Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. dniy lmt,booia rcrusata tess n eceia atr URn uzn,Miad- Lutzoni, community endophytic (U’Ren, determines that factors factor host major geochemical the as is and such identity Host factors, stresses, abiotic 2012). circumstantial Arnold, and & hosts biotic or Laetsch, likowska, various their biological by and influenced climate, microbiota related is interaction identity, endophytic structure the mutual community of however, topics. The microbial ecology research microbes, Endophytic important and and 2020). become biology plant and endophytes and the al., attention of side, radiation, Therefore, gained et biodiversity have ultraviolet other Yao the limited. nutrition, the changed 1998; remains In poor and Sullivan, knowledge dehydration, community & 2008). from shaped al., Helander, them profoundly et Faeth, protect Rodriguez (Saikkonen, which 2012; tissues, competition Sutton, plant 2003; & al., inside et Thawer, live (Arnold herbivores Wearn, pathogen against host to protection Eschen, improves provide response endophytes to host Gange, that production have the chemical shown reprogrammed plants toxic plant have endophytes increased host environments; Studies and the stressed invasion their symbiosis. to of and adapt mutual Endophytes to components this physiology function. from plant important marine ecological benefit and are and terrestrial both diversity in and and distributed phylogenetic coevolved, plant found high are a have microbes and These within plants 2011). live Bayman, that & (Porras-Alfaro microbes microbiome symbiotic are Endophytes Our Introduction different environments. 1 follow radioactive schrenkianum in response. K. stress higher of in was parts paradigms fungi belowground and different and and bacteria and bacteria aboveground endophytic assembly showed endophytic with community between Radiation associated for both found mechanisms endophytes of were the diversity levels. correlations that genetic radiation Negative suggest The the findings No networks. plant. among co-occurrence levels. the communities fungal radiation in bacterial the the fungi aboveground between on the that the effect in than significant Differences in different more a intensity. matter found of were radiation organic were abundance parts high the and differences belowground under on nitrogen, significant and microbiota effect aboveground total significant fungal between no pH, root communities had the Soil Radiation endophytic predominated endophytes. diversity. Sordariomycetes root bacterial classes. of had low, higher diversity bacterial parts (at the Aboveground had on radiation schrenkianum. parts effects K. and significant belowground endophytes of showed Actinobacteria factors while communities class fungal endophytic diversity bacterial geochemical The and the fungal of predominated fungi. bacterial higher and Dothideomycetes effects bacteria of class endophytic the fungal of composition structure and the community those in and the schrenkianum including on differences control) ecosystems, Kalidium and the aquatic level plant high investigates and halophytic medium, terrestrial study the of Our types with various associated radiation. in plants ionizing of with tissues habitats within found microbes are Endophytes Abstract 2020 20, November 2 1 Hou Min Zhu Jing schrenkianum endophytes Kalidium fungal plant and halophytic bacterial the the of on radiation ionizing of Effect e vvUniversity Aviv Tel available not Affiliation 1 1 Xag (Sun) (Xiang) , mrSharon Amir , 2 n ogiYuan Hongli and , 2 hdn Zhang Zhidong , 1 1 iogTang Qiyong , 1 1 eyn Gu Meiying , 1 iunZhang Lijuan , 1 , Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. olce rmfu ie ihdffrn niomna aiatvt eesdrn uutadSpebr2017 September and August during levels radioactivity environmental different China with watershed sites the of four in from located collected Region ( are layer sites Autonomous with surface schrenkianum sampling region the The K. Uyghur in radiation-contaminated mm. 2% Xinjiang from 591 above of floods content the precipitation seasonal annual in of mean a area County and degC Hoxud 12.56 in of conducted was (91 study This sampling and the site level. shaping Study radiation level) with 2.1 radiation microbes methods endophytic local of and and pattern Materials determine in soil 2 habitat; understand shift of radioactive to the a characteristics aim elucidate in We and (geochemical fungi communities; radiations. factor and endophytic of bacteria environmental Amaranthaceae levels endophytic paper main different of of This representing structure the parts community sites aerial China. and from and diversity northwest samples the roots of soil the and desert in samples semi-arid plant bacteria) saline and arid, plant (fungi ( in host halophyte microbes Caesium-137 exist the endophytic of test and the because inter-kingdom nuclear investigates endophytes habitats of historic between High-radiation entity from relationship symbiotic unknown. mulation the is the However, environment and radioactive ionizing plants, circumstances. under to host harsh exposed with plants challenge of associate jointly microbes symbiotically symbiotic microbes the sustainable Endophytic radiation aerospace on designing under studies in ecosystem no and of are utilization power traits there nuclear However, ecological radiation. on and radiation making system. biological of policy support in The effects life concern negative 2012). great other a al., and is vole et environments stress (Wehrden bank radioactive ecosystem fun- of of the organisms soil microbiomes on the the gut in the dominate changes 2005). morphological correlated to Haselwandter, (2018) & ascended Watts Zakharchenko, fungi (Zhdanova, glareolus and melanin-containing pollution the Mappes, radionuclide and Tukalenko, in species in toward Lavrinienko, resistant, shifts increase shift in building radiation with to communities appeared Plant resulted other more in Power structure gal also Nuclear and community be tests Chernobyl fungal has walls nuclear may the soil Radiation of after the example, that unit For years on fourth 2000). two communities. damaged detected Nakonechnaya, microbial (1960) sites the local were & of Shields zero shelter Vember, genera and ground the Rickard Zakharchenko, of Durrell 19 of (Zhdanova, parts 1964; radius of inner 1961). Beatley, mile the species Sparrow, 1963; a in fungal & Beck, structures within & culturable Durrell, soil (Allred Thirty-seven Shields, from tests NTS. 1962; taxa nuclear fungal Drouet, fungi the 41 & and after under isolated Shields algae, years survive terrestrial 1965; few microbes rodents, Beatley, (NTS) shrubs, and & of Site and animals, existence Test accidents, high plants, the Nevada nuclear in certain