Chapter 1 Introduction and Literature Review

The current research project investigated the breed differences in the biochemical (changes to plasma fatty acid composition) and transcriptional (changes to white blood cell inflammatory-related gene expression) responses to n-3 fatty acids from two dietary sources in two different breeds of dogs. Beagles and greyhounds were chosen for their differences in morphology and propensity to obesity. In addition to this, changes in body composition were investigated to correlate with the biochemical and transcriptional responses.

This chapter is divided into five subsections: 1) Lipids, 2) Fatty Acids Regulate Gene

Expression, 3) Canine Obesity, 4) Assessment of Body Composition and Computed

Tomography, and 5) Importance of Canine Breed Differences in Lipid or Fatty Acid

Metabolism. It concludes with the Research Plan and the Organisation of Thesis Chapters.

1.1 Lipids

Lipids are organic compounds that are insoluble in water and are important for the normal function of organisms as they store energy, form an important structural component of cell membranes and also function as enzymes, co-factors, hormones and intracellular messengers

(Rifai et al., 1999). Using a comprehensive system of classification of lipids proposed in

2005, lipids from biological tissues are classified into eight categories (Fahy et al., 2005): fatty acids, glycerolipids (triglycerides), glycerophospholipids, sphingolipids, sterol lipids

(cholesterol), prenol lipids, saccharolipids and polyketides.

From a clinical perspective and for the purpose of this study, four lipid categories are described: fatty acids, cholesterol, triglycerides and phospholipids. Fatty acids are simple lipids consisting of hydrocarbon chains with a carboxyl group at one end and a methyl group at the other end. They are divided into saturated fatty acids containing no carbon-to-carbon double bonds, monounsaturated fatty acids containing one double bond or polyunsaturated fatty acids (PUFA) containing more than one double bond in the carbon-to-carbon (acyl) chain. Cholesterol, which is the main sterol in animal tissues, is mainly obtained through dietary intake or synthesised endogenously by the liver and other tissues. Cholesterol plays a vital role in bile acid metabolism and synthesis of steroid hormones and vitamin D.

Triglycerides are the most common and efficient form of stored energy in mammals, derived from both dietary sources and through hepatic production. Phospholipids are present as a bimolecular sheet with fatty acid chains in the interior of the bilayer, and are defined as the

“fluid mosaic model” It is a major component of all cell membranes (Dietschy & Wilson,

1970; Rifai et al., 1999; Simopoulos, 1991)

Being insoluble in water, lipids are transported in the lymphatic and blood circulation as macromolecular complexes known as lipoproteins, which are spherical structures (Figure 1.1) consisting of a hydrophobic core containing lipids (either triglycerides and/or cholesterol esters), and an amphiphilic (both hydrophobic and hydrophilic) outer layer of phospholipids, free cholesterol, and proteins that form a protective envelope surrounding the lipid core

(Ginsberg, 1998). Lipoproteins are classified based on their physical and chemical characteristics (size, density and composition) and canine lipoproteins are classified into four major types: chylomicrons, very low-density lipoproteins (VLDLs), low-density lipoproteins

(LDLs) and high-density lipoproteins (HDLs) (Barrie et al., 1993; Bauer, 1996, 2004). The

HDLs are further classified into HDL1 (specifically for the canine species), HDL2 and HDL3

(Xenoulis & Steiner, 2010). Apolipoproteins (or apoproteins) are a component of lipoproteins and are responsible for directing the lipoprotein to various sites of metabolism. It is the enzyme lipoprotein lipase (LPL), which is located on the luminal surface of the capillary endothelial cells, that hydrolyses triglycerides within lipoproteins into free fatty acids, mono- and diglycerides, and glycerol (Ginsberg, 1998; Rifai et al., 1999).

The liver is the centre for lipid metabolism in the body (Nguyen et al., 2008). Canine lipid metabolism occurs via two pathways: endogenous and exogenous pathways. The endogenous pathway is associated with metabolism of endogenously produced lipids; whereas, the exogenous pathway is associated with lipids from the diet (Bauer, 2004). The largest and least dense lipoprotein particles are the chylomicrons that transport dietary fat (triglycerides) from the small intestine via the lymphatics and general circulation to various sites of metabolism; whereas, the other lipoproteins transport lipids of endogenous origin (Bauer,

2004). Chylomicrons transport dietary triglycerides to the capillaries of adipose tissue and skeletal muscle, where they are exposed to the LPL enzyme, which has been activated by the lipoprotein, Apo C-II, and this hydrolyses the triglycerides into glycerol and free fatty acids

(Goldberg et al., 1990). The fatty acids produced are taken by the adipocytes for storage or made available as fuel for energy (Flatt, 1995). The remaining part of the chylomicron is a remnant particle, rich in cholesterol esters, which then delivers cholesterol to the liver.

Oxidation of fat is determined by the deficiency in the total energy intake in relation to the energy expended and not determined by fat intake (Fernandez-Quintela et al., 2007), and hence excess fat consumed would result in storage and increased adipose tissue.

Figure 1.1: Structure of a lipoprotein particle. Hydrophobic cholesterol esters and triglycerides are shielded by a polar coat of phospholipid, unesterified (free) cholesterol and special proteins called apolipoproteins. IDL, Intermediate density lipoproteins (size is between VLDL and LDL) (Thiruvelan, 2010).

1.1.1 Polyunsaturated fatty acids

Various commercial PUFA oil supplements are marketed for therapeutic veterinary use and these normally contain a combination of n-3 and n-6 fatty acids in different amounts, depending on the sources of the oil used by the manufacturer (Bauer, 1994). In plant sources, alpha-linolenic acid (ALA) is found in leaves as glycolipids, and as triacylglycerol in certain seed oils, which include rapeseed, flaxseed, perilla seed, chia seed, and in beans, which include soybeans and navy beans, and in nuts (walnuts) (Goncalves et al., 2014; Goyal et al.,

2014; Kim et al., 2014; Rajaram, 2014; Raper et al., 1992; Shim et al., 2014; Sinclair et al.,

2002). Alternatively, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are derived primarily from marine sources such as fish oil (FO) and marine algae (Deckelbaum &

Calder, 2015; Salem & Eggersdorfer, 2015; Srigley & Rader, 2014). Finally, linoleic acid

(LA) and γ-linoleic acid (GLA) are found in seeds, evening primrose or borage plants, and also in blackcurrant seeds and certain fungi.

Polyunsaturated fatty acids are described by three main criteria and specified by the notation

A:Bn-C, wherein A denotes the number of carbon atoms present, B denotes the number of double bonds and C denotes the position of the first double bond counted from the methyl end of the molecule (Figure 1.2). The PUFA of n-9 series can be synthesised by de novo synthesis in the mammalian body from acetate precursors; however, this is not possible with fatty acids of the n-3 and n-6, making it an essential dietary requirement (Simopoulos, 1999).

It is also not possible for mammals to synthesise LA and ALA, as they lack the required desaturase enzymes which are found only in plants; 12-desaturase that converts oleic acid to

LA and 15-desaturase that converts LA to ALA (Calder, 2001). In mammals, however, ALA and LA deposited in the different lipid fractions get metabolised as shown in Figure 1.2, wherein all the fatty acids compete for the same enzymes for the alternate steps of desaturation and chain elongation (Sprecher, 2002). However, it must be noted that the position of the first double bond from the methyl end is maintained and any addition occurs only at the carboxyl end of the molecule. Therefore, fatty acids of one series cannot be converted into another; LA cannot be converted to EPA.

n-6 fatty acids n-3 fatty acids

Common n-6 structure Common n-3 structure CH3-C-C-C-C-C=C-C-C=C- CH3-C-C=C-C-C=C-C-C=C-

Linoleic acid α-linolenic acid (LA, 18:2n-6) (ALA, 18:3n-3) Δ6-desaturase γ-linolenic acid Stearidonic acid (GLA, 18:3n-6) (SDA, 18:4n-3) Elongase (ELOVL5) Dihomo-γ-linolenic acid Eicosatetraenoic acid (DGLA, 20:3n-6) (ETA, 20:4n-3) Δ5-desaturase Arachidonic acid Eicosapentaenoic acid (AA, 20:4n-6) (EPA, 20:5n-3) Elongase (ELOVL2) Docosatetraenoic acid Docosapentaenoic acid (22:4n-6) (DPA, 22:5n-3) Elongase (ELOVL2) Tetracosatetraenoic acid Tetracosapentaenoic acid (24:4n-6) (TPA, 24:5n-3) Δ6-desaturase Tetracosapentaenoic acid Tetracosahexaenoic acid (24:5n-6) (THA, 24:6n-3) β-oxidation Docosapentaenoic acid Docosahexaenoic acid (22:5n-6) (DHA, 22:6n-3)

Figure 1.2: Common structure and metabolism of n-6 and n-3 fatty acids. Adapted from Bauer (1994), and Simopoulos (1991).

1.1.2 Metabolism of PUFA

The conversion of LA and ALA to long chain PUFA occurs in the liver (Figure 1.2), wherein all the conversion steps occur in the endoplasmic reticulum except for the final step that results in the formation of DHA (Sprecher, 2002). There is competition between the two families of PUFA (n-3 and n-6 fatty acids), as they are metabolised by the same pathway. The initial step is rate limiting as the enzyme Δ6-desaturase has greater affinity for ALA compared to LA; however, the presence of higher concentrations of n-6 fatty acids in the cells

can result in a higher conversion rate for n-6 fatty acids. The enzyme Δ6-desaturase converts dietary LA to gamma linolenic acid (GLA, 19:3n-6) by the addition of a double bond at Δ6 position, which is then elongated by the addition of two carbon atoms by elongase to dihomo-

γ-linolenic acid (DGLA), and finally by desaturation at the Δ5 position (Δ5-desaturase) to form arachidonic acid (AA). Similarly, the n-3 fatty acids compete with LA for the same metabolic enzymes, and dietary ALA is converted by the addition of a double bond at the Δ6 position by the Δ6-desaturase enzyme to stearidonic acid (SDA) followed by elongation to eicosatetraenoic acid (ETA), and then desaturation at the Δ5 position (Δ5-desaturase) to EPA.

Further conversion of EPA to DHA involves a further four steps, which include the following: (step i) elongation to docosapentaenoic acid (DPA), (step ii) another elongation to tetracosapentaenoic acid (TPA), (step iii) desaturation (Δ6-desaturase) to form tetracosahexaenoic acid (THA), which is then translocated from the endoplasmic reticulum to the peroxisomes, wherein (step iv) limited β-oxidation removes two carbons (chain shortening) to give DHA. Alternatively, EPA and DPA can be synthesised from DHA by retro-conversion due to the limited peroxisomal β-oxidation. The β-oxidation is a process wherein ALA is metabolised and expired as CO2, and it was demonstrated in rats fed labelled

ALA that the higher the proportion of PUFA in the diet, higher was the rate of β-oxidation

(Pan & Storlien, 1993).

Humans have limited ability to convert ALA to EPA, and little to no conversion of ALA to

DHA occurs (Burdge & Calder, 2005). It appears that this might be the same for dogs. When dogs were fed a commercial diet supplemented with whole ground flaxseed (10.1% of the total fatty acid was ALA; weight/weight) for 84 days, plasma EPA levels increased within four days, and steady levels were achieved at 28 days. DPA levels were also increased, but there was no accumulation of DHA (Bauer et al., 1998). Limited conversion rates have also

been observed in other species, such as rodents (Woods et al., 1996) and guinea pigs (Fu &

Sinclair, 2000). However, as this project did not aim to investigate the metabolic pathways of n-3 fatty acids, a detailed review of the literature pertaining to metabolic responses of the n-3 fatty acids has not been included.

The health benefits of n-3 fatty acids have been investigated in the canine species and have been summarised in a number of reviews (Bauer, 1994; Bauer, 2011; Bauer, 2008; Campbell,

1993). This review will discuss beneficial aspects pertaining to inflammation and obesity.

1.1.3 Modulation of the immune response by fatty acids

The immune system has two aspects of immunity, non-specific (innate or natural) or specific

(acquired or adaptive), which function to protect organisms against infectious environmental agents and other noxious cellular threats. The immune system distinguishes between the body’s own antigens and foreign ones, and this permits tolerance to self-antigens. The cells of the immune system originate in the bone marrow and circulate in the bloodstream. Some cells have the capacity to retain the memory of the threat to the immune system to initiate a rapid response on re-infection. The two types of immunity have been summarised in Figure 1.3.

1.1.3.1 Composition of the cell membrane

In addition to providing energy for the cells, fatty acids alter the cell membrane phospholipids, thereby contributing to the change in the physical and functional properties of the cell membrane. For instance, in human studies, when AA intake was increased, the concentration of AA also increased in the mononuclear cells (Thies et al., 2001). In other human studies, when ALA intake was increased, only the EPA content in the mononuclear cells increased and not DHA (Healy et al., 2000). Further, it has been demonstrated that

increases in the n-3 fatty acid content in the immune cells occurs at the expense of the n-6 fatty acids (Johnson et al., 1982).

Innate Immune Response Acquired Immune Response

Physical and chemical Skin, mucous membranes Cutaneous and mucosal barriers immune systems

Cells Phagocytes (macrophages, Lymphocytes (B and T cells) neutrophils, natural killer cells)

Soluble mediators Macrophage-derived Lymphocyte-derived cytokines (eg. IL1, IL6, cytokines (eg. IL2, IL4, IL5, TNFα, IFNα) IL6, IL10, IFNγ)

Recognition specificity Recognition of crude Recognition of specific molecular patterns (eg. Toll- microbial and non-microbial like receptors) antigens (eg. T-cell receptor)

Memory No Yes

Circulating effector Complement, acute phase Antibodies molecules reactants

Figure 1.3: A summary of the differences in the two types of immunity. Adapted from Miller and Raison, (2008)

1.1.3.2 Eicosanoid synthesis

Fatty acids also act as substrates of inflammatory mediators known as eicosanoids (Sumida et al., 1993), which are hormones that are derived from 20-carbon PUFA (GLA, AA and EPA) and liberated from the cell membrane phospholipids (Figure 1.4). For eicosanoid synthesis to occur, the precursor fatty acids (i.e. AA, EPA and DGLA) need to be mobilised from the cell membrane phospholipids and this usually occurs through the enzyme phospholipase A2

(Dusting & Stewart, 1990). Eicosanoids include prostaglandins (PG), thromboxanes (TX) and prostacyclins (PGI2) – together termed as prostanoids – as well as leukotrienes (LT), lipoxins

(LX), hydroperoxyeicosatetraenoic acids (HPETE) and hydroxyperoxyeicosapentaenoic acids

(HPEPE). The metabolism of the precursors occurs by either one of the two enzyme systems: cyclooxygenase, which yields PG, TX, PGI2, and the 5-, 12-, or 15-lipoxygenases which yields LX, HPETE and HPEPE (Calder, 1998). Macrophages are significant sources of eicosanoids, as they possess both cyclooxygenase and lipoxygenase, and AA fatty acids are found in the membrane phospholipids of macrophages and lymphocytes. Macrophages are involved in influencing the intensity and duration of the immune response and, therefore altering the macrophage eicosanoid production will modulate immune function (Calder,

2006, 2015; Honda, 2014; Honda et al., 2015).

Depending on the type of the fatty acids and enzyme systems, the type of eicosanoids will also vary in their biological function and potency. The cyclooxygenase enzyme (COX) metabolises AA fatty acids into the 2-series PG and TX, while lipoxygenases enzymes metabolize AA into 4-series LT (LTB4, LTC4, LTD4, LTE4, 12 HETE, 15 HETE) (Lewis et al., 1990). On the other hand, the eicosanoids derived from EPA are the 3-series PG and TX and the 5-series LT, and these products do not have the same biological properties as the ones derived from AA. For instance, it was found that LTB5 derived from EPA was less active in the chemotactic and aggregatory properties in the neutrophils compared to LTB4 derived from AA (Goldman et al., 1983). However, contradictory to the present belief that all mediators derived from AA are pro-inflammatory is the research finding that reported PGE2 derived from AA to possess both pro- and anti-inflammatory actions (Serhan et al., 2003).

When EPA was incorporated into the cell membranes through increasing intakes of an n-3 rich diet, it has been found to result in reduced production of AA derived eicosanoids. This was due to EPA inhibiting the release of AA from phospholipids by phospholipase A2, thereby reducing the availability of AA as a substrate which then results in the reduced synthesis of AA derived eicosanoids and this has also been supported by animal studies

(Peterson et al., 1998). Similarly, DGLA competes with AA for cyclooxygenase and results in the production of 1-series PG and TX, thereby reducing the production of AA derived eicosanoids (Manku et al., 1988).

Figure 1.4: Oxidative metabolism of arachidonic acid and eicosapentaenoic acid by the cyclooxygenase and 5-lipoxygenase pathways (Simopoulos, 2002).

1.1.3.3 Resolvins

Both EPA and DHA (Figure 1.5) give rise to resolvins through the pathways that involve the cyclooxygenase and lipoxygenase enzymes (Serhan et al., 2000). The resolvin E1 derived from EPA was demonstrated to be anti-inflammatory in mice with chemically induced colitis

(Arita et al., 2005) and its synthesis was reported to have increased by feeding FO in laboratory rodents (Hong et al., 2003). The discoveries of resolvins from DHA indicate that

DHA may be as important as EPA in the anti-inflammatory role.

Figure 1.5: Outline of the pathway of synthesis of resolvins and related mediators from EPA and DHA. COX, cyclooxygenase; HpDHA, hydroperoxydocosahexaenoic acid; HpEPE, hydroperoxyeicosapentaenoic acid; LOX, lipoxygenase; LT, leukotriene; PG, prostaglandin; Rv, resolvin; TX, thromboxane (Calder, 2010)

1.1.4 Fatty acid analysis

Analysis of the fatty acids in biological or food samples involves the following steps: extraction of the fat from the samples either by acid- or base-hydrolysis, which causes the complete breakdown of the food matrix and the release of fat, followed by the ether extraction of the released fat, transesterification of fatty acids to fatty acid methyl esters

(FAME) and analysis of the FAME by gas chromatography (GC) to obtain the fatty acid profile (Ratnayake et al., 2009).

The detailed procedure followed in this project has been described in Chapter 2 and determines only the total fatty acid composition of the plasma lipids. This differs from the analytical technique used for lipid analysis of biological specimens in a clinical setting where there might be a need to examine the fatty acid composition of lipid classes (phospholipids, triglycerides and cholesterol esters) in plasma, serum or other tissues, which would require isolation of the lipid classes first and then analysis of their fatty acid composition using thin layer chromtography. Such an approach has been reported in other dog studies (Bauer et al.,

1998; Dunbar et al., 2010) that investigated the accumulation of n-3 fatty acids in the serum samples. Serum is prepared from whole blood following a clotting process, while plasma is

obtained from whole blood in the presence of an anticoagulant, which deactivates the coagulation factors and prevents the formation of clots. Because of the differences in the preparation method, and also because it is not strictly possible to control the in-vitro clotting process, it is possible that the changes that can occur in the lipid metabolism within the body, could be masked by the method used to extract serum. Thus it is likely there will be differences between plasma and serum, as reported by Ishikawa et al. (2014).

Erythrocyte membranes composed of fatty acids (approximately 45%), various phosphatides and glycolipids, and determining the erythrocyte fatty acid concentrations provides information about the metabolic functions within the cell, as well as the long term dietary intake and the composition of adipose tissue. Plasma fatty acids are good indicators of recent dietary intake as well as the adipose tissue composition, and studies have been able to measure the very small differences in circulating fatty acid levels and cellular membrane components by measuring plasma and erythrocyte specimens simultaneously (Sun et al.,

2007). This project used fasted samples, as it has been reported that fasting in humans results in the marked increase of plasma free fatty acids as a result of the breakdown of the triglycerides stored in the adipose tissue (Cahill Jr, 1970).

1.2 Fatty Acids Regulate Gene Expression

Polyunsaturated fatty acids regulate the expression of genes in the white blood cells (WBCs) through the activation of two main factors: nuclear receptor κB (NF-κB) and peroxisome- proliferator-activated receptor (PPAR). Therefore, the following sections focus on these two families of genes.

1.2.1 Nuclear receptor κB

NF-κB is a transcription factor that is known to regulate genes involved in inflammation and immunity (Tak & Firestein, 2001) and is activated by cellular stimulation, which include signals related to stress or pathogens. The NF-κB family consist of five members, namely

NF-κB1 (p50/p105), NF-κB2 (p52/p100), p65 (RelA), RelB, and c-Rel (Chen et al., 1999).

Under normal conditions, it is found in the cytoplasm as a heterodimer complex retained with its inhibitory protein IκB (inhibitor of NF-κB). When cells are stimulated by inflammatory cytokines, or in response to proinflammatory signals, IκBα isoform is phosphorylated by IκB kinase at specific serine residues and degraded. The IκBα phosphorylation dissociates the dimer, which then liberates and allows NF-κB to enter the nucleus, where it activates the target genes (Baldwin, 1996). The IκBα gene has three NF-κB binding sites in its promoter region, which results in its higher expression when NF-κB is activated (Ito et al., 1994).

PUFA can inhibit pro-inflammatory cytokines through inactivation of the NF-κB signal transduction pathway, as demonstrated in murine macrophages (Novak et al., 2003). Contrary results were obtained when saturated fatty acids induced NF-κB activation, which in turn promoted inflammatory changes as demonstrated in adipocyte and macrophage interactions

(Suganami et al., 2007). Therefore, different types of PUFA can have differential effects on the NF-κB receptors, and this could then regulate the genes involved in inflammation and immunity differently.

1.2.2 Peroxisome-proliferator-activated receptor

The peroxisome proliferator-activated receptors (PPARs) belong to the nuclear receptor superfamily and have three isoforms (PPARα, -γ, and -β/δ) that are encoded by separate genes (Berger & Moller, 2002). These receptors are ligand-dependent, wherein they regulate

target gene expression by binding to specific peroxisome proliferator response elements

(PPREs) in the enhancer sites of the regulated genes. The mechanism of gene transcription is similar in all the subtypes of PPAR, wherein the process of transcription begins with the ligands (both endogenous and exogenous) binding to the PPAR-γ receptor. The ligand bound

PPAR then heterodimerises with retinoid X receptor (IJpenberg et al., 1997), which binds to the promoter region of the PPRE using co-activators such as steroid receptor co-activator and the PPAR binding protein with histone acetylase activity (Zhu et al., 1995). This initiates the sequence of events leading to the upregulation of various genes involved in different biological processes including inflammation (Kota et al., 2005). In the free state, it has been shown that the heterodimerised nuclear receptor associates with co-repressors containing histone deacetylase activity, where the deacetylated state of histone results in inhibition of transcription (Xu et al., 1999a).

Eicosanoids and their precursors synthesised from fatty acids can activate PPAR in WBCs

(Kliewer et al., 1997; Krey et al., 1997). For the beneficial effects of PPAR activation, it has been reported that in the THP-1 cells, the activation of PPAR-γ by PUFA reduced the production of pro-inflammatory mediators (Zhao et al., 2005). Similar to NF-κB activation, different types of PUFA, i.e. GLA, AA and EPA as well as saturated and monounsaturated fatty acids are capable of activating PPAR (Xu et al., 1999b), which could impact the expression of downstream genes in the pathway.

1.2.3 Genes of interest in the current study

This project aimed to investigate the transcriptional response of two groups of genes: cytokines (interleukin IL1β) and heat shock proteins (HSP90, HSP70). Several other genes were included in the gene expression analysis initially (as mentioned in Chapter 2: General

Materials and Methods); however, these were not detected in the white blood cell samples in the study and hence were not analysed further.

1.2.3.1 Cytokines (Interleukin IL1β)

Cytokines are primarily protein molecules with a molecular weight ranging between 8 and

30kDa and are produced in all tissues and cells. The function of cytokines comes into effect when the cells undergo a physiological challenge, such as a tissue trauma or an infection, wherein cytokines play a role in the defense and repair of tissues. However, when tissues are severely challenged, there is an increased production of cytokines into the blood stream, which creates an imbalance in the normal homeostasis (Akira et al., 1990). Cytokines include several families, of which one of them is the interleukins. Further, interleukins contain several families, of which one of them is IL1. The IL1 family of cytokines is composed of proteins encoded by different genes: 1) IL1α, 2) IL1β, 3) IL1 receptor (IL-1R) and antagonist

(IL-1Ra), and 4) two IL-1R accessory proteins (IL-1R AcP I and II) (Dinarello et al., 2010).

The first cells to respond to a trauma or an infection are the cells of the monocytic lineage.

The classic stimulus would be a bacterial endotoxin or similar factors that activate the toll- like receptors (TLR) on the cell surfaces that trigger the complex signal transduction pathway, which then leads to the activation of NFκB, and eventually resulting in the transcription of cytokines IL1, IL6 and tumour necrosis factor (TNF) (Aderem & Ulevitch,

2000). IL1β is a cytokine that is pro-inflammatory in nature and produced by the blood monocytes, tissue macrophages, dendritic cells, B-lymphocytes and natural killer cells. The inactive form of IL1β (pro-IL1β) needs to be activated by intracellular cysteine protease

(Caspase-1) to its active form. Caspase 1 can be activated by an intracellular protein complex, i.e. inflammasome (Martinon et al., 2009).

