DOCSLIB.ORG

Domenica Marchese

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Domenica Marchese Post-transcriptional regulation of α-synuclein and link to Parkinson’s disease Domenica Marchese TESI DOCTORAL UPF / ANY 2016 DIRECTOR DE LA TESI Dr. Gian Gaetano Tartaglia DEPARTAMENT OF BIOINFORMATICS AND GENOMICS AT CENTRE FOR GENOMIC REGULATION (CRG) ii Acknowledgments The people that I met during this journey and that in one way or another have influenced my life, my person, my way of thinking, are many. First of all, my supervisor Gian. Thank you for choosing me as your first experimental PhD student (!). Thank you for giving me this great chance, for trusting me even when things were going into ‘uncertain’ directions, and for making me believe that I was mature enough for facing new challenges and managing difficulties. You also showed me the importance of ‘thinking outside the box’ and keeping an open-minded attitude toward science. I feel that I have grown a lot during the last four years, and this is in great part because of you. Thank you Davide. You know how precious you became for me during these years. You are a great person, a professional colleague and amazing friend. The calmness, the wisdom and the optimism with which you are naturally gifted helped me many many times. I always felt free to express myself when I was with you because I never felt judged, not a single time! This is something that I’ve always appreciated a lot from you. The past and present lab mates who have worked in close contact with me: Silvia, Teresa, Joana and Elias. I don’t need to say the obvious. You know that I have learnt a lot from you at the professional level, but not only. Silvia, you are the first one who pushed me to develop my criticism toward science. Teresa, you and Benni are my model of “multitasking wonder women”. From the very beginning the professional interaction with you, Teresa, was very smooth, as if we already knew each other! Later, I also discovered a great person with an exquisite sense of humour and I started to enjoy working with you, which is something that is not obvious at all. Joana, you are as authentic as the ‘sardinhas assadas no dia de Santo Antonio’, you showed me the importance of being faithful to yourself and to avoid making compromises. From you I learnt that to be a good scientist it is fundamental to keep a balance between the rigor of the intellect and the freedom of imagination. Feeding our creativity and keeping a space where we can escape ‘common rules’ are as important as working with commitment and responsability. Elias, it was a pleasure to share my last steps at CRG with such a good scientist and generous person! You caught me in a moment when I was tired and disoriented but you were anyway able to inject me with your dose of enthusiasm and confidence, thank you! Thank you Benni! You are the one who better know about my journey through the PhD and I really have to thank you for all the precious advices along the years. Your enthusiasm for science is contagious, so thank you for reminding me the “bright side” of being a scientist also in those moments when my motivation was touching the ground J. I am very grateful also to all the other members of the Tartaglia lab for all the hilarious moments. Federico, Nieves, Riccardo, Carmen, Stefanie, Fernando, Alex, Alessandro, Natalia, Iona, Petr, Marta, Laura and Irene, life in the lab was much more enjoyable with all of you (especially with Fernando and his amazing stories)! And then Sergio, you have always been a sweet friend to me. Thank you for sharing “tears and joy” of the PhD. The funny games in the lab and the long ‘confessions’ on the way home after long and tiring working days have warmed my heart and filled it with joy. Thanks also to the “Aire de Barcelona” and future “Camino de Santiago” team, Silvina and Alessandra, for all the good times, the complicity, the nice dinners and chats with a glass of wine (chicas the best is yet to come!). Francis, sono felice di aver trovato una nuova amica arrivando a Barcellona. Dal giorno in cui siamo arrivate in questa favolosa cittá e ci siamo conosciute cercando casa sotto la pioggia battente, ne é passata di acqua sotto i ponti! Non dimenticheró mai tutti i momenti felici, le risate, gli episodi tragicomici, le ansie e gli entusiasmi condivisi! Ti ringrazio per essere stata una parte importante di questa tappa della mia vita e ci auguro di continuare a coltivare questa amicizia (visto che hai finalmente guadagnato la sezione “amicizie” e non sei piú in quella dei “coinquilini”? ahahah). Alessietta! Sei una delle persone con piú risorse ed energie che io conosca. Non sai quanto ammiri il tuo inesauribile entusiasmo e quanto ti sia grata per avermi sempre spronato ad essere coraggiosa e a seguire il mio