Differentiation During Lymphoid and Myeloid Cell and Heterogeneous Expression of IRF8 a Reporter Mouse Reveals Lineage-Specific

A Reporter Mouse Reveals Lineage-Specific and Heterogeneous Expression of IRF8 during Lymphoid and Myeloid Cell Differentiation This information is current as of September 25, 2021. Hongsheng Wang, Ming Yan, Jiafang Sun, Shweta Jain, Ryusuke Yoshimi, Sanaz Momben Abolfath, Keiko Ozato, William G. Coleman, Jr., Ashley P. Ng, Donald Metcalf, Ladina DiRago, Stephen L. Nutt and Herbert C. Morse III

J Immunol 2014; 193:1766-1777; Prepublished online 14 Downloaded from July 2014; doi: 10.4049/jimmunol.1301939 http://www.jimmunol.org/content/193/4/1766 http://www.jimmunol.org/

Supplementary http://www.jimmunol.org/content/suppl/2014/07/13/jimmunol.130193 Material 9.DCSupplemental References This article cites 63 articles, 36 of which you can access for free at: http://www.jimmunol.org/content/193/4/1766.full#ref-list-1 by guest on September 25, 2021 Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/193/9/4749.full.pdf

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

A Reporter Mouse Reveals Lineage-Speciﬁc and Heterogeneous Expression of IRF8 during Lymphoid and Myeloid Cell Differentiation

Hongsheng Wang,* Ming Yan,† Jiafang Sun,* Shweta Jain,* Ryusuke Yoshimi,‡ Sanaz Momben Abolfath,* Keiko Ozato,x William G. Coleman, Jr.,† Ashley P. Ng,{,‖ Donald Metcalf,{,‖ Ladina DiRago,{ Stephen L. Nutt,{,‖ and Herbert C. Morse, III*

The IFN regulatory factor family member 8 (IRF8) regulates differentiation of lymphoid and myeloid lineage cells by promoting or suppressing lineage-specific genes. How IRF8 promotes hematopoietic progenitors to commit to one lineage while preventing the development of alternative lineages is not known. In this study, we report an IRF8–EGFP fusion protein reporter mouse that revealed previously unrecognized patterns of IRF8 expression. Differentiation of hematopoietic stem cells into oligopotent pro- Downloaded from genitors is associated with progressive increases in IRF8-EGFP expression. However, significant induction of IRF8-EGFP is found in granulocyte–myeloid progenitors and the common lymphoid progenitors but not the megakaryocytic–erythroid progenitors. Surprisingly, IRF8-EGFP identifies three subsets of the seemingly homogeneous granulocyte–myeloid progenitors with an intermediate level of expression of EGFP defining bipotent progenitors that differentiation into either EGFPhi monocytic progenitors or EGFPlo granulocytic progenitors. Also surprisingly, IRF8-EGFP revealed a highly heterogeneous pre–pro-B population with a fluorescence intensity ranging from background to 4 orders above background. Interestingly, IRF8–EGFP readily distinguishes http://www.jimmunol.org/ true B cell committed (EGFPint) from those that are noncommitted. Moreover, dendritic cell progenitors expressed extremely high levels of IRF8-EGFP. Taken together, the IRF8-EGFP reporter revealed previously unrecognized subsets with distinct developmental potentials in phenotypically well-defined oligopotent progenitors, providing new insights into the dynamic heterogeneity of developing hematopoietic progenitors. The Journal of Immunology, 2014, 193: 1766–1777.

ematopoietic stem cells (HSCs) constantly differentiate The plasticity of hematopoietic differentiation has long been into all blood cell lineages via distinct differentiation known and recently was conﬁrmed at single-cell level by Naik et al.

H programs. Lineage specification and commitment are (7) using a novel “cellular barcoding” technique. The develop- by guest on September 25, 2021 marked by timely activation of one set of transcription factors mental heterogeneity of lineage progenitor cells has led not only associated with downregulation of other set(s) of transcription to inconsistencies in identifying phenotypes of intermediate stage factors important for alternate cell lineage potential. Although early cells but also to difficulties in positioning the newly found pre- studies led to the proposal that the flow of intermediate cells within cursors in the orderly progression of lineage differentiation path- each lineage is fixed (1, 2), recent evidence suggests otherwise— ways. For example, macrophages are thought to derive from that oligopotent progenitor differentiation is very “plastic,” espe- myeloid progenitors, whereas dendritic cells (DCs) are thought to cially when the host is stressed, by infection for example. This develop from separate pathways originating from either common causes reprogramming of early lymphoid and myeloid progenitors lymphoid progenitors (CLPs) or common myeloid progenitor leading to enhanced development of myeloid lineage cells but (CMPs) (1, 8–11). However, it was recently found that macro- curbed production of lymphoid lineage cells (3–6). phage–DC progenitors (MDPs) with a phenotype of CD117+