The expression of the cytokine gene could be low or undetectable in normal conditions, which could then rise moderately after a specific stimulation that is physiological in nature, becoming highly elevated in a disease condition (Vitkovic et al., 2000). The effect of IL1β on immune function could also be indirect, wherein IL1β induces the synthesis of inflammatory mediators through inducing the gene expression and synthesis of COX-2 and type 2 phospholipase A, and these resultant products could then affect immune response (Vichai et al., 2005). Another effect of IL1β is its ability to increase expression of adhesion molecules that then mediate the infiltration of inflammatory cells from circulation into the extravascular space, and finally into tissues resulting in the chronic inflammation of the tissues (Marković et al., 2002). Thus, it can be speculated that the feeding of PUFA would influence the activity of genes, such as IL1β, involved in inflammatory and/or immunity related responses.

1.2.3.2 Heat shock proteins

Heat shock proteins (HSP), or stress proteins, are highly conserved and primitive molecules that present in all cellular compartments of all organisms. These proteins range in size from 7 kDa to 110 kDa and are categorised into families based on their approximate molecular weight. For example, 90 kDa protein is recognized as HSP90 and, similarly 70 kDa protein as

HSP70. Initially, heat shock proteins (as the name defines) were known to be expressed in response to increased environmental temperature (heat stress); however, it is now also known to be induced by other kinds of cellular insults, which include infection, inflammation, toxic chemicals, hypoxia, starvation or any other stress that could result in the protein being unfolded and misfolded, or in the aggregation of new-synthesised unwanted proteins (Ellis &

Van der Vies, 1991). Some HSP molecules, such as HSP90, are primarily expressed at high levels, while some others, such as HSP70 are induced to high levels in response to cellular stress.

HSP gene transcription is regulated by the interaction of the transcription factor, known as heat shock factor (HSF), with the heat shock element (HSE) in the promoter region of the

HSP gene. In an unstressed cell, HSF is present in both the cytoplasm as well as the nucleus in a monomeric form with no DNA binding activity. In response to a stress, especially heat,

HSF assembles into a trimer within the nucleus and binds to the HSE, which is the 5’ flanking sequence of the HSP gene, and becomes phosphorylated. This phosphorylation could modulate its transcriptional activity (Sarge et al., 1993). The resultant transcriptional activation of the heat shock genes can then lead to increased levels of heat shock proteins and the formation of a HSF and HSP complex. Normally, the cellular insult is transient, but if prolonged could affect protein homeostasis and cellular functions. For maintaining homeostasis, a negative regulation takes effect wherein HSF activity is negatively regulated by the binding of HSP70 to its transactivation domain, and thereby repressing the HSP gene transcription. Another mechanism is also reported wherein HSP binding factor (HSPB) interacts with the active trimeric form of HSF and HSP70, thereby inhibiting the capacity of

HSF to bind with DNA.

Heat shock proteins have also been reported to be immunodominant molecules, as in infections and also in other conditions such as cancer, diabetes and arthritis. It is still unclear whether all the cells respond to the stress in an identical manner and whether the responses vary with the type of stress. Literature evidence supports the knowledge that obesity driven inflammation promotes insulin resistance, which in turn reduces the expression of HSPs

(HSP70), resulting in tissue damage and accumulation of harmful proteins. This, in turn, results in further damage and decline of anti-inflammatory HSPs that allow inflammation to progress (Chung et al., 2008). In a study conducted by Madrigal-Matute (2010), it was demonstrated that HSP90 was over expressed in the plaques and serum of patients with

atherosclerosis, and that HSP90 inhibitors could reduce inflammation in atherosclerosis in humans. Based on a study conducted in female dogs, it was shown that HSP90 had high expression and was involved in canine mammary gland carcinogenesis (Badowska-

Kozakiewicz & Malicka, 2012). The pro-inflammatory function of the HSP was supported by the evidence that HSP induces the production of pro-inflammatory cytokines such as TNF,

IL1β and IL6, mediated through the TLR pathway leading to the activation of the NF-κB receptor (Wallin et al., 2002).

1.2.4 Polyunsaturated fatty acids regulate gene expression in the white blood cells

Polyunsaturated fatty acids have been shown to regulate the expression of genes in the WBCs through the activation of two main factors, NF-κB and PPAR. In humans, supplementation of

DHA-rich-FO for two months downregulated genes related to signal transduction in the lymphocytes, while HSP90 and HSP70 were upregulated (Gorjao et al., 2006). However, no effect was seen on the expression of inflammatory cytokines such as IL4, interferon gamma

(IFN-γ) and transforming growth factor beta (TGF-β) in the peripheral mononuclear cells

(PMNC) of healthy dogs and dogs with atopic dermatitis (Stehle et al., 2010). On the other hand, when Jurkat cells were treated with either EPA or DHA, both DHA and EPA upregulated cytokines and related receptors (Verlengia et al., 2004). However, these two fatty acids may not show varied ability to alter the expression of these genes; for example tumour necrosis factor receptor (TNFR-β) gene was upregulated 32.1 folds by DHA while only 5.6 folds by EPA. Therefore, the effect of even same type of n-3 fatty acids can have different levels of impact on the expression of inflammation-related genes.

1.3 Canine Obesity

Obesity, an increasing problem in pet dogs, is defined as excessive accumulation of adipose tissue in the body (Laflamme, 2006). It has been proposed that dogs can be categorised as being either overweight or obese, based on their body weight (BW); a 15% increase above the normal weight being overweight and a 30% increase being obese (Burkholder & Toll,

2000). These criteria were not confirmed through extensive epidemiological studies, however, and hence a definition of the optimal body weight is limited in dogs (German,

2006a).

1.3.1 Incidence

The reported incidence of canine obesity varies between countries, and this has been summarised in the Table 1.1. Collectively, data suggest that the incidence has increased over time within the same country and also across countries.

1.3.2 Breed Predisposition

Historically, some breeds have been recognised as having a greater propensity to be obese.

Specific breeds have been identified as having a higher incidence of obesity, suggesting that certain breeds are more genetically prone to developing obesity compared to others (Edney &

Smith, 1986; Mao et al., 2013; Meyer et al., 1978). Greyhounds, on the other hand, appear to be an exception in having resistance to the development of obesity (Diez & Nguyen, 2006).

Table 1.1: A summary of the reported incidence of canine obesity from various countries in a chronological order

Country N Incidence References

UK 1000 28.0% Mason (1970)

UK 1134 34.0% Edney (1974)

USA 3729 22.0% Kronfeld et al. (1991)

USA 30 517 28.0% Lund et al. (1999)

Australia 1093 41.0% McGreevy et al. (2005)

France 616 38.8% Colliard et al. (2006)

China 2391 44.4% Mao et al. (2013)

1.3.3 Other contributing factors

The primary cause of obesity is an excess in energy consumed over energy expended.

However, other contributing factors have been reported, which include the age of the animal, gender, neuter status, exercise, the lifestyle of the owners, diets and hormonal factors. With regard to the age of the animal, it has been reported that with increasing age, the incidence also increases; i.e. 6% of female puppies (<1 yr) were obese in comparison to 40% of adult female dogs (Glickman et al., 1995). It is important to note that excessive weight gain in puppies can predispose them to adult obesity, i.e. obese puppies under the age of one had 1.5 times more chance of developing obesity as adults compared to non-obese puppies (Glickman et al., 1995). The incidence of obesity has also been reported to decrease in dogs over twelve years of age (Armstrong et al., 1996). Gender has also been considered an important contributing factor, with a higher incidence reported in females than in males (32% vs. 23%,

or 40% higher in females) (Glickman et al., 1995; Mason, 1970). In addition, neutering increases the incidence of obesity in both males and females (Jeusette et al., 2004a;

McGreevy et al., 2005). This could be due to an increase in food intake, as observed in a study wherein for three months following neutering, female beagles consumed 20% more food and thus increased weight (Houpt et al., 1979). With respect to physical activity and sedentary behaviour in dogs, Morrison et al. (2014) reported that age and breed were found to influence the duration and intensity of physical activity. The lifestyles of the owners have also been shown to have an influencing effect, wherein overweight owners were more likely to have overweight pets (Nijland et al., 2010). With regard to diet, a major contributing factor is ad libitum feeding, offering treats and feeding leftovers of owner’s meals, as well as various nutritional supplements (Robertson, 2003). Finally, hormone level is a factor closely related to the endocrine function of the adipose tissue, which will be discussed in detail in the following sections.

Obesity is of concern as it decreases the lifespan of the patients and also predisposes them to a number of medical problems (German et al., 2012a; Kealy et al., 2002). The medical problems include a variety of diseases including, but not limited to, insulin resistance, lipid metabolism disorders, cardiovascular and respiratory disease, urinary disorders, reproductive disorders, arthritis, traumatic and degenerative orthopaedic disorders, dermatologic diseases, neoplasia, decreased immune function, decreased heat tolerance and anaesthetic complications (German, 2006a; Gossellin et al., 2007a; Tvarijonaviciute et al., 2012).

1.3.4 What is adipose tissue?

The adipose tissue is composed of two different types of adipocytes (Figure 1.6A). The brown adipose tissue is involved in energy dissipation or thermogenesis regulated by the genes participating the mitochondrial function, including uncoupling protein-1. This adipose tissue appears as multilocular lipid droplets in brown fat, and is in abundance in neonates and hibernating animals (Cannon et al., 2004). White adipose tissue, on the other hand, comprises large cells filled with triglycerides involved in energy storage, and makes up a higher proportion of adipocytes in adults (Wronska & Kmiec, 2012). Besides the presence of mature adipocytes, other cells are present in the adipose tissue, including preadipocytes, mesenchymal stem cells, macrophages, endothelial cells and fibroblasts, all of which regulate adipose tissue inflammation in the case of obesity. The stem cells and pre-adipocytes are important for the expansion (hypertrophy) and multiplication (hyperplasia) of adipose tissue during obesity (Ailhaud et al., 1992). Excess energy is stored in the form of triglycerides and constitutes over 85% of adipose tissue and, as the excess increases, the adipocytes are capable of increasing their diameter twenty-fold and their storage capacity up to several thousand-fold

(Klaus, 2004). Once thought of as simply an energy depot, white adipose tissue is now considered as an endocrine organ secreting a number of hormones and proteins classified as adipokines or adipocytokines (Figure 1.6B), which influences biological functions such as insulin sensitivity, inflammation, lipid metabolism and energy homeostasis (Kershaw & Flier,

2004).

A B

Figure 1.6: A: depicts light microscopy image of white and brown adipose tissues that are close to each other (Tam et al., 2012). B: depicts adipocytes considered endocrinologically active, secreting important hormones, cytokines, vasoactive substances and other peptides. The abbreviations used in the figure are as follows: IL, interleukin; TNF-α, tumour necrosis factor-α; TGF-b, transforming growth factor-b; CRP, C-reactive protein; SAA, serum amyloid A; PAI-1, plasminogen activator inhibitor-1; MCP-1, monocyte chemoattractant protein-1; MIF, macrophage migration inhibitory factor; NGF, nerve growth factor (German et al., 2010a).

1.3.5 Obesity and inflammation

Inflammation is a local physical reaction in response to an injury or infection and can be accompanied by the classical signs of inflammation, which include pain, heat, redness, swelling, and loss of function. However, when irritants persist, as in the case of a metabolic surplus (from excess dietary intake), the immune system is activated and inflammation becomes chronic in nature (German et al., 2010a; Khorsan et al., 2014; Lands, 2014).

Macrophages are cells produced by the differentiation of monocytes in the tissues. During obesity, macrophages accumulate and are responsible for most of the cytokines produced in the adipose tissue. In physiologically normal individuals, adipose tissue cytokine concentrations are low, and this is in contrast with the changes that occur during obesity,

wherein obese individuals show a higher expression of pro-inflammatory cytokine proteins

(Lee & Pratley, 2005). During adipocyte hypertrophy and hyperplasia, the blood supply to adipocytes may reduce and this could lead to hypoxia. The resultant hypoxia could trigger necrosis and macrophage infiltration into the adipose tissue, leading to the excess production of inflammatory cytokines (Ye et al., 2007; Masoodi et al., 2015). The macrophages associated with obesity are thought to have undergone a phenotypic change from an alternatively activated type (M2), seen in the lean state, to a classically activated type (M1) in the obese state, which increases gene expression of pro-inflammatory cytokines (Prieur et al.,

2011). The majority of macrophage cells that gather around the dead adipocyte fuse and form syncytia, with the residual free adipocyte lipid droplets forming multinucleate giant cells, as seen in chronic inflammation (Cinti et al., 2005), as depicted in Figure 1.7. Thus, chronic low-grade inflammation associated with obesity increases slowly, leading eventually to the damage of vital organs and development of insulin resistance (Xu et al., 2003), which could then lead to the development of a number of other conditions such as dyslipidemia, heart diseases, hypertension and stroke, which are seen in humans as well as in dogs (Cespedes et al., 2015; Moller & Kaufman, 2005; Tvarijonaviciute et al., 2012).

Figure 1.7: The changes in immune cell populations in adipose tissue in obesity. Lean adipose tissue contains a higher proportion of M2/M1 macrophages as well as a number of regulatory T cells. Obesity and adipocyte hypertrophy leads to adipocyte necrosis, an increase in pro-inflammatory M1 macrophage numbers, and change in immune cell populations. These then lead to the production of proinflammatory cytokines that cause systemic inflammation and thus insulin resistance (Kalupahana et al., 2012).

Insulin is produced by the pancreas within the β cells of the islets of Langerhans, and is responsible for regulating glucose transport and metabolism, mainly in the adipose tissue, liver and skeletal muscle. Insulin resistance is a condition wherein there is insufficient response to insulin by the tissues that are normally sensitive to insulin, such as adipose tissue, liver and skeletal muscle (Schenk et al., 2008). This could then lead to the inhibition of lipolysis and reduction in glucose production by the liver cells, as well as reduction in the uptake and utilisation of glucose by the skeletal muscles (Figure 1.8). Similar to humans, dogs also develop insulin resistance when overweight and weight loss restores the normal response to insulin (Gayet et al., 2004).

Figure 1.8: The pathogenesis of obesity-associated insulin resistance. The function of insulin is to suppress hepatic glucose production, promote skeletal muscle glucose disposal and inhibit lipolysis. A chronic low-grade inflammation occurring in adipose tissue in obesity gives rise to excessive production of pro-inflammatory cytokines which then attenuates insulin action on the aforementioned tissues (Kalupahana et al., 2012).

1.3.6 Adipokines

Adipose tissue has been reported to respond to metabolic signals through the release of a

number of proteins. These proteins, including leptin and adiponectin, have been termed

adipokines, (Trayhurn & Wood, 2004). The cytokines produced by the adipose tissue,

including TNFα and IL6, have been termed adipocytokines (Tilg & Moschen, 2006).

1.3.6.1 TNF alpha and IL6

Of the cytokines produced by the adipose tissue, TNFα and IL6 are the two cytokines that

have been most extensively studied in humans as well as in dogs (Bastien et al., 2015;

German et al., 2010a; Tilg & Moschen, 2006).

TNF alpha is primarily known for its function in activating the immune system against

infection or cancer. However, it has now been reported to be produced by the adipose tissue

macrophages and to promote insulin resistance centrally in the hypothalamus as well as within the adipocytes (Moller, 2000). Similarly, IL6, also produced by the macrophages, influences the development of insulin resistance by altering the signalling of insulin in the liver cells (Bastard et al., 2002). Circulating concentrations of TNFα were detectable in the plasma of almost 50% of dogs with obesity, and these levels reduced following weight loss

(German et al., 2009).

The genes TNFα and IL6 were included in this project for the gene expression analysis, but were not detected in the white blood cell samples in the study, so were unable to be investigated further.

1.3.6.2 Leptin

Leptin is one of the adipokines that is extensively studied in humans and animals, including dogs (Harris, 2000). Leptin is a protein, coded by the ob gene and secreted primarily by the adipocytes (Iwase et al., 2000). The amount of leptin secreted has been shown to be directly proportional to increasing body fat mass (Considine et al., 1996; Hariri et al., 2015). This is further supported by the observation that leptin concentration decreases with weight loss

(Jeusette et al., 2005).

Based on mouse studies showing that the absence of leptin could lead to the development of severe obesity, leptin was believed to suppress appetite and increase energy expenditure. It was reported to bind to receptors in the hypothalamus to suppress appetite through a series of events, including the suppression of orexigenic neurons (neurons that stimulate appetite) via neurotransmitters such as neuropeptide Y and agouti-related peptide, and the stimulation of anorexigenic neurons (neurons that suppress appetite) via neurotransmitters such as

melanocyte-stimulating hormone (Cowley et al., 2001). However, it was also observed that in both obese humans and dogs, the concentrations of leptin were found to be high. This pinpointed a reduced end organ response to leptin in the hypothalamus, rather than an absence of leptin, was responsible for obesity (Farooqi et al., 2007).

In dogs, certain breeds such as dachshunds, labrador retrievers and shih-tzu were found to have lower levels of leptin, while breeds such as shetland sheep dogs had higher levels

(Ishioka et al., 2007). The concentrations of leptin were also found to increase after being fed an energy dense meal (Ishioka et al., 2005a) or after treatment with glucocorticoids (Nishii et al., 2006).

1.3.6.3 Adiponectin

Adiponectin, an adipokine secreted exclusively by the mature adipocytes, circulates in high concentrations as complexes of variable sizes (Maeda et al., 1996). In contrast to leptin, the concentration of adiponectin decreases with increasing obesity. It has been reported that the gene expression of adiponectin is reduced in dogs with increasing obesity (Ishioka et al.,

2006), and this reduction in gene expression could be due to the increased secretion of other adipocytokines such as TNFα and IL6 through the NFκB pathway.

The beneficial effects of adiponectin have been reported to improve insulin sensitivity, regulate lipid and glucose metabolism, and reduce hepatic lipid accumulation (Yamauchi et al., 2002). Additionally, adiponectin has been reported to exhibit an anti-inflammatory effect by suppressing TNFα production by macrophages (Yokota et al., 2000).

1.3.7 Management and treatment of canine obesity

The primary approach to management of obesity in canines would naturally focus on dietary and lifestyle management. However, this appears to be challenging for pet dog owners, as the incidence of canine obesity seems to be increasing (German, 2006a; Under & Mueller, 2014).

One reason for this is lack of owner compliance. Not all dogs starting a weight loss program actually complete it (Yaissle et al., 2004) and the cases of rebound back to obesity are quite high in pet dogs (German et al., 2012b). This project focuses on dietary strategies using n-3 fatty acids in obesity management.

Commercial pet foods formulated for weight control offer a dietary management strategy which involves the restriction of dietary energy, with diets based on either high protein with moderate fibre or high fibre with moderate protein. However, reduced energy intake can lead to hunger, increased scavenging and begging behaviours, and non-compliance of the owners, ultimately resulting in withdrawal from the weight loss program. A high protein, high fibre diet has been demonstrated to be effective for weight loss outcomes (German et al., 2010b;

Weber et al., 2007). Adequate protein is essential to prevent the loss of muscle mass (Diez et al., 2002), while micronutrient supplementation ensures that nutrients are not deficient when energy is being restricted (Weinsier et al., 1984). Weight monitoring also plays an important role for the success of the weight loss program. Dogs should be regularly checked and owner compliance should be verified frequently to motivate the owner. Follow-up phone calls not only help to track the progress, but also provide an opportunity to address any new problem at an early stage. Regain of BW is common and can be avoided by continuing to feed dogs with diets that were used during the weight loss period (German et al., 2012b). Incorporation of exercise into the weight loss regime has been found to be useful and effective (Chauvet et

al., 2011a). However, these management practices should be designed specifically for each dog, taking into consideration any existing medical condition. The exercises for dogs could include walking or running with the owners, swimming or hydrotherapy, use of treadmills if feasible or canine sports such as agility and obedience training. Off-lead exercising gives dogs the opportunity to move at their own pace as well as encourage them to walk further to investigate the environment. Along with dietary and exercise management, it is also important that owners comply and reduce overfeeding and giving of treats (Chauvet et al.,

2011b).

Some of the more recent treatment approaches include the use of pharmaceuticals or surgical intervention such as reversible gastric restrictive implants and gastric electric stimulators.

The two pharmaceutical products used in dogs are Dirlotapide (marketed as Slentrol)

(Gossellin et al., 2007b) and Mitratapide (marketed as Yarvitan) (Dobenecker et al., 2009), both of which have been reported to inhibit microsomal triglyceride transfer proteins.

Inhibiting these protein molecules inhibits food intake by interfering with fat absorption at the intestinal level, as well as with the release of satiety factors that reduce food intake.

Dirlotapide can be given for a long term, i.e. 12 months, with periodic increases in dose to maintain weight loss. On the other hand, Mitratapide can only be used for short-term treatment, i.e. two to three weeks. Both of these drugs have been reported to have gastrointestinal side effects such as vomiting and diarrhoea. Forewarning the owners about the side effects helps better compliance with the use of this treatment method. However, it must be remembered that there is a chance of a rebound in BW when the use of these drugs are discontinued.

Incorporating other strategies, such as lifestyle and dietary management, in addition to drug therapy are useful for long term results. Recent additions to the treatment strategies include the use of reversible gastric restrictive implants (Guo et al., 2014; Guo et al., 2011) and the use of gastric electric stimulators (Li et al., 2014). Reversible gastric restrictive implants

(Guo et al., 2011) involve the use of two longitudinal parallel plates held together with two rings in a C shape to form a longitudinal gastric pouch that prevents gastric distension. This was tested in non-obese mongrel dogs for six weeks, and results showed a decrease in average food intake by 38.2%, with an average weight loss of 21%. When this procedure was tested in obese mongrel dogs for twelve weeks, it was reported that food intake reduced by an average of 46%, with an average resultant weight loss of 75% (Guo et al., 2014). Surgical implanted gastric electric stimulators (Abell et al., 2006) deliver an electrical stimulus to the stomach through electrodes, which causes a change in gastric motility, improved satiety and causing weight loss. This procedure was tested in eight healthy female dogs for three days, with a significant reduction in food intake reported (Li et al., 2014). However, further animal testing and clinical trials are needed for these techniques to be included as an accepted part of an obesity treatment regime.

1.3.7.1 Dietary management using n-3 fatty acids: Effect of n-3 fatty acids on body

weight and fat mass

A variety of n-3 fatty acids have been investigated in animal obesity research, including different sources of oils in different concentrations (Howe & Buckley, 2014; Sicinska et al.,

2015; Torres-Fuentes et al., 2015).

The reported use in canines for weight control is limited to one study by Ishioka et al. (2002), wherein a significant decrease in body weight (BW) was observed in obese beagles

supplemented with DHA-rich FO for fourteen weeks, and this was associated with an increase in mitochondrial uncoupling protein 3 mRNA expression in skeletal muscles. These

UCP molecules have been reported to dissipate excess fat energy as heat and result in weight loss.

Other reported studies involve rodents. A study conducted in mice fed a high-fat diet to induce weight gain reported that weight gain was limited when EPA/DHA content was increased from 1 to 12% (weight/weight) of dietary lipids (Ruzickova et al., 2004). Similarly, a study was conducted on rats that were fed a high-fat diet (20% fat) containing n-3 fatty acids in different combinations: solely EPA as the EPA group, solely DHA as the DHA group, a mixture of both EPA and DHA (MIX group) and the use of a native fish oil (FO group) (Raclot et al., 1997). It was found that the mean weight of the fat cells (µg) in retroperitoneal adipose tissue was the highest in the control group fed lard plus olive oil, followed by the EPA group, then the other three groups, that were not significantly different from each other: DHA = FO = MIX. However, it was interesting to note that in spite of the presence of n-3 fatty acids in the native FO, the final BW of the rats was highest in the FO group compared to the control group. In another study conducted on rats, it was observed that the final body mass was no different between rats fed FO and lard. However, even though both the groups had a significant increase in fat pad mass, the group fed FO had a considerably smaller increase in fat pad mass compared to lard fed rats (Parrish et al., 1990).

A smaller increase in fat mass when fed FO was also observed in another study when rats were fed diets containing 42% of energy as either FO, safflower oil, olive oil or beef tallow for twelve weeks. The study also reported that the total energy gain was lower in the rats fed

FO compared to olive oil and beef tallow, and that the FO group also gained more lean body mass and less fat mass (Su & Jones, 1993).

To specifically compare the influence of PUFA from n-3 and n-6 sources on lipid composition and metabolism, a study was conducted on rats for one week. It was interesting to note that significant differences were observed in a short period of one week, wherein body weight increments and adipocyte size were significantly smaller in rats fed PUFA from n-3 sources in comparison to rats fed PUFA from n-6 sources, even though the rats of the two groups consumed a comparable amount of food (Fickova et al., 1998).

The above-mentioned studies used healthy and physiologically normal rodents and investigated the function of EPA and DHA limiting obesity and proliferation of adipose tissue cells induced by feeding a high-fat diet. Though these studies provide some evidence for the effect of long chain n-3 fatty acids (LCn-3FA) on BW and fat mass, the mechanism of action is still inconclusive.

1.4 Assessment of Body Composition and Computed Tomography

The assessment of body composition in animals is important for several reasons, including evaluation of obesity, therapeutic purposes and the assessment of meat animals to predict carcass composition at slaughter. It is important to assess the actual level of obesity and understand the responses to both short-term and long-term weight loss programs, and it is also important to assess the nutritional status of the patient to decide the replenishment/treatment of sick animals and to monitor the effect of such an intervention.