reported in tests, minerals, However, have in weapon radioactive Studies effects nuclear habitats. to sufficient environment. harmful plants, radioactive radioactive exposed with causes power new areas radiation particles, Nuclear produced in ionizing or aerospace. detected to mining waves in generally exposure electromagnetic or Overdosed is of environments, radiation molecule. altitude form Ionizing a the or in organisms. atom living radiation, the an of promotes ionize type endophytes to energy a and is plants shed between radiation will interaction Ionizing conditions mutual entity stressed the symbiotic under how the shift of in community adaption issues endophytic high-stress fundamental how et under into plants on Rodriguez light in research 2010). tolerance Sessitsch, Therefore, stress endophytic & symbiotically-conferred have environment. Heijden, of habitat-specific, increased (Compant, factors structure as demonstrated drought such environmental (2008) alters changes and whereas climate stress warming, al. by 2012), global abiotic affected emission, is and al., dioxide population Biotic et endophytic carbon that community. U’Ren shown have endophytic 2012; Studies the Guo, communities. on & influence Hyde, complex Ding, a Sun, (X. composition ° 54”,4dg97”) hsrgo xeine eiai lmt ihama nultemperature annual mean a with climate semi-arid a experiences region This 40deg39’75”N). 45’42”E, naiigCenblzn ihterdociiylvl ere ta.osre hsooia and physiological observed al. et Wehrden level. radioactivity the with zone Chernobyl inhabiting aiimschrenkianum Kalidium a h oiatpplto ftelclhbtt ln aeil n olsmlswere samples soil and materials Plant habitat. local the of population dominant the was Pl. o. oiatpplto flclflr.Hr,w collected we Here, flora. local of population dominant a Moq., (Pall.) < 0c ep n aincielvl35fl hto omlsoil. normal of that fold 3-5 level radionuclide a and deep) cm 20 2 137 sacmlto.Tesi a salt a had soil The accumulation. Cs 137 s accu- Cs) Myodes Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. bv ehd hntetxnm sinet fbceilAV n Tswr obndt noverall an to combined the were following OTUs references and SILVA ASVs on operational bacterial based different of assigned into assignments and taxonomy clustered OTU, the each were function Then bacterial from genus, with For method. selected bacterial respectively. similarity above was 2019), 97% to sequence al., on random assigned et based One not (Nilsson (OTUs) 2013) were 8.0 al., units that et version taxonomic (Quast Fungi ASVs 132 boot- for version those SILVA 75 release against minimum dataset, FASTA 2016) with general al., approach Na¨ıve et UNITE Bayes using (Callahan and workflow ASVs DADA2 fungal following and calls bacterial strap to variants assigned sequence was amplicon Taxonomy the and generate to singletons remove dereplicated were to datasets used DADA2 (ASVs). fungal was Subsequently, and 2016) software. bacterial Holmesa, USEARCH Both & using doubletons. McMurdie, software removed Fukuyama, QIIME were Sankaran, using (Callahan, sequences workflow filtered Chimeric quality analysis. and further demultiplexed from were score quality dataset a fungal with Reads and (Version1.7.0). bacterial was from library reads the Raw last, At MA). analysis Waltham, Bioinformatic platform. Scientific, 2.3 XL (Thermo S5TM quality Fluorometer Kit Ion library 2.0 Extraction an The Qubit@ on Gel recommendations. sequenced the Mix GeneJETTM manufacturer’s on following with min. Kit MA) 5 Library assessed purified Fragment Waltham, for was Plus was 72 Scientific, Ion at products (Thermo using extension generated PCR rxns were final for 48 Then, libraries a 98 Sequencing by detection. at MA). followed Waltham, for denaturation s, Scientific, 30 of (Thermo gel for cycles agarose 72 30 at 2% min, elongation on 1 and 1 s, of for 30 volume 98 for at same 50 denaturation at annealing initial s, of 10 consisted cycling 0.2 Thermal MA); DNA. Ipswich, Biolabs, England (New Mix Testing sequencing & NGS K Standards and Quality PCR, of (Ca), extraction, Institute ion Sciences. DNA the calcium Agricultural in 2.2 such (Sulf), of measured Academy characteristics, sulfate were Xinjiang (Cl), geochemical (Na), avail- ion Agro-Products, ion The (SN), labelled chloride for sodium nitrogen Technology and laboratory. (Sal), and soluble packed salt the (TN), (Mg), each (K), pooled, nitrogen ion to of potassium total litter, magnesium transport available (OM), deep) plant large to (P), matter cm and in phosphorus degC organic (0-20 rocks (EC), able 4 placed remove soil conductivity until at were to electrical surface degC stored sieved pH, plants the -80 as and were from Whole at site bags, shovels stored each cloth with site. and from collected in each icebox, samples were an from Soil samples in uprooted soil site. laboratory Five were to apart) process. transported m further labelled, (15 envelopes, plants paper autoclaved Five S1). (Table rn,19)adIS GTCTCTACAG)pies(ht,Bus e,&Tyo,1990). Taylor, & 30 & Lee, in 799F out (Gardes Bruns, (CTTGGTCATTTAGAGGAAGTAA) carried using (ITS1 (White, were ITS1F 1 primers amplified reactions region using (GCTGCGTTCTTCATCGATGC) PCR was spacer ITS2 amplified All transcribed and gene was internal 1993) fungal RNA RNA Bruns, The ribosomal ribosomal (ACGTCATCCCCACCTTCC) 2013). of 16S Bergelson, 1193R region) & and bacterial Horton, 2001) (Bodenhausen, the primers Triplett, of & region was (Chelius (AACMGGATTAGATACCCKG) USA). DNA hypervariable Wilmington, of V5-V7 Scientific, concentration (Thermo The polyvinyl- The degC). 1.5% Spectrophotometer EDTA, 65 1000 mM to NanoDrop 20 preheated a NaCl, nitrogen, 8.0; using M bromide liquid pH cetyltrimethylammonium measured 1.4 2x Tris-HCl, using 2-mercaptoethanol; mL mM freeze-dried 0.5% 5 100 was (PVP), with CTAB, method pyrolidone material tube CTAB (w/v) a following plant (2% Each to extracted buffer surface-sterilized transferred was extraction the extraction. pestle, DNA min, (CTAB) and of 3 Genomic DNA mortar for gram for a 2000). hypochlorite One with Liew, used sodium homogenized & 3.25% 2000). were Hyde, min, al., types) (Guo, 1 et s tissue for (Guo ethanol 30 2 75% for x with ethanol sterilized treatments 75% surface and 4 was g) x (20 individual material plant (5 samples 40 altogether . schrenkianum × lnswr iie nt eilprsadrost nlz h nohtcmcoe,and microbes, endophytic the analyze to roots and parts aerial to in divided were plants odn ue cnandSBgen ihPRpout n prt electrophoresis operate and products PCR with green) SYB (contained buffer loading < µ 0adtoelcigcmlt acd n rmr eeexcluded were primers and barcode complete lacking those and 20 ecin ih15 with reactions L µ ffradadrvrepies n bu 0n template ng 10 about and primers, reverse and forward of M 3 µ fPhusion of L otu n“mr akg Wlisn 2018). (Wilkinson, package “kmer” in ® ihFdlt C Master PCR High-Fidelity Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. nr-eu eei iest fbcei n ug rmcnrladtretetetlvl eeeautdby evaluated were levels treatment three and control from fungi and bacteria of in diversity functions genetic using Intra-genus determined were characteristics Fr Network (Dormann, 2006). package Nepusz, “bipartite” & function (Csardi with package collectively above. and “igraph” mentioned separately with datasets method fungal the and with bacterial cor.test FDR-corrected on applied were function was rates analysis with error Co-occurrence tested 1 was Type data 2004). in (Scrucca, overdispersion package and “qcc” distribution function Poisson with (GLM) with tested models was ted linear distribution generalized data function Poisson The using 2002). using performed tested was was analysis fungi) This tion for AIC. (ge- by level richness selection species or stepwise and abundance with endophyte bacteria on for variables) levels. level (explanatory factors nus radiation environmental implemented different among was of or effect permutations The statistically tissues 999 to plant with applied (PerMANOVA) between was variance composition (ANOSIM) with of microbial similarities analysis of using in multivariate levels Analysis differences Permutational radiation 2016). significant or al., tissues the et plant test different (Oksanen the package among dissimilarity “vegan” 1987). composition fungi in Belbin, community or & the bacteria visualize Minchin, endophytic to (Faith, used of method was Bray-Curtis (NMDS) scaling fungi using endophytic multidimensional dissimilarities of Non-metric data) calculating read by OTU constructed (Hellinger-transformed with were composition community the test of between (HSD) matrices distance differences difference The significant Significant honestly 2019). Tukey’s al., using et (FDR) compared Veach function Benjamini-Hochberg further 2016; were a Team, had populations tissue function Core microbial rates plant Development with error microbiota R of fungal 1 1995; effect and Type Hochberg, the bacterial (Auguie, 2016). test of Team, “gridExtra” diversity to Core p and and Development out richness (R 2005), carried the package was (Murrell, on were “stats” ANOVA) level Graphs “grid” (two-way radiation 2016). variance 2016), or Team, type of (Wickham, Core in Development analysis samples “ggplot2” (R 40 Two-way packages by 3.6.1 2017). taxa R version transformation. 364 R Hellinger with and using using dataset plotted abundance performed bacterial to were in normalized samples analyses were removed. 40 Statistical were counts by 0.001 taxa taxa and than raw 693 bacterial less The of both abundance relative dataset dataset. from of core out fungal and sum a filtered dataset the in bacterial first with for were resulted taxa 44,787 doubletons noise, This to the and (18,834 decrease Singletons, To magnitude dataset). datasets. of fungal fungal order for same the 62,613 of to were 9726 BioProject samples all under from NCBI counts Read of Archive Read data). analysis Sequence fungal Data the (for 2.4 PRJNA613597 in MT351182-MT353643 and sequences Infor- and data) Biotechnology raw sequences) bacterial for the (for 16S Center and PRJNA625640 National (bacterial sequences) of KEBK00000000 GenBank ITS1 numbers in (fungal accession deposited the been have under diagram. sequences and mation schematic OTU taxa, and and supplementary details non-fungal ASV see more off The Please for above. filtered S1 mentioned dataset, workflow Fig. DADA2 taxon-sample eukaryotes and with for 1 fungal level were references file species generated that UNITE at 2019), ASVs on taxa those al., based fungal the identified dataset, agglomerated et clustered, in fungal (Nilsson For similarly OTUs were 8.0 2016). or “phyloseq” species, al., version using ASVs fungal et assignments to (Callahan The identical assigned workflow with table. DADA2 not level phy- taxon-sample genus in Cyanobacteria bacterial overall described the non-bacteria, as the at package to from agglomerated assigned then removed were were were table that overall order OTUs Rickettsiales and or ASVs lum, All table. taxon-sample bacterial au orcinpromdfrAOAmdl ihfunction with models ANOVA for performed correction value stepAIC adonis HSD.test n“tt”pcae( eeomn oeTa,21) h oocrec ewrswr visualized were networks co-occurrence The 2016). Team, Core Development (R package “stats” in n“ea”pcaet netgt h niomna nuneo irboacomposition. microbiota on influence environmental the investigate to package “vegan” in n“AS akg RDvlpetCr em 06 ec ta. 09 eals&Ripley, & Venables 2019; al., et Veach 2016; Team, Core Development (R package “MASS” in n“gioa”pcae(edbr,2019). (Mendiburu, package “agricolae” in n,Bl und, ¨ tgn rbr 2009). Gruber, & uthgen, ¨ 4 shapiro.test p.adjust n“tt”pcae l aawr calcula- were data All package. “stats” in n“tt”pcae(ejmn & (Benjamini package “stats” in glm n“tt”pcaeadfunc- and package “stats” in qcc.overdispersion.test metaMDS function aov in in Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. h vrg ao ihesa pce ee fedpyi ug ntewoefna omnte coscontrol across communities fungal whole the in fungi endophytic of level species at richness taxon average The levels. endophytes radiation members the of the among Richness of differed 3.3 that abundance significantly and plant, Rozellomycota Mortierellomycetes whole and and the Aphelidiomycota Sordariomycetes, In phyla Leotiomycetes, levels. classes of radiation Agarico- of the class members basidiomycetous among S2). the varied of (Table of abundance significantly levels the fungi radiation tissues, unassigned aerial the and from mycetes among fungi varied endophytic significantly the radioactive among fungi Meanwhile, high unassigned from and of plants Sordariomycetes, fungi of mycetes, endophytic roots con- the the from in Among plants class of Microascales, fungal roots dominated Hypocreales, predominant the Pleosporales (mostly the in Order Sordariomycetes environment. was S2). while group Xylariales) (Table environments abundant and roots radioactive most Sordariales, the medium the in and were class low, fungal fungi trol, abundant Unassigned with most class. associated second communities Dothideomycetes the fungal was endophytic it the while Dothideo- in groups. class fungal abundant prevalent num most most level. the the radiation were was with fungi mycetes abundance unassigned of in plant and difference whole Sordariomycetes, significant the Dothideomycetes, showed and class roots, bacterial tissues, No aerial 1a). in domi- (Fig. communities Oceanospirillales) bacterial and endophytic Xanthomonadales the Rhizobiales (mostly nated (mostly Gammaproteobacteria Alphaproteobacteria hierarchy. and classes taxonomical Sphingomonadales) by high followed and at Actinomycetales) treatments (mostly among Actinobacteria with composition Class community samples shifting 40 showed hierarchy fungi across high The Endophytic taxa at dataset. 