*Virology and Cellular Immunology Section, Laboratory of Immunogenetics, Na- Victoria (to A.P.N.), and the Victorian State Government Operational Infrastructure. tional Institute of Allergy and Infectious Diseases, National Institutes of Health, S.L.N. was supported by an Australian Research Council Future fellowship. Rockville, MD 20852; †Laboratory of Biochemistry and Genetics, National Institute H.W. designed, directed and performed experiments, analyzed data, and wrote the of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, paper; M.Y., J.S., S.J., R.Y., S.M.A., A.P.N., D.M., and L.D. designed and performed Bethesda, MD 20892; ‡Department of Internal Medicine and Clinical Immunology, experiments; A.P.N. wrote the paper; K.O., W.G.C., S.L.N. and H.C.M. directed the Yokohama City University Graduate School of Medicine, Yokohama 236-0004, x research; and H.C.M. steered the research, analyzed data, and wrote the paper. Japan; Program in Genomics of Differentiation, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892; {Walter Address correspondence and reprint requests to Dr. Herbert C. Morse, III, and and Eliza Hall Institute of Medical Research, Parkville, Victoria 3052, Australia; and Dr. Hongsheng Wang, National Institute of Allergy and Infectious Diseases, National ‖Department of Medical Biology, University of Melbourne, Parkville, Victoria 3010, Institutes of Health, 5640 Fishers Lane, Rockville, MD 20852. E-mail addresses: Australia [email protected] (H.C.M.) and [email protected] (H.W.) Received for publication July 22, 2013. Accepted for publication June 10, 2014. The online version of this article contains supplemental material. This work was supported by the Intramural Research Program of the National In- Abbreviations used in this article: 7AAD, 7-aminoactinomycin D; B6, C57BL/6J; stitutes of Health’s National Institute of Allergy and Infectious Diseases (to H.W., BM, bone marrow; CDP, common DC progenitor; CLP, common lymphoid progen- J.S., S.J., S.M.A., and H.C.M.), the National Institute of Child Health and Human itor; CMP, common myeloid progenitor; DC, dendritic cell; Flt3L, Flt3 ligand; Fr., Development (to R.Y. and K.O.), and the National Institute of Diabetes and Digestive fraction; GMP, granulocyte–monocyte progenitor; HSC, hematopoietic stem cell; and Kidney Diseases (to M.Y. and W.G.C.). A.P.N., L.D., and D.M. were supported IRF8, IFN regulatory factor family member 8; MDP, macrophage–DC progenitor; by Program Grant 1016647 and Independent Research Institutes Infrastructure Sup- MEP, megakaryocyte–erythroid progenitor; pDC, plasmacytoid DC; PreGM, pre- port Scheme Grant 361646 from the Australian National Health and Medical Re- granulocyte–macrophage; qPCR, quantitative real-time PCR; SCF, stem cell factor; search Council. This work was also supported by the Carden fellowship (to D.M.) WT, wild-type. from the Cancer Council of Victoria, a Cure Cancer Australia/Leukaemia Foundation Australia postdoctoral fellowship and a Lions fellowship from the Cancer Council of www.jimmunol.org/cgi/doi/10.4049/jimmunol.1301939 The Journal of Immunology 1767

+ CX3CR1 can give rise to both macrophages and DCs (12). These Clonogenic colony assays findings suggest that most, if not all, well-characterized progenitor Cultures were performed with sorted populations using semisolid agar populations are heterogeneous at the clonal level, even though cultures in 1-ml volumes of 0.3% agar in IMDM containing 20% v/v they appear to have a homogeneous phenotype by certain criteria. newborn calf serum using cytokine stimuli as previously described (26), Most of our current knowledge of how blood cells are made incubated for 7 d in a fully humidified atmosphere of 5% CO2 in air. came from studies of transcription factors. One of a series of tran- Cultures were fixed, dried onto glass slides, and stained for acetylcholin- esterase and then with Luxol fast blue and hematoxylin and the number scription factors modulating hematopoietic fate determination is and type of colonies were determined by microscopic examination. IFN regulatory factor family member 8 (IRF8), also known as IFN consensus sequence binding protein. IRF8 is expressed mostly in Immunization cells of the hematopoietic system. Microglial cells with a hema- Mice were immunized i.p. with 100 mg NP-KLH (Biosearch Technologies) topoietic origin also express IRF8 (13, 14). Functional analyses in alum. Splenocytes were analyzed 7 d later by flow cytometry. revealed broad contributions of IRF8 to the regulation of myeloid Quantitative real-time PCR and lymphoid lineage development. The levels of IRF8 transcripts FACS-purified B cell subsets were extracted for RNA using a RNeasy are low in HSCs, but increased in yet poorly defined CLPs, MPs, and Mini kit (Qiagen) including a DNA digestion step, according to the manu- common DC progenitors (CDPs) (15, 16). IRF8 deficiency in mice facturer’s instructions. Approximately 50 –100 ng total RNA in 20 ml was causes disrupted development of monocytes and macrophages but reverse transcribed with Superscript III reverse transcriptase (Invitrogen). increased differentiation of neutrophils (17). The numbers of several One nanogram of cDNA was amplified in triplicate using an ABI Prism subtypes of DCs including plasmacytoid DCs (pDCs), CD8a+ DCs, 7900HT SDS with the SYBR Green PCR Master Mix reagents (Applied Biosystems) and primers (Table I). The housekeeping genes Gapdh and

+ Downloaded from and CD103 nonlymphoid tissue DCs are also greatly diminished in Hprt were amplified as internal controls. The relative RNA levels were 2/2 Irf8 mice (15, 18–23). In humans, a loss of function mutation of calculated by the 22DDCT algorithm (27). IRF8 also causes a monocytic and DC immunodeficiency (24). In vitro differentiation assay Although IRF8 expression is upregulated in both myeloid and lymphoid progenitors, as determined by conventional PCR meth- Sort-purified B cells were cultured on an OP9 stromal cell layer (purchased ods on sorted bulk populations, little is known about how IRF8 from American Type Culture Collection) with cytokines including IL-7 (10 ng/ml), Flt3 ligand (Flt3L; 200 ng/ml), stem cell factor (SCF; 50 ng/ml), participates in the distinct transcriptional programs that control GM-CSF (40 ng/ml), IL-4 (20 ng/ml), or IL-15 (10 ng/ml) for different http://www.jimmunol.org/ lineage specification and commitment. In this study, we created an periods of time. The cells were then analyzed by flow cytometry. IRF8-EGFP reporter mouse by a knockin of the EGFP sequence In vivo adoptive transfer assay into the IRF8 stop codon that results in transcription and translation of an IRF8-EGFP fusion protein under the regulation of endoge- A total of 0.4–2 3 105 of sort-purified cells were injected i.v. into suble- nous IRF8 regulatory elements. Our data revealed previously un- thally (500 rad) irradiated B6.CD45.1 mice. The mice were given antibiotics appreciated expression patterns of IRF8 that help to explain the functions of IRF8 in distinct lineages of hematopoietic cells and to Table I. Primer sequences used for qPCR better understand the heterogeneity of early progenitors.