1.4.1 Assessment of body composition in a clinical setting

Under a clinical setting, the most practical method of estimating body condition is assessing

BW and the body condition score (BCS). To measure BW, a weighing scale calibrated to an

accuracy of 0.1 kg, is used. To avoid potential sources of error and improve accuracy, it is best to use the same weighing scale to measure the animals at various time points and preferably at approximately the same time of day. Measuring BW in isolation is not ideal, as it does not provide an indication of whether the animal is underweight, overweight or of ideal body condition. Hence, BW should be measured in conjunction with BCS to obtain a better perspective on the body condition and health of the animal.

Body condition scoring is a semi-quantitative measurement and involves a subjective evaluation, both visual and palpable, for the outline of the body, coverage of fat and the ability to palpate the ribs to assign a score. The two commonly used scoring systems in dogs

(Figure 1.9) are the 5-point system wherein a BCS of 3 is considered ideal (McGreevy et al.,

2005), or a 9-point system wherein a BCS of 5 is considered ideal (Laflamme, 1997). The 9- point system is widely accepted and when performed by trained operators and compared with other methods of assessing body composition, such as dual-energy X-ray absorptiometry

(DEXA), it was found to be consistent and have a high coefficient of determination (r2 =

0.92) (Mawby et al., 2004). A new system (German et al., 2006b) has been designed for use by owners without any prior training and involves the 7-point algorithm-based approach, wherein each score is assigned an alphabet, starting with A for underweight to G for obese.

One of the major drawbacks for the BCS method in general is its lack of power to detect subtle changes within a short period of time. For the BCS to change one increment and be detected, it generally requires a minimum of two to four months and at least an 8% change in body mass (Dorsten & Cooper, 2004). This makes BCS a poor method for monitoring short term changes in body composition in weight management programs. Another drawback is that the method is subjective in nature and could result in variation in the assignment of

scores between operators. These drawbacks warrant the need for more accurate assessment of body composition (Dorsten & Cooper, 2004).

A B

Figure 1.9: A: 5-point scoring system (McGreevy et al., 2005) B: 9- point scoring system (Laflamme, 1997)

1.4.2 Indirect methods for assessing body composition

The most accurate method of assessment of body composition is a direct method to establish the chemical composition of the body, which involves the chemical analysis of a cadaver.

However, this is not practical in a clinical setting and it is therefore useful to compare the results obtained from such a method with the results obtained from other indirect methods.

There are several methods for assessing body composition and two key factors that need to be considered when choosing a method is accuracy and precision. The accuracy of a method tests the closeness of the measurement to its true value, while precision tests the repeatability

of the test to produce the same results. An ideal method for assessment of body composition should be both accurate as well as precise; however, all the existing methods have limitations.

Most of the indirect methods are based on the assumption that the body is divided into two- compartments: fat and fat-free mass (Burkholder, 2001). It is possible through certain techniques to further divide the fat-free mass and analyse water, protein, bone mineral and tissue distribution. It is assumed that the composition of the fat-free mass is relatively constant, with a density of 1.1 g/cc at 37ºC, a water content of 72% to 74%, and a potassium content of 50 to 70 mmol/kg. Fat, on the other hand, is relatively homogenous in composition anhydrous in nature and free of potassium with a density of 0.900 g/cc at 37ºC (Lukaski,

1987).

The two most commonly used methods to evaluate body composition in canine obesity research are DEXA and deuterium oxide dilution. This review, will, however, briefly discuss a few of the other existing methods with their limitations.

Originally developed for measuring bone mineral content, DEXA has been used to assess whole body composition in dogs (Jeusette et al., 2010). It uses two low energy X-ray beams at 70 kVp and 140 kVp to differentiate the body tissues into bone, soft tissue and lean tissue, and this is based on attenuation of the different energy levels of X-rays emitted. The dogs need to be anaesthetised to avoid unwanted movement and best positioned in dorsal recumbency (Raffan et al., 2006) during scans lasting 20 minutes (Lauten et al., 2001), or shorter scans of 5-10 minutes duration using newer DEXA machines that use fan-beam technology (Raffan et al., 2006). The precision of the DEXA technique was tested in normal healthy dogs using six different breeds, and the coefficient of variation was found to be

5.19% for fat tissue (Lauten et al., 2001). The accuracy was validated by chemical analysis;

however, greater inaccuracies were observed in some individual animals, mainly due to skeletal muscle hydration (Speakman et al., 2001). In spite of the differences observed between animals, the high repeatability for the same animal makes it a reliable method for observing changes in body composition in obesity studies (Munday et al., 1994a).

Isotope dilution (deuterium oxide) works on the principal that body water associated with fat- free mass (lean tissue) is fairly constant compared to the negligible water content of the fat mass. Using this principle, estimation of the body composition can be made by measuring the total body water of the fat-free mass (lean tissue). To determine this, isotopes of deuterium oxide (stable and non-toxic in nature) that freely exchange with water are administered intravenously. The dogs are weighed, and blood samples are collected before and two hours after administration and analysed for the amount of deuterium oxide present. To calculate the total body water, the formula indicated below is used (Sheng et al., 1971). The fat estimated by deuterium oxide dilution was validated against fat determined by ether extraction of the carcass using male and female dogs, and a coefficient of determination, r2 = 0.95, was obtained (Burkholder & Thatcher, 1998). The method was also tested against DEXA in two different studies, both of which reported excellent correlations between measurements of percent body fat (%BF), and coefficient of determination r2 = 0.84 (Son et al., 1998) and r2 =

0.78 (Mawby et al., 2004). However, the percentage of body fat obtained with DEXA was on an average 13-15.8% higher than that obtained with the deuterium oxide (Son et al., 1998).

Volume of total body water was calculated using the formula:

C1V1=C2V2

Wherein C1V1 = known amount of deuterium oxide in a known volume of carrier

C2= final volume of deuterium oxide in a biological fluid (blood)

V2= is the volume of total body water

Computed tomography (CT) works on the principle of acquiring information based on the X- ray radiation being transmitted in many directions through a specific volume of tissue. These transmitted radiations account for the linear attenuation coefficient, which are transformed into CT values or Hounsfield units (HU), a quantitative scale for measuring radio-density, ranging between −1024 for air, 0 for water, and +1000 for bone, with muscle having a positive HU value, while fat has a negative HU value. From human studies, it has been suggested that CT may be a more accurate method for measuring body composition than

DEXA (Lane et al., 2005). Validation of CT in pigs using dissection and near-infrared spectroscopy (NIR) showed a coefficient of determination 푟2 = 0.93 (Jopson et al., 1995). The first study that utilised CT for measuring body composition in dogs was conducted by Ishioka et. al. (2005b). Their study in dogs demonstrated that the fat content measured at the third lumbar vertebra (L3) using the attenuation range of −135/−105HU had the best correlation, correlation coefficient 푟 = 0.98, with the body fat content estimated by the deuterium oxide dilution method. However, CT slices analysed were limited to only three levels; the twelfth thoracic vertebra (T12), the third lumbar vertebra (L3), and the fifth lumbar vertebra (L5), and were only investigated in beagles. The canine study (Ishioka et al., 2005b) also demonstrated the potential for fat to be overestimated at 190/−30HU. Using Ishioka’s attenuation range, a study was conducted in dachshunds, which are chondrodystrophic breeds with a specifically unique body conformation (Comstock et al., 2013). The results from the dachshund study suggested that the fat area measured at L3 and L5 using attenuation ranges

−135/−105 HU was significantly dependent on BW (P=0.05). These two studies have used specific CT slices as representative of the whole body fat. There is, therefore, a need for an improved CT method in dogs. Traditional CT image analysis is cumbersome in a whole body scan because of the large number of CT images involved and the manual calculations required in the prediction equations. However, the application of advanced image analysis

software programs simplifies and automates the process, as demonstrated by a study in dogs using human body fat analysis software (Kobayashi et al., 2014).

An older method, ultrasound, has also been tested in dogs (Wilkinson & McEwan, 1991). The subcutaneous fat thickness measured at six anatomical sites was compared using ultrasound and histology, and it was reported to be significantly correlated (r = 0.81; P < 0.001). Total body fat was then predicted using the subcutaneous fat thickness; however, it was the subcutaneous fat from the lumbar area that significantly correlated with the total body fat (r =

0.87; P<0.001). Recent methods in dogs include using a hand-held device: bioimpedance spectroscopy (Stone et al., 2009). The method was validated against DEXA and good agreement was found with the two methods (correlation coefficient 푟 = 0.93 for fat) at a population level, but was limited in accuracy when used for individual animal measurements.

Quantitative magnetic resonance (QMR) also has been shown to be a useful technique in dogs, particularly because the dogs do not require sedation or anaesthesia (Zanghi et al.,

2013). However, when this method was compared with the deuterium oxide dilution method,

QMR significantly underestimated fat mass by 15.4%.

1.5 Importance of Canine Breed Differences in Lipid or Fatty Acid Metabolism

A review of current scientific literature for lipid metabolism in dogs reveals some breed differences, which are summarised below. As discussed in Section 1.1 of the literature review, fatty acids are simple lipids and classified as saturated fatty acids, monounsaturated fatty acids or PUFA. It is still unclear from the literature if there are distinct breed differences in n-3 or n-6 fatty acid metabolism and, hence, this requires further investigation. This review will, therefore, highlight any evidence of breed differences in lipid metabolism in canines, not limited to PUFA (n-3 or n-6) metabolism.

The diversity observed in dog breeds is greater than that observed in other species of domestic animals. This is highlighted by comparing the smallest breed of dog (chihuahua, 23 cm) to the largest breed of dog (great dane, 86 cm). The genetic explanation for this diversity in size has been attributed to the single IGF1 haplotype, which is present in all small breeds and absent in large breeds (Sutter et al., 2007). Traditionally, dog breeds were grouped based on their roles in human activities, historical records or phenotypes. However, a recent study by Parker et al. (2004) identified four genetic clusters; Asian dogs, guardian dogs (mastiff- type), herding breeds and modern hunting dogs, and defined an independent classification based on patterns of genetic variation. These researchers studied the genetic relationships among 85 domestic dog breeds and found that the differences accounted for ~30% of genetic variation. Using 96 microsatellite markers, 99% of individual dogs were correctly assigned to their breeds, and using phylogenetic analysis, several breeds of ancient origins were separated from the remaining breeds with modern European origins (Parker et al., 2004).

Understanding the genetic relationships that exist among breeds is essential for research targeted at uncovering the complex genetic basis of disease susceptibility, behaviour, and response to treatment.

1.5.1 Breed differences in lipid metabolism

To understand the breed differences in lipid metabolism, terminologies related to lipid metabolism have been highlighted (Watson & Barrie, 1993). Hyperlipidemia is the increased concentration of triglycerides (hypertriglyceridemia), cholesterol (hypercholesterolemia) or both, in the blood. Canine hyperlipidemia can be primary (genetic or idiopathic) or secondary to other disease processes. It can be physiological (associated with the ingestion of diets rich in lipids) or pathological, which could result from increased lipoprotein synthesis or mobilisation or decreased lipoprotein clearance (hyperlipoproteinemia). Primary lipid

abnormalities are relatively uncommon in dogs and are usually, though not always, associated with specific breeds. It is this knowledge of breed differences in lipid metabolism that is of interest in this project.

Miniature schnauzers were the first dog breeds in the US reported to suffer from primary hyperlipidemia (Rogers et al., 1975). To test these findings in another region, Mori et al.

(2010) collected 900 plasma samples from healthy dogs that were free of disorders such as liver failure, kidney failure, cardiac disease and diabetes mellitus. The samples were collected from seven different veterinary clinics across Japan and were tested for the differences in plasma triglycerides and cholesterol concentrations between miniature schnauzers (n=25) and other pure breeds in Japan (shetland sheepdog (n=20), beagle (n=29), miniature dachshund

(n=103), shiba inus (n=92)); and using mixed breeds (n=425) and mongrels (n=228) as controls. The study reported that miniature schnauzers and shetland sheepdogs in Japan exhibited a significantly (P<0.05) higher concentration of plasma triglycerides (180±74mg/dl and 173±67mg/dl respectively) and total cholesterol (241±43mg/dl and 328±79mg/dl respectively) compared to other purebred and mixed canine breeds in Japan (triglycerides

99±12mg/dl, total cholesterol: 205±7mg/dl). However, the cause and condition of primary hyperlipidemia in these two breeds differed; it was hypertriglyceridemia in miniature schnauzers and hypercholesterolemia in shetland sheepdogs. Evidence of hyperlipidemia in miniature schnauzers was further supported by a study conducted by Usui et al. (2014).

Distinct breed differences were seen in dogs (n=487) using five breeds, miniature schnauzers

(n=13), labrador retrievers (n=18), miniature dachshunds (n=65), shiba inus (n=23) and all the remaining dogs were in another group (n=363), wherein it was reported that miniature schnauzers had the highest total cholesterol concentrations (P<0.05, 261.1 ± 20.3mg/dl) in the

plasma in comparison with miniature dachshunds, which had the lowest concentrations

(164.8 ± 9.1mg/dl).

Primary hyperlipidemia has been reported in other dog breeds: beagles, briards, rough collies, shetland sheepdogs, brittany spaniels, doberman pinschers and rottweilers. In two related healthy beagles, primary hyperlipidemia with hypercholesterolemia and hypertriglyceridemia were reported (Wada et al., 1977), wherein α1 and α2 lipoproteins fractions were distinctively present in beagles with hyperlipidemia. Primary hypercholesterolemia without hypertriglyceridemia, possibly due to the abnormal accumulation of HDL (HDLc), was reported in fifteen healthy briards from a study conducted in the United Kingdom (Watson et al., 1993). Similarly hypercholesterolaemia was reported in a family of rough collies, also from the UK, and the increase in total cholesterol could have been due to the increase in the cholesterol content of the VLDL, LDL and alpha-2 HDL lipoprotein fractions (Jeusette et al.,

2004b). A different condition of primary hypercholesterolemia i.e. with or without concurrent hypertriglyceridemia, was reported in shetland sheepdogs, though the exact cause was not clear (Sato et al., 2000). Lastly, primary hypertriglyceridemia has been reported in two related healthy brittany spaniels (Hubert et al., 1987) and primary hypercholesterolemia has been reported in doberman pinschers and rottweilers (Armstrong et al., 1989). Another study by Pasquini et al. (2008) added to the list of differences in breeds (n=251) with the following significant differences (P<0.05): highest total cholesterol concentrations in rottweilers

(n=53), higher plasma cholesterol in pyrenees mountain dogs (n=40), highest β lipoprotein fraction in labrador retrievers (n=40), and doberman breeds (n=30), highest α lipoprotein fraction in pyrenees mountain dogs and lowest α lipoprotein fraction in labrador retrievers.

These breed differences observed in lipid concentrations, and the absence of similar evidence to indicate breed difference in PUFA metabolism in dogs, warrants further research in these areas. The reported breed differences in digestibility and food tolerance in dogs (Zentek &

Meyer, 1995) suggest the need for greater understanding of breed differences in relation to the utilisation of nutrients. The presence of lipid abnormalities, together with a propensity for developing obesity, in the beagle breed of dogs (Wada et al., 1977) could make it a suitable choice for lipid or fatty acid studies. On the other hand, as reported by Diez and Nguyen,

(2006), greyhounds are recognised to be resistant to developing obesity and hence a comparison between these two morphologically diverse breeds (beagles and greyhounds) would be beneficial in understanding breed as an influencing factor. Further, understanding breed differences would be useful in diagnosis and correct interpretation of the biochemical analysis of the blood. The emergence of breed specific diets (Bennett & Shields, 2000), as well as diets for specific purposes such as weight management, suggests there is a need for future research in understanding breed differences in digestion and metabolism of nutrients, and specifically lipid or fatty acid metabolism for the efficient management of obesity and other metabolic disorders.

1.6 Research Plan and Organization of Thesis Chapters

The primary objective of the PhD project was to further the understanding of biochemical responses (changes to plasma fatty acid composition) and transcriptional responses (changes to WBC inflammatory gene expression) to n-3 fatty acids from two dietary sources (ALA- rich flaxseed oil and DHA-rich fish oil) in two different breeds of dogs.

Chapter 2 (General Materials and Methods) presents the methodology used in this PhD project. Three experiments were conducted, and these are presented in Chapters 3 to 6 as

peer-reviewed publications (published or submitted). The formatting of the chapters differs according to the requirements of the journal and some repetition of the experimental methods is unavoidable.

Experiment 1: PUFAs are important for human and animal health. To our knowledge, previous studies investigating the metabolism of PUFA in dogs have not examined breed differences. Experiment 1 therefore investigated the biochemical response (changes to plasma fatty acid composition) to dietary flaxseed oil (57% ALA) in two breeds of dogs that differed in morphology and propensity to obesity: beagles and greyhounds (Chapter 3).

In addition to investigating these biochemical responses, the same study (Experiment 1) also investigated the transcriptional responses (changes in WBC inflammatory gene expression)

(Chapter 4). With the choice of the inflammatory genes in the present study (HSP90, HSP70 and IL1β), several other genes (mentioned in Chapter 2) were included in the gene expression analysis initially; however, these were not detected in the WBC samples, and hence were not investigated further. The study used a minimally invasive approach, as the dogs were privately owned and the choice of sample for investigating transcriptional responses was limited to total WBCs. Cytokine mRNA measured in this study is also considered a good estimate of the level of cytokine protein present, mainly because cytokines in general are transcriptionally regulated (James, 1994) and is an alternative to measuring inflammatory cytokines.

Experiment 2: Several methods exist for estimating body composition in dogs both clinically and for research purposes (Munday, 1994b). One such method for canine obesity research is

CT. The University of New England Animal Science Department has the facilities and

equipment for CT research. The previous use of CT to estimate body composition in canines is limited. Traditional CT image analysis is cumbersome and uses prediction equations that require manual calculations. In order to overcome this, Experiment 2 investigated the use of advanced image analysis software programs to determine body composition in dogs with an application to canine obesity research in two divergent breeds of dogs: beagles and greyhounds. Using the methodology developed in this experiment, body composition was correlated with the biochemical and transcriptional responses to a weight gain feeding regime

(Experiment 3).

Experiment 3: Obesity is a common diet-induced disease affecting modern dogs (German,

2006a). Previous studies in obese beagles have demonstrated increased weight loss with

DHA-rich fish oil (FO) (Ishioka et al., 2002). Experiment 3 investigated a preventative approach to canine obesity by testing the hypothesis that when feeding non-obese dogs

(physiologically normal dogs) diets that were designed to increase bodyweight, inclusion of n-3 FA in the form of DHA-rich FO would result in less bodyweight gain. The effect of fatty acid supplementation and weight gain was further elucidated by investigating body composition, transcriptional responses of the genes HSP90, HSP70 and IL1β in WBCs, and biochemical responses, including the changes in the composition of plasma, erythrocyte membrane PUFA levels, and omega-3 index as in Experiment 1. The model used in this study approaches obesity from a preventive perspective, wherein dogs of ideal body condition were fed diets in excess of maintenance energy requirements and tested for their propensity to gain weight based on the fat composition of the diet.

The main objectives and the link between the chapters are summarised:

1. Experiment 1 investigates the biochemical responses (changes to total plasma fatty

acids) to dietary flaxseed oil in two breeds of dogs: beagles and greyhounds (Chapter

3).

2. Experiment 1 also investigates the transcriptional responses (changes in inflammatory

gene expression) to dietary flaxseed oil in two breeds of dogs: beagles and

greyhounds (Chapter 4).

The animals used in Chapters 3 and 4 are identical and additional details of the animals have been provided in General Materials and Methods (Chapter 2).

3. Experiment 2 investigates the use of advanced image analysis software programs to

determine body composition in dogs with an application to canine obesity research

(Chapter 5).

4. Experiment 3 investigates a preventative approach to canine obesity by feeding non-

obese dogs (physiologically normal dogs), diets that were designed to increase

bodyweight to test the hypothesis that diets containing DHA-rich FO would result in

less bodyweight gain than the diet containing sunflower oil in two divergent breeds

of dogs: beagles and greyhounds (Chapter 6). The study also investigated the

biochemical responses (as in Chapter 3) and transcriptional responses (as in Chapter

4) in addition to determining body composition using the methodology developed in

Chapter 5.

The animals used in Chapters 5 and 6 are identical and additional details of the animals

have been provided in General Materials and Methods (Chapter 2).

Chapter 2 Materials and Methods

This chapter presents the methodology used in this research, as the experimental

chapters (Chapters 3-6) are presented as peer-reviewed journal articles.

2.1 Study Animals

The project utilised two breeds of pure bred dogs, beagles and greyhounds, in two main experiments (Experiment 1 and 3) and a supplementary study (Experiment 2). The details of the animals have been provided in Tables 2.1 and 2.2. The results of Experiment 1 have been written in two chapters (Chapters 3 and 4) and hence the animals in these two chapters are identical. Similarly, the dogs used in Experiment 2 (Chapter 5) and Experiment 3 (Chapter 6) are identical.

Table 2.1: Individual details of animals used in Experiment 1 (Chapters 3 and 4)

No Name Breed Sex Age Body weight* (Years) (Kg) 1 NormaJ Beagle Female entire 2 11.5 2 Bonnie Beagle Female entire 3 12.8 3 Ziggy Beagle Female entire 4 10.9 4 Hannah Beagle Female desexed 7 13.8 5 Mira Beagle Female entire 5 12.8 6 Katie Greyhound Female entire 4 24.2 7 Sally Greyhound Female entire 9 24.2 8 Penny Greyhound Female entire 7 28.6 9 Gemma Greyhound Female entire 3 24.3 10 Scrawny Greyhound Female entire 5 26.5

*Body weight of the dogs at the start of the study

Table 2.2: Individual details of animals used in Experiments 2 and 3 (Chapters 5 and 6)

No Name Breed Sex Age Body weight* (Years) (Kg) 1 Ada Beagle Female entire 5 12.7 2 Niki Beagle Female entire 1 10.0 3 Tegan Beagle Female entire 3 10.4 4 Mischief Beagle Female entire 2.5 10.2 5 Phoenix Beagle Female entire 5 10.9 6 Nora Beagle Female desexed 6 11.8 7 Tess Greyhound Female entire 7 28.5 8 Darling Greyhound Female entire 8 27.4

9 Dollie Greyhound Female entire 5 27.3

10 Tilly Greyhound Female entire 3 25.3

11 Snooky Greyhound Female entire 1 24.6

12 Bear Greyhound Female entire 1 25.2

*Body weight of the dogs at the start of the study

2.2 Location of Study and Animal Management

All experiments were conducted at the dog research facilities at the University of New

England, Armidale, NSW, Australia, with dogs being housed at the premises for the duration of the experiment.

The dog research facility comprises individual indoor pens, individual outdoor pens (6.45 m x 1.45 m) and a common exercise yard (11.8 m x 4.2 m), all with concrete floors. The individual indoor pens measured 2.35 m x 0.92 m for beagles and 2.35 m x 1.80 m for greyhounds. The indoor pens were well ventilated with a provision for heating at night.

Rubber trampoline style beds and water bowls were provided in each pen and dogs had access to fresh clean water at all times. The outdoor kennel facility housed the dogs during

the day. Experiment 1 (Chapters 3 and 4) was conducted during September and October and temperature ranged between 9ºC to 20ºC. Experiments 2 and 3 (Chapter 5 and 6) were conducted during January and February when temperature ranged between 17ºC to 36ºC. The pens, food and water bowls were washed daily. The drainage system within the facility was well integrated, allowing efficient waste disposal and hygienic environment for the dogs. The dogs’ health status was observed daily and any changes in behaviours or clinical signs were observed and recorded. The provision for emergency medical attention was available, if needed.

Female dogs of suitable temperament within the ideal range of 4-5 using a 9-point BCS system (Laflamme, 1997) were selected from reputable breeders to participate in the experiments. On arrival, all dogs were weighed and underwent a veterinary health check, which included complete blood counts, whole body physical examination, measurement of rectal temperatures, and auscultation of the heart and lungs. Any dog that appeared sick on veterinary examination was excluded from the study. Dogs were then dewormed with an oral anthelmintic (Drontal Allwormer, Bayer Australia Ltd, Pymble, NSW, Australia) and administered a booster vaccination (Canvac 4, CSL, Parkville, Vic, Australia). These dogs were accustomed to being kennelled in their usual environment and the pre-test period allowed the dogs to adapt to the kennel environment at UNE and the handlers.

2.3 Animal Ethics

The use of animals for this project has been approved by the University of New England

Animal Ethics Committee: Experiment 1 (authority o. AEC09/072), Experiment 2 (authority no. AEC10/091); and Experiment 3 (authority no: AEC11/081). All experimental procedures were performed with due consideration for the welfare of the animals, keeping in mind the

guidelines recommended by the UNE ethics committee. The dogs were borrowed from breeders who were completely informed of the conditions and procedures associated with the research and written consents were obtained from them.

2.4 Feeding Regimen

For all the experiments, during the pretest phase (four months for Experiment 1 and two weeks for Experiment 3) as their sole nutrient intake, the dogs were fed a basal diet in amounts calculated to meet their individual maintenance energy requirements (MER).

Additionally, the pretest phase (four months for Experiment 1 and two weeks for Experiment

3) allowed dogs to be acclimatised to the environment, diet and kennel routines. By the end of this adaptation period, dogs were consuming their allocated meals without any refusals and bodyweights (measured three times per week) had stabilised. For all the experiments, the dogs were fed once a day in the afternoon. When oil supplements were given as treatment during the test phase, these were provided once daily, mixed into their usual feed.

