity components may be of the D configuration. The Skerra, J. Molecular Recognition 13: 167-187 (2000)). Switch from L to D amino acids neutralizes the digestion In other embodiments, the selectivity component may be a capabilities of many of the ubiquitous peptidases found in the network or pathway protein Such as an enzyme, for example, digestive tract. Alternatively, enhanced stability of the selec a phosphatase or kinase. Such proteins may be mutated to tivity components of the invention may be achieved by the 40 create a binding site for a reporter and/or target molecule. For introduction of modifications of the traditional peptide link example, a method of creating a biosensor from network and ages. For example, the-introduction of a cyclic ring within the pathway proteins in cells and tissues may comprise mutating polypeptide backbone may confer enhanced Stability in order a specific region on the selected protein to create a binding to circumvent the effect of many proteolytic enzymes known site for a reporter or target molecule. The region selected for to digest polypeptides in the stomach or other digestive 45 mutation may be randomly or partially randomly mutated by organs and in serum. In still other embodiments, enhanced creating mutations in selected regions of the gene that codes stability of the selectivity components may be achieved by for the protein that is to be converted into a selectivity com intercalating one or more dextrorotatory amino acids (such ponent. The gene with the mutated region(s) may be incor as, dextrorotatory phenylalanine or dextrorotatory tryp porated by transfection into a system capable of expressing tophan) between the amino acids of the selectivity compo 50 the protein in a way that allows reporter molecule (or target nent. In exemplary embodiments, such modifications molecule) binding and fluorescence sensitivity to the activity increase the protease resistance of the selectivity components (if a reporter molecule) to be assayed. For example, the DNA without affecting their activity or specificity of interaction with the mutated region may be transfected into yeast cells with a desired target molecule or reporter molecule. that are able to express many copies of the mutated protein In certain embodiments, the antibodies or variants thereof, 55 molecules on the cell surface (see Boder and Wittrup (2000) may be modified to make them less immunogenic when Meth. Enzymol. 328:430-33; Boder, et al. (2000) Proc. Natl. administered to a subject. For example, if the subject is Acad. Sci USA 97: 10701-5; and Swers, et al. (2004) Nucl. human, the antibody may be “humanized'; where the com Acids. Res. 32:e36). By isolating and identifying by selection plimentarily determining region(s) of the hybridoma-derived methods the genetic sequence of the particular protein within antibody has been transplanted into a human monoclonal 60 the mutated population that functions optimally as a selectiv antibody, for example as described in Jones, P. et al. (1986), ity component. For example, reporter molecule binding Nature 321,522-525, Tempest et al. (1991) Biotechnology 9, mutants may be detected and selected using magnetic bead 266-273, and U.S. Pat. No. 6,407,213. Also, transgenic mice, separation and by flow cytometry or image cytometry. or other mammals, may be used to express humanized anti Mutants that show a particular fluorescence signal change bodies. Such humanization may be partial or complete. 65 from bound reporter molecule in response to protein activity In another embodiment, the selectivity component is a Fab changes may be detected and isolated. In the case of engi fragment. Fab antibody fragments may be obtained by pro neering a reporter molecule binding site that is reactive, a US 8,664,364 B2 21 22 reactive group may be engineered into the site (such as a thiol) DNA or analogs or derivatives thereof, such as, without limi and ability to covalently bind the reporter molecule may be tation, peptide nucleic acids and phosphorothioate nucleic assayed. A biosensor can then be produced by combining the acids. reporter molecule with the optimized selectivity component In exemplary embodiments, nucleic acid ligands, or containing the engineered site. aptamers, may be prepared using the "SELEX methodology In other embodiments, a library of mutants is generated which involves selection of nucleic acid ligands which inter from a degenerate oligonucleotide sequence. There are many act with a target in a desirable manner combined with ampli ways by which the library may be generated from a degener fication of those selected nucleic acids. The SELEX process, ate oligonucleotide sequence. Chemical synthesis of a degen is described in U.S. Pat. Nos. 5,475,096 and 5,270,163 and erate gene sequence may be carried out in an automatic DNA 10 PCT Application No. WO 91/19813. These references, each synthesizer, and the synthetic genes may then be ligated into specifically incorporated herein by reference, are collectively an appropriate vector for expression. One purpose of a degen called the SELEX Patents. erate set of genes is to provide, in one mixture, all of the The SELEX process provides a class of products which are sequences encoding the desired set of potential protein nucleic acid molecules, each having a unique sequence, and sequences. The synthesis of degenerate oligonucleotides is 15 each of which has the property of binding specifically to a well known in the art (see for example, Narang, SA (1983) desired target compound or molecule. In various embodi Tetrahedron 39:3: Itakura et al., (1981) Recombinant DNA, ments, target molecules may be, for example, proteins, car Proc. 3rd Cleveland Sympos. Macromolecules, ed. AG Wal bohydrates, peptidoglycans or small molecules. SELEX ton, Amsterdam: Elsevier pp. 273-289; Itakura et al., (1984) methodology can also be used to target biological structures, Annu. Rev. Biochem. 53:323: Itakura et al., (1984) Science Such as cell Surfaces or viruses, through specific interaction 198: 1056; Ike et al., (1983) Nucleic Acid Res. 11:477). Such with a molecule that is an integral part of that biological techniques have been employed in the directed evolution of Structure. other proteins (see, for example, Scott et al., (1990) Science In its most basic form, the SELEX process may be defined 249:386-390; Roberts et al., (1992) Proc. Natl. Acad. Sci. 25 by the following series of steps: USA 89:2429-2433: Devlin et al., (1990) Science 249: 404 1) A candidate mixture of nucleic acids of differing 406; Cwirla et al., (1990) Proc. Natl. Acad. Sci. USA 87: sequence, is prepared. The candidate mixture generally 6378-6382: as well as U.S. Pat. Nos. 5,223,409, 5,198,346, includes regions offixed sequences (i.e., each of the members and 5,096,815). of the candidate mixture contains the same sequences in the Alternatively, other forms of mutagenesis may be utilized 30 same location) and regions of randomized sequences. The fixed sequence regions are selected either, (a) to assist in the to generate a combinatorial library. For example, mutants amplification steps described below, (b) to mimic a sequence may be generated and isolated from a library by Screening known to bind to the target, or (c) to enhance the concentra using, for example, alanine Scanning mutagenesis and the like tion of a given structural arrangement of the nucleic acids in (Rufet al., (1994) Biochemistry 33:1565-1572; Wang et al., 35 the candidate mixture. The randomized sequences can be (1994) J. Biol. Chem. 269:3095-3099: Balint et al., (1993) totally randomized (i.e., the probability of finding a base at Gene 137:109-118; Grodberg et al., (1993) Eur: J. Biochem. any position being one. in four) or only partially randomized 218:597-601; Nagashima et al., (1993).J. Biol. Chem. 268: (e.g., the probability of finding a base at any location can be 2888-2892; Lowman et al., (1991) Biochemistry 30:10832 selected at any level between 0 and 100 percent). 10838; and Cunningham et al., (1989) Science 244: 1081 40 2) The candidate mixture is contacted with the selected 1085), by linker scanning mutagenesis (Gustin et al., (1993) target under conditions favorable for binding between the Virology 193:653-660; Brown et al., (1992) Mol. Cell. Biol. target and members of the candidate mixture. Under these 12:2644-2652; McKnight et al., (1982) Science 232:316); by circumstances, the interaction between the target and the saturation mutagenesis (Meyers et al., (1986) Science 232: nucleic acids of the candidate mixture can be considered as 613); by PCR mutagenesis (Leung et al., (1989) Method Cell 45 forming nucleic acid-target pairs between the target and those Mol Biol 1:11-19); or by random mutagenesis (Miller et al., nucleic acids having the strongest affinity for the target. (1992) A Short Course in Bacterial Genetics, CSHL Press, 3) The nucleic acids with the highest affinity for the target Cold Spring Harbor, N.Y.; and Greener et al., (1994) Strate are partitioned from those nucleic acids with lesser affinity to gies in Mol Biol 7:32-34). Linker scanning mutagenesis, par the target. Because only an extremely small number of ticularly in a combinatorial setting, is an attractive method for 50 sequences (and possibly only one molecule of nucleic acid) identifying selectivity components. corresponding to the highest affinity nucleic acids exist in the 3.B. Exemplary Polynucleotide Selectivity Components candidate mixture, it is generally desirable to set the parti In still other embodiments, the selectivity component may tioning criteria So that a significant amount of the nucleic be an aptamer. Aptamers are oligonucleotides that are acids in the candidate mixture (approximately 5-50%) are selected to bind specifically to a desired molecular structure. 55 retained during partitioning. Aptamers typically are the products of an affinity selection 4) Those nucleic acids selected during partitioning as hav process similar to the affinity selection of phage display (also ing the relatively higher affinity for the target are then ampli known as in vitro molecular evolution). The process involves fied to create a new candidate mixture that is enriched in performing several tandem iterations of affinity separation, nucleic acids having a relatively higher affinity for the target. e.g., using a solid Support to which the desired immunogen is 60 5) By repeating the partitioning and amplifying steps bound, followed by polymerase chain reaction (PCR) to above, the newly formed candidate mixture contains fewer amplify nucleic acids that bound to the immunogens. Each and fewer unique sequences, and the average degree of affin round of affinity separation thus enriches the nucleic acid ity of the nucleic-acids to the target will generally increase. population for molecules that successfully bind the desired The SELEX-process ultimately may yield a candidate mix immunogen. In this manner, a random pool of nucleic acids 65 ture containing one or a small number of unique nucleic acids may be “educated to yield aptamers that specifically bind representing those nucleic acids from the original candidate target molecules. Aptamers typically are RNA, but may be mixture having the highest affinity to the target molecule. US 8,664,364 B2 23 24 The basic SELEX method has been modified to achieve a carbohydrate, a polymer, or a chemical moiety and combina number of specific objectives. For example, U.S. Pat. No. tions or variants thereof. In certain embodiments, exemplary 5,707,796 describes the use of the SELEX process in con chemical handles, include, for example, glutathione S-trans junction with gel electrophoresis to select nucleic acid mol ferase (GST); protein A, protein G, calmodulin-binding pep ecules with specific structural characteristics, such as bent tide, thioredoxin, maltose binding protein, HA, myc, poly DNA. U.S. Pat. No. 5,580,737 describes a method for iden arginine, poly H is, poly His-Asp or FLAG tags. Additional tifying highly specific nucleic acid ligands able to discrimi exemplary chemical handles include polypeptides that alter nate between closely related molecules, termed Coun protein localization in vivo. Such as signal peptides, type III terSELEX. U.S. Pat. No. 5,567,588 describes a SELEX secretion system-targeting peptides, transcytosis domains, based method which achieves highly efficient partitioning 10 between oligonucleotides having high and low affinity for a nuclear localization signals, etc. target molecule. U.S. Pat. Nos. 5,496,938 and 5,683,867 In various embodiments, a selectivity component of the describe methods for obtaining improved nucleic acid ligands invention may comprise one or more chemical handles, after SELEX has been performed. including multiple copies of the same chemical handle or two In certain-embodiments, nucleic acid ligands as described 15 or more different chemical handles. It is also within the scope herein may comprise modifications that increase their stabil of the invention to include a linker (such as a polypeptide ity, including, for example, modifications that provide sequence or a chemical moiety) between a selectivity com increased resistance to degradation by enzymes Such as endo ponent of the invention and the chemical handle in order to nucleases and exonucleases, and/or modifications that facilitate construction of the molecule or to optimize its struc enhance or mediate the delivery of the nucleic acid ligand tural constraints. (see, e.g., U.S. Pat. Nos. 5.660,985 and 5,637,459). Examples In another embodiment, a selectivity component of the of Such modifications include chemical Substitutions at the invention may be modified so that its rate of traversing the ribose and/or phosphate and/or base positions. In various cellular membrane is increased. For example, the selectivity embodiments, modifications of the nucleic acid ligands may component may be attached to a peptide which promotes include, but are not limited to, those which provide other 25 “transcytosis, e.g., uptake of a polypeptide by cells. The chemical groups that incorporate additional charge, polariz peptide may be a portion of the HIV transactivator (TAT) ability, hydrophobicity, hydrogen bonding, electrostatic protein, such as the fragment corresponding to residues 37-62 interaction, and fluxionality to the nucleic acid ligand bases or or 48-60 of TAT, portions which have been observed to be to the nucleic acid ligand as a whole. Such modifications rapidly taken up by a cell in vitro (Green and Loewenstein, include, but are not limited to. 2'-position Sugar modifica 30 (1989) Cell 55:1179-1188). Alternatively, the internalizing tions, 5-position pyrimidine modifications, 8-position purine peptide may be derived from the Drosophila antennapedia modifications, modifications at exocyclic amines, substitu tion of 4-thiouridine, substitution of 5-bromo or 5-iodo protein, or homologs thereof. The 60 amino acid long home uracil; backbone modifications, phosphorothioate or alkyl odomain of the homeo-protein antennapedia has been dem phosphate modifications, methylations, unusual base-pairing 35 onstrated to translocate through biological membranes and combinations such as the isobases isocytidine and isoguani can facilitate the translocation of heterologous polypeptides dine and the like. Modifications may also include 3' and 5' to which it-is coupled. Thus, selectivity components may be modifications such as capping. In exemplary embodiments, fused to a peptide consisting of about amino acids 42-58 of the nucleic acid ligands are RNA molecules that are 2'-fluoro Drosophila antennapedia or shorter fragments for transcyto (2'-F) modified on the sugar moiety of pyrimidine residues. 40 sis (Derossi et al. (1996) J Biol Chem 271:18188-18193; 3.C. Other Exemplary Selectivity Components Derossi et al. (1994) J Biol Chem 269:10444-10450; and In other embodiments, the selectivity components may be Perez et al. (1992).J Cell Sci 1.02:717-722). The transcytosis template imprinted material. Template imprinted materials polypeptide may also be a non-naturally-occurring mem are structures which have an outer Sugar layer and an under brane-translocating sequence (MTS). Such as the peptide lying plasma-deposited layer. The outer Sugar layer contains 45 sequences disclosed in U.S. Pat. No. 6,248.558. indentations or imprints which are complementary in shape to In still other embodiments, the selectivity component may a desired target molecule or template so as to allow specific comprise a fusion protein of any of the above-described interaction between the template imprinted structure and the polypeptide selectivity components containing at least one target molecule to which it is complementary. Template domain which increases its solubility and/or facilitates its imprinting can be utilized on the Surface of a variety of 50 purification, identification, detection, targeting and/or deliv structures, including, for example, medical prostheses (such ery. Exemplary domains, include, for example, glutathione as artificial heart valves, artificial limb joints, contact lenses S-transferase (GST), protein A, protein G, calmodulin-bind and stents), microchips (preferably silicon-based microchips) ing peptide, thioredoxin, maltose binding protein, HA, myc, and components of diagnostic equipment designed to detect poly arginine, poly His, poly His-Asp or FLAG fusion pro specific microorganisms, such as viruses or bacteria. Tem 55 teins and tags. Additional exemplary domains include plate-imprinted materials are discussed in U.S. Pat. No. domains that alter protein localization in vivo. Such as signal 6,131,580, which is hereby incorporated by reference in its peptides, type III secretion system-targeting peptides, tran entirety. Scytosis domains, nuclear localization signals, and targeting 3.D. Modification of Selectivity Components for Incorpo moieties, i.e. proteins specific for a target molecule, etc. In ration into Biosensors and Exemplary Embodiments Wherein 60 various embodiments, a polypeptide of the invention may the Selectivity Component is Produced Independently of the comprise one or more heterologous fusions. Polypeptides Cell or Tissue to be Analyzed may contain multiple copies of the same fusion domain or In certain embodiments, a selectivity component of the may contain fusions to two or more different domains. The invention may contain a chemical handle which facilitates its fusions may occurat the N-terminus of the polypeptide, at the isolation, immobilization, identification, or detection and/or 65 C-terminus of the polypeptide, or at both the N- and C-termi which increases its solubility. In various embodiments, nus of the polypeptide. Linker sequences between a polypep chemical handles may be a polypeptide, a polynucleotide, a tide of the invention and the fusion domain may be included US 8,664,364 B2 25 26 in order to facilitate construction of the fusion protein or to The substrate surface shall comprise molecules of formula optimize protein expression or structural constraints of the X(a)-R(b)-Y(c), wherein R is a spacer, X is a functional group fusion protein. that binds R to the surface, Y is a functional group for binding In exemplary embodiments, the dissociation constant of to the biosensor, (a) is an integer from 0 to about 4, (b) is either the selectivity component for a target molecule is optimized 5 0 or 1, and (c) is an integer not equal to 0. Note that when both to allow real time monitoring of the presence and/or concen (a) and (b) are Zero, the Substrate Surface comprises func tration of the analyte in a given patient, sample, or environ tional groups Y as would be seen, for example, with poly ment. meric Substrates or coatings. When (a) and (b) are not equal to The selectivity components (for example, phage, antibod 0, then X(a)-R(b)-Y(c) describes, for example, monolayers ies, antibody fragments, aptamers, etc.) may be affixed to a 10 suitable substrate by a number of known methods. Typically Such as a self assembled monolayers that form on a metal the Surface of the Substrate is functionalized in Some manner, surface. X(a)-R(b)-Y(c) may also describe such compounds so that a crosslinking compound or compounds may as 3-aminopropyltrimethoxysilane, wherein X is covalently link the selectivity component to the substrate. For —Si(OMe), R is —CH2CH2CH2—, and Y is NH. This example, a substrate functionalized with carboxyl groups 15 compound is known to coat porous glass Surfaces to form an may be linked to free amines in the selectivity components aminopropyl derivative of the glass. Biochem. Biophys. Act., using EDC or by other common chemistries, such as by 1970, 212, 1, J. Chromatography, 1974, 97, 39. linking with N-hydroxysuccinimide. A variety of crosslink Other definitions for F. X., and Y include the following. R ing chemistries are commercially available, for instance, optionally comprises a linear or branched hydrocarbon chain from Pierce of Rockford, Ill. from about 1 to about 400 carbons long. The hydrocarbon For attachment of the sensor units to surfaces there are a chain may comprise an alkyl, aryl, alkenyl, alkynyl, number of traditional attachment technologies. For example, cycloalkyl, alkaryl, aralkyl group, or any combination activated carboxyl groups on the substrate will link the sensor thereof. If (a) and (c) are both equal to one, then R is typically units to the Substrate via —NH groups on the selectivity an alkyl chain from about 3 to about 30 carbons long. In a component of the biosensor. The substrate of the array may be 25 preferred embodiment, if (a) and (b) are both equal to one, either organic or inorganic, biological or non-biological, or then Risan alkyl, chain from about 8 to about 22 carbons long any combination of these materials. Numerous materials are and is, optionally, a straight alkane. However, it is also con suitable for use as a substrate for the sensor units of the templated that in an alternative embodiment, R may readily invention. For instance, the Substrate of the invention sensors comprise a linear or branched hydrocarbon chain from about can comprise a material selected from a group consisting of 30 2 to about 400 carbons long and be interrupted by at least one silicon, silica, quartz, glass, controlled pore glass, carbon, hetero atom. The interrupting hetero groups can include alumina, titania, tantalum oxide, germanium, silicon nitride, - O -, CONH CONHCO. , NH , CSNH Zeolites, and gallium arsenide. Many metals such as gold, CO , —CS , —S , —SO , —(OCHCH)n- (where platinum, aluminum, copper, titanium, and their alloys are n=1-20), —(CF)n (where n=1-22), and the like. Alterna also options for Substrates of the array. In addition, many 35 tively, one or more of the hydrogen moieties of R can be ceramics and polymers may also be used as Substrates. Poly substituted with deuterium. In alternative embodiments, R mers which may be used as Substrates include, but are not may be more than about 400 carbons long. limited to, the following: polystyrene; poly(tetra) fluoroeth X may be chosen as any group which affords chemisorp ylene (PTFE); polyvinylidenedifluoride; polycarbonate; tion or physisorption of the monolayer onto the surface of the polymethylmethacrylate; polyvinylethylene; polyethylene 40 substrate (or the coating, if present). When the substrate or imine; poly(etherether)ketone; polyoxymethylene (POM); coating is a-metal or metal alloy, X, at least prior to incorpo polyvinylphenol; polylactides; polymethacrylimide (PMI); ration into the monolayer, can in one embodiment be chosen polyalkenesulfone (PAS); polypropylethylene, polyethylene; to be an asymmetrical or symmetrical disulfide, Sulfide, dis polyhydroxyethylmethacrylate (HEMA); polydimethylsi elenide, selenide, thiol, isonitrile, selenol, a trivalent phos loxane; polyacrylamide; polyimide; and block copolymers. 45 phorus compound, isothiocyanate, isocyanate, Xanthanate, Preferred substrates for the array include silicon, silica, glass, thiocarbamate, a phosphine, an amine, thio acid or a dithio and polymers. The Substrate on which the sensors reside may acid. This embodiment is especially preferred when a coating also be a combination of any of the aforementioned substrate or Substrate is used that is a noble metal such as gold, silver, materials. or platinum. Abiosensor of the present invention may optionally further 50 If the Substrate is a material Such as silicon, silicon oxide, comprise a coating between the Substrate and the bound bio indium tin oxide, magnesium oxide, alumina, quartz, glass, or sensor molecule. This coating may either be formed on the silica, then, in one embodiment, the biosensor may comprise substrate or applied to the substrate. The substrate can be an X that, prior to incorporation into said monolayer, is a modified with a coating by using thin-film technology based, monohalosilane, dihalosilane, tihalosilane, trialkoxysilane, for instance, on physical vapor deposition (PVD), plasma 55 dialkoxysilane, or a monoalkoxysilane. Among these silanes, enhanced chemical vapor deposition (PECVD), or thermal trichlorosilane and trialkoxysilane are exemplary. processing. Alternatively, plasma exposure can be used to In certain embodiments, the substrate is selected from the directly activate or alter the Substrate and create a coating. For group consisting of silicon, silicon dioxide, indium tin oxide, instance, plasma etch procedures can be used to oxidize a alumina, glass, and titania; and X is selected from the group polymeric Surface (for example, polystyrene or polyethylene 60 consisting of a monohalosilane, dihalosilane, tihalosilane, to expose polar functionalities such as hydroxyls, carboxylic trichlorosilane, trialkoxysilane, dialkoxysilane, monoalkox acids, aldehydes and the like) which then acts as a coating. ysilane, carboxylic acids, and phosphates. The coating may also comprise a composition selected In another embodiment, the substrate of the sensor is sili from the group consisting of silicon, silicon oxide, titania, con and X is an olefin. tantalum oxide, silicon nitride, silicon hydride, indium tin 65 In still another embodiment, the coating (or the substrate if oxide, magnesium oxide, alumina, glass, hydroxylated Sur no coating is present) is titania or tantalum oxide and X is a faces, and polymers. phosphate. US 8,664,364 B2 27 28 In other embodiments, the surface of the substrate (or coat No. 5,620.850), activated hydroxyl, haloacetyl, bromoacetyl, ing thereon) is composed of a material Such as titanium oxide; iodoacetyl, activated carboxyl, hydrazide, epoxy, aziridine, tantalum oxide, indium tin oxide, magnesium oxido, or alu sulfonylchloride, trifluoromethyldiaziridine, pyridyldisul mina where X is a carboxylic acid or alkylphosphoric acid. fide, N-acyl-imidazole, imidazolcearbatinate, vinylsulfone, Alternatively, if the surface of the substrate (or coating Succinimidylcarbonate, arylazide, anhydride, diazoacetate, thereon) of the sensor is copper, then X may optionally. be a benzophenone, isothiocyanate, isocyanate, imidoester, fluo hydroxamic acid. robenzene, and biotin. If the substrate used in the invention is a polymer, then in In an alternative embodiment, the functional group Y is many cases a coating on the Substrate Such as a copper coating selected from the group of simple functional moieties. Pos will be included in the sensor. An appropriate functional 10 sible Y functional groups include, but are not limited to group X for the coating would then be chosen for use in the OH, NH, -COOH, -COOR, RSR, PO, sensor. In an alternative embodiment comprising a polymer –OSO,-COONR, SOO, CN, -NR, and the like. substrate, the surface of the polymer may be plasma modified In another embodiment, one or more biosensor species to expose desirable surface functionalities for monolayer for may be bound to discrete beads or microspheres. The micro mation. For instance, EP 78.0423 describes the use of a mono 15 spheres typically are either carboxylated or avidin-modified layer molecule that has an alkene X functionality on a plasma so that proteins, such as antibodies, non-antibody receptors exposed surface. Still another possibility for the invention and variants and fragments thereof, may be readily attached sensor comprised of a polymer is that the Surface of the to the beads by standard chemistries. In an exemplary polymer on which the monolayer is formed is functionalized embodiment, the selectivity components are scFV fragments. by copolymerization of appropriately functionalized precur The scFv fragments may be bound to carboxylated beads by Sor molecules. one of many linking chemistries, such as, for example, EDC Another possibility is that prior to incorporation into the chemistry, or bound to avidin-coated beads by first biotiny monolayer, X can be a free radical-producing moiety. This lating the ScFV fragment by one of many common biotinyla functional group is especially appropriate when the Surface tion chemistries, such as, for example, by conjugation with on which the monolayer is formed is a hydrogenated silicon 25 Sulfo-NHS-LC-biotin. surface. Possible free-radical producing moieties include, but In another embodiment, two or more biosensors areaffixed are not limited to, diacylperoxides, peroxides, and azo com to one or more Supports at discrete locations (that is, biosen pounds. Alternatively, unsaturated moieties such as unsubsti sors having a first specificity are affixed at a first spatial tuted alkenes, alkynes, cyanocompounds and isonitrile com location, biosensors having a second specificity are affixed at pounds can be used for —X, if the reaction with X is 30 a second spatial location, etc.). In one embodiment, the bio accompanied by ultraviolet, infrared, visible, or microwave sensors are affixed to a Substrate in a tiled array, with each radiation. biosensor represented in one or more positions in the tiled In alternative embodiments, X may be a hydroxyl, car array. The spatial configuration of the Substrate or Substrates boxyl, vinyl, Sulfonyl, phosphoryl, silicon hydride, or an may be varied so long as each biosensor species is bound at amino group. 35 detectably discrete locations. The substrate and tiled biosen The component Y is a functional group responsible for Sor pattern typically is planar, but may be any geometric binding a dye containing sensor onto the Substrate. In one configuration desired. For instance, the Substrate may be a embodiment, the Y group is either highly reactive (activated) strip or cylindrical, as illustrated in U.S. Pat. No. 6,057,100. towards the dye containing sensor or is easily converted into In exemplary embodiments, the Substrate may be glass-or Such an activated form. In certain embodiments, the coupling 40 other silicic compositions; such as those used in the semicon of Y with the selectivity component of the biosensor occurs ductor industry. readily under normal physiological conditions. The func Fabrication of the substrate may be by one of many well tional group Y may either form a covalent linkage or a non known processes. In various embodiments, the biosensors of covalent linkage with the selectivity component of the bio the array may be associated with the same reporter molecule sensor. In other embodiments, the functional group Y forms a 45 or may be associated with different reporter molecules. Iden covalent linkage with the selectivity component of the bio tification of a biosensor that interacts with a target molecule sensor. It is understood that following the attachment of the may be based on the signal from the reporter molecule, the selectivity component of the biosensor to Y, the chemical location of the biosensor on the array, or a combination nature ofY may have changed. Upon attachment of the bio thereof. Arrays may be used in association with both the in sensor, Y may even have been removed from the organic 50 vitro and in vivo applications of the invention. linker. In various embodiments, the arrays may comprise any of In one embodiment of the sensor of the present invention, the biosensors described herein, including, for example, Y is a functional group that is activated in situ. Possibilities arrays of biosensors wherein the selectivity components are for this type of functional group include, but are not limited polypeptides (including, antibodies and variants or fragments to. Such simple moieties such as a hydroxyl, carboxyl, amino, 55 thereof), polynucleotides (i.e., aptamers), template imprinted aldehyde, carbonyl, methyl, methylene, alkene, allyne, car materials, organic binding elements, and inorganic binding bonate, aryliodide, or a vinyl group. Appropriate modes of elements. The arrays may comprise one type of biosensor or activation would be obvious to one skilled in the art. Alterna a mixture of different types of biosensors (e.g., a mixture of tively, Y can comprise a functional group that requires pho biosensors having polypeptide and polynucleotide selectivity toactivation prior to becoming activated enough to trap the 60 components). Protein microarrays are described, for protein capture agent. example, in PCT Publication WO 00/04389, incorporated In another embodiment, Y is a complex and highly reactive herein by reference. Examples of commercially available functional moiety that needs no in situ activation prior to protein microarrays are those of Zyomyx of Hayward, Calif., reaction with the selectivity component of the biosensor. Ciphergen Biosystems, Inc. of Fremont, Calif. and Nanogen, Such possibilities forY include, but are not limited to, male 65 Inc. of San Diego, Calif. Nucleic acid microarrays are imide, N-hydroxysuccinimide (Wagner et al., Biophysical described, for example, in U.S. Pat. Nos. 6,261,776 and Journal, 1996,70:2052-2066), nitrilotriacetic acid (U.S. Pat. 5,837.832. Examples of commercially available nucleic acid US 8,664,364 B2 29 30 microarrays are those of Affymetrix, Inc. of Santa Clara, (1990) Journal of Bacteriology 172:6863; de Lorenzo, V. et Calif., BD Biosciences Clontech of Palo Alto, Calif. and al. (1987) Journal of Bacteriology 169:2624; and Hantke, K. Sigma-Aldrich Corp. of St. Louis, Mo. (1981) Molecular & General Genetics 182:288. 3.E. Exemplary Embodiments Wherein the Selectivity In another embodiment, a signal peptide sequence is added Component is Expressed in the Cell or Tissue to be Analyzed to the construct, such that the selectivity component is In other embodiments, the selectivity component is secreted from cells. Such signal peptides are well known in expressed within the cell or organism or Subject to be ana the art. lyzed. The expression methods described below may also be In one embodiment, the powerful phage T5 promoter, that used to express a selectivity component in a host cell that is is recognized by E. coli RNA polymerase is used together then isolated and purified for use in the methods, wherein the 10 with a lac operator repression module to provide tightly regu biosensor is generated from a source external to the cell or tissue to be analyzed. lated, high level expression or recombinant proteins in E. coli. Generally, a nucleic acid encoding a selectivity component In this system, protein expression is blocked in the presence is introduced into a host cell. Such as by transfection or of high levels of lac repressor. infection, and the host cell is cultured underconditions allow 15 In one embodiment, the DNA is operably linked to a first ing expression of the selectivity component. Methods of promoter and the bacterium further comprises a second DNA introducing nucleic acids into prokaryotic and eukaryotic encoding a first polymerase which is capable of mediating cells are well known in the art. Suitable media for mammalian transcription from the first promoter, wherein the DNA and prokaryotic host cell culture are well known in the art. In encoding the first polymerase is operably linked to a second Some instances, the nucleic acid encoding the Subject promoter. In a preferred embodiment, the second promoter is polypeptide is under the control of an inducible promoter, a bacterial promoter, Such as those delineated above. In an which is induced once the host cells comprising the nucleic even more preferred embodiment, the polymerase is a bacte acid have divided a certain number of times. For example, riophage polymerase, e.g., SP6, T3, or T7 polymerase and the where a nucleic acid is under the control of a beta-galactose first promoteris a bacteriophage promoter, e.g., an SP6, T3, or operator and repressor, isopropyl beta-D-thiogalactopyrano 25 T7 promoter, respectively. Plasmids comprising bacterioph side (IPTG) is added to the culture when the bacterial host age promoters and plasmids encoding bacteriophage poly cells have attained a density of about ODoo 0.45-0.60. The merases can be obtained commercially, e.g., from Promega culture is then grown for some more time to give the host cell Corp. (Madison, Wis.) and InVitrogen (San Diego, Calif.), or the time to synthesize the polypeptide. Cultures are then can be obtained directly from the bacteriophage using stan typically frozen and may be stored frozen for Some time, prior 30 dard recombinant DNA techniques (J. Sambrook, E. Fritsch, to isolation and purification of the polypeptide. T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Thus, a nucleotide sequence encoding all or part of a selec Spring Laboratory Press, 1989). Bacteriophage polymerases tivity component may be used to produce a recombinant form and promoters are further described, e.g., in the following of a selectivity component via microbial or eukaryotic cellu references: Sagawa, H. et al. (1996) Gene 168:37: Cheng, X. lar processes. Ligating the sequence into a polynucleotide 35 etal. (1994) Proc. Natl. Acad. Sci. USA 91:4034; Dubendorff, construct, Such as an expression vector, and transforming, J. W. and F. W. Studier (1991) Journal of Molecular Biology infecting, or transfecting into hosts, either eukaryotic (yeast, 2 19:45; Bujarski, J. J. and P. Kaesberg (1987) Nucleic Acids avian, insect or mammalian) or prokaryotic (bacterial cells), Research 15:1337; and Studier, F. W. etal. (1990) Methods in are standard procedures. Similar procedures, or modifications Enzymology 185:60). Such plasmids can further be modified thereof, may be employed to prepare recombinant polypep 40 according to the specific embodiment of the invention. tides by microbial means or tissue-culture technology in In another embodiment, the bacterium further comprises a accord with the subject invention. DNA encoding a second polymerase which is capable of Other embodiments of nucleic acid sequences encoding mediating transcription from the second promoter, wherein the selectivity components, as well as vectors, host cells, and the DNA encoding the second polymerase is operably linked cultures thereof are further described below. 45 to a third promoter. In a preferred embodiment, the third In another embodiment, the nucleic acid encoding a selec promoter is a bacterial promoter. However, more than two tivity component is operably linked to a bacterial promoter, different polymerases and promoters could be introduced in a e.g., the anaerobic E. coli, NirB promoter or the E. coli lipo bacterium to obtain high levels of transcription. The use of protein 11p promoter, described, e.g., in Inouye et al. (1985) one or more polymerase for mediating transcription in the Nucl. Acids Res. 13:3101; Salmonella pagC promoter (Miller 50 bacterium can provide a significant increase in the amount of et al., Supra), Shigella ent promoter (Schmitt and Payne, J. polypeptide in the bacterium relative to a bacterium in which Bacteriol. 173:816 (1991)), the tet promoter on Tn 10 (Miller the DNA is directly under the control of a bacterial promoter. et al., Supra), or the ctX promoter of Vibrio cholera. Any other The selection of the system to adopt will vary depending on promoter can be used in the invention. The bacterial promoter the specific use of the invention, e.g., on the amount of protein can be a constitutive promoter or an inducible promoter. An 55 that one desires to produce. exemplary inducible promoter is a promoter which is induc When using a prokaryotic host cell, the host cell may ible by iron or in iron-limiting conditions. In fact, some bac include a plasmid which expresses an internal T7 lysozyme, teria, e.g., intracellular organisms, are believed to encounter e.g., expressed from plasmid. Lysis of such host cells liberates iron-limiting conditions in the host cytoplasm. Examples of the lysozyme which then degrades the bacterial membrane. iron-regulated promoters of Fep A and TonB are known in the 60 Other sequences that may be included in a vector for art and are described, e.g., in the following references: Head expression in bacterial or other prokaryotic cells include a ley, V. etal. (1997) Infection & Immunity 65:818; Ochsner, U. synthetic ribosomal binding site; strong transcriptional ter A. et al. (1995) Journal of Bacteriology 177.7194; Hunt, M. minators, e.g., t0 from phage lambda and tA from the rrnB D. et al. (1994) Journal of Bacteriology 176:3944; Svinarich, operon in E. coli, to prevent read through transcription and D. M. and S. Palchaudhuri. (1992) Journal of Diarrhoeal 65 ensure stability of the expressed polypeptide; an origin of Diseases Research 10:139; Prince, R. W. et al. (1991) replication, e.g., ColE1; and beta-lactamase gene, conferring Molecular Microbiology 5:2823; Goldberg, M. B. et al. ampicillin resistance. US 8,664,364 B2 31 32 Other host cells include prokaryotic host cells. Even more Arlington Heights, Ill.; and GIBCO/BRL, Grand Island, N.Y. preferred host cells are bacteria, e.g., E. coli. Other bacteria In vitro translation systems typically comprise macromol that can be used include Shigella spp., Salmonella spp., List ecules, such as enzymes, translation, initiation and elongation eria spp., Rickettsia spp., Yersinia spp., Escherichia spp., factors, chemical reagents, and ribosomes. In addition, an in Klebsiella spp., Bordetella spp., Neisseria spp., Aeromonas vitro transcription system may be used. Such systems typi spp., Franciesella spp., Corynebacterium spp., Citrobacter cally comprise at least an RNA polymerase holoenzyme, spp., Chlamydia spp., Hemophilus spp., Brucella spp., Myco ribonucleotides and any necessary transcription initiation, bacterium spp., Legionella spp., Rhodococcus spp., elongation and termination factors. An RNA nucleotide for in Pseudomonas spp., Helicobacter spp., Vibrio spp., Bacillus vitro translation may be produced using methods known in spp., and Erysipelothrix spp. Most of these bacteria can be 10 the art. In vitro transcription and translation may be coupled obtained from the AmericanType Culture Collection (ATCC: in a one-pot reaction to produce proteins from one or more 10801 University Blvd., Manassas, Va. 20110-2209). isolated DNAs. A number of vectors exist for the expression of recombi When expression of a carboxy terminal fragment of a nant proteins in yeast. For instance, YEP24, YIP5, YEP51, polypeptide is desired, i.e. a truncation mutant, it may be YEP52, pYES2, and YRP17 are cloning and expression 15 necessary to add a start codon (ATG) to the oligonucleotide vehicles useful in the introduction of genetic constructs into fragment comprising the desired sequence to be expressed. It S. cerevisiae (see, for example, Broach et al., (1983) in is well known in the art that a methionine at the N-terminal Experimental Manipulation of Gene Expression, ed. M. position may be enzymatically cleaved by the use of the Inouye Academic Press, p. 83). These vectors may replicate in enzyme methionine aminopeptidase (MAP). MAP has been E. coli due the presence of the pBR322 ori, and in S. cerevi cloned from E. coli (Ben-Bassat et al., (1987) J. Bacteriol. siae due to the replication determinant of the yeast 2 micron 169:751–757) and Salmonella typhimurium and its in vitro plasmid. In addition, drug resistance markers such as ampi activity has been demonstrated on recombinant proteins cillin may be used. (Miller et al., (1987) Proc. Natl. Acad. Sci. USA 84:2718 In certain embodiments, mammalian expression vectors 1722). Therefore, removal of an N-terminal methionine, if contain both prokaryotic sequences to facilitate the propaga 25 desired, may be achieved either in vivo by expressing Such tion of the vector in bacteria, and one or more eukaryotic recombinant polypeptides in a host which produces MAP transcription units that are expressed in eukaryotic cells. The (e.g., E. coli or CM89 or S. cerevisiae), or in vitro by use of pcDNAI/amp, pcDNAI/neo, pRc/CMV. pSV2gpt, pSV2neo, purified MAP (e.g., procedure of Miller et al.). pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo and In cases where plant expression vectors are used, the pHygderived vectors are examples of mammalian expression 30 expression of a polypeptide may be driven by any of a number vectors suitable for transfection of eukaryotic cells. Some of of promoters. For example, viral promoters such as the 35S these vectors are modified with sequences from bacterial RNA and 19S RNA promoters of CaMV (Brissonet al., 1984, plasmids, such as pBR322, to facilitate replication and drug Nature, 310:51 1-514), or the coat protein promoter of TMV resistance selection in both prokaryotic and eukaryotic cells. (Takamatsu et al., 1987, EMBO.J., 6:307-311) may be used; Alternatively, derivatives of viruses such as the bovine pap 35 alternatively, plant promoters such as the Small Subunit of illoma virus (BPV-1), or Epstein-Barr virus (pHEBo, pREP RUBISCO (Coruzzi et al., 1994, EMBO.J., 3:1671-1680; derived and p205) can be used for transient expression of Broglie et al., 1984, Science, 224:838-843); or heat shock proteins in eukaryotic cells. The various methods employed promoters, e.g., soybean hsp17.5-E or hsp17.3-B (Gurley et in the preparation of the plasmids and transformation of host al., 1986, Mol. Cell. Biol. 6:559-565) may be used. These organisms are well known in the art. For other Suitable expres 40 constructs can be introduced into plant cells using Ti plas sion systems for both prokaryotic and eukaryotic cells, as mids, Ri plasmids, plant virus vectors; direct DNA transfor well as general recombinant procedures, see Molecular Clon mation; microinjection, electroporation, etc. For reviews of ing A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch such techniques see, for example, Weissbach & Weissbach, and Maniatis (Cold Spring Harbor Laboratory Press, 1989) 1988, Methods for Plant Molecular Biology, Academic Press, Chapters 16 and 17. In some instances, it may be desirable to 45 New York, Section VIII, pp. 421-463; and Grierson & Corey, express the recombinant protein by the use of a baculovirus 1988, Plant Molecular Biology, 2d Ed., Blackie, London, Ch. expression system. Examples of such baculovirus expression 7-9. systems include pVL-derived vectors (such as pVL 1392, An alternative expression system which can be used to pVL 1393 and pVL941), p.AcUW-derived vectors (such as express a polypeptide is an insect system. In one Such system, pAcUW1), and pFastBac-derived vectors. 50 Autographa Californica nuclear polyhedrosis virus (AcNPV) In another variation, protein production may be achieved is used as a vector to express foreign genes. The virus grows using in vitro translation systems. In vitro translation systems in Spodoptera frugiperda cells. The PGHS-2 sequence may are, generally, a translation system which is a cell-free extract be cloned into non-essential regions (for example the poly comprising at least the minimum elements necessary for hedrin gene) of the virus and placed under control of an translation of an RNA molecule into a protein. An in vitro 55 AcNPV promoter (for example the polyhedrin promoter). translation system typically comprises at least ribosomes, Successful insertion of the coding sequence will result in tRNAs, initiator methionyl-tRNAMet, proteins or complexes inactivation of the polyhedrin gene and production of non involved in translation, e.g., eIF2, eIF3, the cap-binding (CB) occluded recombinant virus (i.e., virus lacking the proteina complex, comprising the cap-binding protein (CBP) and ceous coat coded for by the polyhedrin gene). These recom eukaryotic initiation factor 4F (eIF4F). A variety of in vitro 60 binant viruses are then used to infect Spodoptera frugiperda translation systems are well known in the art and include cells in which the inserted gene is expressed. (e.g., see Smith commercially available kits. Examples of in vitro translation et al., 1983, J. Virol., 46:584, Smith, U.S. Pat. No. 4,215,051). systems include eukaryotic lysates, such as rabbit reticulo In a specific embodiment of an insect system, the DNA cyte lysates, rabbit oocyte lysates, human cell lysates, insect encoding the Subject polypeptide is cloned into the pBlue cell lysates and wheat germ extracts. Lysates are commer 65 BacIII recombinant transfer vector (Invitrogen, San Diego, cially available from manufacturers such as Promega Corp., Calif.) downstream of the polyhedrin promoter and trans Madison, Wis.; Stratagene, La Jolla, Calif.; Amersham, fected into Sf9 insect cells (derived from Spodoptera fru US 8,664,364 B2 33 34 giperda ovarian cells, available from Invitrogen, San Diego, 4104-4115; U.S. Pat. No. 4,868, 116; U.S. Pat. No. 4,980,286; Calif.) to generate recombinant virus. After plaque purifica PCT Application WO 89/07136; PCT Application WO tion of the recombinant virus high-titer viral stocks are pre 89/02468; PCT Application WO 89/05345; and PCT Appli pared that in turn would be used to infect Sf9 or High FiveTM cation WO92/07573). (BTI-TN-5B1-4 cells derived from Trichoplusia ni egg cell In choosing retroviral vectors as a gene delivery system for homogenates; available from Invitrogen, San Diego, Calif.) nucleic acids encoding the Subject polypeptides, it is impor insect cells, to produce large quantities of appropriately post tant to note that a prerequisite for the Successful infection of translationally modified Subject polypeptide. Although it is target cells by most retroviruses, and therefore of stable intro possible that these cells themselves could be directly useful duction of the genetic material, is that the target cells must be for drug assay, the Subject polypeptides prepared by this 10 dividing. In general, this requirement will not be a hindrance method can be used for in vitro assays. to use of retroviral vectors. In fact, such limitation on infec In another embodiment, the Subject polypeptides are pre tion can be beneficial in circumstances wherein the tissue pared in transgenic animals, such that in certain embodi (e.g., nontransformed cells) Surrounding the target cells does ments, the polypeptide is secreted, e.g., in the milk of a female not undergo extensive cell division and is therefore refractory animal. 15 to infection with retroviral vectors. Viral vectors may also be used for efficient in vitro introduc Furthermore, it has been shown that it is possible to limit tion of a nucleic acid into a cell. Infection of cells with a viral the infection spectrum of retroviruses and consequently of vector has the advantage that a large proportion of the targeted retroviral-based vectors, by modifying the viral packaging cells can receive the nucleic acid. Additionally, polypeptides proteins on the Surface of the viral particle (see, for example, encoded by genetic material in the viral vector, e.g., by a PCT publications WO93/25234, WO94/06920, and WO94/ nucleic acid contained in the viral vector, are expressed effi 11524). For instance, strategies for the modification of the ciently in cells that have taken up viral vector nucleic acid. infection spectrum of retroviral vectors include: coupling Retrovirus vectors and adeno-associated virus vectors are antibodies specific for cell surface antigens to the viral env generally understood to be the recombinant gene delivery protein (Roux et al. (1989) Proc. Natl. Acad. Sci. USA system of choice for the transfer of exogenous genes in vivo, 25 86:9079-9083; Julanet al. (1992).J. Gen Virol 73:3251-3255; particularly into mammals. These vectors provide efficient and Goud et al. (1983) Virology 163:251-254); or coupling delivery of genes into cells, and the transferred nucleic acids cell surface ligands to the viral env proteins (Neda et al. are stably integrated into the chromosomal DNA of the host. (1991) J Biol Chem 266:14143-14146). Coupling can be in A major prerequisite for the use of retroviruses is to ensure the the form of the chemical cross-linking with a protein or other safety of their use, particularly with regard to the possibility 30 variety (e.g., lactose to convert the env proteinto anasialogly of the spread of wild-type virus in the cell population. The coprotein), as well as by generating chimeric proteins (e.g., development of specialized cell lines (termed "packaging single-chain antibody/env chimeric proteins). This tech cells') which produce only replication-defective retroviruses nique, while useful to limit or otherwise direct the infection to has increased the utility of retroviruses for gene therapy, and certain tissue types, and can also be used to convert an eco defective retroviruses are well characterized for use in gene 35 tropic vector in to an amphotropic vector. transfer for gene therapy purposes (see Miller, A. D. (1990) Moreover, use of retroviral gene delivery can be further Blood 76:271). Thus, recombinant retrovirus can be con enhanced by the use of tissue- or cell-specific transcriptional structed in which part of the retroviral coding sequence (gag, regulatory sequences which control expression of the genetic pol, env) has been replaced by nucleic acid encoding one of material of the retroviral vector. the antisense E6AP constructs, rendering the retrovirus rep 40 Another viral gene delivery system utilizes adenovirus lication defective. The replication defective retrovirus is then derived vectors. The genome of an adenovirus can be manipu packaged into virions which can be used to infect a target cell lated Such that it encodes a gene product of interest, but is through the use of a helper virus by Standard techniques. inactive in terms of its ability to replicate in a normal lytic Protocols for producing recombinant retroviruses and for viral life cycle (see, for example, Berkner et al. (1988) Bio infecting cells in vitro or in vivo with such viruses can be 45 Techniques 6:616; Rosenfeld et al. (1991) Science 252:431 found in Current Protocols in Molecular Biology, Ausubel, F. 434; and Rosenfeld et al. (1992) Cell 68:143-155). Suitable M. et al. (eds.) Greene Publishing Associates, (1989), Sec adenoviral vectors derived from the adenovirus strain Ad type tions 9.10-9.14, and other standard laboratory manuals. 5 d1324 or other strains of adenovirus (e.g., Ad2. Ad3, Ad7. Examples of suitable retroviruses include pl.), pZIP pWE etc.) are well known to those skilled in the art. Recombinant and pPM which are well known to those skilled in the art. 50 adenoviruses can be advantageous in certain circumstances in Examples of suitable packaging virus lines for preparing both that they are capable of infecting non-dividing cells and can ecotropic and amphotropic retroviral systems include Crip, be used to infect a wide variety of cell types, including airway Cre and Am. Retroviruses have been used to introduce a epithelium (Rosenfeld et al. (1992) cited supra), endothelial variety of genes into many different cell types, including cells (Lemarchand et al. (1992) Proc. Natl. Acad. Sci. USA neural cells, epithelial cells, endothelial cells, lymphocytes, 55 89:6482-6486), hepatocytes (Herz and Gerard (1993) Proc. myoblasts, hepatocytes, bone marrow cells, in vitro and/or in Natl. Acad. Sci. USA 90:2812-2816) and muscle cells (Quan vivo (see for example Eglitis, et al. (1985) Science 230:1395 tin et al. (1992) Proc. Natl. Acad. Sci. USA 89:2581-2584). 1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA Furthermore, the virus particle is relatively stable and ame 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. nable to purification and concentration, and, as above, can be USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. 60 modified so as to affect the spectrum of infectivity. Addition Acad. Sci. USA 87:6141-6145; Huberetal. (1991) Proc. Natl. ally, introduced adenoviral DNA (and foreign DNA con Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. tained therein) is not integrated into the genome of a host cell Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Sci but remains episomal, thereby avoiding potential problems ence 254:1802-1805; van Beusechemetal. (1992) Proc. Natl. that can occur as a result of insertional mutagenesis in situa Acad. Sci. USA 89:7640-7644; Kayetal. (1992) Human Gene 65 tions where introduced DNA becomes integrated into the host Therapy 3:641-647: Dai et al. (1992) Proc. Natl. Acad. Sci. genome (e.g., retroviral DNA). Moreover, the carrying capac USA 89:10892-10895; Hwu et al. (1993).J. Immunol. 150: ity of the adenoviral genome for foreign DNA is large (up to US 8,664,364 B2 35 36 8 kilobases) relative to other gene delivery vectors (Berkneret against PV-associated antigen (see Viac et al. (1978).J Invest al., supra: Haj-Ahmand and Graham (1986) J. Virol. 57:267). Dermatol 70:263-266; see also Mizuno et al. (1992) Neurol. Most replication-defective adenoviral vectors currently in use Med Chin 32:873-876). and therefore favored by the present invention are deleted for In yet another illustrative embodiment, the gene delivery all or parts of the viral E1 and E3 genes but retain as much as 5 system comprises an antibody or cell Surface ligand which is 80% of the adenoviral genetic material (see, for example, cross-linked with a gene binding agent Such as polylysine Jones et al. (1979) Cell 16:683; Berkner et al., supra; and (see, for example, PCT publications WO93/04701, WO92/ Graham et al. in Methods in Molecular Biology, E.J. Murray, 22635, WO92/20316, WO92/19749, and WO92/06180). For Ed. (Humana, Clifton, N.J., 1991) vol. 7. pp. 109-127). example, genetic material encoding the Subject chimeric Expression of the inserted genetic material can be under 10 polypeptides can be used to transfect hepatocytic cells in vivo control of, for example, the E1A promoter, the major late using a soluble polynucleotide carrier comprising an asia promoter (MLP) and associated leader sequences, the E3 loglycoprotein conjugated to a polycation, e.g., polylysine promoter, or exogenously added promoter sequences. (see U.S. Pat. No. 5,166.320). It will also be appreciated that Yet another viral vector system useful for delivery of effective delivery of the subject nucleic acid constructs via genetic material encoding the Subject polypeptides is the 15 mediated endocytosis can be improved using agents which adeno-associated virus (AAV). Adeno-associated virus is a enhance escape of the gene from the endosomal structures. naturally occurring defective virus that requires another For instance, whole adenovirus or fusogenic peptides of the virus, such as an adenovirus oraherpesvirus, as a helper virus influenza HA gene product can be used as part of the delivery for efficient replication and a productive life cycle. (see system to induce efficient disruption of DNA-comprising Muzyczka et al. Curr: Topics in Micro. and Immunol. (1992) endosomes (Mulligan et al. (1993) Science 260-926; Wagner 158:97-129). It is also one of the few viruses that may inte et al. (1992) Proc. Natl. Acad. Sci. USA 89:7934; and Chris grate its DNA into non-dividing cells, and exhibits a high tiano et al. (1993) Proc. Natl. Acad. Sci. USA 90:2122). frequency of stable integration (see for example Flotte et al. Tissue-specific expression of a selectivity component may (1992) Am. J. Respir: Cell. Mol. Biol. 7:349-356: Samulski et beachieved by use of a construct comprising a tissue-specific al. (1989) J. Virol. 63:3822-3828; and McLaughlin et al. 25 promoter. (1989).J. Virol. 62: 1963-1973). Vectors comprising as little as 4. Reporters 300 base pairs of AAV can be packaged and can integrate. The reporter may be any molecule which produces a Space for exogenous DNA is limited to about 4.5 kb. An AAV detectable signal change in response to an alteration in the vector such as that described in Tratschin et al. (1985) Mol. environment. For example; the signal change may be an Cell. Biol. 5:3251-3260 can be used to introduce DNA into 30 increase or decrease in signal intensity, or a change in the type cells. A variety of nucleic acids have been introduced into of signal produced. In exemplary embodiments, Suitable different cell types using AAV vectors (see for example Her reporters include molecules which produce optically detect monatetal. (1984) Proc. Natl. Acad. Sci. USA 81:6466-6470; able signals; including, for example, fluorescent and chemi Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wond luminescent molecules. In certain embodiments, the reporter isford etal. (1988) Mol. Endocrinol. 2:32-39: Tratschinet al. 35 molecule is a long wavelength fluorescent molecule which (1984) J. Virol. 51: 611-619; and Flotte et al. (1993).J. Biol. permits detection of the reporter signal through a tissue Chem. 268:3781-3790). sample, especially non-invasive detection of the reporter in In particular, a AAV delivery system suitable for targeting conjunction with in vivo applications. muscle tissue has been developed by Gregorevic, et al., Nat Without being bound by theory, in certain embodiments, Med. 2004 August; 10(8):828-34. Epub 2004 July 25, which 40 the reporter molecule is a pH sensitive fluorescent dye (pH is able to home-in on muscle cells and does not trigger an sensor dye) which shows a spectral change upon interaction immune system response. The delivery system also includes of a selectivity component with a target molecule. Interaction use of a growth factor, VEGF, which appears to increase of the selectivity component with a target molecule may lead penetration into muscles of the gene therapy agent. to a shift in the pH of the microenvironment surrounding the Other viral vector systems may be derived from herpes 45 selectivity component due to the composition of acidic and virus, vaccinia virus, and several RNA viruses. basic residues on the selectivity and/or target molecules. In In addition to viral transfer methods, such as those illus turn, the shift in the pH microenvironment leads to a detect trated above, non-viral methods can also be employed to able spectral change in the signal of the pH sensitive fluores cause expression of nucleic acids encoding the Subject cent dye molecule associated with the selectivity component. polypeptides, e.g. in a cell invitro or in the tissue of an animal. 50 In exemplary embodiments, a pH sensitive dye is selected Most nonviral methods of gene transfer rely on normal with an appropriate pKa to lead to an optimal spectral change mechanisms used by mammalian cells for the uptake and upon binding of the particular selectivity component/target intracellular transport of macromolecules. In preferred molecule combination. A variety of pH sensitive dyes suitable embodiments, non-viral gene delivery systems of the present for use in accordance with the invention are commercially invention rely on endocytic pathways for the uptake of 55 available. In exemplary embodiments, pH sensitive dyes genetic material by the targeted cell. Exemplary gene delivery include, for example, fluorescein, umbelliferones (coumarin systems of this type include liposomal derived systems, compounds), pyrenes, resorufin, hydroxy esters, aromatic polylysine conjugates, and artificial viral envelopes. acids, Styryl dyes, tetramethylrhodamine dyes, and cyanine In a representative embodiment, genetic material can be dyes, and pH sensitive derivatives thereof. entrapped in liposomes bearing positive charges on their Sur 60 Without being bound by theory, in other embodiments, the face (e.g., lipofectins) and, optionally, which are tagged with reporter molecule is a polarity sensitive fluorescent dye (po antibodies against cell Surface antigens of the target tissue larity sensor dye) which shows a spectral change upon inter (Mizuno et al. (1992) No Shinkei Geka 20:547-551; PCT action-of-a-selectivity component with a target molecule. publication WO91/06309; Japanese patent application Interaction of the selectivity component with a target mol 1047381; and European patent publication EP-A-43075). For 65 ecule may lead to a shift in the polarity of the microenviron example, lipofection of papilloma-infected cells can be car ment Surrounding the selectivity component due to the com ried out using liposomes tagged with monoclonal antibodies position of polar and/or non-polar residues on the selectivity US 8,664,364 B2 37 38 and/or target molecules. In turn, the change in the polarity of the microenvironment leads to a detectable spectral change in the signal of the polarity sensitive fluorescent dye molecule X associated with the selectivity component. A variety of polar R3 E D ity sensitive dyes suitable for use in accordance with the ). } invention are commercially available. In exemplary embodi ments, polarity sensitive dyes include, for example, merocya R nine dyes, 5-((((2-iodoacetyl)amino)ethyl)amino)naphtha II lene-1-sulfonic acid (1.5-IAEDANS), and CPM, and polarity O sensitive derivatives of merocyanine dyes, IAEDANS, and 10 CPM. X Rs Without being bound by theory, in certain embodiments, R3 -( C-C-7 the reporter molecule is a fluorescent dye that is sensitive to R6 changes in the microViscosity of the local environment (re 15 striction sensor dye). Interaction of the selectivity component R with a target molecule may lead to a change in the microvis III cosity in the local environment Surrounding the selectivity ) /SRs component. In turn, the change in microViscosity may lead to R3 C-C-7 a detectable spectral change in the signal of the mobility sensor dye molecule associated with the selectivity compo \ R6 nent. For example, an increase of microViscosity upon target O -O binding will restrict the dye and increase the quantum yield of the emitted fluorescence signal. A variety of restriction sensor wherein: dyes suitable for use in accordance with the invention are 25 the curved lines represent the atoms necessary to complete a commercially available. In exemplary embodiments, restric structure selected from one ring, two fused rings, and three tion sensor dyes include, for example, monomethine and fused rings, each said ring having five or six atoms, and trimethine cyanine dyes, and microViscosity sensitive deriva each said ring comprising carbonatoms and, optionally, no tives of monomethine and trimethine cyanine dyes. more than two atoms selected from oxygen, nitrogen and Without being bound by theory, in certain embodiments, 30 sulfur, the reporter molecule is a fluorescent dye that exhibits a D., if present, is spectral change due to a modification in the tumbling rate of the dye as measured on a nanosecond time scale (mobility sensor dye). Mobility sensor dye molecules may be linked to the selectivity component using a linker molecule that per 35 C Y. mits free rotation of the dye molecule. Upon interaction of the V or - H R4 selectivity component with a target molecule, the rotation of R6 t the dye molecule around the linker may become restricted leading to a change in the ratio of parallel to perpendicular R2 polarization of the dye molecule. A change in polarization of 40 the mobility sensor dye may be detected as a change in the m is 1, 2, 3 or 4, and for cyanine, oxynol and thiazole orange, spectral emission of the dye and can be measured using light m can be 0; polarization optics for both excitation and emission to deter X and Y are independently selected from the group consisting mine the tumbling rate of the dye. Abbott's fluorescence of O, S, and —C(CH)—, polarization technology is an exemplary method for deter 45 at least one R1,R2, R3, R4, R5, R6, or R7 is selected from the mining the polarization of the dye. In exemplary embodi group consisting of a moiety that controls water Solubility ments, the mobility sensor dye is attached to the selectivity and non-specific binding, a moiety that prevents the component using a triple-bond containing linker that extends reporter molecule from entering the cell through the mem the dye away from the surface of the selectivity component. A brane, a group that comprises, optionally with a linker, variety of mobility sensor dyes suitable for use in accordance 50 biotin a hapten, a His-tag, or other moiety to facilitate the with the invention are commercially available. In exemplary process of isolating the selection entity, a fluorescent label embodiments, mobility sensor dyes include, for example, optionally comprising a linker, a photoreactive group, or a cyanine dyes and derivatives thereof. reactive group Such as a group containing isothiocyanate, In certain embodiments, the reporter molecule is a dye that isocyanate, monochlorotriazine, dichlorotriazine, mono exhibits a change in its spectral properties when specifically 55 or di-halogen Substituted pyridine, mono- or di-halogen bound to a selectivity component. A nucleic acid, e.g. an Substituted diazine, phosphoramidite, maleimide, aziri aptamer, may be designed to specifically bind Such a dye, for dine, Sulfonyl halide, acid halide, hydroxysuccinimide example Malachite Green (see R. Babendure, et al. (2003).J. ester, hydroxysulfoSuccinimide ester, imido ester, hydra Am. Chem. Soc. 125: 14716). Such dyes, when in complex Zine, axidonitrophenyl, azide, 3-(2-pyridyl dithio)-propri with the nucleic acid or protein that is specific for them, 60 onamide, glyoxal, haloacetamido, or aldehyde; change their spectral properties. For example, Malachite further-providing that R1 and R2 may be joined by a Green and its analogs, which is not normally fluorescent, —CHRs CHRs or —BF biradical; becomes strongly fluorescent when bound to an aptamer spe wherein; cific for it oran sch. v. FIG. 6 depicts the structure of Malachite Rs independently for each occurrence is selected from the Green derivatized with a PEG amine. 65 group consisting of hydrogen, amino, quaternary amino, In certain embodiments, the reporter molecule is repre aldehyde, aryl, hydroxyl, phosphoryl, Sulfhydryl, water sented by structure I, II, or III: solubilizing groups, alkyl groups of twenty-six carbons or US 8,664,364 B2 39 40 less, lipid solubilizing groups, hydrocarbon Solubilizing Substituted diazine, phosphoramidite, maleimide, aziri groups, groups promoting solubility in polar solvents, dine, Sulfonyl halide, acid halide, hydroxysuccinimide groups promoting solubility in nonpolar solvents, and ester, hydroxysulfoSuccinimide ester, imido ester, hydra -E-F; and further providing that any of R1, R2, R3, R4, R5, Zine, axidonitrophenyl, azide, 3-(2-pyridyl dithio)-propri R6, or R7 may be substituted with halo, nitro, cyan, 5 onamide, glyoxal, haloacetamido, or aldehyde; —CO-alkyl, -CO2H. —COaryl, NO, or alkoxy, further-providing that R1 and R2 may be joined by a wherein: —CHRs CHRs or —BF biradical; F is selected from the group consisting of hydroxy, protected wherein; Rs independently for each occurrence is selected from the hydroxy, alkoxy, Sulfonate, Sulfate, carboxylate, and lower group consisting of hydrogen, amino, quaternary amino, alkyl Substituted amino or quartenary amino; 10 aldehyde, aryl, hydroxyl, phosphoryl, Sulfhydryl, water E is spacer group of formula —(CH)n- wherein n is an solubilizing groups, alkyl groups of twenty-six carbons or integer from 0-5 inclusively; less, lipid solubilizing groups, hydrocarbon solubilizing In other embodiments, wherein m=0 in structures I, II, and groups, groups promoting solubility in polar solvents, III, the following general structures IV, V and VI are afforded: groups promoting solubility in nonpolar solvents, and 15 -E-F; and further providing that any of R1, R2, R3, R4, R5, IV R6, or R7 may be substituted with halo, nitro, cyan, X —CO-alkyl, —CO.H. —COaryl, NO, or alkoxy wherein: F is selected from the group consisting of hydroxy, protected C+N ) D hydroxy, alkoxy, Sulfonate, Sulfate, carboxylate, and lower R alkyl Substituted amino or quartenary amino; V E is spacer group of formula —(CH)n- wherein n is an O integer from 0-5 inclusively; 25 The following are more specific examples of reporter mol X Rs ecules according to structure I, II, or III: R-( o R6 S-X R YS1S R 30 VI X Rs -)(-)-(1).21 N iii. N 2 R3 k R6 35 cyanine O -O O Js X R N wherein: R- 1N C - C Z the curved lines represent the atoms necessary to complete a H iii. structure selected from one ring, two fused rings, and three 40 2 N N fused rings, each said ring having five or six atoms, and V each said ring comprising carbon atoms and, optionally, no R O R6 more than two atoms selected from oxygen, nitrogen and merocyanine Sulfur, D., if present, is 45 3 21 ? H iii. Y. Rs Y.