843 composition the covering taxon and dataset from Shifting ASVs new removed 3.2 identified a were The yielded taxa removed. assignment. level doubletons plant 719 taxonomy species and into and to singletons the clustered non-Fungi at subjected were and level, agglomerated again fungal combined, species dataset different were the subsequently to and at assigned were level identified were identity OTUs ASVs be high- 97% 1747 not 1,704,072 of this, could at sequences, region of which chimera OTUs Out ASVs, ITS1 of obtained. 13,054 sequencing removal were Meanwhile, by and ASVs species. samples denosing, 14,801 40 control, and from quality sequences removed. quality obtained After doubletons were RNA. and eukaryotes yielded ribosomal singletons for level fungal with reads genus samples raw the and and 40 at 3,232,676 ASVs Chloroplast, across Similarly, agglomerated taxa identified Cyanobacteria, dataset 1927 The non-Bacteria, bacterial covering assignment. The dataset to 2002 taxonomy dataset. new into assigned the to a clustered taxa from were subjected removed and level, again ASVs were genus combined, Rickettsiales were 19,367 the different subsequently and at to of were level identified assigned were total identity OTUs be ASVs not 97% A 8788 could at assignment; obtained. which taxonomy OTUs and ASVs, were to denoising, 10,579 subjected sequences control, Meanwhile, were quality genera. high-quality dataset After final 1,235,434 gene. the RNA in sequences, recovered ribosomal chimera sequencing 16S by samples bacterial of 40 the removal from prokaryotes of for region reads hypervariable raw 2,790,479 V5-V7 approximately produced platform Ion The treatments. description four General among 3.1 genera, with calculated of of model was regardless significance “K80” distance difference distances Results the using sequence Pairwise test 3 all level analysis. to as treatment applied the well one was as ANOVA in from diversity, One-way included genetic genus 2018). taxonomy intra-genus Schliep, were certain assigned & a fungi ASVs (Paradis package in the and “ape” available Only bacteria ASVs groups. for the all level within among sequences genus DNA the of at distances pairwise the computing Fg b.Dtiemctssgicnl rdmntdteara ise eadeso h aito level radiation the of regardless tissues aerial the predominated significantly Dothideomycetes 1b). (Fig. K . schrenkianum ot,teaudneo soyeoscassLeotio- classes ascomycetous of abundance the roots, 5 K . schrenkianum .schrenkia- K. dist.dna in Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. oprdt oto eadeso h isetp ara ise rros Tbe1). (Table levels roots) or radiation tissues all (aerial diversity in type endophytic Genetic observed tissue of 3.6 were the topology connectance of lower the and regardless and control control on in to modularity effect modularity compared Higher strong similar network. Meanwhile, a and correlation 1). showed control (Table fungal in radiation treatments showed connectance Simultaneously, radioactive tissues higher environments. three showed aerial radioactive communities and in topology bacterial control communities the root bacterial across on the endophytic modularity radiation of and of network effect connectance The minor similar network. a roots bacterial suggested the endophytic communities in bacterial of endophytic interactions of inter-kingdom analysis denser Network tissues. indicate antagonism aerial findings intensive the These suggested in roots. corre- which than negative in rather members, Concatenated fungi eukaryotic 4b). and (Fig. and bacteria connected prokaryotic between roots, more between In were observed community members. were eukaryotic the among or in lations observed prokaryotic exam- members between For was fungal observed 4a). or correlation also bacterial (Fig. be positive could genera tissues, correlation fungal positive aerial among Meanwhile, OTU In occurred eukaryotic fungal correlation roots. unidentified or negative and ple, prokaryotic while parts within genera, aerial occurred bacterial of endophytic correlation microbiota positive in that groups indicated analysis network ( Correlation roots in communities network bacterial Correlation 3.5 of case ( in roots level and radiation 0.001) by affected R was 2.164, composition the that 0.102, ( type composition R endophytic tissue in 3d- of by differences R composition (Fig. affected 15.304, community significant significantly levels = the no was that radiation showed fungi indicated PerMANOVA the tissues and 3c). among bacteria aerial (Fig. levels composition in radiation communities in the bacterial among differences the significant Meanwhile, showed in roots f). endophytes differences and of composition larger tissues level community showed radiation of aerial the community on investigated results tissues based further fungal We those different ANOSIM endophytes. with and in b). fungal compared type and bacterial 3a, tissue bacterial on both (Fig. both based for groups roots in the and among differences composition tissues revealed community aerial ordination across between and NMDS types compositions tissue treatments. two between and composition the community control in among difference significantly significant same indicated was results the level Current three was treatments radiation and among roots low control composition at in Community the bacteria 2). fungi 3.4 among (Fig. endophytic endophytic control similar of of in was richness richness that the tissues than the higher while aerial addition, levels in In radiation fungi 2). different and (Fig. bacteria levels endophytic radiation of richness The ( 163.60 level was radiation 30.122, levels = radiation (df three parts ± and belowground control in 31.543, across than = bacteria parts (df aboveground roots in in less than tissues ( aerial fungi in endophytic 104 of richness was the roots in 127.30 and was 12.90 levels radiation three and 2 91 nros w-a NV hwdta ohtetsu ye ( types tissue the both that showed ANOVA Two-way roots. in 49.15 0.149, = p 2 .0) eMNV ujce omcoilcmuiisi ieettsussprtl indicated separately tissues different in communities microbial to subjected PerMANOVA 0.002). = 0.289, = 2 p 0.242, = .0) n hi neato ( interaction their and 0.001), = p .2)sgicnl ffce h iheso nohtcbacteria. endophytic of richness the affected significantly 0.029) = F p ,19 3, K .0)adfna omnte nara ise ( tissues aerial in communities fungal and 0.002) = p . .0) aiatv ee ( level radioactive 0.001), = .8,R 2.885, = schrenkianum ± 7 n OTU and 673 10.TowyAOAidctdta iseoii infiatyinfluenced significantly origin tissue that indicated ANOVA Two-way 21.01. p < 2 0.351, = ± .0) -etsoe httefna iheswssgicnl more significantly was richness fungal the that showed T-test 0.001). atra omnte nrosadfna omnte nboth in communities fungal and roots in communities Bacterial . 