2.5 Body Weight

Body weights of all the dogs were measured three times each week (Monday, Wednesday and Friday) immediately prior to feeding, using an electronic weigh scale, Provet Nuweigh

Scales CHR-592 (Provet VMS Pty Ltd, Cameron Park, NSW, Australia).

2.6 Body Composition

Body composition was measured using CT with a spiral Picker UltraZ 2000 CT scanner

(Philips Medical Imaging Australia, Sydney, New South Wales, Australia). The dogs were sedated and positioned in sterno-abdominal recumbency on a fiberglass cradle lined with foam, and gently strapped to prevent movement whilst the whole body scan was performed.

The digital CT images were analysed to determine the percentage of total body fat of the dogs in Experiment 2 (Chapter 5) and 3 (Chapter 6). Details are described in Chapter 5.

2.7 Feed Intake

The amount of feed offered and refused was weighed and recorded daily for each dog, using an electronic balance (ISSCO 5000EC Precision Electronic Balance, ISSCO Industrial and

Scientific Supply Co. Pty Ltd, Concord West NSW). The daily feed intake for each dog was then calculated by deducting the amount refused from the amount of feed offered to each dog.

2.8 Faeces Collection and Sample Preparation

To determine apparent total-tract digestibility, the dogs were separated into individual pens and all the faeces produced on the final four days of the test phase were collected for each dog, put into labelled zip-lock bags and stored at -20˚C. The wet faeces weights were recorded before drying to a constant weight at 80˚C (approximately three days) and the dried faeces weight recorded. The dried faeces were pooled for each dog and ground prior to analyses for gross energy (GE) and crude fat.

2.9 Faecal Output and Faecal Dry Matter

Faecal output was calculated by adding together the total weight of all faeces produced by each dog over the collection period and dividing this by the number of days that faeces was collected to give an average daily faeces output. Faecal dry matter was calculated using the formula:

Dry faeces weight % DM = 100 Wet faeces weight

2.10 Proximate Nutrient Analysis

Proximate nutrient analyses were performed on dried faecal samples and representative samples of the dog food samples that were dried at 80ºC and finely ground through a mill

(Glen Creston, London, UK) using a 1 mm screen.

2.10.1 Gross energy

The GE was determined with an IKA Werke C7000 bomb calorimeter (IKA Group, Staufen,

Germany). For the oil supplements, the GE was determined indirectly in a 50:50 mixture of cellulose and oil in duplicates. The GE of the oil supplement was calculated as the difference between the GE of cellulose-supplement mixture and cellulose alone.

2.10.2 Crude fat

Crude fat content was determined by Soxhlet extraction using the AOAC Official Method

(AOAC, 2006; # 991.36). Whatman filter papers (185mm) were dried and weighed to three decimal places and with 8-10 grams of sample added. The paper and sample were folded, stapled (using two staples), labelled and weighed to three decimal places. Duplicates were made for each sample. The weight of the paper and sample less the filter paper weight gave the pre-extraction sample weight. The samples were then loaded for a soxhlet run, which lasted for approximately 24-25 refluxes (48 to 50 hours). These samples were then dried at

80oC for about 72 hours and weighed to three decimal places to determine fat loss.

2.10.3 Calculating Apparent digestibility

The following formulae were used to calculate apparent digestibility:

Feed intake (g) - Faecal output (g)   DM Digestibility (%) =  100  Feed intake (g) 

 Nutrient intake (g) - Nutrient output (g) Nutrient Digestibility (%) =  100  Nutrient intake (g)   

2.11 Biochemical and Gene Expression

2.11.1 Blood collection

Beagles and greyhounds were gently restrained to facilitate collection of whole blood and to prevent any movement that would cause laceration to the blood vessel. Beagles were seated on a table for the collection process. The site of collection was the jugular vein, which was shaved first and cleaned with alcohol swabs to avoid unwanted contamination. For the beagles, 21 gauge needles were used and 25 mL of blood was collected (5 mL for plasma fatty acid analysis and 20 mL for gene expression studies). For the greyhounds, blood was collected from a standing position with their heads restrained to prevent movement. The choice of the site of collection was also the jugular vein; however, 16 gauge needles were used owing to the size of the animal’s vein and pressure of flow; 55 mL of blood was collected (5 mL for plasma fatty acid analysis and 50 mL for gene expression studies). For both beagles and greyhounds, an additional 1 mL of blood was collected for the erythrocyte membrane fatty acid analysis in Experiment 3 (Chapter 6). In all instances, blood was collected in the morning following an overnight fast (18 hours fast). The collected blood was transferred into ethylenediaminetetraacetic acid (EDTA)-coated vials (BD Vacutainer® K2E

18.0 mg 10.0 mL vials) to prevent coagulation. The vials were then mixed well by inverting

the tubes gently eight to ten times and they were then immediately placed on ice to be transferred from the place of collection to the laboratory for further processing.

2.11.2 Differential white blood cell count

The differential white blood cell count was performed on the whole blood transferred into

EDTA coated vials (BD Vacutainer® K2E 18.0 mg 10.0 mL vials) prior to plasma analysis using the haematology autoanalyser (Cell-Dyn 3500R, Abbott Diagnostics, CA).

2.11.3 Plasma fatty acids

Plasma samples were extracted for Experiment 1 (Chapter 3) and Experiment 3 (Chapter 6) and the protocol described below pertains to both these experiments.

Plasma was extracted by centrifugation (BECKMAN, Allegra 6R centrifuge, U.S.A) at 1900 g for 15 minutes at 4°C and stored at -20°C until required for further analysis. Plasma fatty acid analysis was conducted by the Nutraceuticals Research Group, University of Newcastle,

NSW, Australia. The following methodology was provided by Prof. Manohar Garg and published in a study by Munro and Garg (2012).

The fatty acid composition of plasma lipids was determined using the method established by

Lepage and Roy (1986). To 100 μL of plasma, 2 mL of methanol:toluene mixture was added in 4:1 volume/volume, which contained C19:0 internal standard (4 μg/mL). Fatty acids were methylated by adding 200 μL acetyl chloride in a slow drop-wise manner with simultaneous vortexing and then heating for 1 hour at 100ºC. After rapid cooling, to halt the reaction, 5 mL potassium carbonate (K2CO3) was added. The samples were then centrifuged at 3000 g at 4ºC for 10 minutes to separate the layers and 100 μL was drawn from the top toluene layer for GC

analysis of the fatty acid methyl esters. A Hewlett Packard HP6890 GC System (Hewlett

Packard, Palo Alto CA, USA), with a 30 m x 0.25 mm (DB-255) fused carbon-silica column, coated with cyanopropylphenyl (J & W Scientific, Folsom, CA) was used. The injector and detector port temperatures were set at 250ºC. The oven temperature began at 270ºC for 2 minutes and then rose by 10ºC per minute to a temperature of 190ºC and held for 1 minute before increasing 3ºC per minute to 220ºC, and was maintained to give a full run time of 28 minutes. A split ratio of 10:1 and an injection volume of 5 mL were used. Fatty acid methyl ester peaks were ascertained by comparing their retention times with the retention times of synthetic standards of known fatty acid composition (Nu Check Prep Elysian, MN, USA) and were quantified using Chemstations Version A.04.02 for GC analysis. The fatty acid results were reported as percentage of total fatty acids.

2.11.4 Erythrocyte membrane fatty acid and omega 3 index

For erythrocyte membrane fatty acid analysis, 1 mL of whole blood was collected into an

EDTA-coated Eppendorf tube, and 0.5 mL was transferred into a 0.2 mL butylated hydroxyl anisole-coated Eppendorf tube. The transferred blood was gently mixed for 20 seconds and then centrifuged at 3000 g for 10 minutes at 4ºC (BECKMAN, Allegra 6R centrifuge,

U.S.A). The clear plasma was discarded and erythrocyte pellets were stored at -80ºC and sent on dry ice to Nutraceuticals Research Group, University of Newcastle, NSW, Australia. The protocol was provided by Prof. Manohar Garg and published in a study by Burrows et. al.,(2011).

Erythrocyte pellets were washed three times with cold buffer (50 mM Tris-HCL, pH 7.5, which contained 5 mM EDTA and 1mM dithiothreitol) followed by mixing with a vortex and centrifugation at 8500 g at 4°C for 10 minutes. The supernatant was discarded and the

erythrocyte pellets were then lysed with cold deionised water, vortexed and centrifuged and stored at -70°C until analysis. Fatty acid composition of erythrocytes was analysed by gas chromatography based on methods established by Lepage and Roy (1986), and followed the detailed procedure described in the preceding section.

The omega-3 index was calculated as the sum of EPA and DHA in the erythrocyte membrane as a percentage of total fatty acids (Harris & von Schacky, 2004).

2.11.5 Gene expression

2.11.5.1 Harvesting of white blood cells

White blood cells (WBCs) were extracted using a modified protocol of ammonium chloride lysis of erythrocytes (Muirhead et al., 1986). One part of whole blood was mixed with 5 parts of 1x ammonium chloride erythrocyte lysing reagent (0.1 mM EDTA, 150 mM NH4Cl, and

10 mM NaHCO3) and incubated on ice for 45 minutes until complete lysis of erythrocytes occurred. The WBC pellet was obtained after centrifugation (BECKMAN, Allegra 6R centrifuge, U.S.A) at 2000 g for 5 minutes at 4°C. This procedure was repeated twice to remove erythrocyte remnants found in the WBC pellet. The clean pellet obtained after the washes was the final harvest of white cell pellet. This pellet was then resuspended in 1.0 mL

RNAlater® solution and stored at -20°C for 5 days, after which the RNAlater® was removed and it was then stored at -80°C until further processing.

2.11.5.2 Extraction of RNA

Total RNA of the WBC pellet was extracted using a RNeasy Mini Kit (Qiagen, Clifton Hill,

Victoria, Australia) following the manufacturer instructions. The WBC, free of RNAlater®, was homogenised for 50 seconds in 0.5 mL Tri-Reagent, followed by incubation (25°C for 10

minutes) and centrifugation (Heraeus Biofuge 13, U.S.A) at 16000 g for 15 minutes at 4ºC.

This allowed the formation of a clear clarified homogenate to which 200μL bromochloropropane (BCP) was added and mixed vigorously for 15 seconds, incubated at

25°C for 10 minutes, and centrifuged at 16000 g, 4oC for 15 minutes. The added BCP caused a phase separation and RNA was obtained in an aqueous phase. An equal volume of 75% ethanol was added to precipitate the extracted RNA. The precipitated RNA was transferred to a RNeasy mini spin column (Qiagen RNeasy kit, Australia) and centrifuged for 15 seconds at

14000 g (Eppendorf, Centrifuge 5424, Germany). The RNA was washed by the addition of

700 µL RW1 buffer and centrifuged at 14000 g for 15 seconds, followed by the addition of another 350 µL RW1 buffer with centrifugation at 14000 g for 15 seconds. To remove any traces of DNA, 80 µL of DNase solution was added and incubated at 25oC for 15 minutes.

Another washing step was performed to further purify the RNA. Total RNA was eluted into a clean 1.5 mL Eppendorf tube using 50 µL RNase-free water, by centrifuging for 1 minute at

14000 g and storing at -80ºC until further use.

2.11.5.3 RNA concentration and quality

The RNA yield was quantified using a Nanodrop Spectrophotometer (NanoDrop

Technologies, Wilmington, Delaware, USA). The concentration of the sample was expressed as ng/µl and measured at wavelengths of 260 nm. The ratios of 260/230 and 260/280 between

1.8 and 2.1 indicated good purity of the RNA samples.

The integrity of RNA was assessed on 1.2% agarose gels stained with 1:50 concentration

Gelstar nucleic acid stain (Cambrex, Rockland, ME, USA). A stock solution containing 15 grams Ficoll 400 (Pharmacia Biotech) and 0.25 grams Orange G was mixed and volume was made to 100 mL with milli-Q water. Five L Gelstar was added to 1 mL of the above

solution to make a loading buffer. Six µL of RNA samples mixed with 6 µl of loading buffer containing Gelstar and 4 µl of TE buffer was loaded on the 1.2% agarose gel and run at 100 volts for 45 minutes. Standard Mouse liver RNA was used as a positive control. A visual image of the gel was taken using the Gel Doc (Vilber Lourmat, France).

2.11.5.4 cDNA synthesis cDNA was synthesised by a two-step process using the cDNA Synthesis Kit (Bioline,

Sydney, Australia) following the manufacturer’s protocol. Briefly, for each sample, a 10 µL mixture was prepared to contain 8 µL of RNA (125 ng/ µL), 1 µL random hexamer and 1 µL

10nM dNTP, The mixture was incubated at 65oC for 10 minutes in a PCR thermal cycler

(BioRad, Richmond, CA, USA) and placed on ice for 2 minutes.

Four µL of 5X RT buffer, 1 µL RNAse inhibitor and 0.25µL reverse transcriptase were then added in the above mixture and made to a total volume of 20 µL using DEPC water. cDNA was synthesised by incubation of the reaction mix at 42oC for 60 minutes, followed by 70oC for 15 minutes to terminate the reaction, and then chilled on ice immediately. The resultant cDNA samples were stored at -20oC until further analysis. A negative control reaction was performed by negating the reverse transcriptase.

2.11.5.5 Choice of housekeeping gene and candidate genes

Beta-2 microglobulin (β2M), hypoxanthine phosphoribosyltransferase 1 (HPRT1), ribosomal protein S7 (RPS7) and ribosomal protein L8 (RLP8) were initially selected as housekeeping genes based on a canine study (Brinkhof et al., 2006), to test against the samples collected in the current experiments. Beta-2 microglobulin was chosen to be used in the assay as the housekeeping gene from all those tested due to its superior amplification, and stable

expression in response to treatments. The candidate genes chosen for this study are provided in the table below (Table 2.3). These genes were reported to change their levels of expression following fish oil supplementation in humans (Bouwens et al., 2009; Gorjao et al., 2006;

Lima et al., 2007; Weaver et al., 2009). The primers were designed using the program Primer

3 (Rozen & Skaletsky, 2000) following the principle for the primer design that was used in the quantitative PCR assay. However, only three genes out of ten genes (HSP90, HSP70 and

IL1β) were detectable in the WBCs.

Table 2.3: List of housekeeping and candidate genes used in the study

Gene Left Primer (Sense) Right Primer (Antisense) HSP70 Candidate gene GGGGAGGACTTCGACAACAG AAGTCGATGCCCTCGAACAG HSP90 Candidate gene GCAGAGAGAGGAAGAAGCTATTCA CCTCATTTCCAGCAAGAGCAT IL1β Candidate gene ACAAACAAGTGGTGTTCCACATG TGGGCTTTCCATCCTTCATC TNF Candidate gene ATGTTGTAGCAAACCCCGAAG ACAACCCATCTGACGGCACT IL6 Candidate gene TCAATCAGGAGACCTGCTTGAC GTGGTTGGGTCAGGAGTGGT BAX Candidate gene GCTTCAGGGTTTCATCCAAGAT CGCTTGAGACATTCGCTCAG CD36 Candidate gene TCGTGAATAAGACCCAGACCTCT CGGTCACAGCCCATTCTCTT SREBF1 Candidate gene ACTGAAGCAAAGCTGAATAAGTCTG TGGGCACGTCTGTATTTCCTC Akt Candidate gene GCCAAGGTGACCATGAATGAC GTGTGGGCGACTTCATCCTT CCL2 Candidate gene CTCACCCAGCCAGATGCAA TGGAATCCTGGACCCACTTC β2M Housekeeping gene TAAGTGGGACCGAGACAACTGA AGTGACACAGTGCCCAATGTAGA

2.11.5.6 Real-time PCR

Quantitative real-time PCR was performed using a Rotor-Gene 6000 real-time PCR

Thermocycler (Corbett Research, Mortlake, NSW, Australia) in a 10 µL reaction mixture.

The PCR reaction contained 1X PCR buffer (Bioline, Sydney, NSW, Australia), 1.5 mM

MgCl2, 0.2 mM dNTP, 0.5 μM forward primer, 0.5 μM reverse primer, 0.5 U Biotaq DNA polymerase (Bioline, Sydney, Australia), 1.5 μM Syto9 green fluorescent nucleic acid stain

(Invitrogen, Sydney, Australia), and 25 ng cDNA. The real-time PCR reaction was achieved with the following steps: the mixture was preheated to 50°C for 2 minutes, and then it was denatured at 95°C for 10 minutes, followed by 40 cycles of denaturation for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds. A final extension

step was performed at 72°C for 2 minutes. The fluorescence signals were collected at the end of each annealing step during the PCR cycles. The melting curve analysis was performed to assess the specificity of the PCR amplification and primer dimer formation, and it was achieved by increasing the temperature of the reaction following PCR cycles from 50°C to

99°C, with an increment rate of 1°C every 5 seconds. The sizes of the PCR products were determined on 1.2% agarose gel and stained with a 1:50 concentration Gelstar nucleic acid stain (Cambrex, Rockland, ME, USA) to confirm the specificity of the amplification.

To quantify the relative gene expression level, a comparative cycle threshold (Ct) method was used (Schmittgen & Livak, 2008). cDNA samples were amplified in duplicates for target genes and the β2M housekeeping gene. The fluorescence Ct values were automatically detected using the quantitation analysis module of the Rotor-Gene 6000 series software

(Corbett Research, Sydney, Australia). ∆Ct values were then calculated by the difference in

Ct values between the candidate gene and the housekeeping genes. These values were then used for statistical analysis. Additionally, to determine the response of the animals to PUFA supplementation, the expression levels of the genes, 2-∆∆Ct, were calculated and then subjected to statistical analysis.

A standard dilution curve was constructed using the quantitation analysis program of the

Rotor-Gene 6000 series software (Corbett Research, Sydney, Australia) to assess the amplification efficiency of the PCR runs.

2.12 Statistical Analysis

The statistical analyses in this thesis were carried out using different statistical programs:

 Experiment 1: Windows MINITAB Version 14 (Minitab Limited, Coventry, WMD,

UK)

 Experiment 2: MedCalc (MedCalc, Mariakerke, Belgium, Version 12.7.1.0)

 Experiment 3: R (version 2.5.1, R Foundation for Statistical Computing).

The results from the experiments are presented as mean ± standard deviation (SD) or mean ± standard error of the mean (SEM), with a P value< 0.05 considered as statistically significant.

Experiment 1 (Chapter 3): For each individual fatty acid constituent in the plasma, the breed effect and the day effect were analysed using fully nested analysis of variance (ANOVA).

Significant differences between means of breeds were detected by a two-sample independent t-test. The relationship between BW gain and plasma fatty acid concentrations was determined using regression analysis.

It must be noted that initial analysis with the general linear model (GLM), wherein the breed effect and day effect was the fixed effect, and age and BW were random factors, showed no significant interaction between the breed effect and the day effect. Age and body weight showed no significant effect and hence was removed from the model.

Experiment 1 (Chapter 4): Breed differences in gene expression with respect to day of supplementation were determined using a GLM, with breed and day as main effects and with age and body weight as random factors. Age and BW showed no significant effect and hence were removed from the final model. Within a particular breed, one-way ANOVA was used to analyse the effect of flaxseed oil supplementation on gene expression. For each plasma fatty acid constituent, within a particular breed, one-way ANOVA was used to analyze the change

in concentration with the day of supplementation. The correlation between plasma fatty acid concentrations and the levels of gene expression was examined using the Pearson correlation coefficient.

Experiment 2 (Chapter 5) - Supplementary study: Bland-Altman (BA) test of agreement was used to analyze the relationship between CT-derived body weight and measured body weight.

To compare the differences in lean: fat ratios between the breeds, Mann-Whitney U test was used as the data was nonparametric in nature.

Experiment 3 (Chapter 6): The experimental design was a split plot with three replications.

Normality was not observed in the dataset, and hence nonparametric tests were used.

Differences between the treatment means were tested using a two-sample wilocoxon test, and differences in means between the time of treatment (Day 0 and 28) were tested using a paired-sample wilcoxon test. Kruskal Wallis test was used to determine the statistical significance for digestibility. All values are presented as means ± standard error of the means

(SEM) and R (version 2.5.1; R Foundation for Statistical Computing) was used for the statistical analysis. A P value of <0.05 was considered statistically significant.

Chapter 3 Evaluation of breed effects on n-3 PUFA metabolism with dietary flaxseed oil supplementation in dogs

Previous studies in mixed breeds of dogs (Bauer et al., 1998; Dunbar et al., 2010) that were fed a dietary source of flaxseed have reported the accumulation of n-3 fatty acids in the three major serum lipid sub fractions (phospholipids, triacylglycerol and cholesteryl esters) and have reported these changes as early as four days. Using two different breeds of dogs, the current study aimed to investigate the breed differences in biochemical responses (changes to total plasma fatty acid) to ALA enrichment. The present study also aimed to investigate the transcriptional responses (changes to inflammatory-related gene expression) (reported in

Chapter 4), which required the need to determine an effective supplementation period for future experiments in a cost-effective manner, and hence a three week time period was selected in the present pilot study.

For maximising the possibility of observing responses within three weeks, a relatively large dose of flaxseed oil (100 ml/kg food, which equated to 2.4 ± 0.2 ml/kg BW) was chosen. The feeding regime was standardised so that all the dogs of the same breed were fed the same amount, i.e. 30 ml/beagle and 60 ml/greyhound. These doses were calculated based on the average weight of the dogs in the current study: beagles 12.4 ±1.2 kg, and greyhounds

25.6 ± 2.0 kg. The present study accessed dogs at the completion of an unrelated experiment where they were fed a basal diet for four months. The same basal diet was also used in the current study. This was fortuitous, as it provided a controlled environment for four months prior to this study, during which all dogs were fed an identical diet managed in identical environmental conditions. This experiment has been published in British Journal of

Nutrition, 106, S139-S141. doi: 10.1017/s0007114511000523.

64 Chapter 4 Flaxseed Oil Supplementation Alters the Expression of Inflammatory-related Genes in Dogs

This experiment has been published in Genetics and Molecular Research, 13(3), 5322.

71 APPENDIX III

Summary of the results and additional material for Experiment 1 (Chapters 3 and 4)

The main objective of Experiment 1 (Chapter 3) was to identify breed differences in the response to ALA-rich flaxseed oil by investigating changes in the fatty acid concentration (n-

3 fatty acids, ALA, EPA, DHA, and n-6 fatty acids, LA and AA) of the plasma lipids. The

fatty acid concentrations were reported as a percentage of the total fatty acids. Experiment 1 revealed a significant breed difference (P=0.02) with respect to plasma DHA concentrations, wherein beagles maintained a higher plasma concentration of DHA than greyhounds

throughout the study. This significant breed difference was observed at Day 15 (P=0.036) and

Day 22 (P=0.002) (post-supplementation) and was also observed at Day 0 (P=0.008) (pre-

supplementation). The majority of DHA accumulates in the membrane phospholipids of the

brain as well as the retina (Picq et al., 2010). This could explain why the concentrations were

not elevated in the plasma samples of the present study, and is further supported by a study

that reports the metabolic fate of DHA and accumulation in the plasma depends on the lipid

form in which it was ingested: triglyceride or phosphatidylcholine (Lemaitre-Delaunay et al.,

1999). For other plasma fatty acids (ALA, EPA and LA), greyhounds showed a numerically

higher increase compared with beagles, and, conversely, it was for DHA alone that beagles had a higher plasma concentration. For this study, there was the opportunity to access dogs of

two different breeds from a controlled environment, wherein all the dogs were fed a basal diet

for four months immediately prior to our study. Therefore, the influence of previous diet can

be ruled out, as all dogs were fed an identical diet, further supporting the suggestion that the observed differences were due to a differential breed effect on PUFA metabolism. A breed effect on lipid metabolism has been previously demonstrated with evidence of primary

hyperlipidemia exhibited in miniature schnauzers (Mori et al., 2010; Rogers et al., 1975; Usui

et al., 2014). Experiment 1 also investigated breed differences in transcriptional responses to

86 PUFA (Chapter 4). The breed differences observed in transcriptional responses further

support the differential breed effect observed in the biochemical response. The research

finding from this study (Experiment 1) is important when considering nutrition management

strategies for dogs, as suggested by others (Fleischer et al., 2008).

Having identified a breed difference in biochemical and transcriptional responses to n-3 fatty

acids, it would have been ideal to design an experiment to investigate the metabolism of ALA

on the hepatoma cells (liver being the central organ for the whole body lipid metabolism) and

on the expression of enzymes involved in the synthesis of EPA, DPA and DHA from ALA

(delta-5 desaturase, delta-6 desaturase, elongase-5 and elongase-2). However, this project accessed privately owned dogs and hence was limited to non-invasive measurements.

Additionally, the project was financially constrained, and hence these measurements could not be included within the scope of this PhD project, but should be considered as an objective for future studies. To definitely determine a differential breed metabolism, it would have been ideal to include isotope labelled fatty acids or a novel tracer technique, which allows multiple stable isotopically labelled essential fatty acids to be simultaneously and independently measured (Lin & Salem, 2002). Additionally, plasma levels of DPA were not measured in this study and for completeness should be considered in future experiments investigating breed differences in response to PUFA.