O R 50 \V HC={ R4 styryl R6 t R O O Rs v M R2 N N Z C - C C Z X and Y are independently selected from the group consisting 55 N N of O, S, and —C(CH.) : / V at least one R1,R2, R3, R4, R5, R6, or R7 is selected from the R O O R6 group consisting of a moiety that controls water Solubility and non-specific binding, a moiety that prevents the Oxynol reporter molecule from entering the cell through the mem 60 brane, a group that comprises, optionally with a linker, In these structures X and Y are selected from the group biotin a hapten, a His-tag, or other moiety to facilitate the consisting of O, S and —CH(CH.) : process of isolating the selection entity, a fluorescent label Z is selected from the group consisting of O and S; optionally comprising a linker, a photoreactive group, or a m is an integer selected from the group consisting of 0, 1, 2, reactive group Such as a group containing isothiocyanate, 65 3 and 4 and, preferably an integer from 1-3. isocyanate, monochlorotriazine, dichlorotriazine, mono In the above formulas, the number of methine groups deter or di-halogen Substituted pyridine, mono- or di-halogen mines in part the excitation color. The cyclic azine structures US 8,664,364 B2 41 42 can also determine in part the excitation color. Often, higher The following are more specific examples of reporter mol values of m contribute to increased luminescence and absor ecules according to structure VII: bance. At values of m above 4, the compound becomes unstable. Thereupon, further luminescence can be imparted by modifications at the ring structures. When m=2, the exci tation wavelength is about 650 nm and the compound is very fluorescent. Maximum emission wavelengths are generally 15-100 nm greater than maximum excitation wavelengths. CO2H The polymethine chain of the luminescent dyes of this invention may also contain one or more cyclic chemical 10 N1 N. groups that form bridges between two or more of the carbon atoms of the polymethine chain. These bridges might serve to 2 O O; increase the chemical or photostability of the dye and might N1 N. be used to alter the absorption and emission wavelength of the 15 dye or change its extinction coefficient or quantum yield. R Improved solubility properties may be obtained by this modi 21 O O; fication. In certain embodiments, the reporter molecule is repre R-H sented by structure VII: Nan1S1 OnN VII N 's 25 CO2H R-H Y 4N N wherein: W is N or C(R1); 30 X is C(R2); Y is C(R3): In certain embodiments, the reporter molecule is repre Z is NR, O, or S; sented by structure VIII: at least one R1, R2, or R3 is selected from the group consist ing of a moiety that controls water Solubility and non 35 specific binding, a moiety that prevents the reporter mol VIII ecule from entering the cell through the membrane, a group R R that comprises, optionally with a linker, biotin, a hapten, a His-tag, or other moiety to facilitate the process of isolating R R the selection entity, a fluorescent label optionally compris 40 ing a linker, a photoreactive group, or a reactive group Such as a group containing isothiocyanate, isocyanate, R R monochlorotriazine, dichlorotriazine, mono- or di-halogen R R Substituted pyridine, mono- or di-halogen Substituted diaz ine, phosphoramidite, maleimide, aziridine, Sulfonyl 45 halide, acid halide, hydroxySuccinimide ester, hydroxysul wherein: foSuccinimide ester, imido ester, hydrazine, axidonitro at least one R1 is selected from the group consisting of a phenyl, azide, 3-(2-pyridyl dithio)-proprionamide, gly moiety that controls water solubility and non-specific bind oxal, haloacetamido, or aldehyde; ing, a moiety that prevents the reporter molecule from further providing that two R3 taken together may form O, S, 50 entering the cell through the membrane, a group that com NR1, or N+(R1); or two R3 along with R2 may form prises, optionally with a linker, biotin, a hapten, a His-tag. or other moiety to facilitate the process of isolating the selection entity, a fluorescent label optionally comprising a R linker, a photoreactive group, or a reactive group Such as a R 55 group containing isothiocyanate, isocyanate, monochloro R N triazine, dichlorotriazine, mono- or di-halogen Substituted pyridine, mono- or di-halogen Substituted diazine, phos phoramidite, maleimide, aziridine, Sulfonyl halide, acid N s halide, hydroxysuccinimide ester, hydroxysulfo Succinim 60 ide ester, imido ester, hydrazine, axidonitrophenyl, azide, N W or x 3-(2-pyridyl dithio)-proprionamide, glyoxal, haloaceta R mido, or aldehyde; further providing that any two adjacent R1, in certain embodi wherein V is O, S, NR1, or N+(R1); and ments, may be joined to form a fused aromatic ring; and further providing that any of R1, R2, or R3 may be substituted 65 further providing that R1, in certain embodiments, may be with halo, nitro, cyano. —CO-alkyl, -CO2H. —COaryl, Substituted with halo, nitro, cyan, —CO-alkyl, -COH, NO, or alkoxy. —COaryl, NO, or alkoxy. US 8,664,364 B2 43 44 In certain embodiments, at least one, preferably only one, -continued and possibly two or more of either R1,R2, R3, R4, R5, R6 and O R7 groups in each of the foregoing moleculesis or contains a O reactive group covalently reactive with amine, protected or unprotected hydroxy or Sulfhydryl nucleophiles for attaching 5 the dye to the labeled component. For certain reagents, at least one of said R1, R2, R3, R4, R5, R6 and R7 groups on each O molecule may also be a group that increases the solubility of the chromophore, or affects the selectivity of labeling of the O labeled component or affects the position of labeling of the 10 SO labeled component by the dye. Reactive groups that may be - -n(H2C)-C-O- DN attached directly or indirectly to the chromophore to form R1, R2, R3, R4, R5, R6 and R7 groups may include reactive O moieties such as groups containing isothiocyanate, isocyan 15 ate, monochlorotriazine, dichlorotriazine, -mono- or di-halo gen Substituted pyridine, mono- or di-halogen Substituted diazine, phosphoramidite, maleimide, aziridine, Sulfonyl D-O- DN-(CH, halide, acid halide, hydroxysuccinimide ester, hydroxysulfo Succinimide ester, imido ester, hydrazine, axidonitrophenyl, azide, 3-(2-pyridyl dithio)-proprionamide, glyoxal, haloac etamido, and aldehyde. wherein at least one of Q or W is a leaving group such as I, Br Specific examples of R1, R2, R3, R4, R5, R6 and R7 or C1 and n is an integer from 0 to 4. groups that are especially useful as reactive groups (e.g., for Specific examples of R1, R2, R3, R4, R5, R6 and R7 attaching dye to a substrate, linkers, biotin, beads, microar 25 groups that are especially useful for labeling components rays, et alia) for labeling components with available amino-, with available sulfhydryls which can be used for labeling hydroxy-, and Sulfhydryl groups include: selectivity components in a two-step process are the follow 1ng:

30 NCS -NCS: ----- (CH)nNCS: -cho. -( )—is H H NCO 35 O -NCO: ----- (CH2)nNCO:

N. N . . .N -n(H-C-NCH.Q -N || 40 H 1. s 1. s O N 2N O O W W 45 Q; N Q; -O- -n(H2C)-N 1. N1 n(HC)1 s s O O 2N N O 21 50 H || |: W W -N-C-n(HC)-S-S-S N O 21 N Q; H || and n(HC)1 s s N-C-n(H2C)-S-S- ln 55 N 2N O 21 W H || -n(HC)-N-C-n(H2C)-S-S-n 60 N n(HC)1 n1 Q; wherein Q is a leaving group Such as I or Br, and wherein n is 2N an integer from 0 to 4. 65 Specific examples of R1, R2, R3, R4, R5, R6 and R7 W groups that are especially useful for labeling components by light-activated cross linking include: US 8,664,364 B2 45 46 -continued R X ----N: -( )—s. and N DC X 5 R5

ON R 5

For the purpose of increasing water solubility or reducing wherein A' is selected from unwanted nonspecific binding of the labeled component to 10 inappropriate components in the sample or to reduce the interactions between two or more reactive chromophores on R the labeled component which might lead to quenching of R2 fluorescence, the R1,R2: R3, R4, R5, R6 and R7 groups can 15 be selected from the well known polar and electrically Rs charged chemical groups. R4 n In certain embodiments of the invention, the reporter mol R3 R6 ecule is represented by structure I, II, III, IV, V,VI,VII or VIII R and the accompanying definitions, and is a pH sensitive reporter molecule. R In certain embodiments of the invention, the reporter mol ecule is represented by structure I, II, III, IV, V,VI,VII or VIII R4 O and the accompanying definitions, and is a polarity sensitive 25 reporter molecule. R3 In certain embodiments of the invention, the reporter mol R ecule is represented by structure I, II, III, IV, V,VI,VII or VIII R2 and the accompanying definitions, and is a microViscosity N 30 reporter molecule. N In certain embodiments of the invention, the reporter mol R4 S YRs and, ecule is represented by structure I, II, III, IV, V,VI,VII or VIII and the accompanying definitions, and is a mobility sensor reporter molecule. 35 In various other embodiments, the reporter is a of the type C R class IV: wherein the dye has the general structure Y, Rs