92.Rcns fedpyi ug nara ise a 150.60 was tissues aerial in fungi endophytic of Richness 29.21. p 0 hwdsrn eaiecreain osvrlfna taxa. fungal several to correlations negative strong showed 702 p < F 0.001). = .0) ncnrs,tebceilrcns a significantly was richness bacterial the contrast, In 0.001). ,39 3, F 6 .3,R 1.534, = ,39 3, .2,R 2.022, = F ± ,39 1, 2 79 nara ise,wiei a 252.90 was it while tissues, aerial in 27.95 0.084, = 201 R 12.021, = p 2 < 0.111, = p .0) h iheso endophytic of richness The 0.001). F < p ,19 3, 0.032; = .0)adisitrcinwith interaction its and 0.001) 2 p .8,R 2.189, = 0.220, = .0;x 0.001; = F ,39 3, p 0.001; = F 2 .5,R 2.155, = 0.291, = ,39 3, F 3.143, = ,19 3, F ,39 1, p 2 = = ± = Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ise hwdn epnet aidevrnetlfcos eosre nrae iest nendophytes in aerial diversity in increased of microbiota observed diversity the We The factors. while factors. environmental characteristics environmental varied ae- chemical to to between soil microbiota response differences with endophytic no demonstrates correlated showed of study tissues roots responses our in the composition, microbiota in community endophytic roots in and differences tissues of the colonizer. rial assembly fungal to the to addition that selection In suggested stronger have research of roots our roots while summary, in microbes pools, microbiota In endophytic These propagule 2011). fungal 2007). Hyde, and Kirk, & bacterial & both colonized Guo, to (Cannon Sun, able saprobes (Xiang be saprophytism cosmopolitan and inhabitants are soil members be might Sporormiaceae 2015); al., et including taxa, identified related Soil first pool. significantly determined propagule tissue environmental fungi immigrating Sporormiaceae endophytic the the by by and of by restricted assembled composition is community selection largely roots, host The generally differential study. the have is present in by a might in soil However, that communities communities in fungal source. than bacterial the environmental species shaped less the the Microbial was Therefore, from pattern. tissues propagules air. opposite from aerial in an showed that in fungi than bacteria endophytic 2012). more endophytic al., of et of diversity Sun diversity the X. whereas 2010; the al., Interestingly, et fungi. Su transport and 2019; and inter-tissue al., ground and et (Fang in above tissues, communities biochemical various composition aerial pools in in Community and differences in difference propagule the roots the tissues environmental to with to contribute mechanisms distinct addition aerial limitation In coexisting tissues, and 2010). and aerial Hyde, colonizing root & and underground, Guo, between roots Su, communities 2013; between Gong, endophytic environments & Warren, in Lv, (Ma, differences plants reported have Studies Discussion 4 abiotic with correlation taxa level. significant showed fungal group except fungal of factors No environmental abundance roots. with The correlated positively 3). Dothideomycetes (Table community FOTU bacterial rormiaceae plant genera whole bacterial in bacterial of factors. among the environmental abundance correlation for and significant The tissues no taxa was positively aerial fungal There roots bacterial in of OM. in diversity plant with richness communities fungal whole correlated fungal The or negatively the The TN. and roots. with nega- TN and with trend with genus with correlated pH correlated correlated same negatively bacterial with positively communities the of correlated fungal showed and plant negatively richness communities roots whole richness bacterial that richness in the plant showed communities or whole that bacterial results abundance the communities, The endophyte The for 2). on level. TN (Table factors and species roots environmental pH fungal different with or of correlated level tively effect genus the bacterial richness assess at or to abundance used S5). genera). endophyte (Table was ANOVA fungal on higher GLM one-way for were factors with plant S4 environmental tested whole Table of treatments in radioactive and control fungi Effects the in and genera 3.7 in bacterial those bacterial more both than for was of environments communities level radioactive S3 genus fungal the Table at in and 5; diversity bacterial genetic (Fig. overall both control the distance in Meanwhile, in genetic S3 genera average Table that the the 5; Intriguingly, than (Fig. of ANOVA). environments genera one-way half fungal to than 29 proceeded genetic and more genera that genera among fungal Significant bacterial showed genera. and 51 results fungal bacterial of and diversity The all used bacterial genetic study. for were both the present genus for in certain levels in observed were radiation a population different differences in and microbial available control of ASVs within diversity differed all diversity among genetic model the “K80” evaluate on to based calculated distances Pairwise S . podzolica 583, F OTU Aporospora .schrenkianum K. (previously 8,soe infiatpeeec o h otin root the for preference significant showed 583, ceoimchrysogenum Acremonium FOTU Cupriavidus add podzolica Candida 9,fna genus fungal 199, a ieetbtenara ise n ot o ohbacteria both for roots and tissues aerial between different was and K . 7 Brevibacterium schrenkianum hc eaieycreae ihmdu radiation medium with correlated negatively which , sasi es Bbea&Rseoa 95 Liu 1975; Reshetova, & (Babjeva yeast soil a as ) .schrenkianum K. Saitozyma n wthdbtenedpyimand endophytism between switched and oiieycreae ihPadOM and P with correlated positively and .schrenkianum K. Neocamarosporium eeaetdb olmicrobial soil by affected were atzm podzolica Saitozyma atzm podzolica Saitozyma Researchers . n class and , Spo- , Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. Tsmthd(o -au n dniy h ebr fpyu soyoa(aantson;however, shown); not (data The Ascomycota roots. phylum in of dominance members and the abundance identity) the and extraordinary E-value analyse showed (low not mecha- which did matched inherent fungi, we OTUs the unassigned Besides, and environment. as diversity radiation-stressed identified of correla- genetic under OTUs the assembly in mechanisms ra- community investigate increase to drives under not and that answering did microbiota mutation nism We symbiotic when radiation-induced environments. plant ionizing extreme questions between the of additional tion under structure gave maintenance community and study the assembly present community investigate Nevertheless, to treatments. stress. first across aerial dioactive the level both species is composition community in at study fungal