This study used mRNA expression instead of protein expression analysis, as mRNA

expression results has been reported to highly correlate with protein analysis (Greenbaum et

al., 2003; Greenbaum et al., 2002; Guo et al., 2008; Jansen et al., 2002) and the data of

mRNA transcription level to represent the expression of genes have been widely applied

87 elsewhere in different tissues of different species of organisms and with a wide range of

treatments. It is, however, recognised that this study was limited to three genes due to the

limited detectable level of other candidate genes in the WBC, as detailed previously. A larger

scale array of genes would be beneficial (Calder, 2013; Ulven et al., 2014) and this should be

considered as a direction for future work, possibly by employment of microarray or

transcriptomic approaches.

Experiment 1 reported an increase in the concentrations of ALA and EPA following supplementation with flaxseed oil but not of DHA, and this is similar to previous studies in

dogs (Bauer et al., 1998; Dunbar et al., 2010). The dogs in the experiment consumed 52 times

more ALA with the supplemented diet than with the basal diet and, as mentioned earlier, this

was done to maximise the possibility of observing responses within three weeks. The dogs

gained weight during the study; however, regression analysis showed no relationship between

BW gain and any of the plasma fatty acid constituents investigated. Previous studies in dogs

report the accumulation of n-3 fatty acids in the serum as early as four days (Bauer et al.,

1998; Dunbar et al., 2010) and another study in rats (Fickova et al., 1998) that investigated the influence of PUFA on BW gain and adipocyte size was conducted for a short period of one week. These studies support the rationale behind the short duration of this experiment

(three weeks).

It is recognised that the experimental design was limited by the small number of dogs

borrowed from private owners and these small numbers could have influenced the power of

the study: (for n=5, the statistical power was 0.6). However, it should be recognised that in this study we have seen significant differences between the treatments even with small numbers of dogs. Similarly small numbers of dogs have been used in previous dog research

88 (Wallenstein et al., 1980). Additionally the results of the current study have been published in a peer-reviewed scientific journal (Purushothaman et al., 2011). To increase the statistical power to 0.8 with a similar study design, the number of animals required for future experiments have been summarised in the table below (Appendix III, Table 1). A word of caution, however, needs to be placed on the practicality of acquiring large number of dogs from private owners. To enhance the robustness of the study design, future study designs could consider having a control group of dogs fed a diet low or devoid of omega-3 fatty acids; a cross-over study design can also be considered provided a longer wash-out period is included. Another potential confounding factor could be the age of the study animals, as it is known that age influences lipid metabolism in dogs (Kawasumi et al., 2014); however, age and BW did not contribute to significant differences tested with a GLM, and hence were removed from the final model.

Appendix III Table 1: Number of animals calculated for future experiments based on the measurements in the current study design

No. of Animals (n) for Power = 0.8

Plasma fatty acids

ALA 7

EPA 7

DHA 18

LA 7

AA 12

Gene expression

HSP90 18

HSP70 12

IL1β 18

89 Chapter 5 Whole Body Computed Tomography with Advanced Imaging Techniques: A Research Tool for Measuring Body Composition in Dogs

This experiment has been published in Journal of Veterinary Medicine, 2013, 6. doi:

10.1155/2013/610654

Chapter 6 Transcriptional, Biochemical and Body Composition Changes in Response to DHA-rich Fish Oil during Weight Gain in Two Dog Breeds

Dharma Purushothaman1, Shu-Biao Wu1, Vasilieos Giagos2, Barbara Ann Vanselow3 and Wendy Yvonne Brown1

1Animal Science, School of Environmental and Rural Science, University of New England, Armidale, NSW, 2351, Australia 2Statistics, School of Science and Technology, University of New England, Armidale, NSW, 2351, Australia 3NSW Department of Primary Industries, Beef Industry Centre, University of New England, Armidale, NSW, 2351, Australia

Running title: DHA-rich fish oil and weight gain in dogs

Manuscript submitted to Research in Veterinary Science

Chapter 7 Discussion and Conclusions

The primary objective of this PhD project was to further the understanding of biochemical responses (plasma fatty acid composition) and transcriptional responses (changes to WBC inflammatory-related gene expression) to n-3 fatty acids from two dietary sources (ALA-rich flaxseed oil and DHA-rich FO) in two different breeds of dogs. In addition to this, changes in body composition were investigated to correlate with the biochemical and transcriptional responses. This chapter discusses the major findings of the project and limitations of the research not discussed previously in the experimental chapters

7.1 Major Findings

7.1.1 Breed differences in biochemical responses to alpha-linolenic acid rich flaxseed oil

and docosahexaenoic acid-rich fish oil

The main objective of Experiment 1 (Chapter 3) was to identify breed differences in the response to ALA rich flaxseed oil by investigating changes in the fatty acid concentration

(n-3 fatty acids: ALA, EPA, DHA and n-6 fatty acids: LA and AA) of the plasma lipids. The fatty acid concentrations were reported as a percentage of the total fatty acids. Experiment 1 revealed a significant breed difference (P=0.02) with respect to plasma DHA concentrations, wherein beagles maintained a higher plasma concentration of DHA than greyhounds throughout the study. This significant breed difference was observed at Day 15 (P=0.036) and

Day 22 (P=0.002) (post-supplementation) and was also observed at Day 0 (P=0.008) (pre- supplementation). For other plasma fatty acids (ALA, EPA and LA), greyhounds showed a numerically higher increase compared with beagles, and conversely it was for DHA alone that beagles had a higher plasma concentration. For this study, there was this opportunity to

143

access dogs of two different breeds from a controlled environment, wherein all the dogs were fed a basal diet for four months immediately prior to our study. Therefore, the influence of previous diet can be ruled out, as all dogs were fed an identical diet, further supporting the suggestion that the observed differences were due to a differential breed effect on PUFA metabolism. A breed effect on lipid metabolism has been previously demonstrated with evidence of primary hyperlipidemia exhibited in miniature schnauzers (Mori et al., 2010;

Rogers et al., 1975; Usui et al., 2014). Experiment 1 also investigated breed differences in transcriptional responses to PUFA (Chapter 4). The breed differences observed in transcriptional responses further support the differential breed effect observed in the biochemical response. The research finding from this study (Experiment 1) is important when considering nutrition management strategies for dogs, as suggested by others (Fleischer et al.,

2008).

Having identified a breed difference in biochemical and transcriptional responses to n-3 fatty acids, it would have been ideal to design an experiment to investigate the metabolism of ALA on the hepatoma cells (liver being the central organ for the whole body lipid metabolism) and on the expression of enzymes involved in the synthesis of EPA, DPA and DHA from ALA

(delta-5 desaturase, delta-6 desaturase, elongase-5 and elongase-2). However, this project accessed privately owned dogs and hence was limited to non-invasive measurements.

144

measured in this study and for completeness should be considered in future experiments investigating breed differences in response to PUFA.

Experiment 1 reported an increase in the concentrations of ALA and EPA following supplementation with flaxseed oil but not of DHA, and this is similar to previous studies in dogs (Bauer et al., 1998; Dunbar et al., 2010). The dogs in the experiment consumed 52 times more ALA with the supplemented diet than with the basal diet and, as mentioned earlier, this was done to maximise the possibility of observing responses within three weeks. The dogs gained weight during the study; however, regression analysis showed no relationship between

BW gain and any of the plasma fatty acid constituents investigated. Previous studies in dogs report the accumulation of n-3 fatty acids in the serum as early as four days (Bauer et al.,

(three weeks).

It is recognised that the experimental design was limited by the small number of dogs borrowed from private owners and these small numbers could have influenced the power of the study. However, it should be recognised that similarly small numbers of dogs have been used in previous dog research (Wallenstein et al., 1980) and that this study has been published in a peer-reviewed scientific journal (Purushothaman et al., 2011). Another potential confounding factor could be the age of the study animals, as it is known that age influences lipid metabolism in dogs (Kawasumi et al., 2014); however, age and BW did not contribute to significant differences tested with a GLM, and hence were removed from the final model.

145

In Experiment 3, breed differences in biochemical responses to DHA-rich FO (treatment) and

LA-rich sunflower oil (control) were investigated. Similar to the findings of the flaxseed oil study (Experiment 1), a trend was seen indicating a differential breed response for erythrocyte membrane DPA and erythrocyte membrane DHA fatty acid concentration, wherein beagles had a higher concentration than greyhounds. However, these findings should be taken with caution as there is high variability in the dataset and the few numbers of dogs used in the study obscured the chances of arriving at a P value. Additionally, the dogs of the two different breeds used in Experiment 3 were from different properties and the two-week wash out period might not have been sufficient to overcome the effect of the respective diets.

Enquiries made from the dog owners showed the diets were different between the breeds.

7.1.2 Breed differences in transcriptional responses to alpha-linolenic acid rich

flaxseed oil and docosahexaenoic acid-rich fish oil

The main objective of Experiment 1 (Chapter 4) was to identify whether there is a breed difference in the transcriptional responses to ALA-rich flaxseed oil. Similarly, Experiment 3 also investigated the possible breed differences in transcriptional responses to DHA-rich FO

(Chapter 6).

7.1.2.1 Breed differences in baseline gene expression

Interestingly, the expression levels of inflammatory-related genes (HSP90 and IL1β) in WBC were significantly different in the two breeds of dogs even prior to supplementation with flaxseed oil (Experiment 1, Chapter 4). It should be noted that both of these breeds of dogs were subjected to a controlled environment for four months prior to our study, during which all dogs were fed an identical diet and managed in identical environmental conditions. Hence the effect of previous diet on the gene expression can be ruled out and breed differences

146

observed are considered to be due to breed effect. This observation is supported by Ko et al.

(2003), showing that LCn-3FA metabolism was changed by the genetic modification of a mouse strain. On the other hand, the two breeds of dogs in Experiment 3 (Chapter 6) were from different properties and the two-week pre-test phase was possibly not long enough to overcome differences due to dietary difference prior to the two-week adaption period.

Additionally, the number of dogs used in the trial was limited by the availability of dogs and kennel space. All these factors could have contributed to varied results in gene expression in the baseline measurements prior to FA supplementation, as summarised in Table 7.1.

Table 7.1: Summary and Comparison of Results between Experiments 1 and 3

Experiment 1 Baseline – comparison between breeds HSP90 HSP70 IL1β Beagles > Greyhounds ND between breeds Beagles > Greyhounds Experiment 3 Baseline – comparison between breeds HSP90 HSP70 IL1β ND between breeds ND between breeds ND between breeds Experiment 1 Effect of ALA rich flaxseed oil HSP90 HSP70 IL1β Greyhound ↓ ND ↓ then ND Beagle ND ND ND Experiment 3 Effect of DHA rich FO HSP90 HSP70 IL1β Greyhound ND ND ND Beagle ↑ ND ND ND, no difference

7.1.2.2 Breed differences in gene expression in response to supplementation

Experiment 1 (Chapter 4) investigated the transcriptional responses to ALA-rich flaxseed oil and demonstrated that dietary flaxseed oil significantly decreased (P<0.05) the expression of heat shock proteins (HSP90) and inflammatory cytokines (IL1β) in greyhounds. As mentioned in Chapter 3 (Experiment 1), supplementation with flaxseed oil resulted in increased concentrations of plasma ALA and EPA after 22 days of treatment, suggesting that

147

ALA and/or EPA modulated the activities of the genes. Further, the downregulation of the genes were found to be negatively correlated with the plasma concentrations of ALA and

EPA. DHA has been reported to upregulate the HSP90 gene in neutrophils and monocytes of healthy humans (Gorjao et al., 2006). In contrast, flaxseed oil supplementation downregulated HSP90 in the WBCs of greyhound dogs (Experiment 1, Chapter 4). It has been shown that different n-3 fatty acids can have different effects on gene expression and on the functions of neutrophils, monocytes and lymphocytes (Gorjao et al., 2009; Gorjao et al.,

2006; Verlengia et al., 2004). On the other hand, EPA has been found to downregulate IL1β in healthy humans (Weaver et al., 2009) and this is consistent with the findings in this study

(Experiment 1, Chapter 4). It is possible that the differential gene expression observed only in greyhounds could be because of their higher plasma concentrations of ALA and EPA compared to the beagles on Day 22 of supplementation with flaxseed oil. Prior to supplementation, the plasma concentrations of ALA were lower in greyhounds than in beagles. As the supplemented diet had 52 times more ALA than the basal diet had, the greater change of ALA in the body of greyhounds apparently caused the downregulation of the

HSP90 and IL1β genes.

Comparing the results of the flaxseed oil study (Experiment 1, Chapter 4), with the FO study

(Experiment 3, Chapter 6) as summarised in Table 7.1 shown above, an upregulation of the

HSP90 gene was seen in the beagles supplemented with DHA-rich FO in contrast to the downregulation of the HSP90 gene seen in greyhounds supplemented with ALA-rich flaxseed oil. This is an interesting observation that warrants further investigation to elucidate the mechanisms underlying different gene responses to different fatty acid supplements in different breeds. The possible reasons could be speculated: Experiment 3 was conducted during February when the temperature ranged between 17ºC and 36ºC, whereas Experiment 1

148

was conducted in September when the temperature ranged between 9ºC and 20ºC. The higher environmental temperatures experienced during Experiment 3 could have upregulated the stress gene, HSP90.

Additionally, there was also a significant breed difference in response to DHA-rich FO supplementation, wherein the HSP90 gene significantly upregulated (P<0.05) 1.32 ± 0.05 times in beagles; in contrast, it was downregulated 0.71 ± 0.21 times in the greyhounds.

Beagles in general are predisposed to being overweight and it might be possible that the high energy diet in the current study, wherein energy intake was increased to 70% above maintenance level, was regarded as a metabolic stress and caused the HSP90 gene to respond in an opposite manner compared to greyhounds.

It is known that total blood counts in greyhounds (including WBCs) are significantly different to other breeds (Shiel et al., 2007). Total blood counts of the greyhounds were measured in the present project and showed a difference in the average proportion of the different leukocytes, as summarised in Table 7.2.

Table 7.2: Proportions of the leukocytes fractions in two breeds

Lymphocytes Monocytes Neutrophils Eosinophils Basophils

Greyhounds 20.3 % 2.2 % 73.3 % 4.0 % 0.2 %

Beagles 25.6 % 13.6 % 52.2 % 7.6 % 1.0 %

The different gene expression responses in the different breeds found in the present project may be the result of differences in the proportion of WBCs. In a human study, it was reported that genes could express differently in different subtypes of WBC (Eady et al., 2005); for

149

example, tumour necrosis factor (ligand) superfamily member 13b (TNFSF13B) and lymphocyte antigen (96 LY96: MD-2) were reported to have a higher expression in monocytes compared to other subtypes. However, no reports have demonstrated that heat shock proteins (HSP90) have a differential expression in the different cell types. Therefore, we cannot conclude this is the reason why different breeds showed different levels of gene expression in our study. The protocol followed for the gene expression analysis was identical for beagles and greyhounds, and hence the possibility of an ex-vivo effect influencing the observed breed differences can be minimal.

This study used mRNA expression instead of protein expression analysis, as mRNA expression results has been reported to highly correlate with the protein expression analysis

(Greenbaum et al., 2003; Greenbaum et al., 2002; Guo et al., 2008; Jansen et al., 2002) and the data of mRNA transcription level to represent the expression of genes have been widely applied elsewhere in different tissues of different species of organisms and with a wide range of treatments. It is, however, recognised that this study was limited to three genes due to the limited detectable level of other candidate genes in the WBC, as detailed previously. A larger scale array of genes would be beneficial (Calder, 2013; Ulven et al., 2014) and this should be considered as a direction for future work, possibly by employment of microarray or transcriptomic approaches.

7.1.3 Computed tomography combined with advanced image analysis software as an

alternative non-invasive method for assessing body composition in dogs

Experiment 2 investigated the suitability of CT as a phenotypic measurement to correlate with the biochemical and transcriptional responses to fatty acids. Further, Experiment 2

150

(Chapter 5) investigated the potential for advanced image analysis software programs to determine body composition in dogs, with an application to canine obesity research.

From human studies it has been suggested that CT may be a more accurate method for measuring body composition than DEXA (Lane et al., 2005). The first study that utilised CT for measuring body composition in dogs was conducted by Ishioka et al. (2005b), and demonstrated that the fat content measured at the third lumbar vertebra (L3) using the attenuation range of −135/−105HU had the best correlation; correlation coefficient 푟 = 0.98, with the body fat content estimated by the deuterium oxide dilution method. However, CT slices analyzed were limited to only three levels, the twelfth thoracic vertebra (T12), the third lumbar vertebra (L3), and the fifth lumbar vertebra (L5), and were only investigated in beagles. The canine study (Ishioka et al., 2005b) also demonstrated the potential for fat to be overestimated at 190/−30HU. Using Ishioka’s attenuation range, a study was conducted in dachshunds that are chondrodystrophic breeds with a specifically unique body conformation

(Comstock et al., 2013). The results from the dachshund study showed that the fat area measured at L3 and L5 using attenuation ranges −135/−105 Hounsfield units (HU) was the significantly dependent on BW (P = 0.05). A more recent study (Adolphe et al., 2014) also approached an indirect method wherein the total body was calculated as the sum of visceral fat and subcutaneous fat of the entire abdomen; the abdominal fat was obtained from the sum of the two vertebral slices from cranial thoracic vertebra 13 to caudal lumbar vertebra 7 (i.e.

T13 to L7). The above mentioned studies have used specific CT slices as representative of the whole body fat. There is, therefore, a need for an improved CT method in dogs. Traditional

CT image analysis is cumbersome in a whole body scan because of the large number of CT images involved and the manual calculations required in the prediction equations. The

151

application of advanced image analysis software programs simplifies and automates this process (Haynes et al., 2010; Kobayashi et al., 2014).

In Experiment 2, whole body CT scans with regular intervals were performed on beagles and greyhounds that were subjected to a 28-day weight-gain protocol and the CT images obtained were analysed using software programs OsiriX, ImageJ and AutoCAT. The CT scanning technique was able to differentiate bone, and lean and fat tissue in dogs, and proved sensitive enough to detect increases in both lean and fat during weight gain over a short period of four weeks. A significant difference in the lean:fat ratio was also observed between the two breeds on both Days 0 and 28 (P<0.01). Total body fat was determined from the sum of the total of the bone and lean and fat tissues, and its accuracy can be relied on as it was determined based on a whole body scanning approach, as opposed to using specific CT slices as reported in other studies (Adolphe et al., 2014; Comstock et al., 2013; Ishioka et al., 2005b).

Therefore, CT and advanced image analysis proved useful in the current study for the estimation of body composition in dogs and has the potential to be used in canine obesity research. This method was then used to determine the total body fat percentage in our final experiment (Experiment 3). Future research should involve the validation against a gold standard, such as DEXA or deuterium oxide dilution, and also explore the possibility of estimating the visceral/subcutaneous ratio (V/S) to determine visceral obesity, as this has been linked to metabolic diseases (Bergman et al., 2006).

152

7.1.4 Docosahexaenoic acid-rich fish oil did not reduce weight gain in physiologically

normal dogs – weight gain dog model

Experiment 3 developed a short-term canine obesity model (four weeks), which was then used to test the effectiveness of PUFA supplements on weight gain. Previous studies have reported obesity models that overfed dogs for twelve weeks, resulting in an increase in BW of

23% (Adolphe et al., 2014), and for seven months, with a resultant increase in BW by 43%

(Bailhache et al., 2003; Gayet et al., 2004). However, there are currently no standard weight gain models for dogs. The observed increase in BW in both beagles (12%) and greyhounds

(8%) within four weeks (Experiment 3) suggests our model was effective and can be considered for future research.

Using this model, we tested the hypothesis that when feeding dogs iso-caloric diets that were designed to increase BW, supplementation with DHA-rich FO would result in less BW gain than supplementation with SF. The findings of the study (Chapter 6), however, did not support the hypothesis, and beagles supplemented with FO actually gained more weight. This finding is similar to another study (Raclot et al., 1997) conducted on rats fed a high fat diet

(20% fat) and compared BW gain in rats fed different n-3 fatty acid supplements: EPA,

DHA, EPA plus DHA and native FO. It is interesting to note that in spite of presence of n-3 fatty acids in the native FO, the final BW of the rats was highest in the FO group compared to the control group. However, in the same study on rats, the results of total BW and mean weight gain of the fat cells in the retroperitoneal adipose tissue were contradictory; mean weight of the fat cells (µg) in retroperitoneal adipose tissue was the highest in the control group fed lard plus olive oil, whereas the final BW of the rats was highest in the FO group.

Two studies comparing the effect of FO on BW gain can produce inconsistent results and this could be due to several factors, which include the individual animal variation, different

153

genetic strains of animals used, different physiological state, differences in composition of the supplementation oil used (EPA/DHA ratio), differences in the doses, and differences in the baseline values of EPA and DHA. It is possible that some of these listed factors might also have impacted on BW gain in the animals in our study, and it is recognised that larger numbers of animals would help to ameliorate these potential effects.

7.2 Conclusions

Two of the experiments in this PhD project explored the use of ALA-rich flaxseed oil and

DHA-rich FO as dietary supplements in two breeds of dogs. The results from these two experiments indicate a potential breed difference in the metabolism of PUFA, supported by the biochemical and transcriptional responses to PUFA. This warrants further investigation and could be beneficial for the improvement of canine nutrition and health management.

Short-term supplementation (three weeks) with ALA-rich flaxseed oil suppressed the expression of heat shock protein (HSP90) and inflammatory cytokine (IL1β) in greyhounds and, on the other hand, short term supplementation (four weeks) with DHA-rich FO increased the expression of heat shock protein (HSP90) in beagles. These findings suggest that the composition of the supplementation oil may be important for achieving an impact when used for therapeutic purposes, such as a dietary management strategy for obesity.

154

Chapter 8 Consolidated Reference List

Abell, T. L., Minocha, A., & Abidi, N. (2006). Looking to the future: electrical stimulation for obesity. American Journal of the Medical Sciences, 331(4), 226-232.

Abramoff, M. D., Magelhaes, P. J., & Ram, S. J. (2004). Image processing with ImageJ. Biophotonics International, 11(7), 36-42.

Aderem, A., & Ulevitch, R. J. (2000). Toll-like receptors in the induction of the innate immune response. Nature, 406(6797), 782-787.

Adkins, Y., & Kelley, D. S. (2010). Mechanisms underlying the cardioprotective effects of omega-3 polyunsaturated fatty acids. Journal of Nutritional Biochemistry, 21(9), 781- 792. doi: 10.1016/j.jnutbio.2009.12.004

Adolphe, J. L., Silver, T. I., Childs, H., Drew, M. D., & Weber, L. P. (2014). Short-term obesity results in detrimental metabolic and cardiovascular changes that may not be reversed with weight loss in an obese dog model. British Journal of Nutrition, 1-10.

Ailhaud, G., Grimaldi, P., & Negrel, R. (1992). Cellular and molecular aspects of adipose tissue development. Annual Review of Nutrition, 12(1), 207-233.

Akira, S., Hirano, T., Taga, T., & Kishimoto, T. (1990). Biology of multifunctional cytokines: IL 6 and related molecules (IL 1 and TNF). The FASEB Journal, 4(11), 2860-2867.

AOAC Official Method of Analysis, M. (2006). Fat (Crude) in meat and meat products. In AOAC (Ed.), 18th. Gaithersburg, MD: AOAC Int., .

Arita, M., Yoshida, M., Hong, S., Tjonahen, E., Glickman, J. N., Petasis, N. A., Blumberg, R. S., & Serhan, C. N. (2005). Resolvin E1, an endogenous lipid mediator derived from omega-3 eicosapentaenoic acid, protects against 2, 4, 6-trinitrobenzene sulfonic acid- induced colitis. Proceedings of the National Academy of Sciences of the United States of America, 102(21), 7671-7676.

Armstrong, P. J., & Ford, R. B. (1989). Hyperlipidemia. In R. W. Kirk (Ed.), Current Veterinary Therapy X (pp. 1046-1050). Philadelphia, PA: WB Saunders Co.

Armstrong, P. J., & Lund, E. M. (1996). Changes in body condition and energy balance with aging. Veterinary Clinical Nutrition, 3, 83-87.

155

Badowska-Kozakiewicz, A., & Malicka, E. (2012). Immunohistochemical evaluation of expression of heat shock proteins HSP70 and HSP90 in mammary gland neoplasms in bitches. Polish Journal of Veterinary Sciences, 15(2), 209-214.

Bailhache, E., Ouguerram, K., Gayet, C., Krempf, M., Siliart, B., Magot, T., & Nguyen, P. (2003). An insulin‐resistant hypertriglyceridaemic normotensive obese dog model: assessment of insulin resistance by the euglycaemic hyperinsulinaemic clamp in combination with the stable isotope technique. Journal of Animal Physiology and Animal Nutrition, 87(3‐4), 86-95.

Baldwin, A. S. (1996). THE NF-κB AND IκB PROTEINS: New Discoveries and Insights. Annual Review of Immunology, 14(1), 649-681. doi: doi:10.1146/annurev.immunol.14.1.649

Barceló-Coblijn, G., & Murphy, E. J. (2009). Alpha-linolenic acid and its conversion to longer chain n-3 fatty acids: benefits for human health and a role in maintaining tissue n-3 fatty acid levels. Progress in Lipid Research, 48(6), 355-374.