istinto! Alessandra, in te ho trovato una persona autentica e dall’intelletto raffinato. Ascoltare le tue storie e parlare con te é sempre stato molto piacevole e stimolante. Grazie anche per le sbronze improvvisate al mercoledí sera nella Barceloneta! Vale, mi conosci da piú di metá della mia vita, sono felice che il destino ci abbia fatto rincontrare qui e ti sono grata per la voglia di fare, viaggiare ed esplorare che mi trasmetti ogni volta che mi parli. A lo largo de mi vida en Barcelona, he tenido también la suerte de compartir mi tiempo y espacio con maravillosos compañeros de piso: Azahara, Davide, Paolo, Michele, Paola y Hans. Cada uno con iv sus peculiaridades, sus pequeñas obsesiones, su lado divertido. Aquel día que me vaya de Barcelona me llevare’ recuerdos muy lindos de cada uno de vosotros. Azahara y Davide, sois una bomba de energía y entusiasmo, gracias por transmitírmelo! Paolo, eres una persona muy buena y generosa. Michele y Paola, gracias por darme la bienvenida en casa y por haber sido tan amables durante estos últimos meses de escritura loca ofreciéndome comida y suporte moral! Hans, has sido el vecino de habitación mas guay que podría haber esperado tener. Sentirse libre de hablar sola o de cantar porque tu inquilino al lado también lo hace, no es algo muy común! Y gracias por las risas, los frutos secos, el rocódromo, y todos los pequeños gestos de generosidad. Gracias Barcelona, gracias por tu lado mas espectacular hecho de luces, colores, maravillosos edificios, parques, fiestas y gente de todas partes. Y gracias también por tu lado mas oscuro y enigmático que siempre me ha llamado la atención. Es curioso cómo sentí estar como en casa tras solo un mes viviendo aquí. Eres una cuidad hermosa y encantadora donde parece que siempre puede pasar cualquier cosa! Ed eccoci qui, famiglia! So che in questi anni avete un pó sofferto le mie lunghissime assenze e improvvise sparizioni. Nonostante ció, avete sempre pazientemente atteso che io riapparissi e non mi avete mai negato la vostra comprensione e generositá. Potrei scrivere qui per ore di quanto siete speciali per me e di quanto senza il vostro supporto e i vostri insegnamenti non avrei mai potuto raggiungere questo traguardo, ma qualsiasi parola non sará mai sufficiente ad esprimere tutta la mia gratitudine. Grazie per avermi donato le ali ed un nido a cui fare ritorno. v Domenica Marchese received a FPI doctoral fellowship from the Spanish Ministry of Economy and Finance (MINECO), BES-2012- 052457 during the period 2012-2016. The work was also funded by European Research Council (RIBOMYLOME_309545) and Center for Genomic Regulation Severo Ochoa excellence grant SEV-2012- 0208. vii viii Abstract The role of RNA processing in the pathogenesis of neurodegenerative diseases is still poorly understood. α-synuclein (SNCA) is a presynaptic neuronal protein known as the major component of Lewy bodies, the pathological hallmark of Parkinson’s disease (PD). Recent evidence suggests a link between the pathogenesis of PD and the expression of SNCA mRNA isoforms with 3’ untranslated region (3’UTR) of different lengths. The purpose of my doctoral studies was the discovery of RNA-binding proteins (RBPs) regulating SNCA at the post-transcriptional level by binding its 3’UTR. Using computational and experimental approaches, I identified a number of trans-acting elements that physically interact with SNCA and potentially control its metabolism. I especially focused on the characterization of two RBPs, ELAVL1 and TIAR, and showed their implication in SNCA mRNA stability and translation efficiency. These two factors might play important roles in the maintenance of α- synuclein level and functionality in physiological and pathological conditions. ix x Resum Se sap ben poc sobre el paper del processament del RNA en la patogènesi de les malalties neurodegeneratives. L’α-sinucleïna (SNCA) és una proteïna neuronal presinàptica i el principal component dels cossos de Lewy, que al seu torn són la troballa patològica característica en la malaltia de Parkinson (MP). Recentment s’ha suggerit un lligam entre la patogènesi de la MP i l’expressió d’isoformes del mRNA de SNCA amb diferents longituds de les regions de 3’ no traduïdes (en anglès conegudes com a untranslated regions UTRs). El propòsit dels meus estudis de doctorat és descobrir les proteïnes que uneixen el RNA de SNCA i el regulen a nivell posttranscripcional. Gràcies a una combinació d’estratègies computacionals i experimentals he identificat elements que interaccionen físicament amb SNCA i potencialment en regulen el metabolisme actuant en trans. M’he centrat en la caracterització de dues proteïnes que uneixen RNA, ELAVL1 i TIAR, i mostro la seva implicació en la regulació de l’estabilitat del mRNA i l’eficiència en la seva traducció.