and fungi the Current level addition, of In class more treatments. composition at all were across community differences was roots networks all dramatic the in fungi showed bacteria at in co-occurrence of endophytic and increased differences Fungal roots of grassland modularity significant and bacteria. tissues structure observed and in endophytic We community decreased networks of levels. the connectance fungal radiation environments; that study, than radiation-stressed present than stress under the more fragmented drought in radiation under However, (2018) to stable al. UK. sensitive et less in Vries were communities. set fungal networks mesocosms and consequently bacterial bacterial and that in niche responses showed communities. root different microbial the evoked endophytic stressed radiation stable severely Environmental a in soil maintain communities in to endophytic sediments assembled of radionuclide yet, microbes diversity the commu- diverse High correspondence that microbial 2008). direct imply in Martiny, physiology might establish & and to roots phylogeny (Allison difficult between limited linkage is are the it related nities tested however, are convincingly diversity Mar- that redundancy; phylogenetic & studies and and (Allison because and species diversity stressed ecosystem High descriptive functional an 1996). radiation essential high Tilman, of at an 2020; to productivity al., as and roots et function, Diversity Delgado-Baquerizo stability, in diversity. 2008; the tiny, diversity genetic predict community population could increased feature, increased metrological the revealed from inherent also environments. apart an stressed study treatments as moderately current acts under diversity the community genetic the Meanwhile, higher maintain of Therefore, to fitness probability 2010). reduced assembly enhanced al., had community diversity diversity et of genetic (Markert environmentsmechanism genetic low rates with Nevo stressful in extinction populations community. under Increase and increased the 1996), organisms and stresses. Shannon, in biotic model & diversity (Lande and tested survival genetic population climatic, several in chemical, in increase thermal, diversity need in with genetic diversity genetic resulted higher on bacterial discovered stress effect its both Environmental (2001) and for investigated. radiation environments ionizing the be radioactive to structured to due that in mutations factor found However, dominant communities. was the fungal diversity was and radiation genetic rhizosphere. soil, intra-kingdom Higher the of communities. in factors the chemical endophytic competition various to roots, less of restrict presence the indicates the In which to Despite correlated. correlated, prone negatively less were are were members fungi correlations inter-kingdom and Meanwhile, co-occurrence fungi. bacteria The and bacteria level. of In niche globally. members bacteria the and fungi at wider between antagonism competition a strong prefer reported (2010). fungi (2018) we al. al. the that However, schrenkianum et et Conclusively, suggested Bahram species. Rousk study, (2009). had recent bacteria soil al. al. a with of In et et compared diversity Rousk sites growth Lauber diversity. the optimal of study fungal on for findings our and dependent range the pH of pH largely between with pH is correlation consistent pH. soil microbiota no is neutral with found bacterial This near the correlation root 9.6. at predicted negative of to pH peak significant recruitment soil 8.8 a Lauber, that a from attained 2018; stated showed ranged diversity al., (2009) that bacteria phylogenetic et al. (Fan endophytic et and assembly Lauber communities, of and 2010). bacterial Diversity al., structure soil et community of Rousk microbial composition 2009; microbiota. of Fierer, endophytic determinant & root associated major Knight, on endophytes Hamady, factors a in environment is of not pH effect and Soil larger environments indicates radioactive finding to This treatment tissues. control aerial w efudlmtditrcinbtenbcei n ug;hwvr hr a bacterial-fungal was there however, fungi; and bacteria between interaction limited found we , 8 .schrenkianum K. K. Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. alhn .J,Snaa,K,Fkym,J . cude .J,&Hlea .P 21) Bioconductor (2007). P. (2016). Kirk, P. & . S. P., analyses. Holmesa, Cannon, community & to J., reads P. raw McMurdie, From analysis: A., doi:10.12688/f1000research.8986.2 data J. Fukuyama, microbiome leaves for K., the workflow Sankaran, with J., associated B. communities Bacterial Callahan, (2013). J. of Bergelson, roots & the W., and M. approach Horton, powerful N., and Bodenhausen, practical a rate: discovery false testing. the multiple Controlling (1995). to Y. Hochberg, Nevada. microbiome. & county Y., Nye topsoil Benjamini, Site M., Test global P. Nevada the of Bodegom, flora of A., Vascular 51 function (1964). N. C. and Soudzilovskaia, J. Beatley, L., Structure from J. (2018). Anderson, P. Retrieved K., Bork, doi:10.1038/s41586-018-0386-6 S. . Graphics. Forslund, . F., n. . ”Grid” sp Hildebrand, podzolica candida M., - for Bahram, soil from species yeast Functions New (1975). S. 44 I. Miscellaneous Reshetova, & P., I. gridExtra: Babjeva, (2017). Fungalhttps://CRAN.R-project.org/package=gridExtra B. (2003). A. E. Herre, Auguie, 100 site. & tree. America, N., test tropical of Robbins, atomic a Z., States Nevada Maynard, in United I., the at damage E. rodents pathogen Rojas, limit D., some Kyllo, endophytes of C., Mej´ıa, distribution L. E., Ecological A. Arnold, (1963). E. D. communi- Beck, 44 microbial & Ecology, in M., redundancy D. and Allred, resilience, Resistance, (2008). H. doi:10.1073/pnas.0801925105 B. J. Martiny, & ties. D., S. Allison, References https://orcid.org/0000-0002-6875-4971 Sun Xiang Dr. https://orcid.org/0000-0001-8332-9378 Zhu Jing Dr. final the approved wrote and X.S. read authors J.Z., ORCID All analysis. H.L.Y. bioinformatics and L.J.Z. A.S. performed M.Y.G., from Q.Y.T., M.H. contributions manuscript. J.Z., X.S., significant research. with the work. manuscript performed laboratory the and and design project sampling the performed conceived Z.D.Z. and X.S., Supported J.Z., Institutes Non-profit of (KY2019021). contributions Activities Region Author Scientific Autonomous Agricultural Basic Uyghur of Xinjiang for Academy of Xinjiang Project Government in of the Special Platform of Project and Innovation Improvement Project Technology (nkypt005), (2017Q045), (31760009), of China Sciences China Capacity of of and Xinjiang Foundation Science in Science Science Agricultural Natural Young National for Cultivation by Talents supported Innovation was necessary work are research studies This Further plant). environments. the radioactive from under recovered symbiosis