Barrie, J., Nash, A. S., & Watson, T. D. G. (1993). Quantitative analysis of canine plasma lipoproteins. Journal of Small Animal Practice, 34(5), 226-231. doi: 10.1111/j.1748-5827.1993.tb02671.x

Bastard, J.-P., Maachi, M., van Nhieu, J. T., Jardel, C., Bruckert, E., Grimaldi, A., Robert, J.- J., Capeau, J., & Hainque, B. (2002). Adipose tissue IL-6 content correlates with resistance to insulin activation of glucose uptake both in vivo and in vitro. Journal of Clinical Endocrinology & Metabolism, 87(5), 2084-2089.

Bastien, B. C., Patil, A., & Satyaraj, E. (2015). The impact of weight loss on circulating cytokines in beagle dogs. Veterinary Immunology and Immunopathology, 163(3-4), 174-182. doi: 10.1016/j.vetimm.2014.12.003

Bauer, J. (1994). The potential for dietary polyunsaturated fatty acids in domestic animals. Australian Veterinary Journal, 71(10), 342-345.

Bauer, J. E. (1996). Comparative lipid and lipoprotein metabolism. Veterinary Clinical Pathology, 25(2), 49-56.

Bauer, J. E. (2004). Lipoprotein-mediated transport of dietary and synthesized lipids and lipid abnormalities of dogs and cats. Journal of the American Veterinary Medical Association, 224(5), 668-675.

Bauer, J. E. (2011). Therapeutic use of fish oils in companion animals. Journal of the American Veterinary Medical Association, 239(11), 1441-1451.

Bauer, J. E., Dunbar, B. L., & Bigley, K. E. (1998). Dietary flaxseed in dogs results in differential transport and metabolism of n-3 polyunsaturated fatty acids. Journal of Nutrition, 128(12 Suppl), 2641S-2644S.

156

Bauer, J. J. E. (2008). Essential fatty acid metabolism in dogs and cats. Revista Brasileira de Zootecnia, 37, 20-27.

Bennett, J. P., & Shields Jr, R. G. (2000). Breed-specific canine food formulations: Google Patents.

Berger, J., & Moller, D. E. (2002). The mechanisms of action of PPARs. Annual Review of Medicine, 53(1), 409-435.

Bergman, R. N., Kim, S. P., Catalano, K. J., Hsu, I. R., Chiu, J. D., Kabir, M., Hucking, K., & Ader, M. (2006). Why visceral fat is bad: Mechanisms of the metabolic syndrome. Obesity, 14, 16S-19S. doi: 10.1038/oby.2006.277

Boizard, M., Le Liepvre, X., Lemarchand, P., Foufelle, F., Ferré, P., & Dugail, I. (1998). Obesity-related overexpression of fatty-acid synthase gene in adipose tissue involves sterol regulatory element-binding protein transcription factors. Journal of Biological Chemistry, 273(44), 29164-29171. doi: 10.1074/jbc.273.44.29164

Bouwens, M., van de Rest, O., Dellschaft, N., Bromhaar, M. G., de Groot, L. C. P. G. M., Geleijnse, J. M., Muller, M., & Afman, L. A. (2009). Fish-oil supplementation induces antiinflammatory gene expression profiles in human blood mononuclear cells. American Journal of Clinical Nutrition, 90(2), 415-424. doi: 10.3945/ajcn.2009.27680

Brinkhof, B., Spee, B., Rothuizen, J., & Penning, L. C. (2006). Development and evaluation of canine reference genes for accurate quantification of gene expression. Analytical Biochemistry, 356, 36-43.

Brunner, E. J., Jones, P. J. S., Friel, S., & Bartley, M. (2009). Fish, human health and marine ecosystem health: policies in collision. International Journal of Epidemiology, 38(1), 93-100. doi: 10.1093/ije/dyn157

Buelund, L., Nielsen, D., Mcevoy, F., Svalastoga, E., & Bjornvad, C. (2011). Measurement of body composition in cats using computed tomography and dual energy X-ray absorptiometry. Veterinary Radiology and Ultrasound, 52(2), 179-184.

Burdge, G. (2004). Alpha-linolenic acid metabolism in men and women: nutritional and biological implications. Current Opinion in Clinical Nutrition & Metabolic Care, 7(2), 137-144.

Burdge, G. C., & Calder, P. C. (2005). Conversion of alpha-linolenic acid to longer-chain polyunsaturated fatty acids in human adults. Reproduction, Nutrition, Development, 45, 581-597.

Burkholder, W. J. (2001). Precision and practicality of methods assessing body composition of dogs and cats. Compendium on Continuing Education for the Practicing Veterinarian, 23(9), 1-10.

157

Burkholder, W. J., & Thatcher, C. D. (1998). Validation of predictive equations for use of deuterium oxide dilution to determine body composition of dogs. American Journal of Veterinary Research, 59(8), 927-937.

Burkholder, W. J., & Toll, P. W. (2000). Obesity. In M. S. Hand, C. D. Thatcher & R. L. Remillard (Eds.), Small Animal Clinical Nutrition. Topeka: Mark Morris Institute.

Burrows, T., Collins, C. E., & Garg, M. L. (2011). Omega-3 index, obesity and insulin resistance in children. International Journal of Pediatric Obesity, 6(2-2), E532-E539. doi: 10.3109/17477166.2010.549489

Byrne, K. P., Campbell, K. L., Davis, C. A., Schaeffer, D. J., & Troutt, F. H. (2000). The effects of dietary n-3 vs. n-6 fatty acids on ex-vivo LTB4 generation by canine neutrophils. Veterinary Dermatology, 11(2), 123-131. doi: 10.1046/j.1365- 3164.2000.00171.x

Cahill Jr, G. F. (1970). Starvation in man. New England Journal of Medicine, 282(12), 668- 675.

Calder, P. C. (1998). Dietary fatty acids and the immune system. Nutrition Review, 56, S70- S83.

Calder, P. C. (2001). Polyunsaturated fatty acids, inflammation, and immunity. Lipids, 36(9), 1007-1024.

Calder, P. C. (2006). n-3 polyunsaturated fatty acids, inflammation, and inflammatory diseases. American Journal of Clinical Nutrition, 83(6), 1505S-1519S.

Calder, P. C. (2010). Omega-3 fatty acids and inflammatory processes. Nutrients, 2(3), 355- 374.

Calder, P. C. (2013). Long chain fatty acids and gene expression in inflammation and immunity. Current Opinion in Clinical Nutrition & Metabolic Care, 16(4), 425-433.

Calder, P. C. (2015). Marine omega-3 fatty acids and inflammatory processes: Effects, mechanisms and clinical relevance. Biochimica Et Biophysica Acta-Molecular and Cell Biology of Lipids, 1851(4), 469-484. doi: 10.1016/j.bbalip.2014.08.010

Calder, P. C., & Yaqoob, P. (2009). Omega-3 polyunsaturated fatty acids and human health outcomes. BioFactors, 35(3), 266-272. doi: 10.1002/biof.42

Campbell, K. L. (1993). Clinical use of fatty acid supplements in dogs. Veterinary Dermatology, 4(4), 167-173. doi: 10.1111/j.1365-3164.1993.tb00213.x

Cannon, B., & Nedergaard, J. (2004). Brown adipose tissue: function and physiological significance. Physiological reviews, 84(1), 277-359.

158

Caughey, G. E., Mantzioris, E., Gibson, R. A., Cleland, L. G., & James, M. J. (1996). The effect on human tumor necrosis factor α and interleukin 1β production of diets enriched in n-3 fatty acids from vegtable oil or fish oil. American Journal of Clinical Nutrition, 63, 116-122.

Cespedes, E., Baylin, A., & Campos, H. (2015). Adipose tissue n-3 fatty acids and metabolic syndrome. European Journal of Clinical Nutrition, 69(1), 114-120. doi: 10.1038/ejcn.2014.150

Chang, J., Jung, J., Lee, H., Chang, D., Yoon, J., & Choi, M. (2011). Computed tomographic evaluation of abdominal fat in minipigs Journal of Veterinary Science, 12(1), 91-94.

Chauvet, A., Laclair, J., Elliott, D. A., & German, A. J. (2011a). Incorporation of exercise, using an underwater treadmill, and active client education into a weight management program for obese dogs. Canadian Veterinary Journal, 52(5), 491.

Chauvet, A., Laclair, J., & Holden, S. (2011b). Exercise and active client motivation improve rate of weight loss in obese dogs. Canadian Veterinary Journal, 52, 491-496.

Chen, F., Castranova, V., Shi, X., & Demers, L. M. (1999). New insights into the role of nuclear factor-κB, a ubiquitous transcription factor in the initiation of diseases. Clinical chemistry, 45(1), 7-17.

Chouchane, L., Danguir, J., Beji, C., Bouassida, K., Camoin, L., Sfar, H., Gabbouj, S., & Strosberg, A. D. (2001). Genetic variation in the stress protein hsp70-2 gene is highly associated with obesity. International Journal of Obesity, 25(4), 462-466. doi: 10.1038/sj.ijo.0801545

Chu, R. M., Sun, T. J., Yang, H. Y., Wang, D. G., Liao, K. W., Chuang, T. F., Lin, C. H., & Lee, W. C. (2001). Heat shock proteins in canine transmissible venereal tumor. Veterinary Immunology and Immunopathology, 82(1–2), 9-21. doi: http://dx.doi.org/10.1016/S0165-2427(01)00327-0

Chung, J., Nguyen, A.-K., Henstridge, D. C., Holmes, A. G., Chan, M. H. S., Mesa, J. L., Lancaster, G. I., Southgate, R. J., Bruce, C. R., Duffy, S. J., Horvath, I., Mestril, R., Watt, M. J., Hooper, P. L., Kingwell, B. A., Vigh, L., Hevener, A., & Febbraio, M. A. (2008). HSP72 protects against obesity-induced insulin resistance. Proceedings of the National Academy of Sciences, 105(5), 1739-1744. doi: 10.1073/pnas.0705799105

Cinti, S., Mitchell, G., Barbatelli, G., Murano, I., Ceresi, E., Faloia, E., Wang, S., Fortier, M., Greenberg, A. S., & Obin, M. S. (2005). Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. Journal of Lipid Research, 46(11), 2347-2355.

Clarys, J. P., Scafoglieri, A., Provyn, S., Louis, O., Wallace, J. A., & De Mey, J. (2010). A macro-quality evaluation of DXA Variables using whole dissection, ashing, and computer tomography in pigs. Obesity, 18(8), 1477-1485. doi: 10.1038/oby.2009.447

Colliard, L., Ancel, J., Benet, J.-J., Paragon, B.-M., & Blanchard, G. (2006). Risk Factors for Obesity in Dogs in France. Journal of Nutrition, 136(7), 1951S-1954S.

159

Comstock, J. F., Wardlaw, J. L., Brinkman-Ferguson, E. L., & Rowe, D. E. (2013). Computed tomographic assessment of body fat in Dachshunds: a pilot study. Open Journal of Veterinary Medicine, 3(1), 1-5. doi: 10.4236/ojvm.2013.31001

Considine, R. V., Sinha, M. K., Heiman, M. L., Kriauciunas, A., Stephens, T. W., Nyce, M. R., Ohannesian, J. P., Marco, C. C., McKee, L. J., & Bauer, T. L. (1996). Serum immunoreactive-leptin concentrations in normal-weight and obese humans. New England Journal of Medicine, 334(5), 292-295.

Cowley, M. A., Smart, J. L., Rubinstein, M., Cerdán, M. G., Diano, S., Horvath, T. L., Cone, R. D., & Low, M. J. (2001). Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature, 411(6836), 480-484.

Cunnane, S. C., Ganguli, S., Menard, C., Liede, A. C., Hamadeh, M. J., Chen, Z. Y., Wolever, T. M., & Jenkins, D. J. (1993). High alpha-linolenic acid flaxseed (Linum usitatissimum): some nutritional properties in humans. British Journal of Nutrition, 69(2), 443-453.

Deckelbaum, R. J., & Calder, P. C. (2015). From where will all the omega-3 fatty acids come? Current Opinion in Clinical Nutrition and Metabolic Care, 18(2), 111-112. doi: 10.1097/mco.0000000000000153

Deckelbaum, R. J., Worgall, T. S., & Seo, T. (2006). n−3 Fatty acids and gene expression. American Journal of Clinical Nutrition, 83(6), S1520-1525S.

Diez, M., & Nguyen, P. (2006). The epidemiology of canine and feline obesity. Waltham focus, 16, 2-6.

Diez, M., Nguyen, P., Jeusette, I., Devois, C., Istasse, L., & Biourge, V. (2002). Weight Loss in Obese Dogs: Evaluation of a High-Protein, Low-Carbohydrate Diet. Journal of Nutrition, 132(6), 1685S-1687S.

Dinarello, C., Arend, W., Sims, J., Smith, D., Blumberg, H., O'Neill, L., Goldbach-Mansky, R., Pizarro, T., Hoffman, H., & Bufler, P. (2010). IL-1 family nomenclature. Nature Immunology, 11(11), 973-973.

Dobenecker, B., De Bock, M., Engelen, M., Goossens, L., Scholz, A., & Kienzle, E. (2009). Effect of mitratapide on body composition, body measurements and glucose tolerance in obese Beagles. Veterinary Research Communications, 33(8), 839-847. doi: 10.1007/s11259-009-9232-5

Dorsten, C. M., & Cooper, D. M. (2004). Use of body condition scoring to manage body weight in dogs. Journal of the American Association for Laboratory Animal Science, 43(3), 34-37.

Dunbar, B. L., & Bauer, J. E. (2002). Conversion of essential fatty acids by delta 6-desaturase in dog liver microsomes. Journal of Nutrition, 132(6), 1701S-1703S.

160

Dunbar, B. L., Bigley, K. E., & Bauer, J. E. (2010). Early and sustained enrichment of serum n-3 long chain polyunsaturated fatty acids in dogs fed a flaxseed supplemented diet. Lipids, 45(1), 1-10. doi: 10.1007/s11745-009-3364-9

Dusting, G., & Stewart, A. (1990). Overview of eicosanoid metabolism and relationship to platelet-activating factor. Reproduction, Fertility and Development, 2(5), 417-421.

Eady, J. J., Wortley, G. M., Wormstone, Y. M., Hughes, J. C., Astley, S. B., Foxall, R. J., Doleman, J. F., & Elliott, R. M. (2005). Variation in gene expression profiles of peripheral blood mononuclear cells from healthy volunteers. Physiological Genomics, 22(3), 402-411. doi: 10.1152/physiolgenomics.00080.2005

Edney, A. T., & Smith, P. M. (1986). Study of obesity in dogs visiting veterinary practices in the United Kingdom. Veterinary Record, 118(14), 391-396.

Edney, A. T. B. (1974). Management of obesity in the dog Veterinary Medicine Small Animal Practice, 69, 46-49.

Eirmann, L. A., Freeman, L. M., Laflamme, D. P., Michel, K. E., & Satyaraj, E. (2009). Comparison of adipokine concentrations and markers of inflammation in obese versus lean dogs. International Journal of Applied Research in Veterinary Medicine, 7(4), 196-205.

Ellis, R. J., & Van der Vies, S. M. (1991). Molecular chaperones. Annual Review of Biochemistry, 60(1), 321-347.

Escott, E. J., & Rubinstein, D. (2003). Free DICOM image viewing and processing software for your desktop computer: what's available and what it can do for you. Radiographics, 23(5), 1341-1357.

Fahy, E., Subramaniam, S., Brown, H. A., Glass, C. K., Merrill, A. H., Murphy, R. C., Raetz, C. R., Russell, D. W., Seyama, Y., & Shaw, W. (2005). A comprehensive classification system for lipids. Journal of Lipid Research, 46(5), 839-862.

Farooqi, I. S., Wangensteen, T., Collins, S., Kimber, W., Matarese, G., Keogh, J. M., Lank, E., Bottomley, B., Lopez-Fernandez, J., & Ferraz-Amaro, I. (2007). Clinical and molecular genetic spectrum of congenital deficiency of the leptin receptor. New England Journal of Medicine, 356(3), 237-247.

Fernandez-Quintela, A., Churruca, I., & Portillo, M. P. (2007). The role of dietary fat in adipose tissue metabolism. Public Health Nutrition, 10(10A), 1126-1131.

Fickova, M., Hubert, P., Crémel, G., & Leray, C. (1998). Dietary (n-3) and (n-6) polyunsaturated fatty acids rapidly modify fatty acid composition and insulin effects in rat adipocytes. Journal of Nutrition, 128(3), 512-519.

Fisher, M., Upchurch, K. S., Levine, P. H., Johnson, M. H., Vaudreuil, C. H., Natale, A., & Hoogasian, J. J. (1986). Effects of dietary fish oil supplementation on polymorphonuclear leukocyte inflammatory potential. Inflammation, 10(4), 387-392. doi: 10.1007/bf00915822

161

Flatt, J.-P. (1995). Use and storage of carbohydrate and fat. American Journal of Clinical Nutrition, 61(4), 952S-959S.

Fleischer, S., Sharkey, M., Mealey, K., Ostrander, E. A., & Martinez, M. (2008). Pharmacogenetic and metabolic differences between dog breeds: Their impact on canine medicine and the use of the dog as a preclinical animal model. AAPS Journal, 10(1), 110-119. doi: 10.1208/s12248-008-9011-1

Fu, Z., & Sinclair, A. J. (2000). Novel pathway of metabolism of alpha-linolenic acid in the guinea pig. Pediatric Research, 47(3), 414-417. doi: 10.1203/00006450-200003000- 00021

Fullerton, G. D. (1980). Fundamentals of CT tissue characterisation. In G. D. Fullerton & J. A. Zagzebski (Eds.), Medical Physics of CT and Ultrasound: Tissue Imaging and Characterisation (Vol. 6, pp. 125-162): American Institute of Physics.

Gaiva, M. H. G., Couto, R. C., Oyama, L. M., Couto, G. E. C., Silveira, V. L. F., Riberio, E. B., & Nascimento, C. M. O. (2001). Polyunsaturated fatty acid-rich diets: effect on adipose tissue metabolism in rats. British Journal of Nutrition, 86(3), 371-377. doi: 10.1079/bjn2001392

Garvey, W. T., Maianu, L., Hancock, J. A., Golichowski, A. M., & Baron, A. (1992). Gene expression of GLUT4 in skeletal muscle from insulin-resistant patients with obesity, IGT, GDM, and NIDDM. Diabetes, 41(4), 465-475. doi: 10.2337/diab.41.4.465

Gayet, C., Bailhache, E., Dumon, H., Martin, L., Siliart, B., & Nguyen, P. (2004). Insulin resistance and changes in plasma concentration of TNFα, IGF1, and NEFA in dogs during weight gain and obesity. Journal of Animal Physiology and Animal Nutrition, 88(3-4), 157-165. doi: 10.1111/j.1439-0396.2003.00473.x

German, A., Hervera, M., Hunter, L., Holden, S., Morris, P., Biourge, V., & Trayhurn, P. (2009). Improvement in insulin resistance and reduction in plasma inflammatory adipokines after weight loss in obese dogs. Domestic Animal Endocrinology, 37(4), 214-226.

German, A., Holden, S., Wiseman-Orr, M., Reid, J., Nolan, A., Biourge, V., Morris, P., & Scott, E. (2012a). Quality of life is reduced in obese dogs but improves after successful weight loss. The Veterinary Journal, 192(3), 428-434.

German, A., Holden, S., Morris, P., & Biourge, V. (2012b). Long-term follow-up after weight management in obese dogs: The role of diet in preventing regain. The Veterinary Journal, 192(1), 65-70.

German, A. J. (2006a). The growing problem of obesity in dogs and cats. Journal of Nutrition, 136(7), 1940S-1946S.

162

German, A. J., Holden, S., L, Moxham, G. L., Holmes, K. L., Hackett, R., M, & Rawlings, J. M. (2006b). A simple reliable tool for owners to assess the body condition of their dog or cat. Journal of Nutrition, 136, 2031S-2033S.

German, A. J., Ryan, V. H., German, A. C., Wood, I. S., & Trayhurn, P. (2010a). Obesity, its associated disorders and the role of inflammatory adipokines in companion animals. The Veterinary Journal, 185(1), 4-9. doi: http://dx.doi.org/10.1016/j.tvjl.2010.04.004

German, A. J., Holden, S. L., Bissot, T., Morris, P. J., & Biourge, V. (2010b). A high protein high fibre diet improves weight loss in obese dogs. The Veterinary Journal, 183(3), 294-297. doi: http://dx.doi.org/10.1016/j.tvjl.2008.12.004

Ginsberg, H. N. (1998). Lipoprotein physiology. Endocrinology and Metabolism Clinics of North America, 27, 503-519.

Glickman, L. T., Sonnenschein, E. G., Glickman, N. W., Donoghue, S., & Goldschmidt, M. H. (1995). Pattern of diet and obesity in female adult pet dogs. Veterinary Clinical Nutrition, 2(1), 6-13.

Goldberg, I., Scheraldi, C., Yacoub, L., Saxena, U., & Bisgaier, C. (1990). Lipoprotein ApoC-II activation of lipoprotein lipase. Modulation by apolipoprotein A-IV. Journal of Biological Chemistry, 265(8), 4266-4272.

Goldman, D. W., Pickett, W. C., & Goetzl, E. J. (1983). Human neutrophil chemotactic and degranulating activities of leukotriene B5 (LTB5) derived from eicosapentaenoic acid. Biochemical and Biophysical Research Communications, 117(1), 282-288. doi: http://dx.doi.org/10.1016/0006-291X(83)91572-3

Goncalves, N. B., Gomes, P. M., Foss, M. C., & Foss-Freitas, M. C. (2014). Metabolic effects of flaxseed oil supplementation (W3/ALA) in mice. Diabetes Technology & Therapeutics, 16, A131-A131.

Gorjao, R., Azevedo-Martins, A. K., Rodrigues, H. G., Abdulkader, F., Arcisio-Miranda, M., Procopio, J., & Curi, R. (2009). Comparative effects of DHA and EPA on cell function. Pharmacology & Therapeutics, 122(1), 56-64. doi: 10.1016/j.pharmthera.2009.01.004

Gorjao, R., Verlengia, R., de Lima, T. M., Soriano, F. G., Fernanda, M., Boaventura, C., Kanunfre, C. C., Peres, C. M., Sampaio, S. C., Otton, R., Folador, A., Martins, E. F., Cristina, T., Curi, P., Portiolli, E. P., Newsholme, P., & Curi, R. (2006). Effect of docosahexaenoic acid-rich fish oil supplementation on human leukocyte function. Clinical Nutrition, 25(6), 923-938. doi: 10.1016/j.clnu.2006.03.004

Gossellin, J., Wren, J. A., & Sunderland, S. J. (2007a). Canine obesity – an overview. Journal of Veterinary Pharmacology and Therapeutics, 30, 1-10. doi: 10.1111/j.1365-2885.2007.00863.x

163

Gossellin, J., McKelvie, J., Sherington, J., Wren, J. A., Eagleson, J. S., Rowan, T. G., & Sunderland, S. J. (2007b). An evaluation of dirlotapide to reduce body weight of client-owned dogs in two placebo-controlled clinical studies in Europe. Journal of Veterinary Pharmacology and Therapeutics, 30, 73-80. doi: 10.1111/j.1365- 2885.2007.00866.x

Goyal, A., Sharma, V., Upadhyay, N., Gill, S., & Sihag, M. (2014). Flax and flaxseed oil: an ancient medicine & modern functional food. Journal of Food Science and Technology-Mysore, 51(9), 1633-1653. doi: 10.1007/s13197-013-1247-9

Greenbaum, D., Colangelo, C., Williams, K., & Gerstein, M. (2003). Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biology, 4(9), 117.

Greenbaum, D., Jansen, R., & Gerstein, M. (2002). Analysis of mRNA expression and protein abundance data: an approach for the comparison of the enrichment of features in the cellular population of proteins and transcripts. Bioinformatics, 18(4), 585-596.

Gundersen, H. J. G., Bendtsen, T. F., Korbo, L., Marcussen, N., Møller, A., Nielsen, K., Nyenaargd, J. R., Pakkenberg, B., Sørensen, F. B., Vesterby, A., & West, M. J. (1988). Some new, simple and efficient sterological methods and their use in pathological research and diagnosis. Acta Pathologica Microbiologica et Immunologica Scandinavica, 96, 379-394.

Guo, X., Mattar, S., Mimms, S., Navia, J., & Kassab, G. (2014). Efficacy of a laparoscopic gastric restrictive device in an obese canine model. Obesity Surgery, 24(1), 159-166. doi: 10.1007/s11695-013-1127-4

Guo, X., Zheng, H., Mattar, S. G., Lu, X., Sandusky, G., Navia, J. A., & Kassab, G. (2011). Reversible gastric restriction implant: safety and efficacy in a canine model. Obesity Surgery, 21(9), 1444-1450.

Guo, Y., Xiao, P., Lei, S., Deng, F., Xiao, G. G., Liu, Y., Chen, X., Li, L., Wu, S., & Chen, Y. (2008). How is mRNA expression predictive for protein expression? A correlation study on human circulating monocytes. Acta biochimica et biophysica Sinica, 40(5), 426-436.

Hall, J. A., Picton, R. A., Skinner, M. M., Jewell, D. E., & Wander, R. C. (2006). The (n-3) fatty acid dose, independent of the (n-6) to (n-3) fatty acid ratio, affects the plasma fatty acid profile of normal dogs. Journal of Nutrition, 136(9), 2338-2344.