Load more

Recommended publications
  • Differential Requirement for SUB1 in Chromosomal and Plasmid Double-Strand DNA Break Repair
    University of Massachusetts Medical School eScholarship@UMMS University of Massachusetts Medical School Faculty Publications 2013-03-12 Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair Lijian Yu University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/faculty_pubs Part of the Amino Acids, Peptides, and Proteins Commons, Biochemistry Commons, Enzymes and Coenzymes Commons, Genetic Phenomena Commons, Molecular Biology Commons, and the Molecular Genetics Commons Repository Citation Yu L, Volkert MR. (2013). Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair. University of Massachusetts Medical School Faculty Publications. https://doi.org/ 10.1371/journal.pone.0058015. Retrieved from https://escholarship.umassmed.edu/faculty_pubs/248 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in University of Massachusetts Medical School Faculty Publications by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. Differential Requirement for SUB1 in Chromosomal and Plasmid Double-Strand DNA Break Repair Lijian Yu, Michael R. Volkert* Microbiology and Physiological Systems, University of Massachusetts Medical School, Worcester, Massachusetts, United States of America Abstract Non homologous end joining (NHEJ) is an important process that repairs double strand DNA breaks (DSBs) in eukaryotic cells. Cells defective in NHEJ are unable to join chromosomal breaks. Two different NHEJ assays are typically used to determine the efficiency of NHEJ. One requires NHEJ of linearized plasmid DNA transformed into the test organism; the other requires NHEJ of a single chromosomal break induced either by HO endonuclease or the I-SceI restriction enzyme.
    [Show full text]
  • Proteomic Analysis of the Mediator Complex Interactome in Saccharomyces Cerevisiae Received: 26 October 2016 Henriette Uthe, Jens T
    www.nature.com/scientificreports OPEN Proteomic Analysis of the Mediator Complex Interactome in Saccharomyces cerevisiae Received: 26 October 2016 Henriette Uthe, Jens T. Vanselow & Andreas Schlosser Accepted: 25 January 2017 Here we present the most comprehensive analysis of the yeast Mediator complex interactome to date. Published: 27 February 2017 Particularly gentle cell lysis and co-immunopurification conditions allowed us to preserve even transient protein-protein interactions and to comprehensively probe the molecular environment of the Mediator complex in the cell. Metabolic 15N-labeling thereby enabled stringent discrimination between bona fide interaction partners and nonspecifically captured proteins. Our data indicates a functional role for Mediator beyond transcription initiation. We identified a large number of Mediator-interacting proteins and protein complexes, such as RNA polymerase II, general transcription factors, a large number of transcriptional activators, the SAGA complex, chromatin remodeling complexes, histone chaperones, highly acetylated histones, as well as proteins playing a role in co-transcriptional processes, such as splicing, mRNA decapping and mRNA decay. Moreover, our data provides clear evidence, that the Mediator complex interacts not only with RNA polymerase II, but also with RNA polymerases I and III, and indicates a functional role of the Mediator complex in rRNA processing and ribosome biogenesis. The Mediator complex is an essential coactivator of eukaryotic transcription. Its major function is to communi- cate regulatory signals from gene-specific transcription factors upstream of the transcription start site to RNA Polymerase II (Pol II) and to promote activator-dependent assembly and stabilization of the preinitiation complex (PIC)1–3. The yeast Mediator complex is composed of 25 subunits and forms four distinct modules: the head, the middle, and the tail module, in addition to the four-subunit CDK8 kinase module (CKM), which can reversibly associate with the 21-subunit Mediator complex.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Disruption of Transcriptional Coactivator Sub1 Leads to Genome-Wide Re-Distribution of Clustered Mutations Induced by APOBEC in Active Yeast Genes