Acknowledgements was plant-microbe strain to knowledge no our (since expand unknown to still are fungi these 62,687 (6P2), 333-338 (2), rceig fteNtoa cdm fSine fteUie ttso mrc,105 America, of States United the of Sciences of Academy National the of Proceedings 1,2124 doi:10.2307/1933209 211-214. (1), rbdpi thaliana Arabidopsis ora fteRylSaitclSceySre -ehdlgcl 57 B-Methodological, Series Society Statistical Royal the of Journal uglFmle fteWorld the of Families Fungal 2) 54-55.doi:10.1073/pnas.2533483100 15649-15654. (26), . lsOe 8 One, Plos 2,e62.doi:10.1371/journal.pone.0056329 e56329. (2), 9 rceig fteNtoa cdm fSine of Sciences of Academy National the of Proceedings alnfr,U:CABI UK: Wallingford, . mrcnJunlo Botany, of Journal American 10Rsac,5 F1000Research, aue 560 Nature, 1,289-300 (1), Mikrobiologiia, 11512-11519. , 233-237. , 1492. , Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. hlu,M . rpet .W 20) h iest facaaadbcei nascainwt h roots the with association in bacteria and archaea of diversity The (2001). W. E. of Triplett, & K., M. Chelius, a,K,Wiehr,P,Glet .A,Si . a,Y,&Cu .(08.Si Hcreae ihthe with correlates pH wheat Soil of (2018). soils H. bulk Chu, and & rhizosphere Y., in Bai, communities Y., diazotrophic Shi, of process A., fields. assemblage J. and Gilbert, co-occurrence P., Weisenhorn, ecological of K., measure robust Fan, a as dissimilarity Compositional (1987). L. Belbin, distance & Site. R., Test P. Nevada Minchin, the P., of D. Faith, soils from culture in isolated Fungi (1960). M. 52 L. Shields, & W., L. Durrell, B. Singh, . networks. ecological . bipartite . Fr biomes. D., F., across F. C. functions Alfaro, Dormann, ecosystem S., drive Abades, biodiversity J., benefi- soil 4 D. of Evolution, Eldridge, on elements C., Multiple Trivedi, effects (2020). B., research. K. P. change network Reich, complex Climate M., for package Delgado-Baquerizo, software (2010). igraph A. The (2006). Systems Sessitsch, T. Complex Nepusz, & & G., D., Csardi, V. A. G. 6941.2010.00900.x interactions M. plant–microorganism Heijden, cial S., Compant, atraadacaaars ot tmadla ise ntecmo ed hamtsasrls along australis, Phragmites reed, common the in endophytic of tissues structure leaf community and and diversity Y. in stem F. Shifts root, (2013). Bai, J. across . Gong, archaea . & . A., and Warren, T., bacteria F., H. X. Lumbsch, Lv, B., V., Ma, A. wild Kachalkin, Tremellomycetes. a the M., of of Groenewald, doi:10.1016/j.simyco.2015.12.001 classification microbiomes M., 85-147. phylogenetic Goeker, gut integrated M., an and Towards Q. Skin (2015). Wang, (2018). Z., C. X. P. Liu, cues. Watts, environmental & different T., to scale. pH respond Mappes, continental mammal soil E., the Tukalenko, of assessment at A., Pyrosequencing-based Lavrinienko, structure (2009). community N. bacterial Fierer, soil & 75 of in Microbiology, R., persistence predictor Knight, population a M., and Hamady, as adaptation L., in variation C. genetic Lauber, of role The environment (1996). changing S. from a fungi Shannon, endophytic & of R., Identification Lande, (2000). sequences. Y. rDNA C. applica- and E. - Liew, morphology & basidiomycetes on D., based for K. of Hyde, specificity D., effects L. enhanced Guo, Differential with rusts. primers and (2012). mycorrhizae ITS C. of (1993). 294X.1993.tb00005.x identification B. D. the T. Sutton, plant. to Bruns, & tion herbaceous & A., a M., Thawer, attacking Gardes, herbivores A., insect J. on Wearn, doi:10.1007/s00442-011-2151-5 fungi R., endophytic Eschen, foliar C., Tissue-specific (2019). A. H.-B. Gange, Zhang, & of X.-F., fungi Dong, Z.-P., endophytic Yang, environment. in J., variation Zhou, geographical L., Chen, and Y.-F., Miao, K., Fang, e mays Zea 4,6661 doi:10.2307/3756096 636-641. (4), olBooyadBohmsr,121 Biochemistry, and Biology Soil eeai,69 Vegetatio, L. 1-2.doi:10.1038/s41559-019-1084-y 210-220. , rnir nMcoilg,10 Microbiology, in Frontiers irba clg,41 Ecology, Microbial 1) 1152.doi:10.1128/AEM.00335-09 5111–5120. (15), 1695 , n,J,Bl J., und, ¨ 57-68 , vlto,50 Evolution, h pnEooyJunl 2 Journal, Ecology Open The tgn . rbr .(09.Idcs rpsadnl oes Analyzing models: null and graphs Indices, (2009). B. Gruber, & N., uthgen, ¨ 5-6.doi:10.1007/s002480000087 252-263. , 1,4447 doi:10.2307/2410812 434-437. (1), ESMcoilg clg,73 Ecology, Microbiology FEMS 8-9.doi:10.1016/j.soilbio.2018.03.017 185-192. , 99 doi:10.3389/fmicb.2019.02919 2919. , e htlgs,147 Phytologist, New irboe 6 Microbiome, grtn adenophora Ageratina 10 oeua clg,2 Ecology, Molecular -4 doi:10.2174/1874213000902010007 7-24. , 0.doi:10.1186/s40168-018-0595-0 209. , 617-630 , 2,1724 doi:10.1111/j.1574- 197-214. (2), n uglascain ihthe with associations fungal and 2,1318 doi:10.1111/j.1365- 113-118. (2), eooi,168 Oecologia, ple n Environmental and Applied tde nMclg,81 Mycology, in Studies iitn chinensis Livistona aueEooy& Ecology Nature InterJournal, 1023-1031. , Mycologia, , Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. hed,L . url,L . pro,A .(91.Peiiayosrain nrdoestvt falgae of radiosensitivity Site. on Test Site. Preliminary-observations Nevada (1961). Test of H. Nevada soils A. Sparrow, from within & fungi W., algae and L. terrestrial Durrell, M., of L. Distribution Shields, con- (1962). 49 F. A Botany, Drouet, of endophytes: control. & Journal process Fungal M., statistical L. and (1998). charting Shields, control quality J. for package T. R 11-17 an (1), Sullivan, qcc: (2004). & plants. L. Scrucca, M., host Helander, with H., interactions doi:doi.org/10.1146/annurev.ecolsys.29.1.319 S. of Faeth, tinuum Redman, K., soil. arable . Saikkonen, an Soil (2010). in . N. gradient Fierer, . pH . symbiosis. a . F., . across doi:10.1038/ismej.2010.58 G., communities habitat-adapted Beckwith, J. fungal Caporaso, L., via and C., bacterial Wright, Lozupone, plants L., C. M., B˚a˚ath, Lauber, J., in Hoy, C., Rousk, the P. tolerance V., Brookes, of E., E. Stress mosaic Volkenburgh, vegetation (2008). doi:10.1038/ismej.2007.106 shrub J., S. desert Henson, the R. J., of R. Canopy-coverage (1965). Rodriguez, C. Retrieved J. computing. Beatley, Site. statistical Test & Nevada for H., environment W. and Rickard, language A R: Gl (2016). http://www.R-project.org . Team. from . Core . Development P., tools. R Yarza, web-based and T., processing Schweer, data J., improved 41 project: Gerken, Research, database P., gene Yilmaz, RNA E., ribosomal SILVA microbiomes. Pruesse, and C., Endophytes Quast, properties: emergent 49 fungi, Phytopathology, Hidden of (2011). Review P. Annual Bayman, & A., analyses evolutionary Porras-Alfaro, and phylogenetics modern (2016). for H. environment Wagner, an . 