Genes Sequence by guest on September 25, 2021 Materials and Methods Pu.1 CGGATGTGCTTCCCTTATCAAAC 59 Mice Pu.1 TGACTTTCTTCACCTCGCCTGTC 39 Ebf1 CCCCTCCAACTGCAGTAGCT 59 IRF8-EGFP fusion protein reporter mice were generated by Ozgene using Ebf1 GACCATGTTGGCTGGTGAGAA 39 a C57BL/6J (B6) germline targeting strategy illustrated in Fig. 1. Mice were E2a GCAACCTGAACCCCAAAGC 59 genotyped by PCR analysis of tail DNA using primers wild-type (WT) IRF8 E2a ACCACGCCAGACACCTTCTC 39 reverse (59-CTGTCAGCTGACACAGAGTC-39), IRF8 forward (59-TGTA- Pax5 GCAGAGCGAGTCTGTGACAATG 59 CCTCACACCAGAGACC-39), and IRF8 GFP reverse (59-CGCTGAACT- TGCTGTACTTTTGTCCGAATGATC a b Pax5 39 TGTGGCCGTTT-39). B6 and B6.SJL-Ptprc Pepc /BoyJ (CD45.1) con- Cebpa CCCCCAGTCAGACCAGAAAG 59 genic mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Cebpa CCCACAAAGCCCAGAAACCT 39 The use of mice in this study followed a protocol (LIG-16E) approved by the Csf1r TTTTAAAAAACCCGTCCCAAACT 59 National Institute of Allergy and Infectious Diseases Animal Care and Use Csf1r AGCCTTTGAGACTCTTGTCTTTTGA 39 Committee, a protocol (K052-LBG-07) approved by the National Institute of Rag2 TCCTGCTTGTGGATGTGAAA 59 Diabetes and Digestive and Kidney Diseases Animal Care and Use Com- Rag2 GTGCCGAGTTTAATTCCTGG 39 mittee, and protocols approved by the WEHI animal and ethics committee. Stat1 CTGAATATTTCCCTCCTGGG 59 Flow cytometry Stat1 TCCCGTACAGATGTCCATGAT 39 Csf2ra CTTTCGTTGACGAAGCTCAG 59 Cells were prepared and stained as reported previously (25). mAbs specific Csf2ra GCTGGTTCAGGAGGATGATG 39 for cell surface markers are listed in Supplemental Table I. Cells were Cebpb GGCCCGGCTAGACAGTTAC 59 analyzed using an LSR II analyzer (BD Biosciences) and FlowJo software. Cebpb GTTTCGGGACTTGATGCAAT 39 Dead cells were excluded by gating on cells negative for a viability dye (7- Flt3 AACTGGGCGTCATCATTTTC 59 aminoactinomycin D [7AAD], propidium iodide, or fixable viability dye Flt3 GTGAACAGAGAGGCCTGGAG 39 eFluor506). Doublets were excluded electronically by setting a SSC-A Cx3cr1 ATCCAGTTCAGGGAAGGAGG 59 versus FCS-W gate. For some experiments, cells were sorted by a FAC- Cx3cr2 AGACTGGGTGAGTGACTGGC 39 SAria sorter (BD Biosciences). For intracellular staining, bone marrow Ifngr1 CAGCATACGACAGGGTTCAA 59 (BM) cells were first stained with Abs for defining B cell subsets, followed Ifngr1 GATGCTGTCTGCGAAGGTC 39 by fixation and permeabilization with a Fix-and-Perm kit (Invitrogen). The Ifngr2 TGACGGCTCCCAAGTTAGAA 59 cells were then stained with a polyclonal anti-IRF8 Ab (C-19X; Santa Cruz Ifngr2 CTGCTGCTCTGTGGGCTC 39 Biotechology) and a secondary Alexa Fluro 546–labeled donkey anti-goat Ifnar1 ACACTGCCCATTGACTCTCC 59 Ab (Invitrogen). The cells were analyzed by flow cytometry. Ifnar1 TTGGGTGCTACCCTCAGC 39 Ifnar2 CCACAAGACACAAGCTGAGG 59 Cytomorphology Ifnar2 CAGAGGGGGATTCACGAGAC 39 CAGGAACAGGCTGTCAAGGT Cytocentrifuge preparations were stained with a May-Grunwald-Giemsa Stat2 59 CGCTTGGAGAATTGGAAGTT stain before microscopic examination. Images were acquired using a Stat2 39 ACTCGGCCACCATAGATGAA Nikon Eclipse E600 microscope, 3100/1.3 NA oil objective with AxioCam Irf9 59 TGAGCTAGAGGAGGGAGCTG Hrc and AxioVision 3.1 image acquisition software. Irf9 39 1768 HETEROGENEOUS EXPRESSION OF IRF8 IN LYMPHOMYELOID CELLS