    RESEARCH ARTICLE Disruption of Transcriptional Coactivator Sub1 Leads to Genome-Wide Re-distribution of Clustered Mutations Induced by APOBEC in Active Yeast Genes Artem G. Lada1☯*, Sergei F. Kliver2☯, Alok Dhar3, Dmitrii E. Polev4, Alexey E. Masharsky4, Igor B. Rogozin5,6,7, Youri I. Pavlov1* 1 Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, Nebraska, United States of America, 2 Department of Genetics and Biotechnology, Saint Petersburg State University, St. Petersburg, Russia, 3 Department of Genetics, Cell Biology and Anatomy, and Munroe-Meyer Institute, University of Nebraska Medical Center, Omaha, Nebraska, United States of America, 4 Research Resource Center for Molecular and Cell Technologies, Research Park, St. Petersburg State University, St. Petersburg, Russia, 5 National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland, United States of America, 6 Institute of Cytology and Genetics, Novosibirsk, Russia, 7 Novosibirsk State University, Novosibirsk, Russia OPEN ACCESS ☯ These authors contributed equally to this work. * Citation: Lada AG, Kliver SF, Dhar A, Polev DE, [email protected] (AGL); [email protected] (YIP) Masharsky AE, Rogozin IB, et al. (2015) Disruption of Transcriptional Coactivator Sub1 Leads to Genome- Wide Re-distribution of Clustered Mutations Induced Abstract by APOBEC in Active Yeast Genes. PLoS Genet 11 (5): e1005217. doi:10.1371/journal.pgen.1005217 Mutations in genomes of species are frequently distributed non-randomly, resulting in muta- Received: February 3, 2015 tion clusters, including recently discovered kataegis in tumors. DNA editing deaminases Accepted: April 13, 2015 play the prominent role in the etiology of these mutations.
    [Show full text]
  • “Molecular Mechanisms and Pharmacogenomics of Constituents of Salvia Miltiorrhiza for Anticancer Therapy”
    “Molecular mechanisms and pharmacogenomics of constituents of Salvia miltiorrhiza for anticancer therapy” Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” im Promotionsfach Pharmazie am Fachbereich Chemie, Pharmazie und Geowissenschaften der Johannes Gutenberg-Universität Mainz vorgelegt von Ching-Fen Wu Mainz, April 2016 Betreuer: Gutachter der Arbeit: Datum der mündlichen Prüfung: 21.04.2016 Prüfer: Erklärung Hiermit erkläre ich an Eides statt, dass ich diese Arbeit selbständig verfasst und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Mainz, 01.03.2016 ----------------------- -------------------------- Ort, Datum Ching-Fen Wu Acknowledgement I Acknowledgement Acknowledgement II Abstract III Abstract Cancer is a worldwide public health problem. Owing to severe side effects and development of resistance, new anticancer agents are urgently required. Natural products provide novel options, because they are considered as being less toxic and more active by multifactorial mechanisms. Salvia miltiorrhiza Bunge (Lamiaceae), Danshen in Chinese, is a well-known traditional herb widely used in China. In addition to its activity against cardiovascular diseases, recent reports also focused on the anticancer effects this plant. In this thesis, I hypothesized that S. miltiorrhiza can bypass drug resistance. I investigated molecular mechanisms underlying cytotoxic effects of the extract and three main chemical compounds of S. miltiorrhiza. The root extract of S. miltiorrhiza exerted profound cytotoxicity towards various sensitive and multidrug-resistant, P-glycoprotein over-expressing CEM/ADR5000 leukemia cells, EGFR transfected U87.MGΔEGFR glioblastoma cells and HCT-116 p53-knockout colon cancer cells. The plant extract activated the intrinsic apoptotic pathway, which was experimentally determined by increased cleavage of caspase 3, 7, 9 and poly ADP-ribose polymerase (PARP).