40 wherein A is selected from wherein R1, R2, R3, R4, R5 and R6 are selected from the group consisting of a moiety that controls water Solubility and non-specific binding, a moiety that prevents the dye from Rs R entering a cell through a membrane, a group that comprises, 45 optionally with a linker, biotin, a hapten, a His-tag, or a R1 N R2 moiety to facilitate isolation of the ligand, a fluorescent label optionally comprising a linker, a photoreactive group, a reac tive containing isothiocyanate, isocyanate, monochlorotriaz R3 ine, dichlorotriazine, mono- or di-halogen Substituted pyri R4 50 dine, mono- or di-halogen Substituted diazine, phosphoramidite, maleimide, aziridine, Sulfonylhalide, acid R2 halide, hydroxySuccinimide ester, hydroxysulfoSuccinimide O R ester, imido ester, hydrazine, axidonitrophenyl, azide, 3-(2- pyridyl dithio)-proprionamide, glyoxal, haloacetamido, or 55 aldehyde, and, R3 R1 and R2 may be joined by a —CHRs CHRs or —BF-biradical, R4 wherein Rs independently for each occurrence is selected R2 60 from the group consisting of hydrogen, amino, quaternary Rs R amino, aldehyde, aryl, hydroxyl, phosphoryl, Sulfhydryl, water solubilizing groups, alkyl groups of twenty-six carbons or less, lipid solubilizing groups, hydrocarbon solubilizing R3 21 and, groups, groups promoting solubility in polar solvents, groups 65 promoting solubility in nonpolar solvents, and -E-F, R4 wherein F is selected from the group consisting of hydroxy, protected hydroxy, alkoxy, Sulfonate, Sulfate, carboxylate, US 8,664,364 B2 47 48 and alkyl Substituted amino or quartenary amino and E is ent reactive groups), or photoreactive (containing groups that spacer group of formula —(CH)n- wherein n is an integer become reactive on illumination). A variety of photoreactive from 0-5 inclusively; and, groups are known, for example, groups in the nitrene family. any of R1, R2, R3, R4, R5, R6, or R7 may be substituted In various embodiments, one or more reporter molecules with halo, nitro, cyan, —CO-alkyl, -COH, -COaryl, 5 may be attached at one or more locations on the selectivity NO, or alkoxy; component. For example, two or more molecules of the same wherein B is reporter may be attached at different locations on a single selectivity component molecule. Alternatively, two or more different reporter molecules may be attached at different loca 10 tions on a single selectivity component molecule. In exem plary embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more reporter Z Z Z. molecules are attached at different sites on the selectivity component. The one or more reporter molecules may be m is an integer from 0 to 4: attached to the selectivity component so as to maintain the Z is selected from is H. C-C alkyl, C-Cs. Substituted 15 activity of the reporter molecule and the selectivity compo alkyl, cyclic and heterocyclic having from one ring, two fused nent. rings, and three fused rings, each said ring having three to six In certain embodiments, the location of the reporter mol atoms, and each said ring comprising carbon atoms and from ecule is optimized to permit exposure of the reporter molecule Zero to two atoms selected from oxygen, nitrogen and Sulfur to changes in the microenvironment upon interaction of the and containing Zero to 1 oxygen, nitrogen or Sulfur Substitu selectivity component with a target molecule while maintain ents attached; and, ing the ability of the selectivity component to interact with the Z is selected from H. C-C alkyl, C-Cs. Substituted target molecule. In exemplary embodiments, the reporter alkyl, cyclic and heterocyclic having from one ring, two fused molecule is attached to the selectivity component in spatial rings, and three fused rings, each said ring having three to six proximity to the target binding site without affecting the atoms, and each said ring comprising carbon atoms and from 25 ability of the selectivity component to interact with the target Zero to two atoms selected from oxygen, nitrogen and Sulfur, molecule. A, and A'. (See FIG. 2.) In certain embodiments, the reporter molecule further In various embodiments, the spectral change of the sensor comprises a moiety that is specific for the selectivity compo dye upon interaction of the selectivity component and a target nent. For example, the reporter molecule may be linked to a molecule may include, for example, a shift in absorption 30 Substrate, a hapten, etc. that is specific for the selectivity wavelength, a shift in emission wavelength, a change in quan component if it is an enzyme, hapten-binding protein, etc. tum yield, a change in polarization of the dye molecule, The reporter molecule may be covalently attached to the and/or a change in fluorescence intensity. The change can be moiety using standard techniques. In certain embodiments two-fold, ten-fold, one hundred-fold, one thousand-fold or the reporter molecule may be directly attached to the moiety even higher. Any method Suitable for detecting the spectral 35 by forming a chemical bond between one or more reactive change associated with a given sensor dye may be used in groups on the two molecules. In other embodiments, the accordance with the inventions. In exemplary embodiments, reporter molecule may be attached to the moiety via a linker Suitable instruments for detection of a sensor dye spectral group. Suitable linkers that may be used in accordance with change, include, for example, fluorescent spectrometers, fil the inventions include, for example, chemical groups, an ter fluorometers, microarray readers, optical fiber sensor 40 amino acid or chain of two or more amino acids, a nucleotide readers, epifluorescence microscopes, confocal laser scan or chain of two or more polynucleotides, polymer chains, and ning microscopes, two photon excitation microscopes, and polysaccharides. Linkers may be homofunctional (containing flow cytometers. reactive groups of the same type), heterofunctional (contain In variant embodiments, the reporter molecule may be ing different reactive groups), or photoreactive (containing associated with the selectivity component or the target mol 45 groups that become reactive on illumination). ecule. In exemplary embodiments, the reporter molecule is 5. Exemplary Uses covalently attached to the selectivity component. The reporter The biosensors of the invention may be used to detect molecule may be covalently attached to the selectivity com and/or quantitate analytes in any solid, liquid or gas sample, ponent using standard techniques. In certain embodiments as well as in any cell or tissue or organism of interest. the reporter molecule may be directly attached to the selec 50 In various exemplary embodiments, the biosensors of the tivity component by forming a chemical bond between one or invention may be used for a variety of diagnostic and/or more reactive groups on the two molecules. In an exemplary research applications, including, for example, monitoring the embodiment, a thiol reactive reporter molecule is attached to development of engineered tissues, in vivo monitoring of a cysteine residue (or other thiol containing molecule) on the analytes of interest (including polynucleotides, polypeptides, selectivity component. Alternatively, the reporter molecule 55 hormones, lipids, carbohydrates, and Small inorganic and may be attached to the selectivity component via an amino organic compounds and drugs) using injectable free biosen group on the selectivity component molecule. In other sors or implants functionalized with one or more biosensors, embodiments, the reporter molecule may be attached to the biological research (including developmental biology, cell selectivity component via a linker group. Suitable linkers that biology, neurobiology, immunology, and physiology); detec may be used in accordance with the inventions include, for 60 tion of microbial, viral and botanical polynucleotides or example, chemical groups, an amino acid or chain of two or polypeptides, drug discovery, medical diagnostic testing, more amino acids, a nucleotide or chain of two or more environmental detection (including detection of hazardous polynucleotides, polymer chains, and polysaccharides. In Substances/hazardous wastes, environmental pollutants, exemplary embodiments, the reporter molecule is attached to chemical and biological warfare agents, detection of agricul the selectivity component using a linker having a maleimide 65 tural diseases, pests and pesticides and space exploration), moiety. Linkers may be homofunctional (containing reactive monitoring of food freshness and/or contamination, food groups of the same type), heterofunctional (containing differ additives, and food production and processing streams, moni US 8,664,364 B2 49 50 toring chemical and biological products and contaminants, In another embodiment, the biosensors described herein and monitoring industrial and chemical production and pro may be used for monitoring food freshness and/or contami cessing streams. nation, food additives, and food production and processing In one embodiment, the biosensors described herein may streams: Examples of bacterial contaminants that may lead to be used for detecting environmental pollutants, including, air, foodborne illnesses include, for example, Bacillus anthracis, water and Soil pollutants. Examples of air pollutants, include, Bacillus cereus, Brucella abortus, Brucella melitensis, Bru for example, combustion contaminants such as carbon mon cella suis, Campylobacter jejuni, Clostridium botulinum, oxide, carbon dioxide, nitrogen dioxide, Sulfur dioxide, and Clostridium perfringens, enterohemorrhagic E. coli (includ tobacco Smoke; biological contaminants such as animal dan ing E. coli O157:H7-and-other Shiga toxin-producing; E. 10 coli), enterotoxigenic E. coli, Listeria monocytogenes, Sal der, molds, mildew, viruses, pollen, dust mites, and bacteria; monella, Shigella, Staphylococcus aureus, Vibrio cholerae, Volatile organic compounds such as formaldehyde, fragrance Vibrio parahaemolyticus, Vibrio vulnificus, Yersinia entero products, pesticides, solvents, and cleaning agents; heavy colytica and Yersinia pseudotuberculosis. Examples of viral metals such as lead or mercury; and asbestos, aerosols, oZone, contaminants that may lead to foodborne illnesses include, radon, lead, nitrogen oxides, particulate matter, refrigerants, 15 for example, hepatitis A, norwalk-like viruses, rotavirus, Sulfur oxides, and Volatile organic compounds. Examples of astroviruses, calciviruses, adenoviruses, and parvoviruses. soil pollutants, include, for example, acetone, arsenic, Examples of parasitic contaminants that may lead to food barium, benzene, cadmium, chloroform, cyanide, lead, mer borne illnesses include, for example, Cryptosporidium par cury, polychlorinated biphenyls (PCBs), tetrachloroethylene, vum, Cyclospora Cayetanensis, Entamoeba histolytica, Gia toluene, and trichloroethylene (TCE). Examples—of water rdia lamblia, Toxoplasma gondii, and Trichinella spiralis. pollutants, include, for example, arsenic, contaminated sedi Examples of noninfectious toxins or contaminants that may ment, disinfection byproducts, dredged material, and micro lead to foodborne illnesses include, for example, antimony, bial pathogens (e.g., Aeromonas, Coliphage, Cryptospo arsenic, cadmium, ciguatera toxin, copper, mercury, ridium, E. coli, Enterococci, Giardia, total coliforms, museinol, muscarine, psilocybin, coprius artemetaris, viruses). 25 ibotenic acid, amanita, nitrites, pesticides (organophosphates In other embodiments, the biosensors described herein or carbamates), tetrodotoxin, Scombroid, shellfish toxins, may be used for detecting hazardous Substances, including, Sodium floride, thallium, tin, vomitoxin, and zinc. for example, arsenic, lead, mercury, vinyl chloride, polychlo In one embodiment, the biosensors described herein may rinated biphenyls (PCBs), benzene, cadmium, benzopyrene, be used for in vitro and/or in vivo monitoring of analytes of polycyclic aromatic hydrocarbons, benzofluoranthene, chlo 30 interest. The biosensors may be injected or otherwise admin roform, DDT, aroclors, trichloroethylene, dibenza.han istered to a patient as free molecules or may be immobilized thracene, dieldrin, hexavalent chromium, chlordane, onto a surface before introduction into a patient. When hexachlorobutadiene, etc. administered. as free molecules, the biosensors may be used In another embodiment, the biosensors described herein to detect analytes of interest in both interstitial spaces and may be used for detecting chemical and biological warfare 35 inside cells. For detection of analytes inside of cells, the agents. Examples of biological warfare agents, include, for selectivity component may be modified, as described above, example, bacteria Such as anthrax (Bacillus anthracis), botu with a tag that facilitates translocation across cellular mem lism (Clostridium botulinum toxin), plague (Yersinia pestis), branes. Alternatively, the selectivity components may be tularemia (Francisella tullarensis), brucellosis (Brucella spe introduced into cells using liposome delivery methods or cies), epsilon toxin from Clostridium peringens, food safety 40 mechanical techniques such as direct injection or ballistic threats (e.g., Salmonella species, Escherichia coli O157:H7. based particle delivery systems (see for example, U.S. Pat. Shigella); water safety threats (e.g., Vibrio cholerae and No. 6,110,490). In other embodiments, the biosensors may be Cryptosporidium parvum), glanders (Burkholderia mallei), immobilized onto a surface (including, for example, a bead, Melioidosis (Burkholderia pseudomallei), Psittacosis chip, plate, slide, Strip, sheet, film, block, plug, medical (Chlamydia psittaci), Q fever (Coxiella burnetii), Ricintoxin 45 device, Surgical instrument, diagnostic instrument, drug from Ricinus communis, Staphylococcal enterotoxin B, delivery device, prosthetic implant or other-structure) and Typhus fever (Rickettsia prowaaeki) and viruses, such as then introduced into a patient, for example, by Surgical filoviruses (e.g., ebola or Marburg), arenaviruses (e.g., Lassa implantation. In exemplary embodiments, the biosensors are and Machupo), hantavirus, Smallpox (variola major), hemor immobilized onto the Surface of an implant. Such as an arti rhagic fever virus, Nipah virus, and alphaviruses (e.g., Ven 50 ficial or replacement organ, joint, bone, or other implant. The eZuelan equine encephalitis, eastern equine encephalitis, biosensors of the invention may also be immobilized onto western equine encephalitis). Examples of chemical warfare particles, optical fibers, and polymer Scaffolds used for tissue agents, include for example, blister agents (e.g., distilled engineering. For example, one or more biosensors may be mustard, lewisite, mustard gas, nitrogen mustard, phosgene immobilized onto a fiber optic probe for precise positioning oXime, ethyldichloroarsine, methyldichloroarsine, phenod 55 in a tissue. The fiber optic then provides the pathway for ichloroarsine, sesqui mustard), blood poisoning agents (ars excitation light to the sensor tip and the fluorescence signal ine, cyanogen chloride, hydrogen chloride, hydrogen cya back to the photodetection system. In still other embodi nide), lung damaging agents (chlorine, diphosgene, cyanide, ments, at least the selectivity component of the biosensor is nitrogen oxide, perfluorisobutylene, phosgene, red phospho transfected in cell or other host organism of interest and rous, sulfur trioxide-chlorosulfonic acid, teflon, titanium tet 60 expressed within the cell or other host organism of interest. rachloride, Zinc oxide), incapacitating agents (agent 15, BZ, In each of the various embodiments of the invention, a canniboids, fentanyls, LSD, phenothiazines), nerve agents single biosensor may be used for detection of a single target (cyclohexyl sarin, GE, Soman, Sarin, Tabun, VE, VG, V-Gas, molecule or two or more biosensors may be used simulta VM, VX), riot control/tear gas agents (bromobenzylcyanide, neously for detection of two or more target molecules. For chloroacetophenone, chloropicrin, CNB, CNC, CNS, CR, 65 example, 2, 5, 10, 20, 50, 100, 1000, or more different selec CS), and Vomit inducing agents (adamsite, diphenylchloro tivity components may be used simultaneously for detection arsine, diphenylcyanoarsine). of multiple targets. US 8,664,364 B2 51 52 When using multiple selectivity components simulta cally based disease. Non-limiting examples of diseases neously, each selectivity component may be attached to a include, beta-thalassemia, sickle cell anemia, Factor-V different reporter molecule to permit individual detection of Leiden, cystic fibrosis and cancer related targets such as p53, target binding to each selectivity component. Alternatively, a p 10, BRC-1 and BRC-2. In still another embodiment, the dual detection system may be used where two or more selec target sequence may be related to a chromosomal DNA, tivity components may be attached to the same reporter mol wherein the detection, identification or quantitation of the ecule (for example, the same sensor dye) and be identified target sequence can be used in relation to forensic techniques based on a second detectable signal. For example, selectivity Such as prenatal screening, paternity testing, identity confir components having different target specificities but contain mation or crime investigation. ing the same sensor dye may be distinguished based on the 10 signal from a color coded particle to which it is attached. The In still other embodiments, the methods of the invention readout for each selectivity component involves detection of include the analysis or manipulation of plants and genetic the signal from the sensor dye, indicating association with the materials derived therefrom as well as bio-warfare reagents. target molecule, and detection of the signal from the color Biosensors of the invention will also be useful in diagnostic coded particle, permitting identification of the selectivity 15 applications, in screening compounds for leads which might component. In an exemplary embodiment, a panel of biosen exhibit therapeutic utility (e.g. drug development) or in sors may be attached to a variety of color coded particles to screening samples for factors useful in monitoring patients form a Suspension array (LumineX Corporation, Austin, for Susceptibility to adverse drug interactions (e.g. pharma Tex.). The mixture of coded particles associated with the cogenomics). biosensors of the invention may be mixed with a biological In certain embodiments, the biosensors of the invention, or sample or administered to a patient. Flow cytometry or nucleic acids encoding them, may be formulated into a phar microdialysis may then be used to measure the signal from the maceutical composition comprising one or more biosensors sensor dye and to detect the color code for each particle. In and a pharmaceutically acceptable carrier, adjuvant, or various embodiments, the identification signal may be from a vehicle. The term “pharmaceutically acceptable carrier' color coded particle or a second reporter molecule, including, 25 refers to a carrier(s) that is “acceptable' in the sense of being for example, chemiluminescent, fluorescent, or other optical compatible with the other ingredients of a composition and molecules, affinity tags, and radioactive molecules. not deleterious to the recipient thereof. Methods of making In other embodiments, one or more biosensors of the inven and using Such pharmaceutical compositions are also tion may be immobilized onto a three dimensional Surface included in the invention. The pharmaceutical compositions Suitable for implantation into a patient. The implant allows 30 monitoring of one or more analytes of interest in a three of the invention can be administered orally, parenterally, by dimensional space, such as, for example, the spaces between inhalation spray, topically, rectally, nasally, buccally, vagi tissues in a patient. nally, or via an implanted reservoir. The term “parenteral as In other embodiments, the biosensors of the invention may used herein includes Subcutaneous, intracutaneous, intrave be exposed to a test sample. Any test sample Suspected of 35 nous, intramuscular, intraarticular, intrasynovial, intraster containing the target may be used, including, but not limited nal, intrathecal, intralesional, and intracranial injection or to, tissue samples such as biopsy samples and biological infusion techniques. fluids such as blood, sputum, urine and semen samples, bac In other embodiments, the invention contemplates kits terial cultures, Soil samples, food samples, cell cultures, etc. including one or more biosensors of the invention, and other The target may be of any origin, including animal, plant or 40 Subject materials, and optionally instructions for their use. microbiological (e.g., viral, prokaryotic, and eukaryotic Uses for Such kits include, for example, environmental and/or organisms, including bacterial, protozoal, and fungal, etc.) biological monitoring or diagnostic applications. depending on the particular purpose of the test. Examples A biosensor, or an isolated, purified biosensor, comprising include Surgical specimens, specimens used formedical diag the selectivity component may have at least about 85% nostics, specimens used for genetic testing, environmental 45 sequence identity with SEQID NO:1 through 72. The selec specimens, cell culture specimens, food specimens, dental tivity component may reversibly bind either a monomethin specimens and Veterinary specimens. The sample may be cyanine dye, or Malachite Green, or an analog thereof A host processed or purified prior to exposure to the biosensor(s) in cell may express the biosensor. Further, a vector may be accordance with techniques known or apparent to those comprised of a nucleic acid sequence having at least about skilled in the art. 50 85%, and preferably 95%, sequence identity to a polynucle In other embodiments, the biosensors of the invention may otide encoding a protein with SEQID NO:1 through 72. A be used to detect bacteria and eucarya in food, beverages, host cell may comprise the vector. water, pharmaceutical products, personal care products, dairy products or environmental samples. The biosensors of the EXAMPLES invention are also useful for the analysis of raw materials, 55 equipment, products or processes used to manufacture or The invention now being generally described, it will be store food, beverages, water, pharmaceutical products, per more readily understood by reference to the following Sonal care products, dairy products or environmental examples, which are included merely for purposes of illus samples. tration of certain aspects and embodiments of the present Alternatively, the biosensors of the invention may be used 60 invention, and are not intended to limit the invention. Pro to diagnose a condition of medical interest. For example the vided are several single chain antibody (ScPV) based sensors methods, kits and compositions of this invention will be par that comprise amino acid sequences that lead to specific bind ticularly useful for the analysis of clinical specimens or ing of certain monomethin cyanine dyes (TO1 and its analogs equipment, fixtures or products used to treat humans or ani (the structure of TO1 derivatized with PEGamine is shown in mals. In one preferred embodiment, the assay may be used to 65 FIG. 7) and Malachite Green (and its analogs) in a way that detect a target sequence which is specific for a genetically produces a large increase in fluorescence of the dye (a "fluo based disease or is specific for a predisposition to a geneti rogen') when it is in the bound state. US 8,664,364 B2 53 54 Example 1 human renal carcinoma cells. In each case the transfected cells exhibited strong Surface fluorescence when exposed to schv-Based Sensors that Reversibly Bind low concentrations of TO1-2p or MG-11p fluorogen. No sig Fluorescent Dyes nificant intracellular fluorescence was observed under these experimental conditions; TO1-2p and MG-11p controls did In one experiment, an schv that reversibly binds nonco not enter living NIH3T3 cells. It is noteworthy that little or no valently the dye TO1 (“scFv1) was produced. See, for photobleaching of cell surface fluorescence was observed. example, SEQID NO:1. A 2700-fold increase in fluorescence Separate experiments showed that TO1-2p FAPs resisted was detected (by methods described below) when the TO1 bleaching about as well as EGFP and that MG FAPs were binds to the scFV. This sequence was used in Subsequent work 10 to produce additional scFvs that bind to TO1 with a stronger even more bleach resistant (FIG. 16). Fluorescence signal of binding affinity and have enhanced fluorescence. In other TO1-2p FAPs decayed to a TO1-2p concentration dependent experiments, sclvs were developed that bind certain deriva steady state, which suggests without being bound by theory, tives of malachite green where the noncovalent binding is that rapid exchange of fluorogen (and/or fluorogen photo strong and again a large increase in fluorescence is produced 15 products) between the solution and the FAP itself was effec upon binding of the dye to the sclv. See, FIGS. 9, 10A and tively buffering the system against photobleaching. For MG 1OB. FAPs, other mechanisms may contribute. Such as loose 1A sequestration of dark fluorogen on the plasma membrane The genetic sequence of this scFv may be inserted into outer Surface. In aqueous Solution mobile fluorogens Such as genes for other proteins so that the expressed fusion protein MG or TO1 show almost no photoreactivity, but under illu will contain the dye-binding schv. For example, a cell surface mination MG conjugated to an antibody generates reactive membrane protein was labeled with scFv1 by genetic meth oxygen species at a rate similar to GFP sufficient to be pho ods and expressed on the cell Surface of cultured mammalian totoxic under continuous or intense excitation. Phototoxicity cells. When the relatively non-fluorescent (in water or buffer) correlates with photobleaching, Suggesting that MG and TO1 dye TO1 was added to cell Suspensions containing the pro 25 FAPs generated reactive oxygen species at GFP-like rates. tein-scFv, a fraction of the dye binds to the scFv with a large MG has also been used as an antifungal agent; at experimental (more than 2500x) fluorescence increase upon binding and concentrations the MG derivatives studied here had little or thereby produced a fluorescent label on the protein of interest no effect on yeast growth (FIG. 17). Cell surface-exposed on the membrane Surface. Thus, the appearance of fluores FAPs visualized with a membrane-impermeant fluorogen cence when the sclv and the dye are both present is very 30 were seen at the plasma membrane only. When exposed to a rapid. Thus, TO1 and the corresponding TO1 schv may be membrane-permeant fluorogen, however, these same cells used to detect protein expression of the scFv-fusion protein showed additional fluorescence within elements of the secre on the surface of the cell where the scEv will have access to the membrane impermeant dye that has been added to the tory apparatus, including the nuclear endoplasmic reticulum culture medium. Other proteins may be labeled with the schv 35 and the Golgi. This result suggests that permeant fluorogens and if the labeled protein is present inside the cell, a mem can be used to visualize FAPs shortly after cotranslational brane permeant fluorogen may be used to detect the presence insertion into the lumen, and thus potentially report protein of that particular schv fusion protein. folding in near real time. Permeant fluorogens can be added The presence of the scFv can be used to ascertain the and withdrawn at will, facilitating development of pulse amount, expression, degradation, or location of the fusion 40 chase and other approaches to studying secretory and protein. endocytic pathways. When incorporated into fusion proteins, In one experiment, yeast FAPs were fused via AGA2 to the FAP domains provided a reporter of protein location and AGA1-AGA2 complex, which is directed to the outer leaflet abundance in time and space. Fluorescence signal was gen of the plasma membrane by a C-terminal glycosylphosphati erated only upon addition of a second component (the fluo dylinositol (GPI) anchor before insertion into the cell wall. 45 rogen); in this respect FAPs resemble the site-specific chemi Live cell imaging using fluorescent proteins fused to GPIs or cal labeling systems. However, all chemical labeling systems GPI-anchored proteins is useful for studying organization require additional manipulation Such as enzymatic conjuga and function of membrane proteins, including signaling tion steps or washes to reduce background signal, whereas receptors and cell adhesion molecules, but these constructs FAPs can be visualized directly after fluorogen addition on a may also label cell structures involved in biosynthesis, secre 50 time scale of seconds (on the cell Surface) to minutes (within tion and degradation. Dynamic imaging of lipid rafts and the secretory apparatus). Fluorescence visualization can also other surface features would benefit by confining fluores be spatially controlled by the appropriate choice offluorogen, cence to proteins anchored to the outer leaflet. Whereas meth enabling one to selectively observe fusion proteins at particu ods such as total internal reflection fluorescence microscopy lar cellular locations. Multicolor imaging of spectrally and have evolved to allow selective observation, there are no 55 antigenically distinct FAPs co-expressed within a cell will methods for selective labeling and homogenous detection. To greatly enhance the usefulness of different fluorogens to illustrate such labeling and detection, an MG FAP and an dynamically monitor complex cellular functions. Sclv-based identically anchored AGA2-GFP fusion protein was imaged. FAPs contain internal disulfide linkages and are currently The MG FAP and the GFP were visualized on the extracel adapted for use only in nonreducing environments, mainly lular surface, but intracellular structures, many with the mor 60 the cell surface and secretory apparatus. FAP/fluorogens thus phology expected of vacuoles and nuclear membranes (endo complement the biarsenical system, which is generally lim plasmic reticulum), were visualized only by the GFP. To ited to intracellular reducing environments, primarily the explore fluorogenic labeling of mammalian cell Surface pro cytoplasmic and nuclear compartments. However, it has been teins, selected TO1 and MG FAPs were fused to the N termi shown that functional SchvS can be expressed cytoplasmi nus of platelet-derived growth factor receptor (PDGFR) 65 cally in a disulfide-free format in yeast and mammalian cells, transmembrane domain. The TO1 and MG FAPs were than and future developments of scFv and other FAP platforms expressed stably in NIH3T3 mouse fibroblasts and in M21 will address these intracellular compartments. US 8,664,364 B2 55 56 1B ity of specific proteins, pathways and networks within cells or Additionally, the genetic sequence of an Schv may be used to measure biochemical, structural and physiological proper to create molecular biosensors. In one example, the initial ties of cells. The reporter molecules allow control of targeting sequence of an ScFv is modified to make the binding of a of the region of a cell or tissue where the perturbation or reporter molecule by the scFv sensitive to the presence of 5 measurement OCCurS. other molecular interactions with the scEv. Such interactions Many types of reporter molecules diffuse into cells and include contact with another protein or peptide. Such inter perturb or report from many regions of a cell where the probe actions can involve contact with a kinase or phosphatase or non-specifically associates. The targeting in the reporter mol other covalent modification that alters an amino acid of the ecules may be controlled by bringing together two molecular ScFv to produce a change in fluorogen fluorescence. The 10 entities within a cell or on its surface or in a tissue. One Such interaction can produce a steric change or allosteric change entity may comprise the reporter molecule, a hapten and a near the reporter group on the sensor that produces the fluo rescence signal. The interaction can alter a charged amino water soluble linker that separates the probe and the hapten. acid side chain or an ionizable group on a side chain or The hapten is a molecule with which antibodies that bind the hydrogen bonding group or a non-polar group near the 15 molecule can be generated by known procedures. This three reporter that produces a fluorescence signal. part structure is shown on the right hand side of FIG. 3. Such 1C a reporter might be a Voltage sensitive dye, a calcium indica The TO1 schv was created using a large PNNL Yeast tor, a pH indicator, ion indicator, polarity indicator, mechani Display library comprised of cells that each express on its cal stress indicator oran indicator of some other physiological surface on of an estimated 10 different sequence variations in or molecular process occurring in the cell. the heavy and light variable regions that constitute the dis The second entity required for targeting the probe in a cell played scFv proteins. The TO1-binding scFv was isolated in consists of a selectivity component, e.g., a hapten-binding two steps. First, a TO1 dye linked via a PEG polymer to a antibody, specifically a scFv that may be genetically fused to biotin was used in a magnetic bead separation procedure to a “protein of interest” within the cell. The protein of interest isolate a population of cells that was enriched for cells that 25 serves the purpose of localizing the reporter molecule-bind bind in variable degrees to the TO1 dye. In a second step, flow ing schv, and thus the reporter molecule after it has been cytometry experiments were carried out to select for cells that incorporated in the cell or tissue, to a specific region of bind the dye and make it highly fluorescent. One of the highly interest within or on a cell. The protein of interest and the schv fluorescent cells was sorted and cloned. This yeast cell was are illustrated on the left hand side of FIG. 3. the source of the scFv. Yeast plasmid DNA encoding this schv 30 The process of targeting the reporter molecule within the clone was amplified by PCR methods, and then sequenced. cell takes place in several steps: (1) first, a hapten-linker Flow cytometry data has demonstrated the successful cloning reporter molecule must be synthesized, then (2) a hapten of this highly fluorescent TO1-binding schv. Similarly for binding schv must be created. This may be done, for example, malachite green. by yeast selection procedures developed by Wittrup, et al. 1D 35 (Methods Enzymol. (2000) 328:430-33, Proc. Natl. Acad. It is possible to engineer and select other proteins that are Sci. USA (2000) 97: 10701-5. Nucleic Acids Res (2004) capable of binding to the fluorescent reporters of this inven 32:e36). (3) The cell of interest must be transfected with a tion Such that they also would function as biosensors in a way gene that codes for the protein of interest fused to the hapten similar to the scFv1 of this example. Such engineered pro binding protein. (4) The hapten-linker-reporter molecule teins that can be used as biosensors we call Fluorescent Bind 40 must be incorporated into the cell by diffusion through the ing Protein (FBP) sensors. Examples of such non-immuno membrane or microinjection or by another means. logical binding proteins engineered to bind Small-to-medium The result of this process will be noncovalent placement of molecular weight molecules are described by Bintz et al. the reporter molecule into the protein of interest that may be (2005) Nature Biotech. 23:1257-1268. in the nucleus, or an organelle, in the cytoplasm, on the 45 internal Surface of the membrane, or in a specific location of Example 2 a tissue. By using a photoreactive group or a reactive func tional group the reporter moiety may be covalently attached Reporter Molecule-Localizing System Based on SAb to the protein of interest. sch v Technology Several variations are possible: 50 Variation 1: Non-Covalent Binding of the Hapten-Linker In this example, a combination of reagents with which the Reporter Molecule to the scFv. location of the reporter molecule can be controlled within a The affinity of this binding depends on the structure of the cell by genetic methods ScFv and the hapten. In some cases, it is desirable to have In biological research and pharmaceutical drug discovery relatively weak binding so that the reporter molecule can it is useful to be able to target specific reporter molecules to 55 experience the targeted protein of interest but also other certain regions or structures within a cell. Examples of Such regions of the cell. In other cases, it is desirable to have strong specific reporter molecules include regulatory metabolites binding so that the probe is predominantly at the scFv. In this Such as Small peptides, growth factors, and inhibitory RNAS. case, there would be less non-specific binding of the hapten Also Such reporter molecules S may include synthetic and linker-reporter molecule to other regions of the tissue and the natural molecules that modify cellular behavior such as those 60 modulating or measuring capabilities of the reporter mol often used and developed by the pharmaceutical industry. ecule would be targeted mainly to the sclv-protein of interest Further, such reporter molecules might also include fluores region. There would therefore be a better signal-to-noise in cent or light absorbing molecules that provide a signal for the experiment. The binding constant of the hapten to the targeting of a protein within a cell or that are sensitive to a antibody (often expressed as a dissociation constant, Kd) can physiological property of the cell Such as membrane poten 65 be adjusted by the procedures used to create the hapten tial, ion concentration or enzyme activity. In other words, the binding ScFv. By yeast selection procedures and by a process reporter molecules are used to modulate or perturb the activ called affinity maturation (where the schv is genetically US 8,664,364 B2 57 58 mutated and further selection is carried out) it is possible to addition of the “caged reporter molecule' to the cells would considerably decrease Kd (increase the binding affinity). allow the targeted ScHv containing cell to specifically and Variation 2: Covalent Linkage of the Hapten-Linker-Reporter strongly bind the caged reporter molecule. Washing the cells Molecule to the schv Using Light. would remove the caged reporter molecule from cells that are In this case, the hapten is modified to contain a specific not of interest and illumination would produce release of the reactive group or a photo-reactive group that will cause the reporter molecule only in the cells of interest. ScFv binding group to permanently and covalently associate In this invention scFv-based binding proteins offer one with the targeting scv. The photoreactive group could be type of fluorescent binding protein that can be used to create placed adjacent to the hapten or could be structurally part of biosensors as in Example 3. As mentioned earlier there are the hapten. A schv that binds the hapten or the modified 10 hapten may be created. The photoreactive hapten is called a other FBPs that could also be engineered to create sensors. “photohapten.” Illumination of the cell or tissue containing Example 3 the photohapten-linker-probe and the scFV-protein of interest would cause covalent linkage of the photohapten groups that A Biosensor for Protein-Protein Interaction Based on are within the schv binding site to a region of the scFv. A 15 potential advantage of this approach is that excess non-scFV sch v Technology associatinghapten-linker-reporter molecule could be washed out, so long as it does not photochemically react with other Protein-protein interactions are widely used by living cells cellular structures. Any of a variety of known photoreactive to regulate important pathways controlling cell growth and groups may be used. Such as those of the nitrene family. behavior. There are examples in the literature of the study of Several examples of reporter molecules are shown in FIG. 4. protein-protein interactions by protein complementation (TK The compounds have sites for attachment to a linker and thus Kerppola (2006) Nature Methods 3:969). The protein-protein to a reporter molecule. interaction event is detected by attaching the two cleaved Variation 3: Photo-Controlled Reversible Binding of the parts of a sensor protein to the two proteins whose interaction Reporter Molecule to the scFv. 25 is to be detected. When the interaction takes place the cleaved The binding of the reporter molecule may be reversibly parts of the sensor protein complement (interact with) one controlled with light by a photoreaction upon illumination of another to form a functional protein. The known examples in the ScFv binding group chromophores that alters its molecu the literature do not include the use of fluorescent reporter lar conformation and thereby its affinity for the binding site of binding scFVs described above. the targeting scFV. There are known organic chromophores 30 This example involves the use of the heavy (H) and light that undergo conformational changes upon illumination. Still (L) fragments of single chain antibodies (ScPVs) that have benes and azo-compounds undergo cis-trans isomerization. been selected to bind fluorescent reporter molecules. Once a Spiranes undergo ring opening as shown in FIG. 5. ScFv with appropriate fluorogen has been obtained and the In producing Such a reversible system, the Sclv may be genetic sequence of the ScFv determined, molecular biology generated using the predominant species of the equilibrium at 35 room temperature, which for example is the spiro form of the methods are available to modify genetic sequences into the compound in FIG. 5 that is >99% in the absence of UV light. ScFV gene at certain locations. The modified genetic When the reagent system is in the cell or tissue, the reporter sequences can be inserted into yeast expression systems to molecule would then be released from the schv-protein of produce secreted protein or to produce Surface displayed interest by illuminating the sample with UV light. For recap 40 ScFv that correspond to the genetic modifications. It is further ture of the reporter molecule by the scFv alonger wavelength possible to eliminate the genetic sequence corresponding to of illumination that excites the mero form may be used, or the the short polypeptide linker that holds the H and L chains of reaction may be incubated to achieve thermal re-equilibrium the selected ScFv together. Thus it is possible to obtain inde of the reaction to favor the spiro form. Such a reagent system pendently the Hand Lhalves of the original Schv. It is further may be used to transient release of metabolic factors or drugs 45 possible to attach the genetic sequence of the H chain to a that modify regulatory pathways in cells and tissues. A variety protein, for example, P1, and the L chain to a second protein, of photoreversible chromophores are known in the art and P2 to obtain two DNA sequences that will give fusion proteins have been recently described in Sakata, et al., Proc. Natl. upon protein expression. The goal is to investigate whether P1 Acad. Sci. USA (2005) 102(13):4759-4764. and P2 interact within or outside cells. The genetic sequences Variation 4: Photo-Release of Targeted Reporter Molecule 50 for the P1-H and P2-L. fusion proteins can then be transfected Photo-uncaging of cell and tissue modulating agents have into living cells where the cells will produce the two fusion been widely used by biologists and biophysicists. Generally, protein products. In this example when the P1-Hand P2-L are an inactive form of a modulating agent or reporter molecule is diffusing independently in the interior of a cell, neither the H illuminated to release an active form into the illuminated nor the L fragments alone will bind the fluorogen (that bound region. In this case, the modulating agent may be active, but 55 targeted to the Sclv-containing region of the cell or tissue. with a fluorescence increase to the original Schv from which Illumination would release the material, allowing it to diffuse the H and L halves were obtained) to produce a significant and produce effects elsewhere in the cell or tissue. Photo fluorescence signal. However, when P1 and P2 interact, the H uncaging chemistries are known (Curtin, et al. Photochemis and L components will be brought into close proximity and try and Photobiology (2005) 81:641-648) and may be 60 will interact as well to form the original combining site that inserted at a convenient site between the hapten and the will bind to the fluorogen. If this is the case, a fluorescence reporter molecule. signal will occur on interaction of P1 and P2. Currently, there is no way to target Such reagents to specific The protein-protein biosensor of this example has advan types of cells in a heterogeneous mixture of cells. Through tages of quick fluorescence response, good sensitivity and genetic targeting, the reporter molecule could be sequestered 65 relative reversibility. It is possible to use fragments of other and remain caged in a defined region of the cell through the FBPs to create protein-protein interaction sensors similar to genetic targeting of the scFv to the cell of interest. Also, the one described above. US 8,664,364 B2 59 60 Example 4 dye-binding schvs. The TO1- and MG-affinity enriched schv libraries were further enriched and then screened for fluores Eight Unique FBPs That Elicit Intense Fluorescence cence-generating scEvs by 2-4 rounds of FACS using the From Otherwise Dark Dyes dye-PEG conjugates. For subsequent binding studies, TO1 and MG were coupled to diethylene glycol diamine (TO1-2p In this experiment, it was demonstrated that fluorescent and MG-2p) to maintain antigenic structure and aqueous dye proteins for live cell applications could be created. Eight solubility. unique FBPs that elicit intense fluorescence from otherwise Sixteen clones that enhanced MG-2p fluorescence and two dark dyes were isolated by screening a yeast display library of clones that enhanced TO1-2p fluorescence were isolated from human single chain antibodies (scFVs) using derivatives of 10 the library (FIG. 8). Sequence analysis revealed that the TO1 thiazole orange (TO) and malachite green (MG). When dis 2p scFvs were encoded by different heavy and light chain played on yeast or mammalian cell surfaces, these FBPs bind germline genes. The fluorogenic MG-2p Sclvs represented their fluorogens with nanomolar affinity, increasing their six germline configurations, three composed of the usual respective green or red fluorescence by several thousand-fold heavy and light chain segments, and three composed of only to brightness levels similar to that of enhanced green fluores 15 a single heavy or light chain segment (FIG.9). The 11.5-14.4 cent protein. Significant spectral variation is generated within kD single chain species are about half the size of GFP (26.7 the family of malachite green FBPs by use of different pro kD). When expressed on the yeast cell surface, spectra of the teins and chemically modified fluorogens. These diverse fluorescent scFvs could be determined in a 96 well homog FBPs and fluorogens provide opportunities to create new enous assay format in the presence of free dye. We took classes of biosensors and new homogeneous cell-based advantage of the robust surface expression to spectrally char assays. These studies were aimed at creating a new class of acterize and determine the affinity of all of our FBPs when protein/dye reporters whose spectral properties are deter bound to these two fluorogens (FIG. 9). The dissociation mined by the interplay of a protein moiety (a Fluorescent constants for HLI-TO1 and HL2-TO1 were high nanomolar Binding Protein or FBP) and a noncovalently bound fluoro range. To obtain stronger binders, one of the clones (HL1 gen. In the ideal case: (1) neither the FBP nor the fluorogen 25 TO1) was affinity matured by directed evolution using two exhibits fluorescence in the absence of the other, (2) the rounds of error prone PCR mutagenesis and FACS selection increase in fluorescence upon binding is dramatic, (3) the for increased fluorescence at low fluorogen concentration, fluorogenic interaction between FBP and fluorogen is highly generating several FBPs with improved properties (FIG. 8). specific, eliminating the need for washes or blocking agents, The most improved FBP, HL 1.0.1-TO1, bound TO 1-2p with (4) neither the FBP nor the fluorogen is toxic or have intrinsic 30 a cell surface K of about 3 nM. HL 1.0.1-T01 and HL2-TO1 biological activity, 5) variation of the FBP and/or the fluoro each exhibited modest red excitation shifts (509 and 515 nm, gen elicits useful variation in fluorescence color, binding respectively) relative to free dye absorbance (504 nm) but affinity and other properties, and 6) the FBP can fold or differed significantly from one another in emission maxima readjust its conformation rapidly with an associated fluores (530 and 550 nm.) cence change. 35 Each of the anti-MG FBPs bound MG-2p tightly when For example, such a system may allow the experimenter to assayed on the cell Surface, with an apparent K, in the low modulate fluorescence as needed by adding or removing fluo nanomolar range. Cell Surface spectra showed significant rogens. Or, fluorogens could be tailored to address specific variation among MG-2p binding FBPs. Excitation maxima of requirements, such as cell membrane permeability and exclu the FBP/MG-2p complexes ranged from 620-640 nm, mark sion, or binding to a given FBP with different affinities and 40 edly to the red of free dye absorbance (607 nm), whereas colors to facilitate pulse-chase techniques. Unrelated fluoro emission maxima ranged from 645-670 nm. gen-FBP pairs that do not cross-react could be developed to To more rigorously investigate the properties of FBP/fluo support FRET applications. As proof-of-principle, it was rogens, secreted forms of HL 1.0.1-TO1, HL4-MG and demonstrated that cells expressing single chain antibodies L5-MG were produced and affinity-purified (FIG. 8). In solu (ScPVS) display intense fluorescence enhancement after expo 45 tion HL 1.0.1-TO1 bound TO1-2p with a K very similar to sure to two unrelated dyes, TO1 and MG. ScFvs were chosen that observed on the cell surface. Direct measurement showed because these small (<30 kDa) molecules retain the full range that the fluorescence of TO1-2p increased about 2.600-fold of antigen recognition capabilities of the humoral antibodies upon binding to the HL 1.0.1-TO1. The extinction coefficient and are amenable to use as recombinant tags in fusion pro and quantum yield of the HL 1.0.1-TO1/TO1-2p complex teins. A complex human scFv library composed of ~10 syn 50 (X=60,000 M' cm and (O-0.47) are comparable to the thetically recombined heavy and light chain variable regions values for Aequorea EGFP (53,000 and 0.60), and predict that was available in a yeast Surface-display format, enabling us to this FBP/fluorogen has EGFP-like brightness. use Fluorescence Activated Cell Sorting (FACS) to directly HL4-MG and L5-MG respectively showed 185- and 265 screen for fluorogenic binding to the dyes. fold reduced affinity for MG-2p in solution as compared to TO1 and MG are known fluorogens: strong fluorescence 55 surface display but affinity of H6-ME was reduced only five activation is observed when TO1 intercalates into DNA or fold (FIG. 9). This behavior differs markedly from that of when MG binds to a specific RNA aptamer. Without being HL1.0.1-TOL. The quantum yield of the HL4-MG/MG-2p bound by theory, enhanced fluorescence is thought to occur complex (0.17) is similar to the quantum yield (0.187) of the because rapid rotation around a single bond within the chro malachite green RNA aptamer. Our result reflects a fluores mophore is constrained upon binding. Enhanced fluorescence 60 cence enhancement of about 18,000-fold as compared to free of such molecular rotors has also been reported for an anti fluorogen, which is much greater than the 40 to 100-fold body-dye complex, although with comparatively modest enhancement for other antibody/fluorogen complexes but increase. less than the 50.000-fold increase observed when a quenched TO1 and MG were coupled to 3350 or 5000 MW polyeth FIASH-EDT2 reagent binds its cognate tetracysteine peptide. ylene glycol (PEG)-biotin, and the dye-PEG-biotin conju 65 Absorbance of the FBP/fluorogen is more than 1.4-fold gates were used with Streptavidin and anti-biotin magnetic greater than free MG-2p, corresponding to an extinction coef beads to affinity enrich the yeast surface display library for ficient of about 105,000M cm. The combined absorbance US 8,664,364 B2 61 62 and quantum yield predict a red fluorescent probe with high obtained another library that represents a subset of the origi brightness. We have synthesized and obtained several deriva nal PNNL library. The estimated complexity of this library is tives of the MG fluorogen to explore whether fluorogenic ~8x10 independent scFvs. This library shows no evidence of properties can be usefully modulated by altered chemistry, contamination, and was the source of all other FBPS isolated and have observed among our six MG FBPS many changes in 5 for this study. This uncontaminated library version is cur binding affinity, fluorescence intensity and excitation/emis rently available from PNNL. sion spectra. FIG. 10B illustrates striking spectral changes Yeast Strains produced by 3 MG fluorogen derivatives. It can be seen that a EBY100 was host to the yeast display library and YVH10 given fluorogen derivative tends to shift the spectrum to the was used to secrete scEvs, as described. For studies of indi blue or the red within a spectral context established by the 10 vidual FBPs, pPNL6 plasmids were transferred to JAR200, a FBP. However, in some cases for some fluorogens, specific G418 resistant derivative of EBY100. JAR200 expressed features of the FBP can greatly alter the extent of this shift or higher levels of displayed SchvS and gave higher transforma generate new spectral bands. Malachite green and most tion transformation rates with pPNL6 plasmids than derivatives have a secondary absorbance peak at near ultra EBY1OO. violet to blue wavelengths that is sensitive to fluorogenic 15 modulation by the FBP. We have taken advantage of this YVH10: Mat O. ura3-52, trp 1, leu28200, his36200, pep4: behavior to demonstrate fluorescent reporting in two colors HIS3, prbd1.6R, can1, GAL, GAPDH promoter-PDI1 excited by a single laser (non-overlapping green and red EBY100: Mat C. ura3-52, trp 1, leu28200, his36200, pep4: colors singly excited by the 488 nm argon laser.) It was found HIS3, prbd1.6R, can1, GAL.GAL promoter-AGAI:URA3 that color is a property of the combined FBP/fluorogen. Pro AR200: Mat O. ura3-52, trp 1, leu28200, his36200, pep4: tein context thus changes the fluorescent behavior of these HIS3, prbd1.6R, can1, GAL, GAL promoter-AGAI:: fluorogens, as has also been shown for stilbenes. URA3:G418r It has been long established that certain dyes exhibit Yeast Buffer System enhanced fluorescence upon binding to proteins, and there are We employed a modified PBS buffer (PBS pH 7.4, 2 mM other reports of fluorogenic binding of dye to an antibody. 25 EDTA, 0.1% w/v Pluronic F-127 (Molecular Probes, Invitro Several features of what we report are new and provide prom gen)) for magnetic bead enrichment, FACS experiments, and ise for development of a new generation of biosensor Systems all assays of yeast Surface displayed or purified ScHVS. Inclu and live-cell assays. Unlike fluorogen-activating monoclonal sion of Pluronic F-127 was found to greatly reduce absorption antibodies previously described, the fluorogen-activating oflow concentrations of TOI and MG dyes to plastic and glass ScFVs described here are relatively small and compact mono 30 surfaces; microplate samples of 500 nM free dye gave stable meric proteins that can be recombinantly manipulated and expressed, making scFvs Suited for use as genetically readings for at least 18 hours. expressed tags or as injectable sensors. Unlike GFP and Standard Procedure for Cloning of Single Chain Antibodies related fluorescent proteins, the reversibly bound fluorogen All FBPs other than HL1-TOI (see below) were cloned chromophore is directly accessible to experiment and its 35 essentially as described except that a 2-color FACS enrich chemistry can be modified to alter reporting and sensing ment Screen based on enhanced fluorescence of the fluorogen capabilities. In particular, control of access to the dye can was employed instead of a 2-color screen based on antigen afford a new level of selectivity. Unlike the biarsenical target labeled with independent fluorophore. FACS enrichment was peptide and the enzymatic peptide tags, ScPVS provide a rich carried out on a Becton Dickinson FACSVantage SE with well-understood source of binding variation, which can be 40 FACSDiva option; candidate FBPS were autocloned onto exploited to clone new FBPs that bind new fluorogens, or to agar plates prior to characterization. 1 uM TO1-PEG5000 enhance the functionality of existing FBPs and fluorogen biotin or 500 nMMG-PEG5000 biotin were used to magneti variants using directed evolution technology. cally enrich and sort for respective FBPS, except that 50 nM These studies demonstrated that FBP/fluorogen reporters MG-PEG5000-biotin was used to autoclone highest affinity are well suited for expression at the extracellular side of the 45 MG-FBP candidates. cell membrane. Although schvs are derived from extracellu Cloning of HL1-TOI lar antibodies and contain internal disulfide linkages, it has A large population of induced cells was directly enriched been shown that functional sclvs can be expressed intracel for FBPS by 3 successive rounds of FACS. Briefly, cells were lularly in a disulfide-free format. In addition, the FBP concept enriched for affinity by two rounds of magnetic bead treat can be extended to protein scaffolds beyond scFVs, as has 50 ment, and the output cells grown and induced. 10 of these been done for dye binding motifs such as the rhodamine cells were sorted on a MoFlo high speed FACS, and the output binding fluorettes and other structures. 9x10° cells were immediately resorted under the same con ditions to give 7x10" cells. These cells were again sorted to Example 5 give ~1500 cells as final output. After growth and induction, 55 these cells were sorted on an Epics Elite FACS, and the small Materials and Methods for Example 5 population of cells (-0.5%) with significantly improved fluo rogen signal was collected, regrown and resorted. These cells Yeast Display Library exclusively displayed HL1-TO1. Subsequent attempts at A yeast cell surface display library, composed of ~10 cloning other FBPs using this direct approach failed. recombinant human scFv's derived from cDNA representing 60 Identification of FBPS a naive germline repertoire, is obtained from Pacific North Autocloned yeast cells displaying candidate FBP isolates west National Laboratory (PNNL). The original version of were grown in Small cultures, and yeast plasmid DNA iso the library was obtained from PNNL and was the source of lated using a Zymoprep kit (Zymo Research). The sclv insert our first isolated FBP, HL1TO1. However, this library was was PCR amplified, and the amplified DNA product purified subsequently found to be contaminated by a low level of 65 on an agarose gel and then DNA sequenced. Sclv Variable another yeast strain (Candida parapsilosis) that over region sequences were classified as to human germline com whelmed yeast cultures afterrepeated outgrowth steps. We position by analysis on the IMGTN-QUEST website. US 8,664,364 B2 63 64 Spectral Characterization of FBPs Determination of Fluorogen Binding Affinity to Soluble Yeast surface displayed scFVs were spectrally character FBPS ized using fluorescence bottom reading in 96 well micro Binding affinity to soluble scFvs was determined by moni plates on a Tecan Safire2 plate reader. 10° cells in 200lyeast toring fluorogenic signal under conditions of ligand depletion buffer were assayed with 100-1000 nM MG-2p or TO1-2p. using a homogenous 96 well microplate assay similar to Spectra were corrected by subtraction of fluorescence of con above. 1 nM HL 1.0.1-TO1, 10 nM L5-MG and 100 nM trol cells not expressing Schvs. HL4-MG were each assayed with a 0.1 to 1000 nM range of Affinity Maturation of HL1-TO1 fluorogen. Fluorescence of each FBP+dye sample was cor Affinity maturation of HL1-TO1 followed described meth rected by Subtracting the fluorescence of a dye only sample. ods for random mutagenesis and selection of improved 10 K. Values were determined by non-linear regression using clones, except that the 2-color FACS screen used in our stan Graphpad Prism 4.0 and a ligand depletion algorithm. dard cloning procedure was employed using TO1-2p as the fluorogen. Secretion and Purification of Soluble FBPS 15 where X is the concentration of fluorogen, and R is the con Induction and secretion of scFvs were at 20° or 25° C. as centration of FBP/fluorogencomplex at the observed or described, except that YEPD was replaced by a tryptone extrapolated plateau at maximum fluorescence. based secretion medium: Determination of Quantum Yields 5 g/L casamino acids (-ade, -ura, -trp) 50 g/L Bacto-Tryptone Quantum yields were determined by comparing integrated (BD #211705) spectra of FBP/fluorogen complexes with those of reference 1.7 g/L Yeast Nitrogen Base w/out ammonium sulfate amino dyes. Corrected emission spectra were taken at concentra acids (BD #233520) tions of FBP/fluorogen complex and reference dyes giving 5.3 g/L ammonium sulfate similar absorbances at the excitation wavelength, and the 10.19 g/L NaHPO.7HO intensity integral computed. Provisional quantum yields were 8.56 g/L NaH2POHO 25 calculated by the relation: FBP secretion in 1 liter cultures was monitored during the 2-5 day course of induction by assaying the fluorescence of culture supernatants on a 96-well Tecan Safire2 plate reader. d = dp: 100 ul of 2x assay buffer (100 mMNa HPO, pH 7.4, 4 mM R IR 3: A kni EDTA, 0.2% Pluronic F-127) containing either 1 uMTO1-2p 30 or 200 nMMG-2p was added to 100 ul of culture supernatant where (phi is the quantum yield, I is the integrated intensity, for reading; readings were corrected for background by Sub A is the absorbance, m is the refractive index, and R desig tracting the fluorescence of identically treated virgin secre nates the reference dye. Provisional quantum yields were tion medium. Tryptone secretion medium gave 2 to 10-fold 35 adjusted to 1:1 complexation by using the solution K, of the increased yields of secreted schvs as compared to YEPD. complex to quantify the proportional occupancy at these con Culture Supernatants were dialysed and concentrated 3 centrations (using Graphpad Prism 4.0 and the above ligand times against 6 liters PBS on an Amicon Model 2000 high depletion algorithm). performance ultrafiltration cell using a 10,000 mw cut-off A cyanic dye, Cy5.18 in PBS and Di-S C2-(5) in MeOH cellulose membrane. To purify the 6-his tagged FBPS, the 40 were used as reference fluorophores for the determination of concentrated dialysate (~50 ml) was subjected to nickel-ni HL4-MG/MG-2p and L5-MG/MG-2p quantum yields. 2 uM trilotriacetic acid chromatography (Ni-NTA) according to schv and 440 nMMG-2p were employed; emission spectra of manufacturers instructions. Appropriate dilutions of eluted respective complexes were taken in duplicate. Absorbances fractions were assayed for fluorogenic activity using essen of the respective complexes were significantly higher than tially the same assay as for secretion. Fluorescent fractions 45 free MG-2p. These differences in absorbance magnitude were pooled, assayed for protein content using a BCA protein underrepresent actual differences because of incomplete assay kit, and analyzed by SDS gel electrophoresis. complexation at these concentrations. HL4MG/MG-2p and Determination of Fluorogen Binding Affinity to Yeast Surface L5-MG/MG-2p quantum yields were respectively multiplied Displayed FBPs by 1.35 and 1.20 to correct for incomplete complexation. A homogenous assay under equilibrium binding condi 50 Fluorescein in 0.1 N NaOH and Rhodamine-6-G in MeOH tions was devised to determine the binding affinity of fluoro were used as reference fluorophores for the determination of gen to yeast displayed scEvs. A flow cytometric method for the quantum yield of HL 1.0.1-TO1/T012p. At the employed titrating yeast displayed scFvs with fluorescently labeled concentrations of 2 uM scFv and 520 nM TO1-2p, virtually antigen was adapted to the use of fluorogens. 10 induced complete complexation is expected, and no correction was yeast in 200 ul modified PBS (~1 nM displayed scFvs) con 55 used. Only slight changes in absorbance magnitude were taining fluorogen over a concentration range of 0.1-1000 nM noted. were assayed in duplicate for fluorescence in 96 well micro Determination of Fluorogenic Enhancement plates on a Tecan Safire2 reader. As controls, mock induced Fluorogenic enhancement of HL4-MG, L5-MG and JAR200 cells that do not express schvs were treated with HL 1.0.1-TO1 was measured in 96 well microplates on a equal concentrations of fluorogen; fluorescence was cor 60 Tecan Safire2 reader by comparison of the fluorescence of rected by subtraction of the fluorescence of control cells. Cell 500 nM free fluorogen with the fluorescence of a mixture of surface K values were determined on Prism Graphpad Prism 500 nM fluorogen and 2 uM respective FBP. After a 1 hour 4.0 Software by non-linear regression analysis using a one incubation to allow complex formation, fluorescence was site binding algorithm for saturation binding: measured at the excitation and emission maxima of the fluo 65 rogen/FBP complexes. Fluorescence of yeast PBS buffer was Subtracted from all samples. Fluorescence readings were where X is the concentration of fluorogen. stable for at least 16 hours. US 8,664,364 B2 65 66 Extended gain settings were used to increase numerical rier transform filter in Photoshop. Images in were acquired on accuracy. For HL4-MG and L5MG, the differences in fluo a Zeiss LSM510 META laser scanning microscope using a rescence between complexes and free dye exceeded the 63x objective. Fluorescence images were excited at 633 nm extended gain range of the instrument, so intermediate con using a 650 nm long pass filter. centrations of Cy5 were also measured to allow interpolation In addition, Surface labeling of human tumor cells with a between the extreme values. Two independent experiments, MG fluorogen-activating polypeptide was shown. Stably each with triplicate measurements, were carried out for each transformed M21 melanoma cells expressing HL4-MG fused of the 3 FBPS. standard deviations for averaged values of to PDGFR were imaged as a confocal stack at 488-nm exci FBPS, free fluorogen or PBS were less than 5%. The fold tation using 10 nMMG-11p. Images were acquired on a Zeiss enhancement values for HL4-MG and L5-MG were respec 10 LSM510 META laser scanning microscope using a 63x tively multiplied by 1.35 and 1.20 to correct for partial com objective. Images were acquired on a Zeiss Axioplan 2 with plexation. Apotome microscope. Green false color (TO1-2p) was Mammalian cell-surface expression of FBP molecules imaged using 540/25 and 605/55 nm excitation and emission Plasmids expressing Surface-displayed scFv's were gener filters; red false color was imaged using 560/55 and 710/75 15 nm excitation and emission filters. Images were reconstructed ated as follows. A 375 by PCRamplicon was amplified from from 721 um sections, displayed as 15 projections in NIH E. coli C600 DNA using as primers: Image software, and false colored in Adobe Photoshop. Also, surface labeling offibroblasts with a TO1 fluorogen SEQ ID NO: 23: activating polypeptide was detected. Stably transformed GGGGCTACCAGTTTGAGGGGACGACGA NIH3T3 cells expressing HL1.1-TO1 fused to PDGFR and imaged using 40 nM TO1-2p. Images were acquired on a SEQ ID NO: 24: Zeiss Axioplan 2 with Apotome microscope. Green false GGCCCCTGCGGCCGTTAGCTCACTCATTAGGCA color (TO1-2p) was imaged using 540/25 and 605/55 nm. This molecule, which contains the lac promoter and 271 excitation and emission filters; red false color was imaged nucleotides of beta-galactosidase coding sequence flanked by 25 using 560/55 and 710/75 nm excitation and emission filters. Sfil sites, was cut with Xmal and ligated into poisplay (Invit Images were reconstructed from 721 um sections, displayed rogen) between the Smal and Xmal sites to produce vector as 15 projections in NIH Image software, and false colored in pDisplayBlue. Individual schv sequences were prepared for Adobe Photoshop. The HL1.1-TO1 expressing cells were insertion between the Sfil sites in plisplayBlue by PCR excited at 488 nm and visualized with a 500 nm long pass amplifying the scFv sequences from pPNL6 clones using as 30 filter. primers: In another experiment, it was shown that simultaneous surface labeling of fibroblasts with MG and TO1 FAPs occurred. NIH3T3 cells respectively expressing the FAPs 1:1 SEO ID NO: 25: and imaged using 10 nM MG-2p and 40 nM TO1-2p. The TATATAGGCCCAGCCGGCCTACCCATACGACGTTCCAGAC 35 transparency of Surface-labeled cells allows fine discrimina tion of contact surfaces between cells of different colors. SEO ID NO: 26: Images were acquired on a Zeiss Axioplan 2 with Apotome TATATAGGCCCCTGCGGCCAATTCCGGATAGGACGGTGAG microscope. Green false color (TO1-2p) was imaged using These amplicons were cut with Sfil, ligated into Sfil-cut 540/25 and 605/55 nm excitation and emission filters; red vector, transformed into DHScc E. coli to ampicillin resis 40 false color was imaged using 560/55 and 710/75 nm excita tance, and Lac-- colonies picked for DNA sequencing. DNA tion and emission filters. Images were reconstructed from 72 was prepared from selected transformants using Qiagen 1 um sections, displayed as 15 projections in NIH Image Mini-Prep kits and transfected into NIH3T3 cells or M21 software, and false colored in Adobe Photoshop. a 700/75 nm. mouse melanoma cells (~1 ug DNA per 10 cells) in 24-well bandpass filter was used to visualize the 488 nm excitation of plates using Lipofectamine 2000 (Invitrogen) following the 45 HL4-MG protocols supplied by the manufacturer. Stable transfectants were isolated by successive rounds of FACS sorting of cells Example 7 exposed to the appropriate fluorogens. Fusion of schv Sequences to the Human Glucose Example 6 50 Transporter GLUT4, and Expression of the Fusion Constructs in Mammalian Cells Fusion of schv Sequences to a Transmembrane Domain Derived from Human Fibroblast Growth An open reading frame comprising the coding sequence of Factor Receptor 2, and Expression of the Fusion human GLUT4 was cloned 5' to the PDGFR sequence in the Constructs in Mammalian Cells 55 modified pCisplay vector described in Example 5 that was further modified to accept the insert between PflMI restriction Mammalian Cell-Surface Expression of Fluorogen-Activat sites. Fluorogen-activating Schv sequence HL1.1-TO1 was ing Polypeptide Molecules. cloned between the Sfil sites of these constructs as described NIH3T3 cells stably expressing HL4-MG fused to PDGFR in Example 5. NIH3T3-L1 cells were transfected with the were imaged by confocal microscope at 633 nm excitation 60 constructs, and stable transfectants were isolated by multiple after treatment for 5 minin PBS with 200 nMMG-11p or 200 rounds of FACS sorting for fluorogen-activating cells. nM. MG-ester. On longer incubation, MG-ester illuminated Imaging by fluorescence microscopy after incubation in intracellular features such as the nuclear periphery (endoplas the presence of fluorogen showed distinct surface labeling mic reticulum) and Golgi become more difficult to visualize. when cells were treated with a membrane impermeant fluo Fluorescence images were excited at 633 nm using a 650 nm 65 rogen, and internal as well as Surface labeling when cells were long pass filter. Fluorescence images were unprocessed; transfected with a control plasmid with EGFP cloned interference lines on DIC images were removed using a fou between the Sfil sites. US 8,664,364 B2 67 68 Images were taken with Apotome microscope with 63x ence and absence of TO1. The population of induced cells water immersion lens. Excitation occurred at 488 nm with was analyzed by measuring fluorescence emitted at 685 from emission collected in GFP channel. Cells are undifferentiated a signal caused by protein labeled by anti-C-myc Alexa 647. 3T3-L1 fibroblasts. These results indicate that a fusion pro This allowed confirmation that the three classes of yeast cells tein between GLUT4 and a fluorogen-activating scFv is cor were expressing full length heavy, light, or heavy and light rectly localized at the cell surface, as well as in the expected chains on the cell surface. For cells that expressed full length Subcellular compartments of the endomembrane system. fragments the TO1-2p fluorescence was observed as emission at 530. Example 8 10 TABLE 1 Fusion of schv Sequences to the Human G-Protein Coupled Receptor ADRB2, and Expression of the Fusion Constructs in Mammalian Cells PLASMID MEANS3O SIGNAL