FIGURE 1. Generation of the IRF8-EGFP reporter. (A) A diagram of the targeting strategy used to replace the stop codon with an EGFP-PGK-Neo cassette. The PGK-Neo sequence was subsequently deleted by Cre-mediated excision. (B) The tail DNA of IRF8-EGFP mice was analyzed by PCR. The primers detected the knockin fragment at 139 bp and the WT fragment at 642 bp. Downloaded from http://www.jimmunol.org/

in their drinking water after irradiation. The splenocytes of recipients were the mouse germline using Cre recombinase. The targeting strategy stained and analyzed by flow cytometry 10 d later. resulted in the expression of mRNA encoding an IRF8-EGFP by guest on September 25, 2021 Statistical analysis fusion protein under the control of the endogenous Irf8 regulatory elements. A retroviral construct encoding essentially the same Student t test was used to determine the statistical significance of the data. IRF8-EGFP fusion protein was previously used to study IRF8 A p value , 0.05 was considered to be statistically significant. function in infected cells or cell lines and was not found to cause unexpected effects because of the EGFP sequence (28). Geno- Results typing of Irf8-EGFP knockin mice identified heterozygous and Generation of IRF8-EGFP fusion protein reporter mice homozygous mice (Fig. 1B). As expected, the IRF8–EGFP mice The stop codon at exon 9 of the mouse Irf8 locus was replaced with developed normally without differences from WT mice. More- an EGFP sequence (Fig. 1A). The PGK-Neo selection cassette over, homozygous mice, which expressed twice as much IRF8- inserted into exon 9 next to the EGFP sequence was deleted from EGFP as heterozygous mice, were phenotypically indistinguish-

Table II. Cellular distribution of hematopoietic cells in WT and IRF8-EGFP mice

Absolute Cell Numbers (3105) per Femur (Mean 6 SD) BMa Genotype CMPs GMPs Fr. A Fr. B-C Fr.D Fr. E Fr. F WT 0.15 6 0.02 0.08 6 0.02 0.24 6 0.04 0.37 6 0.22 3.08 6 2.13 2.0 6 1.12 2.53 6 1.25 IRF8-EGFPEgfp/+ 0.18 6 0.04 0.1 6 0.02 0.29 6 0.05 0.47 6 0.33 2.41 6 1.25 1.3 6 0.56 2.73 6 0.64 IRF8-EGFPEgfp/Egfp 0.15 6 0.03 0.1 6 0.03 0.22 6 0.07 0.55 6 0.13 3.15 6 0.65 2.01 6 0.48 3.66 6 1.04

Absolute Cell Numbers (3106) (Mean 6 SD) Spleenb Genotype T Cells FO B Cells MZ B Cells DCs N M WT 18.3 6 7.0 14.6 6 4.0 1.7 6 0.6 0.2 6 0.1 0.7 6 0.4 0.5 6 0.3 IRF8-EGFPEgfp/+ 20.1 6 7.8 12.5 6 5.3 1.4 6 0.7 0.2 6 0.1 0.6 6 0.3 0.4 6 0.2 IRF8-EGFPEgfp/Egfp 23.6 6 5.0 14.1 6 2.0 1.6 6 0.6 0.2 6 0.1 0.4 6 0.1 0.5 6 0.1 aBM cells from indicated mice were stained and analyzed by flow cytometry. The gating schemes used for calculating each population were depicted in Figs. 2 and 4. Data represent four mice per group. bSplenocytes from indicated mice were stained and analyzed by flow cytometry. The cells were gated for T cells (CD4+), follicular (FO) B cells (CD19+IgM+CD23+CD21lo/2), marginal zone (MZ) B cells (CD19+IgM+CD232CD21+), DCs (MHCII+CD11chi), neutrophils (N) (CD32CD192Gr-1hiCD11b+), and monocytes (M) (CD32CD192Gr- 1intCD11b+). Data represent four mice per group. The Journal of Immunology 1769 able from heterozygous and WT mice for the cellular distribution Gr12CD11b2Ter1192CD192CD27+Flt3+IL7R+B2202CD11c2) of lymphocytes and myeloid cells among different lymphoid (31) revealed similar results (Fig. 2C, Supplemental Fig. 1A). organs (Table II). To study this further, we examined myeloid progenitor populations using an expanded range of markers to characterize IRF8- IRF8-EGFP expression distinguishes bipotent granulocyte- EGFP expression in the granulocyte–macrophage committed macrophage progenitors from more differentiated progeny Lin2IL-7R2Sca-12cKit+ CD1502FcgRII/III2 pre-granulocyte– Previous analyses of Irf8 transcripts showed that expression of macrophage (PreGM) Flt3+ progenitors and multipotential PreGM IRF8 increased after differentiation of HSCs into Lin2IL-7R2 Flt32 progenitors (Fig. 3A, left panel), both of which lie within the Sca-12cKit+ myeloid progenitors and Lin2IL-7R+Sca-1+cKitlo CLPs CMP fraction that we had characterized previously (32, 33). Using (16). By using multicolor flow cytometry and a gating strategy of this approach, we identified IRF8-EGFP expression in Flt3+ PreGMs, Pronk et al. (29), we detected IRF8-EGFP expression in early which are the first identifiable cells committed to forming GMPs hematopoietic progenitors. As shown in Fig. 2A and 2B, long- (Fig. 3A, middle panel) but not in the multipotential Flt32 PreGMs term- and short-term-HSCs expressed negligible levels of IRF8- that form GMPs as well as bipotential MEPs in vivo (32). These EGFP (Fig. 2B). Differentiation of HSCs into the multipotent data suggest that IRF8 expression identifies the first point in the progenitor→CMP→granulocyte–myeloid progenitor (GMP) path- myeloid progenitor hierarchy associated with granulocyte–monocyte way coincided with sequential increases in IRF8-EGFP expression commitment from CMPs. (Fig. 2B). Nearly all Flt3+ CLPs were positive for IRF8-EGFP, Given the range of IRF8-EGFP expression in GMPs (Fig. 2B), whereas megakaryocyte–erythroid progenitors (MEPs) were nega- we then fractionated GMPs into three subpopulations based on tive (Fig. 2B). Further characterization of CLPs by using the Hardy IRF8-EGFPlo,IRF8-EGFPint, and IRF8-EGFPhi expression (Fig. 3A, Downloaded from criteria (CD32Gr12CD11b2Ly6C2Ter1192CD192CD242AA4.1hi right panel) and examined their cytomorphology (Fig. 3B) and CD43+B2202cKitloIL7R+) (30) or the Weissman criteria (CD32 myeloid colony-forming potential by semisolid agar clonogenic http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 2. IRF8-EGFP expression in BM hematopoietic progenitors. (A) Gating schemes shown for the identiﬁcation of LT-HSC, ST- HSC, multipotent progenitor (MPP), GMP, CMP, MEP, and CLP. Lineage panel Abs included anti-CD3, B220, CD11b, Gr-1, and Ter119. Cells were gated on 7AAD2 singlet cells. (B) Overlays are expression of IRF8- EGFP over WT controls. (C) IRF8-EGFP expression in CLPs deﬁned by Rumfelt et al. (30). Data are representative of eight independent experiments. 1770 HETEROGENEOUS EXPRESSION OF IRF8 IN LYMPHOMYELOID CELLS