    [Show full text]
  • Genomic Study of RNA Polymerase II and III Snapc-Bound Promoters Reveals a Gene Transcribed by Both Enzymes and a Broad Use of Common Activators
    Genomic Study of RNA Polymerase II and III SNAPc-Bound Promoters Reveals a Gene Transcribed by Both Enzymes and a Broad Use of Common Activators Nicole James Faresse1., Donatella Canella1., Viviane Praz1,2, Joe¨lle Michaud1¤, David Romascano1, Nouria Hernandez1* 1 Center for Integrative Genomics, Faculty of Biology and Medicine, University of Lausanne, Lausanne, Switzerland, 2 Swiss Institute of Bioinformatics, Lausanne, Switzerland Abstract SNAPc is one of a few basal transcription factors used by both RNA polymerase (pol) II and pol III. To define the set of active SNAPc-dependent promoters in human cells, we have localized genome-wide four SNAPc subunits, GTF2B (TFIIB), BRF2, pol II, and pol III. Among some seventy loci occupied by SNAPc and other factors, including pol II snRNA genes, pol III genes with type 3 promoters, and a few un-annotated loci, most are primarily occupied by either pol II and GTF2B, or pol III and BRF2. A notable exception is the RPPH1 gene, which is occupied by significant amounts of both polymerases. We show that the large majority of SNAPc-dependent promoters recruit POU2F1 and/or ZNF143 on their enhancer region, and a subset also recruits GABP, a factor newly implicated in SNAPc-dependent transcription. These activators associate with pol II and III promoters in G1 slightly before the polymerase, and ZNF143 is required for efficient transcription initiation complex assembly. The results characterize a set of genes with unique properties and establish that polymerase specificity is not absolute in vivo. Citation: James Faresse N, Canella D, Praz V, Michaud J, Romascano D, et al.
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer
    Florida International University FIU Digital Commons FIU Electronic Theses and Dissertations University Graduate School 11-7-2018 Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer Jairo Ramos [email protected] Follow this and additional works at: https://digitalcommons.fiu.edu/etd Part of the Clinical Epidemiology Commons Recommended Citation Ramos, Jairo, "Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer" (2018). FIU Electronic Theses and Dissertations. 3872. https://digitalcommons.fiu.edu/etd/3872 This work is brought to you for free and open access by the University Graduate School at FIU Digital Commons. It has been accepted for inclusion in FIU Electronic Theses and Dissertations by an authorized administrator of FIU Digital Commons. For more information, please contact [email protected]. FLORIDA INTERNATIONAL UNIVERSITY Miami, Florida DECIPHER MECHANISMS BY WHICH NUCLEAR RESPIRATORY FACTOR ONE (NRF1) COORDINATES CHANGES IN THE TRANSCRIPTIONAL AND CHROMATIN LANDSCAPE AFFECTING DEVELOPMENT AND PROGRESSION OF INVASIVE BREAST CANCER A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in PUBLIC HEALTH by Jairo Ramos 2018 To: Dean Tomás R. Guilarte Robert Stempel College of Public Health and Social Work This dissertation, Written by Jairo Ramos, and entitled Decipher Mechanisms by Which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer, having been approved in respect to style and intellectual content, is referred to you for judgment.
    [Show full text]
  • Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis
    Getting “Under the Skin”: Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis by Kristen Monét Brown A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Epidemiological Science) in the University of Michigan 2017 Doctoral Committee: Professor Ana V. Diez-Roux, Co-Chair, Drexel University Professor Sharon R. Kardia, Co-Chair Professor Bhramar Mukherjee Assistant Professor Belinda Needham Assistant Professor Jennifer A. Smith © Kristen Monét Brown, 2017 [email protected] ORCID iD: 0000-0002-9955-0568 Dedication I dedicate this dissertation to my grandmother, Gertrude Delores Hampton. Nanny, no one wanted to see me become “Dr. Brown” more than you. I know that you are standing over the bannister of heaven smiling and beaming with pride. I love you more than my words could ever fully express. ii Acknowledgements First, I give honor to God, who is the head of my life. Truly, without Him, none of this would be possible. Countless times throughout this doctoral journey I have relied my favorite scripture, “And we know that all things work together for good, to them that love God, to them who are called according to His purpose (Romans 8:28).” Secondly, I acknowledge my parents, James and Marilyn Brown. From an early age, you two instilled in me the value of education and have been my biggest cheerleaders throughout my entire life. I thank you for your unconditional love, encouragement, sacrifices, and support. I would not be here today without you. I truly thank God that out of the all of the people in the world that He could have chosen to be my parents, that He chose the two of you.