The coding sequence of human ADRB2 was PCR ampli 15 ScFv1 PNL6 840 Intact origininal ScFv fied from an ADRB2 fosmid and cloned into the BSmI site in ScFv1 PNL6URA3 760 Intact origininal ScFv the modified poisplay vector described in exampleN, with an in frame stop codon at the 3' end of the ADRB2 sequence. HOPNL6 88 Heavy chain only Fluorogen-activating Schv sequences HL1.1-TO1 and HOPNL6URA3 82 Heavy chain only HL4MG were cloned into the Sfil sites of these constructs as LOPNL6 102 Light chain only described in example N. NIH3T3 cells were transfected with LOPNL6URA3 1OO Light chain only the constructs, and stable transfectants were isolated by mul HOPNL6-LO 317 Heavy and light same cell tiple rounds of FACS sorting for fluorogen-activating cells. Imaging by fluorescence microscopy after incubation in PNL6URA3 the presence of fluorogen showed distinct Surface labeling 25 HOPNL6URA3 - 261 Heavy and light same cell when cells were treated with membrane imperimeant fluoro LOPNL6 gens, and internal as well as Surface labeling when cells were treated with membrane permeant fluorogens. Further, when cells were treated with the ADRB2 agonist isoproterenol at The cells expressing both heavy and light were 2.5-3 times physiological concentrations, internalization of the ADRB 30 more fluorescent than cells expressing heavy or light only. fusion protein was observed, indicating that the fusion protein The signal increase is likely to be larger in assays where the was physiologically active with respect to recognition and two proteins containing the heavy and light chains are asso internalization of the agonist. ciating in a pair-wise manner rather that a statistical associa tion. With pair-wise protein-protein interactions the fluores Example 9 35 cence of the complex may approach that of the original Schv PNL6 or PNL6URA3 in which the heavy and light chains are Cell Surface Complementation directly linked through a short-serine-glycine-polymeric This experiment demonstrated that the light chain and linker. heavy chains of a selected scFv can be separately fused to two 40 In the second approach, a fluorescence spectrometer was different proteins, and that when these two proteins are in used to quantify the fluorescence from Suspensions of cells. close proximity, the heavy and light chains associate to pro The fluorescence excitation wavelength was 506 nm and the duce a binding site for the same dye that binds to the original emission wavelength was 610 nm. Values presented below are ScFv leading to a fluorescence increase. In the following corrected from raw data by subtracting out the values for experiments three classes of yeast cells were generated by 45 (buffer+dye) and induced (no dye) samples. They were then molecular biology methods known in the art. One class of corrected for the percent of the population that was induced, yeast expressed only the heavy chain of the sclv on the as determined by the flow cytometry analysis analysis. Surface. A second class expressed only the light chain of the sch v on its surface. The third class expressed both the heavy TABLE 2 and light chains on the surface. When the fluorescent reporter 50 TO1 was added independently to Solutions containing the F/(% Pop three classes of yeast cells, only the third class that expressed PLASMID Fluorescence % Pop. Ind IND) both heavy and light chains at a high Surface density produced a fluorescence increase, as shown below. Specifically, two ScFv1 PNL6 23934 60.3 39691 vectors, pPNL6 and pPNL6URA3 were prepared, where the 55 ScFv1 PNL6URA3 28686 48.4 S9268 TRP1 gene of pPNL6 was replaced with the URA3 gene of S. HOPNL6 135 84.2 160 cerevisiae. This approachallowed selection for both plasmids HOPNL6URA3 -605 70.6 f in a single cell. Fragments carrying Schv1. Sclv1 HO (heavy LOPNL6 -16 73.7 f only chain), or schv1 LO (light only chain) were cloned into LO PIML6URA3 882 64.4 1369 each of the two vectors. 60 HOPNL6-LO PIML6URA3 6553 84.2 7782 JAR200 yeast cells were transformed with each single HOPNL6URA3 - LOPNL6 4571 73.1 6253 plasmid as well as both sclv1 HO (PNL6)+scFv1 LO (PNL6URA3) or both scFv1 HO (PNL6URA3)+scFv1 LO (PNL6). Analysis by FACS and TECAN followed induction The fluorescence spectroscopy measurements demon of the cells. In both cases, 1 uMTO1-2P was used. 65 strated that cells expressing both heavy and light were sig In the first approach, flow cytometry was used to assay nificantly more fluorescent than cells expressing heavy or cellular fluorescence of the three classes of yeast in the pres light only.