FIGURE 3. IRF8-EGFP identifies specific myeloid PreGM and GMP populations. (A) Gating schemes for identification of PreGM and GMP populations with IRF8-EGFP expression shown. (B) Cytomorphology of IRF8-EGFPlo/2,-EGFPint,and-EGFPhi GMP populations sorted from Lin2 BM cells of IRF8-EGFP mice. The cells Downloaded from were stained with a May–Grunwald– Giemsa stain and shown at original magnification 3100. (C) Clonogenic colony-forming assays of IRF8- EGFPlo/2,-EGFPint,and-EGFPhi GMP populations cultured with 103 U/ml

G-CSF, GM-CSF, M-CSF, or IL-3. http://www.jimmunol.org/ The numbers are CFUs of granulocyte (G), granulo-monocyte (GM), monocyte (M), and eosinophil (Eo) per 100 cells plated (means 6 SDs of three biological replicates). by guest on September 25, 2021

colony assays using cytokine stimuli associated with specific cy- intermediate IRF8 expression identifying GMPs that could con- tokine receptor signaling, namely G-CSF, M-CSF, GM-CSF, and tribute to all forms of myeloid colonies in vitro with the greatest IL-3 (Fig. 3C). potential to form granulocyte colony–forming potential colonies. Morphologically, all GMP populations were composed pri- IRF8-EGFPhi cells have predominantly monocytic lineage po- marily of promyelocytes, myelocytes, and metamyelocytes but tential, whereas IRF8-EGFPlo GMPs appear to have lost most with IRF8-EGFPlo GMPs containing some more differentiated myeloid clonogenic potential. granulocyte ring forms and eosinophil progenitors as well (Fig. 3B). In semisolid agar colony-forming assays, the IRF8-EGFPint GMPs IRF8-EGFP expression revealed heterogeneous pre–pro-B and were capable of forming all myeloid colonies in vitro and on a per homogeneous late B cell populations at the single-cell level cell basis possessed the greatest granulocyte colony–forming B cell lineage specification has been proposed to occur at the pre– potential in response to all cytokine stimuli (Fig. 3C). Interest- pro-B cell stage (Hardy fraction [Fr.] A), which is characterized hi ingly, IRF8-EGFP GMPs were biased toward macrophage col- by the generation of IgH D to JH gene rearrangements (34). The ony formation after exposure to GM-CSF and M-CSF in particular criteria used for phenotypic identification of pre–pro-B cells have while having virtually no response to G-CSF (Fig. 3C). In contrast, been inconsistent in the literature, possibly because of the use of IRF8-EGFPlo GMPs did not possess significant colony forming different markers and gating strategies. For example, the original potential to any of the cytokine stimuli when compared with the definition of Fr. A was based on four markers: B220, CD43, CD24, other GMP populations, consistent with this population being com- and BP-1/Ly-51 (34). This was later expanded to more than 8 posed primarily by more differentiated and no longer clonogenic (B220, CD43, CD24, CD19, AA4.1, cKit, IL-7R, and BP-1) as granulocyte progenitors. Eosinophil colony forming potential was well as the lineage markers (30). Kincade’s group defined pre– minimal and basically seen only in cultures of IRF8-EGFPlo cells. pro-B cells as DX5-Ly6C2IgM2B220+CD43+CD192CD242 (35). Taken together, these data demonstrate that GMPs are a het- More recently, Weissman’s group redefined early stage B cells by erogeneous collection of myeloid-committed progenitors, with using Ly6D (31). To accommodate these different nomenclatures The Journal of Immunology 1771 for this B lineage subset, we combined markers used by the Hardy pro-B cells and examine their B cell developmental potentials. and Kincade groups to exclude granulocytes, monocytes, NK cells, First, we examined expression levels of a selected set of 18 genes and T cells as well as erythroid and megakaryocytic lineage cells. that are considered to be “signature genes” representing lymphoid, Thus, the pre–pro-B cells were defined as CD192CD43+CD242 myeloid, and DC lineages as well as signaling activities of cyto- B220+AA4.1+cKit+IL7R+DX52CD32Gr-12CD11b2CD11c-Ly6C2 kine receptor pathways. As shown in Fig. 5A and 5B, EGFP neg, Ter1192 (Fig. 4A). As shown in Fig. 4B, the expression of IRF8- int, and hi subsets were well distinguished by expression patterns EGFP in Fr. A cells was strikingly heterogeneous with fluorescence of these genes. The lymphoid genes Pax5, Rag2, Pu.1, and Flt3 intensity ranging from negative (background) to 104 above back- were enriched in the EGFPint subset, whereas the myeloid and ground. In contrast, cells in Fr. B through Fr. F expressed moderate dendritic progenitor representative genes Cebpb, Csf1r, Csf2r, and relatively homogeneous levels of IRF8-EGFP (Fig. 4B). and Cx3cr1 were over-expressed in the EGFPhi subset. Next, we Using the Weissman nomenclature, which includes Ly6D to evaluated the B cell developmental potential of these subsets distinguish all-lymphoid progenitors, B cell lineage progenitors, in vitro under lymphoid permissive conditions. EGFPint pre–pro- and pre–pro-B cells (31), we observed similar heterogeneity of B cells cultured in the presence of IL-7 gave rise to substantial IRF8-EGFP expression in Ly6D+ pre–pro-B cells (Supplemental numbers of CD19+ B cells within 48 h, whereas EGFPneg and Fig. 1A). Most recently, Medina et al. (36) have shown that EGFPhi pre–pro-B cells did so at greatly reduced frequencies PDCA-1 could reduce pDC contamination from the pre–pro-B (Fig. 5C). After 4 d of culture, the generation of CD19+ B cells fraction. By including PDCA-1 as an additional marker, we was significantly enriched in all subsets, but the frequency of evaluated the Hardy Fr. A for IRF8-EGFP expression. We found B cells generated by EGFPint cells was still the highest (90%), that PDCA-1 expression was heterogeneous in the Fr. A com- followed by EGFPhi (60%) and EGFPneg (31%) (Fig. 5C). Finally, Downloaded from partment. Excluding PDCA-1+ cells did not change the hetero- because the EGFPhi pre–pro-B cells expressed both lymphoid and geneous nature of IRF8-EGFP expression (Supplemental Fig. 1B). myeloid progenitor genes (Fig. 5B), we tested the developmental From this, we conclude that the pre–pro-B compartment is potential of EGFPhi pre–pro-B cells by an adoptive transfer assay. a mixture of cells with different levels of IRF8-EGFP expression. Although EGFPhi pre–pro-B cells could yield a small number of Further analyses of peripheral B cells revealed consistently ho- B cells in vivo at 10 d following adoptive transfer, most of the