5.0: R . ape in (2018). . K. B., Schliep, R. & https://cran.r-project.org E., O’Hara, Paradis, R., from P. Retrieved Minchin, package. P., ecology Legendre, Community R., ’vegan’: Kindt, K. Package G., Abarenkov, F. . taxonomic Blanchet, parallel . J., and Oksanen, . taxa D., dark handling Schigel, fungi: T., of identification Jeppesen, molecular classifications. J., for Bengtsson-Palme, database UNITE A., The Taylor, (2019). K.-H., 98 Larsson, America, of R., States Nilsson, United stress. the environmental of under Sciences diversity of Academy genome-phenome tional of Evolution (2001). E. Nevo, D. (2005). Nacci, 1.3-1. P. version . Murrell, package R . Research. . Agricultural for M., https://CRAN.R-project.org/package=agricolae Procedures J. from Statistical Retrieved T. agricolae: (2019). Jr, d. A., F. Mendiburu, Kuhn, environments. multiple S., in J. fitness doi:10.1186/1471-2148-10-205 Grear, and 205. R., diversity , Gutjahr-Gobell, genetic Population M., (2010). China. D. E. Champlin, northern A., of J. wetland 104 Markert, Microbiology, tidal Molecular marine and General a of in Journal gradient salinity a iifrais 35 Bioinformatics, D) 50D9.doi:10.1093/nar/gks1219 D590-D596. (D1), uli cd eerh 47 Research, Acids Nucleic clg,46 Ecology, Graphics R 6,5754 doi:10.2307/2439709 547-554. (6), 3,5658 doi:10.1093/bioinformatics/bty633 526-528. (3), 4,5459 doi:10.2307/1934886 524-529. (4), odn K hpa alCCPress Hall/CRC & Chapman UK: London, . 9-1.doi:10.1146/annurev-phyto-080508-081831 291-315. , clg,42 Ecology, D) 29D6.doi:10.1093/nar/gky1022 D259-D264. (D1), nulRve fEooyadSseais 29 Systematics, and Ecology of Review Annual 11 5,7978 doi:10.1007/s10482-013-9984-3 759-768. (5), 2,4041 doi:10.2307/1932103 440-441. (2), 1) 2364.doi:10.1073/pnas.101109298 6233-6240. (11), noi a euehe International Leeuwenhoek Van Antonie h SEJunl 4 Journal, ISME The m vltoayBooy 10 Biology, Evolutionary Bmc seJunl 2 Journal, Isme cnr .O 21) The (2013). O. F. ¨ ockner, rceig fteNa- the of Proceedings uli Acids Nucleic 1340-1351. , 319-343. , 404-416. , es 4 News, R American Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. kalidium-schrenkianum ionizing-radiation-on-the-bacterial-and-fungal-endophytes-of-the-halophytic-plant- page.pdf reactor. title nuclear damaged the of file structures Hosted containment Chernobyl: the from Fungi of (2000). regions T. 104 L. Research, inner Nakonechnaya, & the V., of V. Vember, mycobiota A., V. Zakharchenko, N., N. (Eds.), Zhdanova, communities. Oudemans fungal P. and & Radionuclides White, (2005). Ecosystem F. K. the J. Haselwandter, grass Dighton, toxic & J. A A., (2020). In V. Zakharchenko, Z. N., Nan, N. . Zhdanova, . . X., 448 Huang, J., Soil, White, and S., Chen, X., Wei, inebrians Z., package R Chen, sequences. X., biological Yao, of clustering https://cran.r-project.org/package=kmer alignment-free from fast Retrieved for package 1.0.0. R version an kmer: (2018). S. Wilkinson, ribosomal (Eds.), fungal White (2016). of T. H. & sequencing Wickham, Sninsky, direct J. and Gelfand, applications Amplification D. and (1990). Innis, methods M. J. to Taylor, In phylogeneics. & for S., genes Lee, RNA T., Bruns, D. T., R. White, Bardgett, . services. . ecosystem and . K doi:10.1111/j.1755-263X.2011.00217.x biodiversity for V., S., accidents Wagner, nuclear P., H. of Brandt, Gweon, Consequences J., Fischer, M., V., Girlanda, H. networks. Wehrden, H., fungal than Craig, drought M., under stable Bailey, less I., 9 are networks R. bacterial Griffiths, (2019). Soil W. D., (2018). C. T. Schadt, F. . (2002). Vries, . D. . B. Ripley, A., & M. N., Cregger, W. L., Venables, N. Engle, origin. K., soil Z. on Yang, depends among Z., diverge D. geographic Yip, microbiomes and R., Rhizosphere Host Morris, (2012). M., E. A. A. scale. Veach, continental Arnold, a & at D., fungi A. doi:10.3732/ajb.1100459 endolichenic Laetsch, 898-914. and J., endophytic Miadlikowska, of F., structure Lutzoni, M., J. PopulationU’Ren, Biodiversity: in (1996). fungi doi:10.2307/2265614 endophytic of D. composition Community Tilman, (2011). D. decomposition. K. in Hyde, role & their D., fungi and endophytic L. of Guo, forest. preference X., and mixed structure Sun, a Community (2012). in of D. plants L. fungi Guo, woody & endophytic three D., of of K. China Hyde, Response Q., steppe, Ding, (2010). X., Mongolia Sun, D. Inner K. in Hyde, removal & group doi:10.1007/s13225-010-0040-6 D., function L. plant Guo, mental Y., Y. Su, 03 doi:10.1038/s41467-018-05516-7 3033. , evsa iest euefrtesi uglcmuiyi aglnso otenChina. northern of rangelands in community fungal soil the for refuge diversity a as serves 2-3.doi:doi.org/10.1007/s11104-020-04440-4 425-438. , 1) 4112.doi:10.1017/S0953756200002756 1421-1426. (12), TidEiine. p 5-6) oaRtn L R Press CRC FL: Raton, Boca 759-768). pp. ed., Edition (Third vial at available glt:EeatGahc o aaAnalysis Data for Graphics Elegant ggplot2: irboe 7 Microbiome, p.3532.SnDeo Academic Diego: San 315-322). (pp. uglDvriy 47 Diversity, Fungal https://authorea.com/users/377448/articles/494122-effect-of- 6 doi:10.1186/s40168-019-0668-8 76. , uglEooy 5 Ecology, Fungal oenApidSaitc ihS with Statistics Applied Modern ouu trichocarpa Populus versus h uglCmuiy-IsOgnzto n oein Role and Organization Its - Community Fungal The 12 1,8-5 doi:10.1007/s13225-010-0086-5 85-95. (1), mee,K,Kemre . otr,P (2012). P. Hostert, . . . T., Kuemmerle, K., ummerer, ¨ csse stability. ecosystem 5,6462 doi:10.1016/j.funeco.2012.04.001 624-632. (5), ln-otgntpsadceoye,btit but chemotypes, and genotypes plant-host pigrVra e York. New Springer-Verlag : mrcnJunlo oay 99 Botany, of Journal American osrainLtes 5 Letters, Conservation uglDvriy 43 Diversity, Fungal Fut d) e ok Springer York: New ed.). (Fourth clg,77 Ecology, aueCommunications, Nature tp grandis Stipa C rtcl:aguide a protocols: PCR crtruncatum Acer 2,350-363. (2), Achnatherum 1,93-101. (1), Mycological 2,81-89. (2), oexperi- to Plant (5), Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 13 Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 14 Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 15 Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 16 Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. otdfile Hosted kalidium-schrenkianum ionizing-radiation-on-the-bacterial-and-fungal-endophytes-of-the-halophytic-plant- 2.pdf Table file Hosted kalidium-schrenkianum ionizing-radiation-on-the-bacterial-and-fungal-endophytes-of-the-halophytic-plant- 1.pdf Table file Hosted vial at available at available https://authorea.com/users/377448/articles/494122-effect-of- https://authorea.com/users/377448/articles/494122-effect-of- 17 Posted on Authorea 20 Nov 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160587754.47033775/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. kalidium-schrenkianum ionizing-radiation-on-the-bacterial-and-fungal-endophytes-of-the-halophytic-plant- 3.pdf Table vial at available https://authorea.com/users/377448/articles/494122-effect-of- 18