US 8,664,364 B2 71 72 2-(1-3-3 (1,3-Dihydro-1,3-dioxo-2H-isoindol-2- t);3.13 (2H, t); 2.58 (4H, m); 2.33 (2H, m); 2.06 (2H, m); 1.42 yl)propyl-4(1H)cquinolinylidene)methyl-3-(3-sulfo (9H, m). UV/VIS.% m, =508 nm propyl)benzothiazolinium inner salt 3 2-(1-(18-amino-4,9-diaza-12, 15-dioxa-5,8-dioxo 1-(3-N-Phthalimidopropyl)-4-methyl-quinolinium bro octadecanyl)-4(1H)-quinolinylidene)methyl-3-(3- mide 2 (822 mg, 2 mmol) and 3-(3-Sulfopropyl)-2-meth sulfopropyl)benzothiazolinium trifluoroacetate ylthio-benzothiazole 1 (1.2g, 4 mmol) were dissolved in 150 “TO1-2P7 mL boiling anhydrous ethanol. Triethylamine (0.28 ml, 4 mmol) was gradually added over a 15 minutes time period. TO1-2P-BOC 6 (368 mg 0.5 mmol) was dissolved in The reaction mixture was refluxed for one hour. The precipi 10 methanol (50 mL) and 1N hydrochloric acid 5 mL was added. tated solid was filtered off from the hot reaction mixture to The reaction mixture was stirred overnight at room tempera give 822 mg of a red powder. Yield: 820 mg (70%); ture. The solvent was removed under vacuum to give an CH7NOSMW=585.7 g/mol orange resin. The product was purified by HPLC: Waters u-Bondapak C18; gradient 10-40% waterfacetonitrile/0.1% Theory: C63.57% H 4.65%: N 7.17% Found: C 63.62% H 15 4.61% N 7.05% TFAH-NMR (MeOD):8.53 (1H, d); 8.27 (1H, d); 7.75 (1H, t); 7.68 (1H, d); 7.55 (1H, t): 7.49 (1H, d); 7.43 (1H, d); 7.37 'H-NMR (CDC1/MeOD): 8.85 (1H, d); 8.33 (1H, d); (1H, t): 7.05 (1H, t): 7.01 (1H, d); 6.68 (1H, d-exchanges): 7.68-7.87 (8H, m); 7.52-7.62 (2H, m); 7.31 (2H, m); 7.06 4.57 (2H, t); 4.35 (2H, t):3.72 (2H, t): 3.65 (4H, m); 3.57 (2H, (1H, s); 4.75 (2H, t); 4.51 (2H, t): 3.84 (2H, t): 3.11 (2H, t): t); 3.39 (2H, t): 3.31 (2H, t): 3.14 (2H, m); 3.12 (2H, m); 2.26 2.34 (4H, m). (2H, m); 2.04 (2H, m); CHFNOS MW: 799.9 g/mol -(1-(3-Aminopropyl)-4-(1H)-quinolinylidene)me emol (504 in H2O)34000; emol (504 in MeOH)49500 thyl-3-(3-sulfopropyl)benzothiazolinium hydrochlo Biotin-PEG5000-TO1 9 ride “TO14 25 2-(1-(3-Aminopropyl)-4-(1H)-quinolinylidene)methyl 2-(1-3-3 (1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)pro 3-(3-sulfopropyl)benzothiazolinium hydrochloride TO1 4 pyl-4(1H) quinolinylidene)methyl-3-(3-sulfopropyl)ben (5.8 mg; 0.01 mmol) was dissolved in 0.1 mL of water. Zothiazolinium inner salt 3 (585.7 mg; 1 mmol) was sus Biotin-PEG5000-NHS ester 8 (Nektar Therapeutics) (50 mg: pended in 20 mL concentrated hydrochloric acid and 5 mL 0.01 mmol) dissolved in 0.1 mL of DMF was added to the ethanol. The reaction mixture was refluxed for 48 hrs. The 30 TO1 solution followed by 0.1 mL of saturated sodium bicar Solvent was removed under vacuum. The residue was dis bonate solution. The reaction mixture was stirred for 1 hr. The solved in 10 ml, of methanol and the dye was precipitated solvents were removed under vacuum and the residue was with 50 mL methylene chloride. The dye was filtered off; taken up in a minimum of water and passed through a P4 sized dissolved in water and filtered. The filtrate was concentrated exclusion column to remove free TO1. The PEG fraction was under vacuum to give 400 mg of a red powder. Yield: 394 mg 35 concentrated and purified on Q-Sepharose (Amerscham Bio (80%) CHCINOS MW: 492.06 g/mol; Theory: C sciences) to separate unlabeled Biotin-PEG from Biotin 54.16% H 5.53% N 8.23%; Found: C 54.39% H 5.70% N PEG5000-TO1. MS; M. 5743.56; 7.82% 'H-NMR (DO): 7.64 (1H, d); 7.63 (1H); 7.53 (1H); 7.43 H O (1H): 7.23 (1H); 7.1 (1H); 6.92 (1H); 6.9 (1H); 6.54 (1H): 40 N1 6.29 (1H); 5.9 (1H); 3.7 (4H); 2.95 (2H); 2.82 (2H); 1.81 (4H). CHCINOS X HO: MW 510.07 g/mol; LTV/VIS a, b max=488 mm; emol, =58000 -- -e- 2-(1-(Boc-18-amino-4,9-diaza-12, 15-dioxa-5,8- 45 O dioxo-octadecanyl)-4(1H)quinolinylidene)methyl-3- (3-sulfopropyl)benzothiazolinium inner salt “TO1 10 O 1N 2P NHBOC 6 11 Boc-14-amino-5-aza-8,11-dioxa-4-oxo-tetradecanoic 50 Cl acid 5 (700 mg, 2 mmol) was dissolved in dry CHCN (10 N N mL). N-Hydroxysuccinimide (2.1 mmol, 300 mg) and dicy clohexylcarbodiimide (500 mg, 2.1 mmol) were added. The reaction mixture was stirred at room temperature overnight. 1. O 21 C N The precipitated urea was filtered off and the filtrate was used 55 in the next reaction step. TO1-amine (500 mg, 1 mmol) was dissolved in a mixture of water (10 mL) and acetonitrile (10 mL). The active ester solution was added in portions of 0.5 mL. After 30 min of stirring a precipitate formed. TLC control O (silica gel) showed the product in the solution phase (9:1 60 CHC13/McOH/1 TFA). The solid was filtered off and the 's-- filtrate concentrated under vacuum. The residue was purified OCH5 by column chromatography on silica gel. Yield: 1.1 g (75%); 13 CHCINOS MW: 725.48 g/mol 1H-NMR (MeOD): a) ZnCl2:EtOH:12 8.64 (1H, d); 8.31 (1H, d); 7.75 (2H, m); 5.59 (2H, m); 7.44 65 b) TCB:ethyl acetate (2H, m); 7.12(1H, t): 7.07 (1H, d); 6.79 (1H, s); 4.65 (2H, bt); 4.39 (2H, t): 3.60 (4H, s); 3.5 (4H, m); 3.38 (2H, t): 3.21 (2H, US 8,664,364 B2 73 74 4-(1-Oxa-3-carboethoxypropyl)phenylbis 4-(dim -continued ethylamino)phenyl-methane 12 N N Dimethylaniline 10 (7.27 g; 60 mmol) and ethyl 4(4- 1. N formylphenoxy)butanoate 11 (7.08 g; 30 mmol) were dis 5 H solved in anhydrous ethanol (300 mL). Anhydrous zinc chlo ride (8.2 g) was added and the reaction mixture was refluxed for 2 days, distilling off the ethanol 4-5 times and replacing it with anhydrous ethanol. After cooling to room temperature, the reaction mixture was concentrated. The residue was taken 10 up in ethyl acetate and water. The organic phase was sepa O rated, washed with water, dried, concentrated and purified on silica gel. Eluent: Ethyl acetate. MWCHNO. 476.62 O ~s 1N1 NHC3 g/mol; yield: 11.4 g (80%): 'H-NMR (CDC13): 7.1 (2H, d); H 15 7.05 (4H, d); 6.85 (2H, d), 6.75 (2H, d);5.4 (1H.s, OH); 4.25 a) 2N NaOH:14 16 (2H, q): 4.05 (2H, t); 2.95 (12H, s); 2.6 (2H, t); 2.25 (2H, m), b) CH3COOEt/NEt3; 1.35 (3H, t) c) H5N-CH-NHBoc 15, d) HCLEtOH Methylium, bis4-(dimethylamino)phenyl (4-(3- 4-(Boc-9-amino-6-aza-1-Oxa-5-oxo-nonyl)phenyl carboethoxypropyl)phenyl)-chloride 13 bis(4-(dimethylamino)phenylmethane 15 4-(1-Oxa-3-carboethoxypropyl)phenylbis 4-(dimethy 4-(1-Oxa-3-carboxypropyl)phenylbis 4-(dimethy lamino)phenyl-methane 12 (460 mg, 1 mmol) was dissolved lamino)phenyl-methane 14 (4.1 g, 9.14 mmol) was dissolved in 25 mL ethyl acetate. Tetrachloro-p-benzochinone (490 in a mixture of dry THF/CHC1. Triethylamine (1.4 mL, 10 mg/2 mmol) was added and the reaction mixture was refluxed 25 mmol) was added. The reaction mixture was cooled to 0°C. for 1 hr. The reaction mixture was cooled to room tempera Ethyl chloroformate (0.95 mL, 10 mmol) was added and the ture. Ethyl acetate (75 mL) was added and the product was reaction mixture was stirred for 30 min (TLC) control. extracted with water (5x50 mL). The combined aqueous NBOC-ethylenediamine (1.6 g. 10 mmol) was added. The phase was washed with ethyl acetate (2x50 mL) and concen reaction mixture was stirred for 30 min at room temperature trated to give 200 mg (40%) of product. MWCHCINO 30 (TLC control silica gel, ethyl acetate). The solvent was 511.1 g/mol 'H-NMR (CD3CN): 7.33 (4H, d); 7.08 (2H, d); removed and the residue was taken up in ethyl acetate. The 6.92 (4H, d); 4.15 (2H, t); 4.10 (2H, q): 3.23 (12H, s); 2.48 organic phase was washed with diluted sodium bicarbonate, (2H, t): 2.08 (2H, m); 1.21 (3H, t) water and brine and dried over sodium sulfate. The solvent was removed under vacuum and the residue purified by col 4-(1-Oxa-3-carboxypropyl)phenylbis 4-(dimethy 35 umn chromatography on silicagel; eluent: ethyl acetate (RF lamino)phenyl-methane 14 0.2). Light blue crystals were obtained. MWCHNO 574.8 g/mol. Yield: 4.2 g (80%). H-NMR (CD3CN): 7.01 (2H, d); 6.94 (4H, d); 6.82 (2H, d); 6.69 (4H, d); 6.59 (1H, s, 4-(1-Oxa-3-carboxypropyl)phenylbis 4-(dimethy CONH); 5.59 (1H, s, CONH); 5.28 (1H, s, OH); 3.95 (2H, t): lamino)phenyl-methane 12 (5g, 10.5 mmol) was dissolved in 3.21 (2H, m); 3.11 (2H, m); 2.88 (12H, s); 2.28 (2H, t): 1.99 acetone (30 mL). Sodium hydroxide (10 mL of a 2Naqueous 40 (2H, m); 1.4 (9H, s, BOC) Solution) was added. The reaction mixture was stirred at room temperature until the ester was cleaved (TLC control). The 4-(9-amino-6-aza-1-Oxa-5-oxo-nonyl)phenylbis 4 acetone was removed and the aqueous solution adjusted to pH (dimethylamino)phenyl-methane 16 3-4 with 1 NHC1. The aqueous phase was extracted with ethyl acetate (3x50 mL). The combined organic phase was washed 45 4-(Boc-9-amino-6-aza-1-Oxa-5-oxo-nonyl)phenylbis A with water and brine and dried over sodium sulfate. The (dimethylamino)phenylmethane (118 mg, 0.2 mmol) was Solvent was removed to give 4 g of a light green resin (Yield: dissolved in HCI/ethanol (2 mL of a 5% solution). The reac 90%). The compound was used without further purification. tion mixture was kept overnight at room temperature. The MW:CHNO. 448.6 g/mol. H-NMR (CDC13): 6.96 (2H, solvent was removed and the residue dried. The product was d); 6.88 (4H, d); 6.81 (2H, d); 5.24 (1H, s); 3.92 (2H, t); 2.83 50 used as such in the next reaction step. (12H, s); 2.34 (2H, t): 1.91 (2H, m) a, b, c 16 -e-

-N N 55 N + Cl Clu N a, b, c, d OUC 60

O

--- OCH5 65 12 US 8,664,364 B2 75 76 -continued 3-CONH-CH NHCO CH, O CH CONH O (CHO), C.H. NHNHBOC: 'H-NMR (CD3CN): H 7.28 (1H, d), 7.17 (2H, d), 7.11 (1H, d), 7.02 (2H, d), 6.80 MG-2PR = --~~r- (2H, dd), 6.67 (2H, dd), 5.4 (1H, s), 3.95 (2H, m), 3.91 (2H, O d), 3.88 (2H, s), 3.54 (42H, m), 3.45 (2H, t), 3.39 (2H, m), 18 3.29 (2H, m), 3.27 (2H, m), 2.89 (12H, s), 2.30 (2H, m), 2.00 (2H, m), 1.40 (9H, s). MG-11PR = N^^ -non-" O O 10 MG-11P2O