mogeneous and similar levels of IRF8-EGFP expression throughout progeny belonged to DC and/or monocyte lineages based on ex- http://www.jimmunol.org/ the transitional to mature stages (Supplemental Fig. 2). In keeping pression of markers including B220, CD19, IRF8-EGFP, Gr-1, and with previous studies of IRF8 transcripts employing microarray CD11b (Fig. 5D). Altogether, we conclude that B cell lineage and quantitative RT-PCR analyses (37), expression of IRF8-EGFP specification and commitment is primarily associated with inter- was significantly increased in germinal center B cells and decreased mediate levels of IRF8-EGFP expression. in plasma cells (Supplemental Fig. 2). In addition, neutrophils were DC progenitors express very high levels of IRF8-EGFP negative for IRF8-EGFP, whereas NK cells and macrophages expressed intermediate levels (Supplemental Fig. 2). DCs are generated from lineage potential–restricted progenitors including MDPs and CDPs (38, 39). Studies of MDPs (Lin2 2 2 2 + + + 2 IRF8-EGFP expression distinguishes B cell committed from CD11c SiglecH MHCII Flt3 cKit CD115 ) and CDPs (Lin by guest on September 25, 2021 noncommitted pre–pro-B cells CD11c2SiglecH2MHCII2Flt3+cKit2CD115+) revealed strikingly The finding that expression levels of IRF8-EGFP in the pre–pro- high and homogeneous expression of IRF8-EGFP (Fig. 6A). BM B cell compartment spanned 4 logs in fluorescence intensity pDCs (B220+SiglecH+CD11c+MHCII+) were also IRF8-EGFPhi prompted us to sort-purify EGFPneg, EGFPint, and EGFPhi pre– (Fig. 6B). By contrast, splenic DCs exhibited heterogeneous ex-

FIGURE 4. IRF8-EGFP expression in BM B lineage cells. (A) Gating schemes for identiﬁcation of Hardy Frs. A, B, C, D, E, and F, which represent pre–pro-B, early pro-B, late pro-B, pre-BII, immature, and mature B cells, respectively. Lineage panel Abs contained anti-CD3, -CD11b, -CD11c, -Ly6C, and -Ter119 Abs. (B) Overlays are expression of IRF8-EGFP in each subset over WT controls. Data are representative of nine independent experiments. 1772 HETEROGENEOUS EXPRESSION OF IRF8 IN LYMPHOMYELOID CELLS