Hariri, M., Ghiasvand, R., Shiranian, A., Askari, G., Iraj, B., & Salehi-Abargouei, A. (2015). Does omega-3 fatty acids supplementation affect circulating leptin levels? A systematic review and meta-analysis on randomized controlled clinical trials. Clinical Endocrinology, 82(2), 221-228. doi: 10.1111/cen.12508

Harris, R. B. (2000). Leptin-much more than a satiety signal. Annual Review of Nutrition, 20(1), 45-75.

164

Harris, W., DiRienzo, M., Sands, S., George, C., Jones, P., & Eapen, A. (2007). Stearidonic acid increases the red blood cell and heart eicosapentaenoic acid content in dogs. Lipids, 42(4), 325-333. doi: 10.1007/s11745-007-3036-6

Harris, W. S., & von Schacky, C. (2004). The Omega-3 Index: a new risk factor for death from coronary heart disease? Preventive Medicine, 39(1), 212-220. doi: 10.1016/j.ypmed.2004.02.030

Haynes, F. E. M., Greenwood, P. L., McDonagh, M. B., & Oddy, V. H. (2012). Myostatin allelic status interacts with level of nutrition to affect growth, composition, and myofiber characteristics of lambs. Journal of Animal Science, 90(2), 456-465. doi: 10.2527/jas.2011-4452

Haynes, F. E. M., Greenwood, P. L., Siddell, J. P., McDonagh, M. B., & Oddy, V. H. (2010). Computer tomography software program ‘Osirix’ aids prediction of sheep body composition. Proceedings of the Australian Society of Animal Production, 28, 49.

Healy, D., Wallace, F., Miles, E., Calder, P., & Newsholme, P. (2000). Effect of low-to- moderate amounts of dietary fish oil on neutrophil lipid composition and function. Lipids, 35(7), 763-768.

Honda, K. L. (2014). Effect of omega-3 fatty acids on toll-like receptor 4-mediated macrophage inflammation and its regulation. Tufts University, Friedman School of Nutrition Science and Policy.

Honda, K. L., Lamon-Fava, S., Matthan, N. R., Wu, D. Y., & Lichtenstein, A. H. (2015). EPA and DHA exposure alters the inflammatory response but not the surface expression of toll-like receptor 4 in macrophages. Lipids, 50(2), 121-129. doi: 10.1007/s11745-014-3971-y

Hong, S., Gronert, K., Devchand, P. R., Moussignac, R.-L., & Serhan, C. N. (2003). Novel docosatrienes and 17S-resolvins generated from docosahexaenoic acid in murine brain, human blood, and glial cells autacoids in anti-inflammation. Journal of Biological Chemistry, 278(17), 14677-14687.

Houpt, K., Coren, B., Hintz, H., & Hilderbrant, J. (1979). Effect of sex and reproductive status on sucrose preference, food intake, and body weight of dogs. Journal of the American Veterinary Medical Association, 174(10), 1083-1085.

Howe, P., & Buckley, J. (2014). Metabolic health benefits of long-chain omega-3 polyunsaturated fatty acids. Military Medicine, 179(11), 138-143. doi: 10.7205/milmed-d-14-00154

Hubert, B., La Farge, F. d., Braun, J., & Magnol, J. (1987). Hypertriglyceridemia in two related dogs. Companion Animal Practice (USA).

165

IJpenberg, A., Jeannin, E., Wahli, W., & Desvergne, B. (1997). Polarity and specific sequence requirements of peroxisome proliferator-activated receptor (PPAR)/retinoid X receptor heterodimer binding to DNA A functional analysis of the malic enzyme gene PPAR response element. Journal of Biological Chemistry, 272(32), 20108- 20117.

Ishikawa, M., Maekawa, K., Saito, K., Senoo, Y., Urata, M., Murayama, M., Tajima, Y., Kumagai, Y., & Saito, Y. (2014). Plasma and serum lipidomics of healthy white adults shows characteristic profiles by subjects’ gender and age. PLoS ONE, 9(3), e91806.

Ishioka, K., Hatai, H., Komabayashi, K., Soliman, M., Shibata, H., Honjoh, T., Kimura, K., & Saito, M. (2005a). Diurnal variations of serum leptin in dogs: effects of fasting and re-feeding. The Veterinary Journal, 169(1), 85-90.

Ishioka, K., Okumura, M., Sagawa, M., Nakadomo, F., Kimura, K., & Saito, M. (2005b). Computed tomographic assessment of body fat in beagles. Veterinary Radiology & Ultrasound, 46(1), 49-53. doi: 10.1111/j.1740-8261.2005.00009.x

Ishioka, K., Hosoya, K., Kitagawa, H., Shibata, H., Honjoh, T., Kimura, K., & Saito, M. (2007). Plasma leptin concentration in dogs: Effects of body condition score, age, gender and breeds. Research in Veterinary Science, 82(1), 11-15. doi: 10.1016/j.rvsc.2006.06.002

Ishioka, K., Omachi, A., Sagawa, M., Shibata, H., Honjoh, T., Kimura, K., & Saito, M. (2006). Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity. Research in Veterinary Science, 80(2), 127-132.

Ishioka, K., Soliman, M. M., Sagawa, M., Shibata, H., Honjoh, T., Kitamura, H., & Kimura, K. (2002). Effects of fish oil feeding on obesity and UCP expression in dogs. Veterinary Biochemistry, 39, 31-38.

Ito, C. Y., Kazantsev, A. G., & Baldwin, A. S. (1994). Three NF-χB sites in the IχB-α promoter are required for induction of gene expression by TNFα. Nucleic Acids Research, 22(18), 3787-3792. doi: 10.1093/nar/22.18.3787

Iwase, M., Kimura, K., Sasaki, N., Komagome, R., Ishioka, K., Morimatsu, M., Murakami, T., & Saito, M. (2000). Canine leptin: cDNA cloning, expression and activity of recombinant protein. Research in Veterinary Science, 68(2), 109-114.

James, S. P. (2001). Detection of Cytokine mRNA Expression by PCR Current Protocols in Immunology: John Wiley & Sons, Inc.

Jansen, R., Greenbaum, D., & Gerstein, M. (2002). Relating whole-genome expression data with protein-protein interactions. Genome Research, 12(1), 37-46.

Jeusette, I., Detilleux, J., Cuvelier, C., Istasse, L., & Diez, M. (2004a). Ad libitum feeding following ovariectomy in female Beagle dogs: effect on maintenance energy requirement and on blood metabolites. Journal of Animal Physiology and Animal Nutrition, 88(3-4), 117-121. doi: 10.1111/j.1439-0396.2003.00467.x

166

Jeusette, I., Grauwels, M., Cuvelier, C., Tonglet, C., Istasse, L., & Diez, M. (2004b). Hypercholesterolaemia in a family of rough collie dogs. Journal of Small Animal Practice, 45(6), 319-324.

Jeusette, I., Greco, D., Aquino, F., Detilleux, J., Peterson, M., Romano, V., & Torre, C. (2010). Effect of breed on body composition and comparison between various methods to estimate body composition in dogs. Research in Veterinary Science, 88(2), 227-232.

Jeusette, I. C., Detilleux, J., Shibata, H., Saito, M., Honjoh, T., Delobel, A., Istasse, L., & Diez, M. (2005). Effects of chronic obesity and weight loss on plasma ghrelin and leptin concentrations in dogs. Research in Veterinary Science, 79(2), 169-175.

Johnson, M., Carey, F., & McMillan, R. (1982). Alternative pathways of arachidonate metabolism: prostaglandins, thromboxane and leukotrienes. Essays in Biochemistry, 19, 40-141.

Jopson, N. B. (1993). Physiological adaptations in two seasonal cervids. (Doctor of Philosophy Thesis), University of New England, Armidale, New South Wales.

Jopson, N. B., Kolstad, K., Sehested, E., & Vangen, O. (1995). Computed tomography as an accurate and cost effective alternative to carcass dissection. Proceedings of the Australian Association Animal Breeding Genetics, 11, 635-639.

Jude, S., Martel, E., Vincent, F., Besson, P., Couet, C., Ogilvie, G. K., Pinault, M., De Chalendarl, C., Bougnoux, P., Richard, S., Champeroux, P., Crozatier, B., & Le Guennec, J.-Y. (2007). Dietary long-chain n-3 fatty acids modify blood and cardiac phospholipids and reduce protein kinase-C-delta and protein kinase-C-epsilon translocation. British Journal of Nutrition, 98(6), 1143-1151. doi: 10.1017/s0007114507798914

Kalupahana, N. S., Moustaid-Moussa, N., & Claycombe, K. J. (2012). Immunity as a link between obesity and insulin resistance. Molecular Aspects of Medicine, 33(1), 26-34.

Kapoor, R., & Huang, Y.-S. (2006). Gamma linolenic acid: An antiinflammatory omega-6 fatty acid. Current Pharmaceutical Biotechnology, 7(6), 531-534. doi: 10.2174/138920106779116874

Kawasumi, K., Kashiwado, N., Okada, Y., Sawamura, M., Sasaki, Y., Iwazaki, E., Mori, N., Yamamoto, I., & Arai, T. (2014). Age effects on plasma cholesterol and triglyceride profiles and metabolite concentrations in dogs. BMC Veterinary Research, 10(1), 57.

Kealy, R. D., Lawler, D. F., Ballam, J. M., Mantz, S. L., Biery, D. N., Greeley, E. H., Lust, G., Segre, M., Smith, G. K., & Stowe, H. D. (2002). Effects of diet restriction on life span and age-related changes in dogs. Journal of the American Veterinary Medical Association, 220(9), 1315-1320.

Kershaw, E. E., & Flier, J. S. (2004). Adipose tissue as an endocrine organ. Journal of Clinical Endocrinology & Metabolism, 89(6), 2548-2556.

167

Khorsan, R., Crawford, C., Ives, J. A., Walter, A. R., & Jonas, W. B. (2014). The effect of omega-3 fatty acids on biomarkers of inflammation: A rapid evidence assessment of the literature. Military Medicine, 179(11), 2-60. doi: 10.7205/milmed-d-14-00339

Kim, H.-K., Della-Fera, M. A., Lin, J., & Baile, C. A. (2006). Docosahexaenoic acid inhibitis adipocyte differentiation and induces apoptosis in 3T3-L1 preadipocytes. Journal of Nutrition, 136, 2965-2969.

Kim, K. B., Nam, Y. A., Kim, H. S., Hayes, A. W., & Lee, B. M. (2014). alpha-Linolenic acid: Nutraceutical, pharmacological and toxicological evaluation. Food and Chemical Toxicology, 70, 163-178. doi: 10.1016/j.fct.2014.05.009

Kim, S., Sohn, I., Ahn, J.-I., Lee, K.-H., Lee, Y. S., & Lee, Y. S. (2004). Hepatic gene expression profiles in a long-term high-fat diet-induced obesity mouse model. Gene, 340(1), 99-109. doi: http://dx.doi.org/10.1016/j.gene.2004.06.015

Kinghorn, B., & Thompson, J. (1992). CATMAN - a program to measure CAT-Scans for predictions of body components in live animals. Proceedings of the Australian Association Animal Breeding Genetics, 10, 560-564.

Kirby, N. A., Hester, S. L., Rees, C. A., Kennis, R. A., Zoran, D. L., & Bauer, J. E. (2009). Skin surface lipids and skin and hair coat condition in dogs fed increased total fat diets containing polyunsaturated fatty acids. Journal of Animal Physiology and Animal Nutrition, 93(4), 505-511. doi: 10.1111/j.1439-0396.2008.00832.x

Klaus, S. (2004). Adipose tissue as a regulator of energy balance. Current Drug Targets, 5(3), 241-250.

Kliewer, S. A., Sundseth, S. S., Jones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W., Willson, T. M., Lenhard, J. M., & Lehmann, J. M. (1997). Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors α and γ. Proceedings of the National Academy of Sciences, 94(9), 4318-4323.

Ko, C., O'Rourke, S. M., & Huang, L.-S. (2003). A fish oil diet produces different degrees of suppression of apoB and triglyceride secretion in human apoB transgenic mouse strains. Journal of Lipid Research, 44(10), 1946-1955. doi: 10.1194/jlr.M300172- JLR200

Kobayashi, T., Koie, H., Kusumi, A., Kitagawa, M., Kanayama, K., & Otsuji, K. (2014). Comparative iInvestigation of body composition in male dogs using CT and body fat analysis software. Journal of Veterinary Medical Science, 76(3), 439-446. doi: 10.1292/jvms.13-0397

Kota, B. P., Huang, T. H.-W., & Roufogalis, B. D. (2005). An overview on biological mechanisms of PPARs. Pharmacological Research, 51(2), 85-94.

168

Krey, G., Braissant, O., L’Horset, F., Kalkhoven, E., Perroud, M., Parker, M. G., & Wahli, W. (1997). Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Molecular Endocrinology, 11(6), 779-791.

Kris-Etherton, P. M., Harris, W. S., Appel, L. J., & Nutrition, C. (2002). Fish consumption, fish oil, omega-3 fatty acids, and cardiovascular disease. Circulation, 106(21), 2747- 2757. doi: 10.1161/01.cir.0000038493.65177.94

Kronfeld, D. S., Donoghue, S., & Glickman, L. T. (1991). Body condition and energy intakes of dogs in a referral teaching hospital. Journal of Nutrition, 121(11 Suppl), S157- S158.

Kvame, T., & Vangen, O. (2006). In-vivo composition of carcass regions in lambs of two genetic lines, and selection of CT positions for estimation of each region. Small Ruminant Research, 66(1-3), 201-208.

Kvame, T., & Vangen, O. (2007). Selection for lean weight based on ultrasound and CT in a meat line of sheep. Livestock Science, 106, 232 - 242.

Laflamme, D. (1997). Development and validation of a body condition score system for dogs. Canine Practice, 22, 10-15.

Laflamme, D. P. (2006). Understanding and managing obesity in dogs and cats. Vet. Clin. N. Am-Small, 36(6), 1283–1295. doi: 10.1016/j.cvsm.2006.08.005

Laflamme, D. P. (2012). Companion Animal Symposium: Obesity in dogs and cats: What is wrong with being fat? Journal of Animal Science, 90(5), 1653-1662. doi: 10.2527/jas2011-4571

Lands, B. (2014). Dietary omega-3 and omega-6 fatty acids compete in producing tissue compositions and tissue responses. Military Medicine, 179(11), 76-81. doi: 10.7205/milmed-d-14-00149

Lane, J. T., Mack-Shipman, L. R., Anderson, J. C., Moore, T. E., Erickson, J. M., Ford, T. C., Stoner, J. A., & Larsen, J. L. (2005). Comparison of CT and dual-energy DEXA using a modified trunk compartment in the measurement of abdominal fat. Endocrine, 27(3), 295-299. doi: 10.1385/endo:27:3:295

Lauten, S. D., Cox, N. R., Brawner Jr, W. R., & Baker, H. J. (2001). Use of dual energy x-ray absorptiometry for noninvasive body composition measurements in clinically normal dogs. American Journal of Veterinary Research, 62(8), 1295-1301.

LeBlanc, C. J., Horohov, D. W., Bauer, J. E., Hosgood, G., & Mauldin, G. E. (2008). Effects of dietary supplementation with fish oil on in vivo production of inflammatory mediators in clinically normal dogs. American Journal of Veterinary Research, 69(4), 486-493. doi: 10.2460/ajvr.69.4.486

169

Lee, M.-S., Kwun, I.-S., & Kim, Y. (2008). Eicosapentaenoic acid increases lipolysis through up-regulation of the lipolytic gene expression and down-regulation of the adipogenic gene expression in 3T3-L1 adipocytes. Genes and Nutrition, 2(4), 327-330. doi: 10.1007/s12263-007-0068-8

Lee, Y.-H., & Pratley, R. (2005). The evolving role of inflammation in obesity and the metabolic syndrome. Current Diabetes Reports, 5(1), 70-75. doi: 10.1007/s11892- 005-0071-7

Lemaitre-Delaunay, D., Pachiaudi, C., Laville, M., Pousin, J., Armstrong, M., & Lagarde, M. (1999). Blood compartmental metabolism of docosahexaenoic acid (DHA) in humans after ingestion of a single dose of [13C] DHA in phosphatidylcholine. Journal of Lipid Research, 40(10), 1867-1874.

Lenox, C., & Bauer, J. (2013). Potential Adverse Effects of Omega‐3 Fatty Acids in Dogs and Cats. Journal of Veterinary Internal Medicine, 27(2), 217-226.

Lepage, G., & Roy, C. C. (1986). Direct transesterification of all classes of lipids in a one- step reaction. Journal of Lipid Research, 27(1), 114-120.

Lewis, R. A., Austen, K. F., & Soberman, R. J. (1990). Leukotrienes and other products of the 5-lipoxygenase pathway. Biochemistry and relation to pathobiology in human diseases. New England Journal of Medicine, 323(10), 645-655.

Li, Y., Yao, S., Chen, S., Zhang, Y., Guo, X., Zhang, W., & Guo, W. (2014). The acute effects of a new type of implantable gastric electrical stimulators featuring varied pulse widths on beagle dogs’ food intake and gastric accommodation. Obesity Surgery, 24(5), 783-790. doi: 10.1007/s11695-013-1158-x

Lin, Y., & Salem, N. (2002). A technique for the in vivo study of multiple stable isotope- labeled essential fatty acids. Prostaglandins, Leukotrienes and Essential Fatty Acids, 67(2), 141-146.

Lukaski, H. C. (1987). Methods for the assessment of human body composition: traditional and new. The American Journal of Clinical Nutrition, 46(4), 537-556.

Lund, E. M., Armstrong, P. J., Kirk, C. A., Kolar, L. M., & Klausnor, J. (1999). Health status and population characteristics of dogs and cats examined at private veterinary practices in the United States. American Veterinary Medical Association, 214, 1336- 1341.

Madrigal-Matute, J., López-Franco, O., Blanco-Colio, L. M., Muñoz-García, B., Ramos- Mozo, P., Ortega, L., Egido, J., & Martín-Ventura, J. L. (2010). Heat shock protein 90 inhibitors attenuate inflammatory responses in atherosclerosis. Cardiovascular Research, 86(2), 330-337. doi: 10.1093/cvr/cvq046

170

Maeda, K., Okubo, K., Shimomura, I., Funahashi, T., Matsuzawa, Y., & Matsubara, K. (1996). cDNA Cloning and Expression of a Novel Adipose Specific Collagen-like Factor, apM1 (AdiposeMost Abundant Gene Transcript 1). Biochemical and Biophysical Research Communications, 221(2), 286-289. doi: http://dx.doi.org/10.1006/bbrc.1996.0587

Mahaffey, K. R. (2004). Fish and shellfish as dietary sources of methylmercury and the ω-3 fatty acids, eicosahexaenoic acid and docosahexaenoic acid: risks and benefits. Environmental Research, 95(3), 414-428.

Manku, M., Morse-Fisher, N., & Horrobin, D. (1988). Changes in human plasma essential fatty acid levels as a result of administration of linoleic acid and gamma-linolenic acid. European Journal of Clinical Nutrition, 42(1), 55-60.

Mao, J. F., Xia, Z. F., Chen, J. N., & Yu, J. H. (2013). Prevalence and risk factors for canine obesity surveyed in veterinary practices in Beijing, China. Preventive Veterinary Medicine, 112(3-4), 438-442. doi: 10.1016/j.prevetmed.2013.08.012

Marković, S., Daxecker, H., Raab, M., Griesmacher, A., & Müller, M. M. (2002). Effect of cytokines on adhesion molecules expression in cell culture of blood vessel endothelium. Jugoslovenska Medicinska Biohemija, 21(1), 39-40.

Martinon, F., Mayor, A., & Tschopp, J. (2009). The inflammasomes: guardians of the body. Annual Review of Immunology, 27, 229-265.

Mason, E. (1970). Obesity in pet dogs. Veterinary Record, 86, 612-616.

Masoodi, M., Kuda, O., Rossmeisl, M., Flachs, P., & Kopecky, J. (2015). Lipid signaling in adipose tissue: Connecting inflammation & metabolism. Biochimica Et Biophysica Acta-Molecular and Cell Biology of Lipids, 1851(4), 503-518. doi: 10.1016/j.bbalip.2014.09.023

Mawby, D. I., Bartges, J. W., d’Avignon, A., Laflamme, D. P., Moyers, T. D., & Cottrell, T. (2004). Comparison of various methods for estimating body fat in dogs. Journal of American Animal Hospital Association, 40, 109-114.

McGreevy, P. D., Thomson, P. C., Pride, C., Fawcett, A., Grassi, T., & Jones, B. (2005). Prevalence of obesity in dogs examined by Australian veterinary practices and the risk factors involved. Veterinary Record, 156(22), 695-702. doi: 10.1136/vr.156.22.695

Meyer, H., Drochner, W., & Weidenhaupt, C. (1978). A contribution to the occurrence and treatment of obesity in dogs. Dtsch Tierarztl Wochenschr, 85, 133-136.

Miller, A. H., & Raison, C. L. (2008). Immune system contributions to the pathophysiology

Moller, D. E. (2000). Potential role of TNF-α in the pathogenesis of insulin resistance and type 2 diabetes. Trends in Endocrinology & Metabolism, 11(6), 212-217.

Moller, D. E., & Kaufman, K. D. (2005). Metabolic syndrome: a clinical and molecular perspective. Annual Review of Medicine, 56, 45-62.

171

Mori, N., Lee, P., Muranaka, S., Sagara, F., Takemitsu, H., Nishiyama, Y., Yamamoto, I., Yagishita, M., & Arai, T. (2010). Predisposition for primary hyperlipidemia in Miniature Schnauzers and Shetland sheepdogs as compared to other canine breeds. Research in Veterinary Science, 88(3), 394-399.

Morrison, R., Penpraze, V., Greening, R., Underwood, T., Reilly, J. J., & Yam, P. S. (2014). Correlates of objectively measured physical activity in dogs. The Veterinary Journal, 199(2), 263-267. doi: http://dx.doi.org/10.1016/j.tvjl.2013.11.023

Mueller, R. S., Fettman, M. J., Richardson, K., Hansen, R. A., Miller, A., Magowitz, J., & Ogilvie, G. K. (2005). Plasma and skin concentrations of polyunsaturated fatty acids before and after supplementation with n-3 fatty acids in dogs with atopic dermatitis. American Journal of Veterinary Research, 66(5), 868-873. doi: 10.2460/ajvr.2005.66.868

Muirhead, K. A., Wallace, P. K., Schmitt, T. C., Frescatore, R. L., Franco, J. A., & Horan, P. K. (1986). Methodological considerations for implementation of lymphocyte subset analysis in a clinical reference laboratory. Annals of the New York Academy of Sciences, 468, 113-127. doi: 10.1111/j.1749-6632.1986.tb42034.x

Munday, H. S., Booles, D., Anderson, P., Poore, D. W., & Earle, K. E. (1994a). The repeatability of body composition measurements in dogs and cats using dual energy x- ray absorptiometry. Journal of Nutrition, 124(12 Suppl), 2619S-2621S.

Munday, H. (1994b). Assessment of body composition in cats and dogs. International Journal of Obesity and Related Metabolic Disorders, 18, S14-21.

Munro, I. A., & Garg, M. L. (2012). Dietary supplementation with n-3 PUFA does not promote weight loss when combined with a very-low-energy diet. British Journal of Nutrition, 108(08), 1466-1474. doi: doi:10.1017/S0007114511006817

Munro, I. A., & Garg, M. L. (2013). Dietary supplementation with long chain omega-3 polyunsaturated fatty acids and weight loss in obese adults. Obesity Research & Clinical Practice, 7(3), e173-e181.

Nguyen, P., Leray, V., Diez, M., Serisier, S., Bloc’h, J. L., Siliart, B., & Dumon, H. (2008). Liver lipid metabolism. Journal of Animal Physiology and Animal Nutrition, 92(3), 272-283. doi: 10.1111/j.1439-0396.2007.00752.x

Nijland, M. L., Stam, F., & Seidell, J. C. (2010). Overweight in dogs, but not in cats, is related to overweight in their owners. Public Health Nutrition, 13(01), 102-106.

Nishii, N., Takasu, M., Ohba, Y., Maeda, S., Kitoh, K., Ohtsuka, Y., Honjo, T., Saito, M., & Kitagawa, H. (2006). Effects of administration of glucocorticoids and feeding status on plasma leptin concentrations in dogs. American Journal of Veterinary Research, 67(2), 266-270.

172

Novak, T. E., Babcock, T. A., Jho, D. H., Helton, W. S., & Espat, N. J. (2003). NF-κB inhibition by ω-3 fatty acids modulates LPS-stimulated macrophage TNF-α transcription. American Journal of Physiology-Lung Cellular and Molecular Physiology, 284(1), L84-L89.

Pan, D. A., & Storlien, L. H. (1993). Dietary lipid profile is a determinant of tissue phospholipid fatty acid composition and rate of weight gain in rats. Journal of Nutrition, 123(3), 512-519.

Park, H. J., Park, J. S., Hayek, M. G., Reinhart, G. A., & Chew, B. P. (2011). Dietary fish oil and flaxseed oil suppress inflammation and immunity in cats. Veterinary Immunology and Immunopathology, 141(3-4), 301-306. doi: 10.1016/j.vetimm.2011.02.024

Parker, H. G., Kim, L. V., Sutter, N. B., Carlson, S., Lorentzen, T. D., Malek, T. B., Johnson, G. S., DeFrance, H. B., Ostrander, E. A., & Kruglyak, L. (2004). Genetic Structure of the Purebred Domestic Dog. Science, 304(5674), 1160-1164. doi: 10.1126/science.1097406

Parrish, C., Pathy, D., & Angel, A. (1990). Dietary fish oils limit adipose tissue hypertrophy in rats. Metabolism, 39(3), 217-219.