Leuko-MG-11P-NHBoc 19 (150 mg, 0.124 mmol) was dissolved in 25 mL acetonitrile. The reaction mixture was heated to 50 C. Tetrachloroquinone (100 mg 0.4 mmol) was 15 dissolved in 30 mL boiling acetonitrile and dropwise added under stirring to the leukobase. The darkgreen dye formation was followed by 'H-NMR control. After several hours the reaction mixture was cooled to room temperature. The aceto 4-(Boc-9-Aminoethyl-PEG2)-6.9, 15-triaza-1,12 nitrile was removed and the reaction mixture was partitioned dioxa-5,10,14-trioxopentaundecanyl)phenylbis 4 between water (150 mL) and ethyl acetate (50 mL). The water (dimethylamino)phenyl-methane Leuko-MG-2P 17 phase was separated and washed several times with ethyl acetate. The water phase was concentrated to give a green 4-(9-Amino-6-aza-1-Oxa-5-oxo-nonyl)phenylbis A residue. Hydrochloric acid in ethanol (2 mL of a 20% solu (dimethylamino)phenyl-methane (118 mg 0.2 mmol) 16 was 25 tion) was added and the reaction mixture was stirred for 1 hr. reacted with the NHS-ester of boc-4-amino-5-aza-8,11 The reaction mixture was concentrated to dryness to give 60 dioxa-4-oxo-tetradecanoic acid 5 in 1 DMF (1 mL)/1N mg of a green powder. Yield: 53% MG-O-(CH)— NaHCO (1 mL). The reaction mixture was concentrated and CONH-CH NHCO CH, O CH, CONH purified by chromatography on silicagel (eluent: ethyl (CHO). CH-NH. 'H-NMR (MeOD): 7.43 (4H, d); acetate/10-30% methanol). MW: CHNO. 574.8 g/mol 30 7.36 (2H,d), 7.17 (2H,d), 7.05 (4H, d), 4.20(2H, t), 4.06 (2H, d); 4.05 (2H, d), 3.77 (2H, t), 3.78-3.58 (44H, m), 3.45 (2H, t), 4-(9-Aminoethyl-PEG2)-6.9, 15-triaza-1,12-dioxa-5, 3.32 (12H, s), 3.18 (2H, t), 2.45 (2H, t), 2.15 (2H, m). 10,14-trioxo-pentaundecanyl)MG-2P 18 Cs, HNO+MS/M--=1116.53 Leuko-MG2 17 (161 mg/0.28 mmol) was dissolved in 25 35 mL of ethyl acetate. Tetrachloro-p-benzochinone (100 mg/0.4 mmol) was added and the reaction mixture was MG-11P-Biotin refluxed for 1 hr. The reaction mixture was concentrated to 2 mL. Hydrochloridacid (2 mL of a 1N solution) was added and MG-11p 20 (11 mg; 0.01 mmol) was dissolved in 0.2 mL the reaction mixture was stirred at room temperature for 1 hr. 40 DMSO. A solution of BiotinNHS ester (6.5 mg 0.02 mmol) The reaction mixture was partitioned between 100 mL ethyl in 0.1 mL DMSO was added followed by 0.02 ml, of DEA (1 acetate and 150 mL of water. The water phase was separated mMol in DMSO). The reaction mixture was stirred for 2 hrs and washed with ethyl acetate (2x100 mL). The aqueous at room temperature, then passed through a short column of phase was concentrated. The residue was dried at 60° C. neutral aluminum oxide. DMSO and DEA were eluted with under high vacuum to give 130 mg of dye (yield: 88%). MW: 45 C.H.N.O.C1 509. 1 g/mol 'H-NMR (MeOD): 7.42 (4H, chloroform. The product was eluted with chloroform/10-20% d); 7.36 (2H, d); 7.17 (2H, d); 7.04 (4H, d); 4.25 (2H, t): 3.71 methanol to give 8 mg of a green solid. Yield: 58%. (2H, m); 3.65 (4H, m); 3.55 (2H, t): 3.36 (2H, t): 3.31 (12H, MG-O-(CH) CONH-CH NHCO CH-O s): 3.30 (2H, m);3.07 (2H, m); 2.49 (4H; m); 2.44 (2H, t): 2.15 CH-CONH-(CHO), C.H. NH-Biotin "H-NMR (2H, q). 50 (MeOD): 7.43 (4H, d), 7.37 (2H, d), 7.18 (2H, d), 7.06 (4H, d), 4.51 (1H, m), 4.32 (1H, m), 4.21 (2H, m), 4.06 (2H, s), 4-(Boc-Aminoethyl-PEG 11)-6.9, 15-triaza-1,12 4.05 (2H, s), 3.65 (44H, m), 3.55 (2H, m), 3.47 (2H, m), 3.38 dioxa-5,10,14-trioxopentaundecanyl) Leuko-MG (6H, m), 3.32 (12H, s), 3.25 (4H, m), 3.06 (1H, m), 2.93 (3H, NHBOC 19 m), 2.45 (2H, m), 2.22 (2H, m), 2.16 (2H, qui). C7HosC1 55 O-2-Boc-amino)-ethyl-O'2-(diglycolyl-amino)ethyl NOsS+: MS/M+=1342.60 decaethylene glycol P11 (152 mg, 0.2 mmol) were dissolved in dry DMF (0.5 mL). TSTU (66 mg, 2.2 mmol) and DEA (39 Biotin-PEG5000-MG LL, 2.2 mmol) were added. The reaction mixture was kept overnight at room temperature. 4-(9-Amino6-aza-1-Oxa-5- 60 MG-2P 18 (5 mg; 0.01 mmol) and Biotin-PEG5000-NHS oxo-nonyl)phenylbis 4-(dimethylamino)phenyl-methane ester 8 (Nektar Therapeutics) (50 mg; 0.01 mmol) were dis (100 mg, 0.2 mmol) 16 was dissolved in dry DMF (0.2 mL) solved in 0.2 mL of DMF and 0.01 mL of DEA (1 mMol in and added to the active ester of P11. The reaction mixture was DMF) was added. The reaction mixture was stirred for 1 hr. kept at room temperature for 3 hrs. The solvent was removed The reaction mixture was passed through a short column of under vacuum and the residue purified on silicagel (eluent: 65 neutral aluminum oxide. DMF and DEA were eluted with ethyl acetate/10-30% methanol). MW: CHNOs 1208.5 chloroform. The product was eluted with chloroform/10-20% g/mol. Yield: 150 mg (62%). (MG(H) O-(CH) methanol. Mn=5747.8. US 8,664,364 B2 77 78 N-4-(4-Carboxyphenyl)4-(dimethylamino)phenyl Chem. 279, 22284 (May 21, 2004); L. W. Miller, V. W. Cor methylene-2,5-cyclohexadienlylidene-N-methyl nish, Curr. Opin. Chem. Biol. 9, 56(February, 2005); A. Tirat, methanaminium chloride 21 F. Freuler, T. Stettler, L. M. Mayr, L. Leder, Int. J. Biol. Macromol. 39, 66 (Aug. 15, 2006); B. R. Martin, B. N. Giep mans, S. R. Adams, R. Y. Tsien, Nat. Biotechnol. 23, 1308 (October, 2005:); S. R. Adams et al., J. Am. Chem. Soc. 124, 21 6063 (May 29, 2002); J. Nygren, N. Svanvik, M. Kubista, Biopolymers 46, 39 (July, 1998); J. R. Babendure, S. R. Adams, R.Y. Tsien, J. Am. Chem. Soc. 125, 14716 (Dec. 3, 10 2003); and T. Iwaki, C. Torigoe, M. Noji, M. Nakanishi, OCrs21 Biochemistry 32,7589 (Jul 27, 1993). R. W. Siegel, J. R. Coleman, K. D. Miller, M.J. Feldhaus, J. Immunol. Methods 286, 141 (March, 2004); M.J. Feldhaus 15 et al., Nat. Biotechnol. 21, 163 (February, 2003); D. W. Colby et al., Methods Enzymol. 388,348 (2004); G. H. Patterson, S. M. Knobel, W. D. Sharif, S. R. Kain, D. W. Piston, Biophys. J. 73,2782 (November, 1997); A. Simeonov et al., Science 290,307 (Oct. 13, 2000); D. W. Colby et al., J. Mol. Biol. 342, O OH 901 (Sep. 17, 2004); T. Tanaka, M. N. Lobato, T. H. Rabbitts, J. Mol. Biol. 331, 1109 (Aug. 29, 2003); K. M. Marks, M. All publications and patents mentioned herein, included Rosinov, G. P. Nolan, Chem Biol 11,347 (March, 2004): R.Y. those listed below, are hereby incorporated by reference in Tsien, FEBS Lett. 579,927 (Feb. 7, 2005); O. Tacal, L. Ozer, their entirety as if each individual publication or patent was J. Biochem. Mol. Toxicol. 18, 253 (2004); S. J. Culp et al., specifically and individually incorporated by reference. In 25 Chem. Biol. Interact. 122, 153 (Nov. 1, 1999); J. P. Jadhav, S. case of conflict, the present application, including any defi P. Govindwar, Yeast 23, 315 (March, 2006): Yeast Display nitions herein, will control. sch v Antibody Library User's Manual (Pacific Northwest Also incorporated by reference are the following: U.S. Pat. National Laboratory, Richland, WA993.52:-2003); G. Chao Nos. 5,334,537; 5,998,142; 6,287,765; 6,297,059; 6,331,394; et al., Nat. Protocols 1, 755 (2006); V. Giudicelli et al., 6,358,710; WO 02/23188: WO 02/18952; Bark and Hahn, 30 Nucleic Acids Res. 34, D781 (Jan. 1, 2006); H. Motulsky, The Methods 20:429-435 (2000); Barker et al., Anal. Chem. 71: GraphPad Guide to Analyzing Radioligand Binding Data 1767-1172 (1999); Barker et al., Anal. Chem, 71: 2071-2075 (GraphPad Software, Inc., 1996); Invitrogen, Theory of Bind (1999); Bradbury, Nature Biotechnology 19:528-529 (2001): ing Data Analysis, Fluorescence Polarization Technical Benhar, Biotechnology Advances 19: 1-33 (2001); Carrero Resource Guide, Fourth Edition (2006); R. B. Mujumdar, L. and Voss, J. Biol. Chem. 271:53325337 (1996); Chamberlain 35 A. Ernst, S. R. Mujumdar, C. J. Lewis, A. S. Waggoner, and Hahn, Traffic 1: 755-762 (2000); Chen et al., Nature Bioconjug. Chem. 4, 105 (March-April, 1993); P. J. Sims, A. Biotechnology 19:537-542 (2001); Hahnet al., J. Biol. Chem. S. Waggoner, C. H. Wang, J. F. Hoffman, Biochemistry 13, 265: 20335-20345 (1990); Marks et al., J. Mol. Biol. 222: 3315 (Jul 30, 1974); J. Lacowicz, Principles of Fluorescence 581-597 (1991); Post et al., J. Biol. Chem. 269: 12880-12887 Spectroscopy, 2nd edition (Kluwer Academic/Plenum, (1994); Post et al., Mol. Biol. Cell 6: 1755-1768 (1995); 40 1999); R. F. Kubin, A. N. Fletcher, J. Lumin. 27, 455 (1982); Ramjiawanet al., Cancer 89: 1134-44 (2000); Skerra, J. Mol. and W. H. Mueller, I. Hattesohl, H. J. Schuetz, G. Meyer, Recognition. 13: 167-187 (2000); and Sumner et al., Analyst Nucleic Acids Res 9, 95 (1981). 127: 11-16 (2002) Those skilled in the art will recognize, or be able to ascer B. N. Giepmans, S. R. Adams, M. H. Ellisman, R.Y. Tsien, tain using no more than routine experimentation, many Science 312, 217 (Apr. 14, 2006); J. Yao, K. M. Munson, W. 45 equivalents to the specific embodiments of the invention W. Webb, J. T. Lis, Nature 442, 1050 (Aug. 31, 2006); P. W. described herein. While specific embodiments of the subject Wiseman et al., J. Cell Sci. 117,5521 (Nov. 1, 2004); O. Pertz, invention have been discussed, the above specification is K. M. Hahn, J. Cell Sci. 117, 1313 (Mar. 15, 2004); O. Pertz, illustrative and not restrictive. Many variations of the inven L. Hodgson, R. L. Klemke, K. M. Hahn, Nature 440, 1069 tion will become apparent to those skilled in the art upon (Apr. 20, 2006); M. T. Kunkel, Q. Ni, R.Y. Tsien, J. Zhang, A. 50 review of this specification. The full scope of the invention C. Newton, J. Biol. Chem. 280, 5581 (Feb. 18, 2005); G. should be determined by reference to the claims, along with Miesenbock, D. A. De Angelis, J. E. Rothman, Nature 394, their full scope of equivalents, and the specification, along 192 (Jul. 9, 1998); S. T. Hess, A. A. Heikal, W. W. Webb, J. with such variations. Such equivalents are intended to be Phys. Chem. B 108, 10138 (2004); C.T. Dooley et al., J. Biol. encompassed by the following claims.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 82

SEO ID NO 1 LENGTH: 1222 TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: scFv sequence US 8,664,364 B2 79 - Continued <4 OOs, SEQUENCE: 1 cattttcaat taagatgcag titactitcgct gtttittcaat attittctgtt attgctt cag 6 O ttittagcaca ggaactgaca actatatgcg agcaaatccc Ctcaccalact ttagaatcqa 12 O cgc.cgtactic tttgtcaacg act act attt tggccaacgg gaaggcaatg Caaggagttt 18O ttgaat atta caaatcagta acgtttgtca gtaattgcgg ttct cacocci toaaacaact 24 O agcaaaggca gcc ccatalaa cacacagtat gtttittalagg acaatagotc gacgattgaa 3OO ggtatatacc catacgacgt to cagacitac gctctgcagg Ctagtggtgg tggtggttct 360 gttctggtgg ttggttct gctagoc agg tgcagctggit ggaatctgag gctgaggtga aaggit ct cot gcaaggctt C tggaggcacc ttcago agct atgctatcag Ctgggtgcga Caggc.ccctg gacaagggct tgagtggatg 54 O ggagggat.ca tcc citat citt togg tacagca aactacgcac agaagttcca gggcagagtic acgattaccg cggacgaatc. cacgagcaca gcc tacagtg agctgagcag cctgagatct 660 gaggacacgc gcgtgt atta Ctgtgtcttg ttggatacaa citatgttac gggatactac 72 O tittgac tact ggggcCaggg aaccCtggtc acct ct cot caggaattct aggat.ccggit ggcggtggca gcggcggtgg tagttcCgga ggcgg.cggitt Ctaattittat gctgacticag 84 O ccc.ccct cag cgtctgggac C cctgggcag agcgt cacca totcttgttc tggaa.gcggc 9 OO tcqaac at cq gaaacaataa agtaaactgg taccagcagc tcc caggaac ggcc.cccaaa 96.O cit cott cat ct at agtaataa totagoggc cc t cagggg.tcC ctgaccgatt citctggcticc aagttctggca cct cagocto Cotggccatc agtgggctcC agtctgagga tgaggctgat 108 O tatt actgtg Cagcatggga tigacagcctg aatggittatg t ctitcggaac tgggaccaag 114 O citcaccgt.cc tat coggaat tctagaacaa aagct tattt Ctgaagaaga cittgtaatag 12 OO

Ctcggcggcc gcatcgagat ct 1222

SEQ ID NO 2 LENGTH 393 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: scFv sequence

<4 OOs, SEQUENCE: 2

Met Glin Lieu. Lieu. Arg Cys Phe Ser Ile Phe Ser Wall Ile Ala Ser Wall 1. 5 15

Lell Ala Glin Glu Lieu. Thir Thir Ile Cys Glu Glin Ile Pro Ser Pro Thir 2O 25

Lell Glu Ser Thir Pro Tyr Ser Lieu. Ser Thir Thir Thir Ile Luell Ala Asn 35 4 O 45

Gly Lys Ala Met Glin Gly Val Phe Glu Tyr Lys Ser Wall Thir Phe SO 55 6 O

Wall Ser Asn Ser His Pro Ser Thir Thir Ser Gly Ser Pro 65 70 8O

Ile Asn Thir Gln Tyr Val Phe Lys Asp Asn Ser Ser Thir Ile Glu Gly 85 90 95

Arg Pro Tyr Asp Val Pro Asp Tyr Ala Luell Glin Ala Ser Gly Gly 1OO 105 11 O

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Ser Glin 115 12 O 125

Wall Glin Luell Wall Glu Ser Glu Ala Glu Wall Lys Lys Pro Gly Ser Ser 13 O 135 14 O US 8,664,364 B2 81 - Continued

Val Llys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr Ala 145 150 155 160 Ile Ser Trp Val Arg Glin Ala Pro Gly Glin Gly Lieu. Glu Trp Met Gly 1.65 17O 17s Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Llys Phe Glin 18O 185 19 O Gly Arg Val Thir Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr Met 195 2OO 2O5 Glu Lieu. Ser Ser Lieu. Arg Ser Glu Asp Thir Ala Val Tyr Tyr Cys Val 21 O 215 22O Lieu. Lieu. Asp Thir Thr Met Val Thr Gly Tyr Tyr Phe Asp Tyr Trp Gly 225 23 O 235 24 O Gln Gly Thr Lieu Val Thr Val Ser Ser Gly Ile Leu Gly Ser Gly Gly 245 250 255 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asn Phe Met 26 O 265 27 O Lieu. Thr Glin Pro Pro Ser Ala Ser Gly Thr Pro Gly Glin Ser Val Thr 27s 28O 285 Ile Ser Cys Ser Gly Ser Gly Ser Asn. Ile Gly Asn. Asn Llys Val Asn 29 O 295 3 OO Trp Tyr Glin Gln Leu Pro Gly Thr Ala Pro Llys Lieu Lleu. Ile Tyr Ser 3. OS 310 315 32O Asn Asn Glin Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys 3.25 330 335 Ser Gly. Thir Ser Ala Ser Lieu Ala Ile Ser Gly Lieu. Glin Ser Glu Asp 34 O 345 35. O Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Lieu. Asn Gly Tyr 355 360 365 Val Phe Gly Thr Gly Thr Lys Lieu. Thr Val Leu Ser Gly Ile Leu Glu 37 O 375 38O Glin Llys Lieu. Ile Ser Glu Glu Asp Lieu. 385 390

<210s, SEQ ID NO 3 &211s LENGTH: 252 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: scFv sequence <4 OOs, SEQUENCE: 3 Glin Val Glin Lieu Val Glu Ser Glu Ala Glu Val Llys Llys Pro Gly Ser 1. 5 1O 15 Ser Val Llys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 2O 25 3O Ala Ile Ser Trp Val Arg Glin Ala Pro Gly Glin Gly Lieu. Glu Trp Met 35 4 O 45 Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Glin Llys Phe SO 55 6 O Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 7s 8O Met Glu Lieu Ser Ser Lieu. Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Val Lieu. Lieu. Asp Thr Thr Met Val Thr Gly Tyr Tyr Phe Asp Tyr Trp 1OO 105 11 O US 8,664,364 B2 83 84 - Continued Gly Glin Gly Thir Lieu. Wall. Thir Wall Ser Ser Gly Ile Lieu. Gly Ser Gly 115 12 O 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asn. Phe 13 O 135 14 O

Met Luell Thir Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Glin Ser Wall 145 150 155 160

Thir Ile Ser Cys Ser Gly Ser Gly Ser Asn. Ile Gly Asn. Asn Llys Val 1.65 17O 17s

Asn Trp Gln Gln Leu Pro Gly Thir Ala Pro Llys Lieu. Lieu. Ile Tyr 18O 185 19 O

Ser Asn Asn Glin Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser 195 2O5

Ser Gly Thir Ser Ala Ser Lieu. Ala Ile Ser Gly Lieu. Glin Ser Glu 21 O 215 22O

Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Lieu Asin Gly 225 23 O 235 24 O

Wall Phe Gly Thr Gly Thr Lys Lieu. Thir Wall Lell 245 250

SEQ ID NO 4 LENGTH: 1221 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ScFw Se quence

SEQUENCE: 4 cattttcaat taagatgcag ttact tcgct gtttittcaat attittctgtt attgctt cag 6 O ttittagcaca ggaactgaca actatatgcg agcaaatccc Ctcaccalact ttagaatcqa 12 O cgc.cgtactic tttgtcaacg act act attt tggccaacgg gaaggcaatg Caaggagttt 18O ttgaat atta caaatcagta acgtttgtca gtaattgcgg ttct cacocci toaacaacta 24 O gcaaaggcag CCC cataaac acacagtatg tttittaagga caatagotcg acgattgaag 3OO gtagataccc atacgacgtt ccagacitacg Ctctgcaggc tagtggtggit ggtggttctg 360 ttctggtggit ggtggttctg CtagcCaggit gCagctggtg gaatctgagg Ctgaggtgaa gaa.gc.ctggg aggtotcCtg caaggcttct ggaggcacct t cagcagota tgctat cago tgggtgcgac aggcc cctgg acaagggctt gagtggatgg 54 O gagggat cat cc citat cit tt ggtacagcaa. actacgcaca gaagttc.ca.g ggcagagtica cgattaccgc ggacgaatcc acgagcacag cct acatgga gctgagcagc Ctgagatctg 660 aggacacggc cgtgtattac tggatacaac tatggittacg ggatact act 72 O ttgact actg gggcCaggga accctggtca cc.gtctocto aggaatticta ggat.ccggtg

cgg.cggtggit ggttc.cggag gcggcggttc taattittatg ctgacticago 84 O cc.ccct cago gtctgggacc cc.cgggcaga gcqt cac cat citcttgttct ggaag.cggct 9 OO cgalacatcgg aaacaataaa. gtaaactggit accagcagct CCC aggaacg gcc cc caaac 96.O t cott catcta tag taataat Cagcggcc ct Caggggtc.cc tgaccgattic tctggct coa agtctggcac cticago: ct co ctggc catca gtgggct coa gtctgaggat gaggctgatt 108 O attact.gtgc agcatgggat gacagcctga atggittatgt citt cqgaact gggaccalagc 114 O t caccgt.cct atc.cggaatt ctagaacaaa agct tatttic tgaagaagac ttgtaatagc 12 OO

catcgagatc t 1221 US 8,664,364 B2 85 - Continued <210s, SEQ ID NO 5 &211s LENGTH: 250 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: ScFW Se quence

<4 OOs, SEQUENCE: 5

Glin Val Glin Lieu. Glin Glin Gly Gly Ala Gly Lieu. Lell Pro Ser Glu 1. 5 1O 15

Thr Lieu Ser Lieu. Thr Cys Gly Val Tyr Gly Gly Ser Phe Ser Gly Tyr 25

Tyr Trp Ser Trp Ile Arg Glin Ser Pro Gly Lys Gly Lell Glu Trp Ile 35 4 O 45

Gly Glu Ile Asn His Ser Gly Ser Ala Asn Tyr Asn Pro Ser Val Lys SO 55 6 O

Ser Arg Val Thir Ile Ser Val Asp Thir Ser Lys Asn Glin Phe Ser Luell 65 70 7s 8O

Gln Lieu. Ser Ser Wall. Thir Ala Ala Asp Thir Ala Wall Cys Ala 85 90 95

Arg Asp Arg Ala Val Lieu. Thr Gly Glu Gly Trp Phe Asp Lieu. Trp 105 11 O

Gly Arg Gly Thr Lieu Val Thr Val Ser Ser Gly Ile Lell Gly Ser Gly 115 12 O 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Tyr 13 O 135 14 O

Glu Lieu. Thir Glin Pro Pro Ser Wall Ser Wal Ser Pro Gly Glin Thir Ala 145 150 155 160

Ser Ile Thr Cys Ser Gly Asp Llys Lieu. Gly Asp Thir Cys Trp 1.65 17O 17s

Tyr Glin Gln Llys Pro Gly Glin Ser Pro Wall Lieu. Wall Lell Tyr Glu Asp 18O 185 19 O

Thr Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn. Ser 195 2O5

Gly Asn Thr Ala Thr Lieu. Thir Ile Ser Arg Val Glu Ala Gly Asp Glu 21 O 215

Ala Asp Tyr Tyr Cys Glin Lieu. Trp Asp Ser Ser Ser Asp His 225 23 O 235 24 O

Phe Gly Ser Gly Thr Lys Lieu. Thr Wall Lieu 245 250

<210s, SEQ ID NO 6 &211s LENGTH: 835 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: ScFW Se quence

<4 OOs, SEQUENCE: 6

Ctggtggtgg tdttctgct agcCaggtgc agctacagca gggggg.cgca ggactgttga 6 O agcctt.cgga gaccctgtc.c Ctcacgtgcg gtgtctatgg tgggit ctitt c agtggitt act 12 O attggagctg gatticgc.cag t ccc.caggaa aggggctgga atggattggg gaaat caatc 18O at agtggaag cqccalactac aac cc.gtc.cg t caagagtcg tgtcaccata t cagtag aca 24 O cgt.ccaagaa toagttct co Ctgcagttga gctctgttgac cgctg.cggac acggc.cgtgt 3OO actact.gtgc gagagatagg gcggtgttaa cgggggaggg ctgg tacttic gat ct ctggg 360 gcc.gtggtac Cctggt cacc gtc. tcct cag gaattictagg atc.cggtggc ggtggcagcg US 8,664,364 B2 87 88 - Continued

titc.cggaggc ggcggttctt cctatgagct gacacagc.ca c cct cagtgt

aggacagaca gcc agcatca Cctgctctgg agataaattg ggggataaat 54 O at acttgttg gtaticagoag aagcc aggcc agt cc cctogt actggtc.ctic tatgaagata cCaagcggcc Ctcagggatc Cctgagcgat t citctggctic Caact Ctggg alacacggc.ca 660 c cct gaccat Cagcagggtc gaa.gc.cgggg atgaggc.cga ctatt actgt Cagctgttggg 72 O at agtag tag tgat catt at gtc.ttctggaa gtgggaccala gct gaccgt.c citatccggaa ttctagaa.ca aaagct tatt t cagaagaag acttgtaata cgcat 835

SEO ID NO 7 LENGTH: 252 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: scFv sequence

SEQUENCE: 7

Glin Wall Glin Lieu Wall Glu Ser Glu Ala Glu Wall Pro Gly Ser 1. 5 15

Ser Wall Lys Wall Ser Ala Ser Gly Gly Thir Phe Ser Ser Tyr 2O 25

Ala Ile Ser Trp Val Arg Glin Ala Pro Gly Glin Gly Lell Glu Trp Met 35 4 O 45

Gly Gly Thir Ile Pro Ile Phe Gly Thir Ala Asp Tyr Ala Glin Glu Phe SO 55 6 O

Glin Gly Arg Wall. Thir Ile Thir Thir Asp Glu Ser Thir Ser Thir Ala Tyr 65 70 8O

Met Glu Luell Ser Gly Lell Arg Ser Glu Asp Thir Ala Wall Tyr Cys 85 90 95

Wall Luell Luell Gly Thr Thir Met Wall Thir Gly His Phe Asp 1OO 105 11 O

Gly Glin Gly Thir Lieu. Wall Thir Wall Ser Ser Gly Ile Lell Gly Ser Gly 115 12 O 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asn. Phe 13 O 135 14 O