FIGURE 5. The developmental potential of IRF8- EGFP+ pre–pro-B cells. (A) Sort-purification of pre– pro-B cells with different levels of IRF8-EGFP. Downloaded from Lineage panel Abs included anti-CD3, -CD11b, -CD19, -Gr-1, and -Ter119. (B) Sort-purified cells were analyzed by qPCR for expression of indicated genes. Numbers are relative amounts of mRNA. Data are representative of two independent experiments with similar results. FOB, follicular B cell. (C) Sort- http://www.jimmunol.org/ purified cells were cultured with IL-7 for 2 d (top panel) or with SCF, Flt3L, and IL-7 for 4 d (bottom panel). The cells were then analyzed by flow cytometry. The numbers are percentages of cells falling in each gate. Data are representative of three independent experiments. (D)EGFPhi pre–pro-B cells sort-purified as in (A) were injected i.v. into sublethally irradiated CD45.1 congenic mice. The splenocytes of recipient mice were analyzed by flow cytometry 10 d later. Data are representative of eight by guest on September 25, 2021 mice from three independent experiments. The numbers are percentages of cells falling in each gate. MO, monocyte-like cell.

pression of IRF8-EGFP (Fig. 6C). We conclude that DC lineage pression in thymic T lineage cells including early T cell progen- speciﬁcation and commitment are associated with very high levels itors were negative to weak positive (Fig. 7A, 7B). Most peripheral of IRF8-EGFP expression. naive T cells including CD4 and CD8 T cells were also negative T lineage cells express negligible levels of IRF8-EGFP for IRF8-EGFP expression (Fig. 7C). The minimal levels of IRF8- EGFP expression in T lineage cells under steady-state conditions A previous report indicated that IRF8 is dispensable for development of T cells (17). To determine whether IRF8-EGFP was argue that IRF8 is not required for thymic T cell development and expressed by T cells, we examined thymic and splenic T lineage homeostasis, consistent with the characteristics of IRF8 knockout cells by ﬂow cytometry. The overall levels of IRF8-EGFP ex- mice (17). The Journal of Immunology 1773

FIGURE 6. IRF8-EGFP expression in DC progenitors and mature DCs. (A and B) BM cells were stained and analyzed by ﬂow cytometry. MDPs and CDPs (A) and pDCs (B) were identiﬁed as indicated. Overlays were IRF8-EGFP over WT controls. (C) Splenocytes were analyzed for IRF8-EGFP expression in DCs. Cells were gated on Viability dye eFluor506-negative singlets. The numbers are percentages of cells falling in each gate. Data are representative of eight independent experiments. Downloaded from http://www.jimmunol.org/

IRF8-EGFP expression is upregulated in activated B and IRF8 protein expression, on a single-cell level, in all hematopoietic T cells cell types from the earliest adult progenitors to their terminally To determine whether expression of IRF8-EGFP is altered in differentiated progeny. The levels of IRF8-EGFP expression were activated lymphocytes, we stimulated purified B and T cells with initially low in HSCs but progressively increased along with HSC anti-BCR, -TCR, LPS, CpG, and/or IFN-g and measured ex- differentiation into two major branches of the hematopoietic tree, by guest on September 25, 2021 pression levels of IRF8-EGFP by flow cytometry. As shown in the myeloid and lymphoid lineages. The lack of IRF8-EGFP ex- Fig. 8A, expression of IRF8-EGFP was significantly upregulated pression in the third branch, the megakaryocytic and erythroid in B cells stimulated with LPS, CpG, and anti-IgM Abs. A syn- lineages, is consistent with the idea that IRF8 has no role in ergistic effect on IRF8-EGFP expression was observed between promoting differentiation along these pathways. Surprisingly, ex- LPS and IFN-g. Stimulation of T cells by coligation of the TCR pression of IRF8-EGFP was extremely heterogeneous in the well- ∼ and CD28 also dramatically enhanced expression of IRF8-EGFP defined and seemingly homogeneous GMPs with 40% of these (Fig. 8B). We therefore conclude that expression of IRF8-EGFP, cells being negative for IRF8-EGFP expression. By using additional markers, we were able to define the IRF8-EGFP–positive similar to IRF8 native proteins in stimulated B and T cells (40), is + markedly upregulated in activated B and T cells. and –negative subpopulation as being Flt3 PreGMs with restricted GMP potential and Flt32 PreGMs with GMP, megakaryocytic, and erythroid potential, respectively. We further identified Discussion three subsets of GMPs with varying levels of IRF8-EGFP ex- Previous studies showing that IRF8-deficient mice exhibited broad pression and differentiation potential. Perhaps counterintuitively, defects in the development of a variety of cell types led to the the IRF8-EGFPint GMPs represented the true bipotent GMPs be- concept that IRF8 might regulate gene programs facilitating cel- cause they are readily primed for the granulocyte and macrophage lular lineage differentiation. However, except for the evidence that lineages. In contrast, the IRF8-EGFPhigh GMPs significantly en- IRF8 may extinguish gene programs for neutrophil fate and pro- riched for monocytic lineage forming progenitors, whereas the mote differentiation of the macrophage and the DC lineages (15, IRF8-EGFPneg GMPs were more mature granulocytic and eosin- 41), little is known whether and how IRF8 could regulate myeloid ophilic progenitors that had lost significant CFU potential. Al- versus lymphoid lineage selection at different branch points. We though the driving force for IRF8 expression in GMP subsets is now use an IRF8-EGFP reporter mouse to demonstrate that IRF8- currently unknown, our finding that IRF8-EGFP subsets of GMPs EGFP exhibits different expression patterns in distinct progenitor responded differently to cytokine-driven differentiation in vitro cells of the myeloid and lymphoid lineages, correlating with (Fig. 3) supports the hypothesis that cytokines may play more previous studies showing that IRF8 is differentially expressed in selective (42) than instructive (43) roles in development of oli- distinct lineages of hematopoietic cells. Most importantly, IRF8- gopotential progenitors. EGFP reporter mice revealed previously unappreciated heteroge- Another striking finding of the IRF8-EGFP reporter is the neity in expression of IRF8 in some of the seemingly homoge- heterogeneity of the pre–pro-B cell compartment. Since the first 2 neous populations of oligopotent progenitors including CMPs, description of B220+CD19 pre–pro-B cells (Fr. A) by Hardy GMPs, and pre–pro-B cells. et al. (34), the B cell developmental potential of this population The most prominent finding of this study is that the IRF8-EGFP has been assessed by both in vitro and in vivo assays. The in- reporter allele made it possible to accurately measure the levels of consistent observations in the literature have been largely attrib- 1774 HETEROGENEOUS EXPRESSION OF IRF8 IN LYMPHOMYELOID CELLS