Pasquini, A., Luchetti, E., & Cardini, G. (2008). Plasma lipoprotein concentrations in the dog: the effects of gender, age, breed and diet. Journal of Animal Physiology and Animal Nutrition, 92(6), 718-722.

Pawlosky, R., Barnes, A., & Salem, N. (1994). Essential fatty acid metabolism in the feline: relationship between liver and brain production of long chain polyunsaturated fatty acids. Journal of Lipid Research, 35, 2032-2040.

Peterson, L., Jeffery, N., Thies, F., Sanderson, P., Newsholme, E., & Calder, P. (1998). Eicosapentaenoic and docosahexaenoic acids alter rat spleen leukocyte fatty acid composition and prostaglandin E2 production but have different effects on lymphocyte functions and cell-mediated immunity. Lipids, 33(2), 171-180.

Picq, M., Chen, P., Perez, M., Michaud, M., Véricel, E., Guichardant, M., & Lagarde, M. (2010). DHA metabolism: targeting the brain and lipoxygenation. Molecular Neurobiology, 42(1), 48-51.

Pratt, W. B., & Toft, D. O. (2003). Regulation of signaling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Experimental Biology and Medicine, 228(2), 111-133.

Prieur, X., Mok, C. Y., Velagapudi, V. R., Núñez, V., Fuentes, L., Montaner, D., Ishikawa, K., Camacho, A., Barbarroja, N., & O’Rahilly, S. (2011). Differential lipid partitioning between adipocytes and tissue macrophages modulates macrophage lipotoxicity and M2/M1 polarization in obese mice. Diabetes, 60(3), 797-809.

Purushothaman, D., Brown, W. Y., Vanselow, B. A., Quinn, K., & Wu, S. B. (2014). Flaxseed oil supplementation alters the expression of inflammatory-related genes in dogs. Genetics and Molecular Research, 13(3), 5322.

173

Purushothaman, D., Brown, W. Y., Wu, S.-B., & Vanselow, B. A. (2011). Evaluation of breed effects on n-3 PUFA metabolism with dietary flaxseed oil supplementation in dogs. British Journal of Nutrition, 106, S139-S141. doi: 10.1017/s0007114511000523

Purushothaman, D., Vanselow, B. A., Wu, S.-B., Butler, S., & Brown, W. Y. (2013). Whole body computed tomography with advanced imaging techniques: A research tool for measuring body composition in dogs. Journal of Veterinary Medicine, 2013, 6. doi: 10.1155/2013/610654

Raclot, T., Groscolas, R., Langin, D., & Ferre, P. (1997). Site-specific regulation of gene expression by n-3 polyunsaturated fatty acids in rat white adipose tissues. Journal of Lipid Research, 38(10), 1963-1972.

Raffan, E., Holden, S. L., Cullingham, F., Hackett, R. M., Rawlings, J. M., & German, A. J. (2006). Standardized positioning is essential for precise determination of body composition using dual-energy x-ray absorptiometry in dogs. Journal of Nutrition, 136(7), 1976S-1978S.

Rajaram, S. (2014). Health benefits of plant-derived alpha-linolenic acid. American Journal of Clinical Nutrition, 100(1), 443S-448S. doi: 10.3945/ajcn.113.071514

Ramadeen, A., Laurent, G., dos Santos, C. C., Hu, X., Connelly, K. A., Holub, B. J., Mangat, I., & Dorian, P. (2010). n-3 Polyunsaturated fatty acids alter expression of fibrotic and hypertrophic genes in a dog model of atrial cardiomyopathy. Heart Rhythm, 7(4), 520-528. doi: 10.1016/j.hrthm.2009.12.016

Raper, N. R., Cronin, F., & Exler, J. (1992). Omega-3 fatty acid content of the US food supply. Journal of the American College of Nutrition, 11(3), 304-308.

Ratib, O., Rosset, A., & Heuberger, J. (2002). OsiriX: The Pocket Guide. Genève, Switzerland: OsiriX Foundation.

Ratnayake, W. N., & Galli, C. (2009). Fat and fatty acid terminology, methods of analysis and fat digestion and metabolism: a background review paper. Annals of Nutrition and Metabolism, 55(1-3), 8-43.

Ren, J., & Chung, S. H. (2007). Anti-inflammatory effect of α-linolenic acid and its mode of action through the inhibition of nitric oxide production and inducible nitric oxide synthase gene expression via NF-κB and mitogen-activated protein kinase pathways. Journal of Agricultural and Food Chemistry, 55(13), 5073-5080.

Rettig, M. P., Low, P. S., Gimm, J. A., Mohandas, N., Wang, J. Z., & Christian, J. A. (1999). Evaluation of biochemical changes during in vivo erythrocyte senescence in the dog. Blood, 93(1), 376-384.

Rifai, N., Bachorik, P. S., & Albers, J. J. (1999). Lipids, lipoproteins, and apolipoproteins. In C. A. Burtis & E. R. Ashwood (Eds.), Tietz Textbook of Clinical Chemistry (pp. 809- 861). Philadelphia, Pennsylvania: WB Saunders.

174

Robertson, I. D. (2003). The association of exercise, diet and other factors with owner- perceived obesity in privately owned dogs from metropolitan Perth, WA. Preventive Veterinary Medicine, 58(1–2), 75-83. doi: http://dx.doi.org/10.1016/S0167- 5877(03)00009-6

Rogers, W., Donovan, E., & Kociba, G. (1975). Idiopathic hyperlipoproteinemia in dogs. Journal of the American Veterinary Medical Association, 166(11), 1087-1091.

Rosset, A., Spadola, L., & Ratib, O. (2004). OsiriX: An open-source software for navigating in multidimensional DICOM Images. Journal of Digital Imaging, 17(3), 205-216.

Rozen, S., & Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology, 132, 365-386.

Ruzickova, J., Rossmeisl, M., Prazak, T., Flachs, P., Sponarova, J., Vecka, M., Tvrzicka, E., Bryhn, M., & Kopecky, J. (2004). Omega-3 PUFA of marine origin limit diet-induced obesity in mice by reducing cellularity of adipose tissue. Lipids, 39(12), 1177-1185. doi: 10.1007/s11745-004-1345-9

Salem, N., & Eggersdorfer, M. (2015). Is the world supply of omega-3 fatty acids adequate for optimal human nutrition? Current Opinion in Clinical Nutrition and Metabolic Care, 18(2), 147-154. doi: 10.1097/mco.0000000000000145

Sampath, H., & Ntambi, J. M. (2004). Polyunsaturated fatty acid regulation of gene expression. Nutrition Reviews, 62(9), 333-339. doi: 10.1301/nr.2004.sept.333-339

Sarge, K. D., Murphy, S. P., & Morimoto, R. I. (1993). Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA- binding activity, and nuclear localization and can occur in the absence of stress. Molecular and Cellular Biology, 13(3), 1392-1407. doi: 10.1128/mcb.13.3.1392

Sato, K., Agoh, H., Kaneshige, T., Hikasa, Y., & Kagota, K. (2000). Hypercholesterolemia in Shetland sheepdogs. Journal of Veterinary Medical Science, 62(12), 1297-1301.

Schenk, S., Saberi, M., & Olefsky, J. M. (2008). Insulin sensitivity: modulation by nutrients and inflammation. Journal of Clinical Investigation, 118(9), 2992-3002.

Schmittgen, T. D., & Livak, K. J. (2008). Analyzing real-time PCR data by the comparative C-T method. Nature Protocols, 3(6), 1101-1108. doi: 10.1038/nprot.2008.73

Serhan, C. N., Clish, C. B., Brannon, J., Colgan, S. P., Chiang, N., & Gronert, K. (2000). Novel functional sets of lipid-derived mediators with antiinflammatory actions generated from omega-3 fatty acids via cyclooxygenase 2–nonsteroidal antiinflammatory drugs and transcellular processing. Journal of Experimental Medicine, 192(8), 1197-1204.

Serhan, C. N., Jain, A., Marleau, S., Clish, C., Kantarci, A., Behbehani, B., Colgan, S. P., Stahl, G. L., Merched, A., & Petasis, N. A. (2003). Reduced inflammation and tissue damage in transgenic rabbits overexpressing 15-lipoxygenase and endogenous anti- inflammatory lipid mediators. Journal of Immunology, 171(12), 6856-6865.

175

Sheng, H.-P., & Huggins, R. A. (1971). Direct and Indirect Measurement of Total Body Water in the Growing Beagle. Experimental Biology and Medicine, 137(3), 1093- 1099. doi: 10.3181/00379727-137-35734

Shiel, R. E., Brennan, S. F., O'Rourke, L. G., McCullough, M., & Mooney, C. T. (2007). Hematologic values in young pretraining healthy Greyhounds. Veterinary Clinical Pathology, 36(3), 274-277. doi: 10.1111/j.1939-165X.2007.tb00223.x

Shim, Y. Y., Gui, B., Arnison, P. G., Wang, Y., & Reaney, M. J. T. (2014). Flaxseed (Linum usitatissimum L.) bioactive compounds and peptide nomenclature: A review. Trends in Food Science & Technology, 38(1), 5-20. doi: 10.1016/j.tifs.2014.03.011

Sicinska, P., Pytel, E., Macczak, A., & Koter-Michalak, M. (2015). The use of various diet supplements in metabolic syndrome. Postepy Higieny I Medycyny Doswiadczalnej, 69, 25-33.

Simopoulos, A. P. (1999). Essential fatty acids in health and chronic disease. American Journal of Clinical Nutrition, 70(3), 560s-569s.

Simopoulos, A. P. (1991). Omega-3 fatty acids in health and disease and in growth and development. American Journal of Clinical Nutrition, 54(3), 438-463.

Simopoulos, A. P. (2002). Omega-3 fatty acids in inflammation and autoimmune diseases. Journal of the American College of Nutrition, 21(6), 495-505.

Sinclair, A. J., Attar-Bashi, N. M., & Li, D. (2002). What is the role of alpha-linolenic acid for mammals? Lipids, 37(12), 1113-1123. doi: 10.1007/s11745-002-1008-x

Son, H., d'Avignon, D., & Laflamme, D. (1998). Comparison of dual-energy x-ray absorptiometry and measurement of total body water content by deuterium oxide dilution for estimating body composition in dogs. American Journal of Veterinary Research, 59(5), 529-532.

Speakman, J. R., Booles, D., & Butterwick, R. (2001). Validation of dual energy X-ray absorptiometry (DXA) by comparison with chemical analysis of dogs and cats. International Journal of Obesity, 25(3), 439-447. doi: 10.1038/sj.ijo.0801544

Sprecher, H. (2002). The roles of anabolic and catabolic reactions in the synthesis and recycling of polyunsaturated fatty acids. Prostaglandins, Leukotrienes and Essential Fatty Acids, 67(2), 79-83.

Sreedhar, A. S., Kalmar, E., Csermely, P., & Shen, Y. (2004 ). Hsp90 isoforms: functions, expression and clinical importance. FEBS Letters, 562, 11-15.

Srigley, C. T., & Rader, J. I. (2014). Content and composition of fatty acids in marine oil omega-3 supplements. Journal of Agricultural and Food Chemistry, 62(29), 7268- 7278. doi: 10.1021/jf5016973

176

Stehle, M. E., Hanczaruk, M., Schwarz, S. C. N., Göbel, T. W., & Mueller, R. S. (2010). Effects of polyunsaturated fatty acids on isolated canine peripheral blood mononuclear cells and cytokine expression (IL-4, IFN-γ, TGF-β) in healthy and atopic dogs. Veterinary Dermatology, 21(1), 113-118. doi: 10.1111/j.1365- 3164.2009.00860.x

Stoeckel, K., Nielsen, L. H., Fuhrmann, H., & Bachmann, L. (2011). Fatty acid patterns of dog erythrocyte membranes after feeding of a fish-oil based DHA-rich supplement with a base diet low in n-3 fatty acids versus a diet containing added n-3 fatty acids. Acta Veterinaria Scandinavica, 53(57), (24 October 2011)-(2024 October 2011).

Stone, R., Berghoff, N., Steiner, J., & Zoran, D. (2009). Use of a bioelectric impedance device in obese and lean healthy dogs to estimate body fat percentage. Veterinary Therapeutics, 1-2, 59-70.

Su, W., & Jones, P. (1993). Dietary fatty acid composition influences energy accretion in rats. Journal of Nutrition, 123(12), 2109-2114.

Suganami, T., Tanimoto-Koyama, K., Nishida, J., Itoh, M., Yuan, X., Mizuarai, S., Kotani, H., Yamaoka, S., Miyake, K., & Aoe, S. (2007). Role of the Toll-like receptor 4/NF- κB pathway in saturated fatty acid–induced inflammatory changes in the interaction between adipocytes and macrophages. Arteriosclerosis, Thrombosis, and Vascular Biology, 27(1), 84-91.

Sumida, C., Graber, R., & Nunez, E. (1993). Role of fatty acids in signal transduction: modulators and messengers. Prostaglandins, Leukotrienes and Essential Fatty Acids, 48(1), 117-122.

Sun, Q., Ma, J., Campos, H., Hankinson, S. E., & Hu, F. B. (2007). Comparison between plasma and erythrocyte fatty acid content as biomarkers of fatty acid intake in US women. American Journal of Clinical Nutrition, 86(1), 74-81.

Sutter, N. B., Bustamante, C. D., Chase, K., Gray, M. M., Zhao, K., Zhu, L., Padhukasahasram, B., Karlins, E., Davis, S., Jones, P. G., Quignon, P., Johnson, G. S., Parker, H. G., Fretwell, N., Mosher, D. S., Lawler, D. F., Satyaraj, E., Nordborg, M., Lark, K. G., Wayne, R. K., & Ostrander, E. A. (2007). A single IGF1 allele is a major determinant of small size in dogs. Science, 316(5821), 112-115. doi: 10.1126/science.1137045

Tak, P. P., & Firestein, G. S. (2001). NF-κB: a key role in inflammatory diseases. Journal of Clinical Investigation, 107(1), 7-11.

Tam, C. S., Lecoultre, V., & Ravussin, E. (2012). Brown Adipose Tissue: Mechanisms and Potential Therapeutic Targets. Circulation, 125(22), 2782-2791. doi: 10.1161/circulationaha.111.042929

Thies, F., Nebe-von-Caron, G., Powell, J., Yaqoob, P., Newsholme, E., & Calder, P. (2001). Dietary supplementation with γ-linolenic acid or fish oil decreases T lymphocyte proliferation in healthy older humans. Journal of Nutrition, 131(7), 1918-1927.

177

Thiruvelan. (2010). Lipoprotein from http://healthy-ojas.com/cholesterol/lipoprotein.html

Tilg, H., & Moschen, A. R. (2006). Adipocytokines: mediators linking adipose tissue, inflammation and immunity. Nature Reviews Immunology, 6(10), 772-783.

Torres-Fuentes, C., Schellekens, H., Dinan, T. G., & Cryan, J. F. (2015). A natural solution for obesity: Bioactives for the prevention and treatment of weight gain. A review. Nutritional Neuroscience, 18(2), 49-65. doi: 10.1179/1476830513y.0000000099

Trayhurn, P., & Wood, I. S. (2004). Adipokines: inflammation and the pleiotropic role of white adipose tissue. British Journal of Nutrition, 92(03), 347-355.

Tvarijonaviciute, A., Ceron, J., Holden, S., Cuthbertson, D., Biourge, V., Morris, P., & German, A. (2012). Obesity-related metabolic dysfunction in dogs: a comparison with human metabolic syndrome. BMC Veterinary Research, 8(1), 147.

Ulven, S. M., Myhrstad, M. C., & Holven, K. B. (2014). Marine n-3 fatty acids and gene expression in peripheral blood mononuclear cells. Current Cardiovascular Risk Reports, 8(11), 1-10.

Under, D., & Mueller, M. (2014). Pet obesity management beyond nutrition. Veterinary Clinics of North America-Small Animal Practice, 44(4), 789-+. doi: 10.1016/j.cvsm.2014.03.004

Usui, S., Mizoguchi, Y., Yasuda, H., Arai, N., & Koketsu, Y. (2014). Dog Age and Breeds Associated with High Plasma Cholesterol and Triglyceride Concentrations. Journal of Veterinary Medical Science, 76(2), 269-272. doi: 10.1292/jvms.13-0369

Vaughn, D. M., Reinhart, G. A., Swaim, S. F., Lauten, S. D., Garner, C. A., Boudreaux, M. K., Spano, J. S., Hoffman, C. E., & Conner, B. (1994). Evaluation of effects of dietary n-6 to n-3 fatty acid ratios on leukotriene B synthesis in dog skin and neutrophils. Veterinary Dermatology, 5(4), 163-173. doi: 10.1111/j.1365-3164.1994.tb00028.x

Verlengia, R., Gorjao, R., Kanunfre, C. C., Bordin, S., De Lima, T. M., Martins, E. F., & Curi, R. (2004). Comparative effects of eicosapentaenoic acid and docosahexaenoic acid on proliferation, cytokine production, and pleiotropic gene expression in Jurkat cells. Journal of Nutritional Biochemistry, 15(11), 657-665. doi: 10.1016/j.jnutbio.2004.04.008

Vichai, V., Suyarnsesthakorn, C., Pittayakhajonwut, D., Sriklung, K., & Kirtikara, K. (2005). Positive feedback regulation of COX-2 expression by prostaglandin metabolites. Inflammation Research, 54(4), 163-172.

Vitkovic, L., Bockaert, J., & Jacque, C. (2000). “Inflammatory” Cytokines. Journal of Neurochemistry, 74(2), 457-471. doi: 10.1046/j.1471-4159.2000.740457.x

Wada, M., Minamisono, T., Ehrhart, L. A., Naito, H. K., & Mise, J. (1977). Familial hyperlipoproteinemia in beagles. Life Sciences, 20(6), 999-1008. doi: http://dx.doi.org/10.1016/0024-3205(77)90287-9

178

Wall, R., Ross, R. P., Fitzgerald, G. F., & Stanton, C. (2010). Fatty acids from fish: the anti- inflammatory potential of long-chain omega-3 fatty acids. Nutrition Reviews, 68(5), 280-289. doi: 10.1111/j.1753-4887.2010.00287.x

Wallenstein, S., Zucker, C. L., & Fleiss, J. L. (1980). Some statistical methods useful in circulation research. Circulation Research, 47(1), 1-9.

Wallin, R., Lundqvist, A., Moré, S. H., von Bonin, A., Kiessling, R., & Ljunggren, H.-G. (2002). Heat-shock proteins as activators of the innate immune system. Trends in Immunology, 23(3), 130-135.

Ward, L. C., Rae, L., Vankan, D., Flickinger, E., & Rand, J. (2012). Prediction of body composition in dogs by bioimpedance spectroscopy. Australasian Medical Journal, 5(12), 708.

Watson, T. D. G., & Barrie, J. (1993a). Lipoprotein metabolism and hyperlipidaemia in the dog and cat: A review. Journal of Small Animal Practice, 34(10), 479-487. doi: 10.1111/j.1748-5827.1993.tb03519.x

Watson, P., Simpson, K., & Bedford, P. (1993b). Hypercholesterolaemia in briards in the United Kingdom. Research in Veterinary Science, 54(1), 80-85.

Weaver, K. L., Ivester, P., Seeds, M., Case, L. D., Arm, J. P., & Chilton, F. H. (2009). Effect of dietary fatty acids on inflammatory gene expression in healthy humans. Journal of Biological Chemistry, 284(23), 15400-15407. doi: 10.1074/jbc.M109.004861

Weber, M., Bissot, T., Servet, E., Sergheraert, R., Biourge, V., & German, A. J. (2007). A high-protein, high-fiber diet designed for weight loss improves satiety in dogs. Journal of Veterinary Internal Medicine, 21(6), 1203-1208. doi: 10.1111/j.1939-1676.2007.tb01939.x

Weinsier, R., Wadden, T., Ritenbaugh, C., Harrison, G., Johnson, F., & Wilmore, J. (1984). Recommended therapeutic guidelines for professional weight control programs. American Journal of Clinical Nutrition, 40, 865-872.

Wilkinson, M. J. A., & McEwan, N. A. (1991). Use of ultrasound in the measurement of subcutaneous fat and prediction of total body fat in dogs Journal of Nutrition, 121, S47-S50.

Woods, J., Ward, G., & Salem, N. (1996). Is docosahexaenoic acid necessary in infant formula? Evaluation of high linolenate diets in the neonatal rat. Pediatric Research, 40(5), 687-694. doi: 10.1203/00006450-199611000-00007

Wronska, A., & Kmiec, Z. (2012). Structural and biochemical characteristics of various white adipose tissue depots. Acta Physiologica, 205(2), 194-208. doi: 10.1111/j.1748-1716.2012.02409.x

Xenoulis, P. G., & Steiner, J. M. (2010). Lipid metabolism and hyperlipidemia in dogs. The Veterinary Journal, 183(1), 12-21. doi: http://dx.doi.org/10.1016/j.tvjl.2008.10.011

179

Xu, L., Glass, C. K., & Rosenfeld, M. G. (1999a). Coactivator and corepressor complexes in nuclear receptor function. Current Opinion in Genetics & Development, 9(2), 140- 147.

Xu, H. E., Lambert, M. H., Montana, V. G., Parks, D. J., Blanchard, S. G., Brown, P. J., Sternbach, D. D., Lehmann, J. M., Wisely, G. B., & Willson, T. M. (1999b). Molecular recognition of fatty acids by peroxisome proliferator–activated receptors. Molecular Cell, 3(3), 397-403.

Xu, H. Y., Barnes, G. T., Yang, Q., Tan, Q., Yang, D. S., Chou, C. J., Sole, J., Nichols, A., Ross, J. S., Tartaglia, L. A., & Chen, H. (2003). Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. Journal of Clinical Investigation, 112(12), 1821-1830. doi: 10.1172/jci200319451

Yaissle, J. E., Holloway, C., & Buffington, C. T. (2004). Evaluation of owner education as a component of obesity treatment programs for dogs. Journal of the American Veterinary Medical Association, 224(12), 1932-1935.

Yamauchi, T., Kamon, J., Minokoshi, Y. a., Ito, Y., Waki, H., Uchida, S., Yamashita, S., Noda, M., Kita, S., & Ueki, K. (2002). Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Medicine, 8(11), 1288-1295.

Ye, J., Gao, Z., Yin, J., & He, Q. (2007). Hypoxia is a potential risk factor for chronic inflammation and adiponectin reduction in adipose tissue of ob/ob and dietary obese mice. American Journal of Physiology-Endocrinology and Metabolism, 293(4), E1118-E1128.

Yokota, T., Oritani, K., Takahashi, I., Ishikawa, J., Matsuyama, A., Ouchi, N., Kihara, S., Funahashi, T., Tenner, A. J., & Tomiyama, Y. (2000). Adiponectin, a new member of the family of soluble defense collagens, negatively regulates the growth of myelomonocytic progenitors and the functions of macrophages. Blood, 96(5), 1723- 1732.

Yoshino, S., & Ellis, E. F. (1987). Effect of a fish-oil-supplemented diet on inflammation and immunological processes in rats. International Archives of Allergy and Applied Immunology, 84(3), 233-240.

Zanghi, B. M., Cupp, C. J., Pan, Y., Tissot-Favre, D. G., Milgram, N. W., Nagy, T. R., & Dobson, H. (2013). Noninvasive measurements of body composition and body water via quantitative magnetic resonance, deuterium water, and dual-energy x-ray absorptiometry in awake and sedated dogs. American Journal of Veterinary Research, 74(5), 733-743.

Zentek, J., & Meyer, H. (1995). Normal handling of diets‐are all dogs created equal? Journal of Small Animal Practice, 36(8), 354-359.

180

Zhao, G. X., Etherton, T. D., Martin, K. R., Gillies, P. J., West, S. G., & Kris-Etherton, P. M. (2007). Dietary alpha-linolenic acid inhibits proinflammatory cytokine production by peripheral blood mononuclear cells in hypercholesterolemic subjects. American Journal of Clinical Nutrition, 85(2), 385-391.

Zhao, G. X., Etherton, T. D., Martin, K. R., Heuvel, J. P. V., Gillies, P. J., West, S. G., & Kris-Etherton, P. M. (2005). Anti-inflammatory effects of polyunsaturated fatty acids in THP-1 cells. Biochemical and Biophysical Research Communications, 336(3), 909- 917. doi: 10.1016/j.bbrc.2005.08.204

Zhao, G. X., Etherton, T. D., Martin, K. R., West, S. G., Gillies, P. J., & Kris-Etherton, P. M. (2004). Dietary alpha-linolenic acid reduces inflammatory and lipid cardiovascular risk factors in hypercholesterolemic men and women. Journal of Nutrition, 134(11), 2991-2997.

Zhu, Y., Qi, C., Calandra, C., Rao, M., & Reddy, J. (1995). Cloning and identification of mouse steroid receptor coactivator-1 (mSRC-1), as a coactivator of peroxisome proliferator-activated receptor gamma. Gene expression, 6(3), 185-195.

181