Met Luell Thir Gln Pro Pro Ser Ala Ser Gly Thir Pro Gly Glin Ser Wall 145 150 155 160

Thir Ile Ser Gly Ser Gly Ser Asn Ile Gly Asn Asn Llys Val 1.65 17O 17s

Asn Trp Glin Glin Lell Pro Gly Thir Ala Pro Lell Luell Ile Tyr 18O 185 19 O

Ser Asn Asn Glin Arg Pro Ser Gly Wall Pro Asp Arg Phe Ser Gly Ser 195

Ser Gly Thir Ser Ala Ser Luell Ala Ile Ser Gly Lell Glin Ser Glu 21 O 215 22O

Asp Glu Ala Asp Tyr Tyr Ala Ala Trp Asp Asp Gly Luell Ser Gly 225 23 O 235 24 O

Wall Phe Gly Thr Gly Thir Luell Thir Wall Lell 245 250

SEQ ID NO 8 LENGTH: 84.5 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: scFv sequence US 8,664,364 B2 89 90 - Continued

<4 OOs, SEQUENCE: 8 ggttctggtg gtggtggttc tgctagdcag gtgcagctgg tggaatctga ggctgaggtg 6 O aagaa.gc.ctg ggtcct cigt gaaggtotCc tgcaaggcct Ctggaggcac citt cago agc 12 O tatgctatica gctgggtgcg gCaggc.ccct ggaCaagggc ttgagtggat gggagggacC 18O at occitat ct ttggtacagc agacitacgca CaggagttcC agggcagagt cacgattacc 24 O acggacgaat ccacgagcac agcct acatg gagctgagcg gcc tagat C tgaggacacg 3OO gcc.gtgtatt actgtgttitt gttgggtaca actatggitta cggga cact a ctittgacitac 360 tggggcCagg gaaccotggit caccgt.ct co t caggaattic taggat.ccgg tgg.cggtggc agcggcggtg gtggttcCgg agg.cggcggit totaattitta tgctgactica gcc cc cct ca

CCC ccgggca gag.cgtcacc atctottgtt Ctggaag.cgg citcgaac atc 54 O ggaaacaata aagtaaactg gtaccagcag Ctcc.caggaa cggcc.cccaa act CCtcatC tatagtaata atcagcggcc Ctcagggg.tc cct gaccgat t citctggctic Caagttctggc 660 acct cagoct c cctdgcc at Cagtgggctic Cagtctgagg atgaggctga ttatt actgt 72 O gCagcatggg atgacggit ct gagtggittat gtc.ttctgaa Ctgggaccala gcttaccgt.c

Ctgtc.cggat ccgaacaaaa gct tatttct gaagaggact tgtaatagot 84 O atcga 845

SEO ID NO 9 LENGTH: 252 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ScFw Se quence

<4 OOs, SEQUENCE: 9

Glin Wall Glin Lieu Val Glu Ser Glu Ala Glu Wall Pro Gly Ser 1. 5 1O 15

Ser Wall Lys Val Ser Cys Lys Ala Ser Gly Gly Thir Phe Ser Ser Tyr 25

Ala Ile Ser Trp Val Arg Glin Ala Pro Gly Glin Gly Lell Glu Trp Met 35 4 O 45

Gly Gly Thir Ile Pro Ile Phe Gly Thir Ala Asn Tyr Ala Glin Llys Phe SO 55 6 O

Glin Gly Arg Wall. Thir Ile Thir Ala Asp Glu Ser Thir Ser Thir Ala Tyr 65 70 7s

Met Glu Luell Ser Ser Lieu. Arg Ser Glu Asp Thr Ala Wall Tyr Cys 85 90 95

Wall Luell Luell Gly. Thir Thr Met Val Thr Gly Tyr Phe Asp 105 11 O

Gly Glin Gly Thir Lieu. Wall. Thir Wall Ser Ser Gly Ile Lell Gly Ser Gly 115 12 O 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asn. Phe 13 O 135 14 O

Thir Luell Thir Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Glin Ser Wall 145 150 155 160

Thir Ile Ser Cys Ser Gly Ser Gly Ser Asn. Ile Gly Asn Asn Llys Val 1.65 17O 17s

Asn Trp Gln Gln Leu Pro Gly Thir Ala Pro Lell Luell Ile Tyr 18O 185 19 O

Ser Asn Asn Glin Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser US 8,664,364 B2 91 92 - Continued

195 2OO 2O5

Lys Ser Gly. Thir Ser Ala Ser Lieu. Ala Ile Ser Gly Lieu. Glin Ser Glu 21 O 215 Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Lieu. Asn Gly 225 23 O 235 24 O

Tyr Val Phe Gly Thr Gly Thr Lys Lieu. Thir Wall Lell 245 250

SEQ ID NO 10 LENGTH: 864 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ScFw Se quence

SEQUENCE: 1.O gctctgcagg ctagtggtgg tggtggttct ggtggtggtg gttctggtgg tggtggttct 6 O gctago Cagg to agctggit ggaatctgag gctgaggtga agaa.gc.ctgg gtc.ct cqgtg 12 O aagg to tcct gcaaggct tc tggaggcacc ttcagcagot atgctat cag Ctgggtgcga 18O

Caggcc cctg gacaagggct cgagtggatg ggagggacca t cc citat citt tgg tacagca 24 O aactacgcac agaagttc.ca gggcagagtic acgattaccg cggacgagtic cacgagcaca 3OO gcct acatgg agctgagcag cctgagat ct gagga cacgg cc.gtg tatta ctgtgtc.ttg 360 ttggg tacaa ctatoggttac gggatact ac tittgact act ggggcCaggg aac cctdgtc accotctic ct caggaattict aggat.ccggit ggcggtggca tggttcc.gga ggcggcggitt Ctaattittac gctgacticag c cc cc ct cag cgtctgggac CCC cqggcag 54 O agcgtcacca totcttgttc tcqaa catcg gaaacaataa agtaaactgg taccagcagc tcc caggaac ggcc.cccaaa ctic ct catct at agtaataa t cagcggcc C 660 t caggggit Co ctgaccgatt citctggct co aagtctggca cct cago ct c cctggc.catc 72 O agtgggct Co agt ctgagga tgaggctgat tattact.gtg Cagcatggga tgacagcctg aatggittatg t ctitcggaac tgggaccalag ctic accqtcc tat coggaat tctagaacaa 84 O aagct tattt ctdaagaaga cittg 864

SEQ ID NO 11 LENGTH: 264 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ScFw Se quence, (GILEQKLISEEDL at end of sequence is derived from a vector) SEQUENCE: 11

Glin Wall Glin Lieu Val Glu Ser Glu Gly Gly Lieu. Wall Glin Pro Gly Gly 1. 5 1O 15

Ser Luell Arg Lieu. Ser Cys Ala Ala Ser Gly Phe Thir Phe Ser Ser Tyr 25

Glu Met Asn Trp Val Arg Glin Ala Pro Gly Lys Gly Lell Glu Trp Val 35 4 O 45

Ser Arg Ile Asp Gly Asp Gly Ser Ser Thir Asn Tyr Ala Asp Ser Wall SO 55 6 O

Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Ser Thir Leu Tyr 65 70 7s 8O

Lell Glin Met Asn Ser Lieu. Arg Ala Glu Asp Thr Ala Wall Tyr Cys 85 90 95 US 8,664,364 B2 93 94 - Continued

Thir Arg Ala Arg Tyr Phe Gly Ser Wall Ser Pro Tyr Gly Met Asp Wall 105 11 O

Trp Gly Glin Gly. Thir Thr Val Thr Wall Ser Ser Gly Ile Luell Gly Ser 115 12 O 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp 13 O 135 14 O

Ile Arg Wall Thr Glin Ser Pro Ser Ser Wal Ser Ala Ser Wall Gly Asp 145 150 155 160

Arg Wall Thir le Ser Cys Arg Ala Ser Glin Gly Ile Ala Thir Trp Lieu. 1.65 17O 17s

Gly Trp Gln Gln Lys Pro Gly Llys Pro Pro Glin Lell Luell Ile Tyr 185 19 O

Ser Ala Ser Thr Lieu Gln Thr Gly Wall Pro Ser Arg Phe Ser Gly Ser 195

Gly Ser Gly Thr Asp Phe Thr Lieu Thir Ile Ser Ser Lell Glin Pro Glu 21 O 215 22O

Asp Wall Ala Thr Tyr Tyr Cys Glin Glu Gly Ser Thir Phe Pro Lieu. Thir 225 23 O 235 24 O

Phe Gly Gly Gly Thr Llys Val Asp Ile Llys Ser Gly Ile Luell Glu Glin 245 250 255

Luell Ile Ser Glu Glu Asp Lieu 26 O

SEQ ID NO 12 LENGTH: 881 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ScFw Se quence

<4 OOs, SEQUENCE: 12

Ctctgcaggc tagtggtggit ggtggttctg gtggtggtgg ttctgctago Caggtgcagc 6 O tggtggagtic tgagggaggc ttggtacagc Ctggagggtc cctgagactic t ccttgcag 12 O ccitctggatt caccitt cagt agittatgaaa tgaactgggit cc.gc.caggct cCagg talagg 18O ggctggagtg ggtcticacgt. attgatggtg atgggagcag Cacaaactac gcggacticcg 24 O tgaagggcc.g att Caccatc. tccagaga.ca acgc.caagag cacgctgitat Ctgcaaatga 3OO at agtctgag agc.cgaggac acggctgttgt attactgtac aagggcc aga tactittggitt 360 cggtgagc cc Ctacgg tatg gacgtctggg gccaagggac cacggtcacc gtc. tcct cag gaattic tagg atc.cggtggc ggtggcagcg gC9gtggtgg titc.cggaggc ggcggttctg a catcc.gggit gacccagt ct cct tcttcc.g tgtctgcatc tgttgggtgac agagt cacca 54 O t cagttgtcg ggcgagticag gggattgc.ca Cctggittagg Ctggitat cag Cagaa.gc.ca.g ggaalaccCCC t cagotcc tt atc tatt citg cat coactitt gcaaactggg gtcc.cat caa 660 ggttcagogg Cagtggat ct gggacagatt t cact cit tact cat cagcagc Ctgcagc.cgg 72 O aggatgttgc aact tact at tgtcaagagg gtagcactitt coct cit cact titcgg.cggag ggaccaaagt ggatat caaa tccggaattic tagaacaaaa gct tatttct gaagaag act 84 O tgtaatagct atcgagat ct gataacaa.ca 9 881

SEQ ID NO 13 LENGTH: 163 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ScFw Se quence, (GILEQKLISEEDL at end of US 8,664,364 B2 95 96 - Continued sequence is derived from a vector)

<4 OOs, SEQUENCE: 13 Ser Ala Ser Thr Gly Ser Phe Asp Ser Trp Gly Gln Gly Thr Lieu Val 1. 5 1O 15 Thr Val Ser Ser Gly Ile Leu Gly Ser Gly Gly Gly Gly Ser Gly Gly 2O 25 3O

Gly Gly Ser Gly Gly Gly Gly Ser Glin Ala Val Wall. Thir Glin Glu Pro 35 4 O 45 Ser Val Thr Val Ser Pro Gly Gly Thr Val Ile Lieu. Thir Cys Gly Ser SO 55 6 O Ser Thr Gly Ala Val Thir Ser Gly His Tyr Ala Asn Trp Phe Glin Glin 65 70 7s 8O Llys Pro Gly Glin Ala Pro Arg Ala Lieu. Ile Phe Glu Thir Asp Llys Llys 85 90 95 Tyr Ser Trp Thr Pro Gly Arg Phe Ser Gly Ser Lieu. Lieu. Gly Ala Lys 1OO 105 11 O Ala Ala Lieu. Thir Ile Ser Asp Ala Glin Pro Glu Asp Glu Ala Glu Tyr 115 12 O 125 Tyr Cys Lieu. Lieu. Ser Asp Wall Asp Gly Tyr Lieu. Phe Gly Gly Gly Thr 13 O 135 14 O Glin Lieu. Thr Val Lieu. Ser Gly Ile Lieu. Glu Glin Llys Lieu. Ile Ser Glu 145 150 155 160 Glu Asp Lieu.

<210s, SEQ ID NO 14 &211s LENGTH: 651 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: scFv sequence

<4 OOs, SEQUENCE: 14 ggct agtggt getggtggitt Ctggtggtgg tagttctgct agcactggca gctttgactic 6 O

Ctggggc.cag ggalacc Ctgg to accgt.ctic ct cagga att Ctaggat.ccg gttggcggtgg 12 O

Cagcggcggt getggttcCg gaggcggcgg ttct Caggct gtggtgactic aggagcc.gtC 18O agtgactgtg tcc ccaggag gga cagt cat t ct cacttgt ggctic cagca Ctggagctgt 24 O

Caccagtggt cattatgc.ca actggttcca gcagaa.gc.ct ggccaagcc C C Cagggc act 3OO tatatttgaa accogacaaga aatatt cotg gaccc ctdgc cgatt ct cag got coct cot 360 tggggccaag gctgcc ctga C catct ciga tigcgcagcct gaagatgagg Ctgagtatt a Ctgtttgctic ticcgacgttg acggittatct gttcggagga ggc acccagc tigaccgt.cct citccggaatt citagaacaaa agct tatttic tdaagaagac ttgtaat agc ticggcggcc.g 54 O catcgagatc tdataacaac agtgtagatg taacaaaatc gactttgttc ccactgtact tittagotcgt acaaaataca atatacttitt catttct cog taaacaa.cat g 651

<210s, SEQ ID NO 15 &211s LENGTH: 155 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: scFv sequence <4 OOs, SEQUENCE: 15 Glin Val Glin Leu Gln Glu Ser Gly Pro Gly Lieu Val Llys Pro Ser Glu 1. 5 15 US 8,664,364 B2 97 98 - Continued

Thir Lieu. Ser Lieu. Thir Cys Thr Val Ser Gly Ala Ser Ile Ser Ser Ser 25 3O

Ile Thr Tyr Tyr Trp Gly Trp Ile Arg Glin Pro Pro Gly Gly Pro 35 4 O 45

Glu Trp Ile Gly Ser Met Tyr Tyr Ser Gly Arg Thir Asn. Pro SO 55 6 O

Ala Lieu Lys Ser Arg Val Thr Ile Ser Pro Asp Ser ASn Glin 65 70 7s 8O

Phe Phe Lieu. Lys Lieu. Thir Ser Val Thir Ala Ala Asp Thir Ala Val Tyr 85 90 95

Tyr Cys Ala Arg Glu Gly Pro Thr His Tyr Tyr Asp Asn Ser Gly Pro 105 11 O

Ile Pro Ser Asp Glu Tyr Phe Glin His Trp Gly Glin Gly Thir Lieu Wall 115 12 O 125

Thir Wal Ser Ser Gly Ile Lieu. Gly Ser Gly Gly Gly Gly Ser Gly Gly 13 O 135 14 O

Gly Gly Ser Gly Gly Gly Gly Lieu. Glin Glu Phe 145 150 155

<210s, SEQ I D NO 16 &211s LENGT H: 781 212. TYPE : DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATU RE: 223 OTHER INFORMATION: ScFW Se quence

<4 OOs, SEQUENCE: 16 actagdaaag gcago.cccat aaacacacag tatgtttitta aggacaatag citcgacgatt 6 O gaaggtagat acc catacga cgttccagac tacgctctgc aggct agtgg tggtggtggit 12 O

gtggttctgg tggtggtggit tctgctagoc aggtgcagct gCaggagtcg 18O ggccCaggac tggtgaagcc titcggagacic ctgtc.cctica cctgcactgt Ctctggtgcc 24 O tccatcagca gtag to atta Ctactggggg tggat.ccgc.c agc.ccc.cagg galaggggcct 3OO gagtggattg ggagtatgta ttatagtggg agaacgtact acaac Coggc cct caagagt 360 cgagt cacca tat caccaga Caagttctgaag aac cagttct t cittgaagtt gacct ctdta accgc.cgcgg acacggcc.gt gtatt actgt gcgagggagg gacccacaca ttactatgat aatagtggtc Caatacct to ggatgagtat titc.ca.gcact ggggcCaggg taccctggit c 54 O actgtc. tcct caggaattict aggat.ccggit ggcggtggca tggttcc.gga ggcggcgggc tgcaggaatt ctagaacaaa agct tatttic tgaagaagac ttgtaatagc 660

catcgagatc tgataacaac agtgtagatg taacaaaatc. gactttgttc 72 O c cactgtact tittagotcgt. acaaaataca at at acttitt catttct cog taaacaa.cat

9 781

<210s, SEQ I D NO 17 &211s LENGT H: 268 212. TYPE : PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATU RE: 223 OTHER INFORMATION: ScFW Se quence, (GILEQKLISEEDL at end of sequence is derived from a vector)

<4 OOs, SEQUENCE: 17 Glin Val Glin Lieu. Glin Gln Trp Asp Ala Gly Lieu Val Llys Pro Ser Glin 1. 5 15 US 8,664,364 B2 99 100 - Continued Thir Luell Ser Lieu. Thir Cys Ala Ile Ser Gly Asp Ser Wall Ser Ser Asn 25

Ser Ala Ala Trp Asn Trp Ile Arg Glin Ser Pro Ser Arg Gly Lieu. Glu 35 4 O 45

Trp Pro Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Glin Asn Asn Tyr Ala SO 55 6 O

Lell Ser Wall Gln Gly Arg Ile Thr Ile Asn. Pro Asp Thir Ser Asn. Asn 65 70 8O

Glin Phe Ser Lieu. Glin Lieu. Asp Ser Met Thr Pro Glu Asp Thir Gly Val 85 90 95

Thir Arg Gly Gly Gly Ser Lieu. Asp Trp Gly Gln Gly 105 11 O

Thir Luell Wall Thr Val Ser Ser Gly Ser Ala Ser Ala Pro Thir Gly Ile 115 12 O 125

Lell Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 13 O 135 14 O

Gly Ser Ser Tyr Glu Lieu. Thr Glin Pro Pro Ser Wall Ser Wall Ser Pro 145 150 155 160

Gly Glin Thir Ala Thr Ile Thr Cys Ser Gly Asp Glu Met Gly Asp Llys 1.65 17O 17s

Ala Trp Tyr Glin Gln Lys Pro Gly Glin Ala Pro Wall Lieu Wall 185 19 O

Ile Lys Asp Ser Glu Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser 195

Gly Ser Ser Ser Gly Thr Thr Val Thir Lieu. Thir Ile Ser Gly Wall Glin 21 O 215

Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Glin Ser Ala Asp Ser Ser Gly 225 23 O 235 24 O

Thir Ser Wall Val Phe Gly Gly Gly Thr Llys Val Thir Wall Luell Ser Gly 245 250 255

Ile Luell Glu Glin Llys Lieu. Ile Ser Glu Glu Asp Lell 26 O 265

SEQ ID NO 18 LENGTH: 908 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ScFw Se quence

SEQUENCE: 18

Ctctgcaggc tagtggtggit ggtggttctg gtggtggtgg ttctggtggit ggtggttctg 6 O

Ctagcc aggt gcagot acag Cagtgggacg Caggactggit gaa.gc.ccticg cagaccct ct 12 O cact cacctg tgc catct co gggga cagtg tctictagoaa Cagtgctgct tggaactgga 18O t caggcagtic cc catcgaga ggt ctitgagt ggc.cgggaag gacatactac agg to Caagt 24 O ggcaaaacaa titatgcactic tctgtgcaag gtcgaataac Cat Caac Coa gacacat coa 3OO acalaccalatt ctic cctdcag ctggacticta tgact cocq a ggaCacgggt gtatattact 360 gtacaagggg cgg.cgggtCc ttagacitact ggggcCaggg aac cctdgtc acct ct cot Cagggagtgc atcc.gc.ccca accoggaattic taggat.ccgg agcgg.cggtg gtggttcCgg agg.cggcggit tct tcc tatg agctgacaca gcc accctica gtgtc.cgtgt 54 O

CCCC aggaca gacago Cacc atcacctgct Ctggagatga aatgggggat aaatatgctt attgg tacca gCagaa.gc.ca ggcCaggc cc Ctgtgctggit gatatataaa gacagtgaga 660 US 8,664,364 B2 101 102 - Continued ggcc ct cagg gatccCtgag catt Ctctg gct coagctic agggacaac a gtcaccttga 72 O c cat cagtgg agt ccaggca galagacgagg Ctgact atta Ctgtcaatca gcaga cagda gtgg tact tc ttggt attc ggcggaggga cca aggt cac cgt.ccitatcc ggaattic tag 84 O aacaaaagct tatttctgaa gaagacittgt aatagotcgg cggcc.gcatc gagatctgat 9 OO aacaacag 908

<210s, SEQ ID NO 19 &211s LENGTH: 124 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: scFv sequence, (EF at end of sequence is derived from a vector)

<4 OOs, SEQUENCE: 19

Glin Val Glin Leu Gln Glin Ser Gly Pro Gly Lieu Wall Arg Pro Ser Glin 1. 5 1O 15

Thir Lieu. Ser Lieu. Thir Cys Ala Ile Ser Gly Asp Ser Wall Pro Lys Asn 2O 25

Gly Ala Ser Trp Asn Trp Ile Arg Lieu. Ser Pro Ser Arg Gly Lieu. Glu 35 4 O 45

Trp Leu Gly Arg Thr His Tyr Ser Ser Arg Trp Tyr His Asp Tyr Ala SO 55 6 O

Phe Phe Val Lys Ser Arg Ile Thr Ile Asin Val Asp Thir Ser Glu Thir 65 70 7s 8O

Glin Val Ser Leu Gln Lieu. Asp Ser Val Thr Pro Asp Asp Thir Gly Val 85 90 95

Tyr Cys Ala Arg Glu Ser Glin Arg Arg Gly Trp Phe Asp Lieu. Trp 1OO 105 11 O

Gly Gln Gly Thr Lieu Val Thr Val Ser Glin Glu Phe 115 12 O

<210s, SEQ ID NO 2 O &211s LENGTH: 853 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: scFv sequence <4 OOs, SEQUENCE: 2O ggtggtggtg gttctggtgg tggtggttct gctagoc agg tacagctgca gcagt caggit 6 O cCaggactgg taggc cct c gcagaccctic ticact cacct gtgc.cat ct c cggggacagt 12 O gtcc ct aaga acggtgcatc ttggaactgg at Caggctgt cac catcgc.g aggccttgag 18O tggctgggaa ggactic act a cagttcCagg titat catg attatgcatt Ctttgttgaag 24 O agtc.gaataa ccatcaacgt agata catcc gag acccaag t cagt ctdca gctggactict 3OO gtgacticccg acgacacggg ttitt attac ttgcaa.gag aatct caacg taggggatgg 360 titcgacct ct gggggcaggg aaccotggtc. accgt.ct coc aggaatticta ggat.ccggtg taattittatg ctgacticago

Cccact ctgt gtcggagt ct ccdgggagga C9gttacctt ctic ct gcacc cgcagcagtg 54 O gcggcattgc cagcaact at gtgcagtggit accaa.ca.gcg cc.cgggcagt a CCCC Cacca

Ctgtgatcta tigggatagc caaag accct Ctggagt ccc tgatcggttc tctggct coa 660 tcqacagotc ctic caattct gcc to cotca ccatcto agg gctgaaggct gaggacgagg 72 O ctgact act a citgtcagtico totgatgg ta gct cittgggit gttcggcgga ggc acccagc US 8,664,364 B2 103 104 - Continued tgaccgt.cct citccggaatt citagaacaaa agct tatttic tdaagaagac ttgtaatagc 84 O tcggcggc.cg cat

SEQ ID NO 21 LENGTH: 279 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: scFv sequence, (GILEOKLISEEDL at end of sequence is derived from a vector)

<4 OOs, SEQUENCE: 21

Glin Wall Glin Lieu. Glin Glin Ser Gly Pro Gly Arg Wall Pro Ser Glin 1. 5 1O 15

Thir Luell Ser Luell Thir Asp Ile Ser Gly Asp Ser Wall Ser Ser Asn 25

Ser Wall Ala Trp Asn Ile Arg Glin Ser Pro Ser Arg Gly Luell Glu 35 4 O 45

Trp Luell Gly Arg Thir Tyr Arg Ser Trp Ile Asn Glu Tyr Gly SO 55 6 O

Pro Phe Wall Arg Ser Arg Ile Thir Ile Asn Pro Asp Thir Ser Asn 65 70

Glin Phe Ser Luell Glin Lell Asn Ser Wall Thir Pro Glu Asp Thir Ala Wall 85 90 95

Ala Thir Met Ala Asn Ser Gly Tyr Asp Arg Ser Ser Gly 1OO 105 11 O

His Asn Tyr Gly Met Asp Wall Trp Gly Glin Gly Thir Thir Wall Thir Wall 115 12 O 125

Ser Ser Gly Ser Ala Ser Ala Pro Thir Gly Ile Lell Gly Ser Gly Gly 13 O 135 14 O

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu 145 150 155 160

Lell Thir Glin Pro Pro Ser Wall Ser Wall Ser Pro Gly Glin Thir Ala Arg 1.65 17O 17s

Ile Thir Ser Gly Asp Ala Luell Pro Glin Thir Tyr Trp Tyr 18O 185 19 O

Glin Glin Lys Ala Gly Glin Ala Pro Wall Luell Wall Ile Tyr Asp Thir 195

Glu Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Thir Ser Ser Gly 21 O 215 22O

Thir Thir Wall Thir Lell Thir Ile Ser Gly Wall Glin Ala Glu Asp Glu Ala 225 23 O 235 24 O

Asp Glin Ser Ala Asp Ser Ser Gly Ser Wall Phe Phe 245 250 255

Gly Gly Gly Thir Wall Thir Wall Luell Ser Gly Ile Lell Glu Glin 26 O 265 27 O

Lell Ile Ser Glu Glu Asp Lell 27s

SEQ ID NO 22 LENGTH: 935 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: scFv sequence

SEQUENCE: 22