    [Show full text]
  • Small-Molecule G-Quadruplex Stabilizers Reveal a Novel Pathway
    RESEARCH ARTICLE Small-molecule G-quadruplex stabilizers reveal a novel pathway of autophagy regulation in neurons Jose F Moruno-Manchon1, Pauline Lejault2, Yaoxuan Wang1, Brenna McCauley3, Pedram Honarpisheh4,5, Diego A Morales Scheihing4, Shivani Singh6, Weiwei Dang3, Nayun Kim6, Akihiko Urayama4,5, Liang Zhu7,8, David Monchaud2, Louise D McCullough4,5, Andrey S Tsvetkov1,5,9* 1Department of Neurobiology and Anatomy, The University of Texas McGovern Medical School at Houston, Houston, United States; 2Institut de Chimie Mole´culaire (ICMUB), UBFC Dijon, CNRS UMR6302, Dijon, France; 3Huffington Center on Aging, Baylor College of Medicine, Houston, United States; 4Department of Neurology, The University of Texas McGovern Medical School at Houston, Houston, United States; 5The University of Texas Graduate School of Biomedical Sciences, Houston, United States; 6Department of Microbiology and Molecular Genetics, The University of Texas McGovern Medical School at Houston, Houston, United States; 7Biostatistics and Epidemiology Research Design Core Center for Clinical and Translational Sciences, The University of Texas McGovern Medical School at Houston, Houston, United States; 8Department of Internal Medicine, The University of Texas McGovern Medical School at Houston, Houston, United States; 9UTHealth Consortium on Aging, The University of Texas McGovern Medical School at Houston, Houston, United States Abstract Guanine-rich DNA sequences can fold into four-stranded G-quadruplex (G4-DNA) *For correspondence: structures. G4-DNA regulates replication and transcription, at least in cancer cells. Here, we [email protected] demonstrate that, in neurons, pharmacologically stabilizing G4-DNA with G4 ligands strongly downregulates the Atg7 gene. Atg7 is a critical gene for the initiation of autophagy that exhibits Competing interests: The decreased transcription with aging.
    [Show full text]
  • Product Size GOT1 P00504 F CAAGCTGT
    Table S1. List of primer sequences for RT-qPCR. Gene Product Uniprot ID F/R Sequence(5’-3’) name size GOT1 P00504 F CAAGCTGTCAAGCTGCTGTC 71 R CGTGGAGGAAAGCTAGCAAC OGDHL E1BTL0 F CCCTTCTCACTTGGAAGCAG 81 R CCTGCAGTATCCCCTCGATA UGT2A1 F1NMB3 F GGAGCAAAGCACTTGAGACC 93 R GGCTGCACAGATGAACAAGA GART P21872 F GGAGATGGCTCGGACATTTA 90 R TTCTGCACATCCTTGAGCAC GSTT1L E1BUB6 F GTGCTACCGAGGAGCTGAAC 105 R CTACGAGGTCTGCCAAGGAG IARS Q5ZKA2 F GACAGGTTTCCTGGCATTGT 148 R GGGCTTGATGAACAACACCT RARS Q5ZM11 F TCATTGCTCACCTGCAAGAC 146 R CAGCACCACACATTGGTAGG GSS F1NLE4 F ACTGGATGTGGGTGAAGAGG 89 R CTCCTTCTCGCTGTGGTTTC CYP2D6 F1NJG4 F AGGAGAAAGGAGGCAGAAGC 113 R TGTTGCTCCAAGATGACAGC GAPDH P00356 F GACGTGCAGCAGGAACACTA 112 R CTTGGACTTTGCCAGAGAGG Table S2. List of differentially expressed proteins during chronic heat stress. score name Description MW PI CC CH Down regulated by chronic heat stress A2M Uncharacterized protein 158 1 0.35 6.62 A2ML4 Uncharacterized protein 163 1 0.09 6.37 ABCA8 Uncharacterized protein 185 1 0.43 7.08 ABCB1 Uncharacterized protein 152 1 0.47 8.43 ACOX2 Cluster of Acyl-coenzyme A oxidase 75 1 0.21 8 ACTN1 Alpha-actinin-1 102 1 0.37 5.55 ALDOC Cluster of Fructose-bisphosphate aldolase 39 1 0.5 6.64 AMDHD1 Cluster of Uncharacterized protein 37 1 0.04 6.76 AMT Aminomethyltransferase, mitochondrial 42 1 0.29 9.14 AP1B1 AP complex subunit beta 103 1 0.15 5.16 APOA1BP NAD(P)H-hydrate epimerase 32 1 0.4 8.62 ARPC1A Actin-related protein 2/3 complex subunit 42 1 0.34 8.31 ASS1 Argininosuccinate synthase 47 1 0.04 6.67 ATP2A2 Cluster of Calcium-transporting
    [Show full text]
  • 393LN V 393P 344SQ V 393P Probe Set Entrez Gene
    393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393
    [Show full text]