FIGURE 7. IRF8-EGFP expression in T cells. (A) Gating schemes used to identify early T cell progenitors (ETPs) and double-negative (DN) and double-positive (DP) populations in the thymus. (B)

Overlays show expression of IRF8-EGFP over WT Downloaded from controls in thymocytes. (C) Splenocytes of WT and IRF8-EGFP mice were stained and analyzed by ﬂow cytometry. All cells were gated on 7AAD2 single cells. Data are representative of ﬁve independent experiments. FSC, forward light scatter. http://www.jimmunol.org/ by guest on September 25, 2021

uted to contamination by other types of cells, such as DCs that compartment could be a true nature of this population. A strong express Ly6C (44) or PDCA-1 (36). In this study, we used strin- bias of IRF8-EGFPhi Fr. A cells to develop into DC–myeloid gent gating strategies revised by Hardy and colleagues (30) and lineages as assessed by adoptive transfer assays (Fig. 5D) is identified three subsets with low, intermediate, and high levels of consistent with the notion that some DCs bear rearranged Ig DHJH IRF8-EGFP in this well-defined Fr. A compartment (Fig. 4). When sequences (45, 46). This is consistent with the idea that DCs tested under lymphoid permissible conditions, EGFPint Fr. A cells might be generated from different developmental pathways, in- quickly differentiated into CD19+ B cells, suggesting that IRF8- cluding at least the MDP–CDP pathway and the pre–pro-B EGFPint pre–pro-B cells are readily specified to the B cell lineage. pathway. Therefore, the IRF8-EGFP reporter mouse could be Although IRF8-EGFPneg Fr. A cells could be precursors of IRF8- a valuable tool for investigating the nature of the pre–pro-B cell EGFPint and -EGFPhi pre–pro-B cells, as suggested by studies of population. cells cultured with Flt3L, SCF, IL-7, and IL-15 (Supplemental Another intriguing finding of this study is that differentiation Fig. 3A), most of IRF8-EGFPhi Fr. A cells appeared to be speci- to the DC lineage, and pDC in particular, is associated with very fied for the DC and/or monocyte lineages (Fig. 5 D). Because high expression of IRF8. Both MDPs and CDPs are uniformly pDCs express B220 and very high levels (104 above background) IRF8-EGFPhi. This suggests that commitment to the DC lineage of IRF8-EGFP (Fig. 6), it was possible that IRF8-EGFPhi pre–pro- is highly dependent on IRF8-regulated gene programs. Indeed, B cells could be contaminated by a small number of pDCs that IRF8-deficient mice exhibit a complete blockade in the develop- expressed low levels of Ly6C and were not excluded efficiently ment of pDCs and CD8a+ cDCs (21, 22). Although this study was by gating. To exclude this possibility, we assessed PDCA-1 ex- in preparation for submission, Rosenbauer and colleagues reported pression in Fr. A cells. PDCA-1+ pDCs recently have been shown to a very similar finding in DC progenitors by using an IRF8-Venus contaminate the analysis of pre–pro-B cells (36). Consistent with reporter mouse (47). the results from using the Hardy and the Weissman gating strat- As with any other EGFP reporter models, there is a concern of egies, gating on PDCA-12 Fr. A cells still yielded heterogeneous reporter efficiency during a dynamic differentiation process. On the expression levels of IRF8-EGFP (Supplemental Fig. 1B). We one hand, a prolonged requirement for IRF8-EGFP to build up to believe that the existence of IRF8-EGFPhi subset in the Fr. A a sufficient level for detection would underreport true IRF8 pro- The Journal of Immunology 1775

Finally, the IRF8-EGFP reporter mouse recently has been demon- strated to faithfully reveal dynamic changes of IRF8 expression during progression of an experimental autoimmune encephalomyelitis disease (52) and in differentiating Langerhans cells (53). Altogether, the IRF8-EGFP reporter appeared to faithfully reflect true IRF8 expression in both physiological and pathological conditions. In view of the data indicating that IRF8-EGFP could identify subsets of GMPs and pre–pro-B cells with distinct lineage potentials, we propose that there exists an IRF8 concentration-dependent mechanism for myeloid and lymphoid lineage specification and commitment. In this model, the development of macrophages and DCs requires very high levels of IRF8, whereas the generation of B lineage cells depends on intermediate levels. Minimal or no requirement of IRF8 is found for the development of megakaryocytic and erythroid cells as well as the T cell lineage in general. The phenotypes of IRF8-EGFP reporter mice described in this study and IRF8-deficient mice reported previously support this conclusion.

In addition to its function in regulating immune cell differen- Downloaded from tiation under the steady-state conditions, IRF8 also plays important roles in the effector stages of innate and adaptive immune responses against a variety of microbial pathogens (54–59). This is at least partially achieved by IRF8-mediated transcriptional control of cytokine expression, including IL-12p40 and type I IFNs (60).

Because both B and T cells significantly upregulate IRF8-EGFP http://www.jimmunol.org/ expression following in vitro stimulation with LPS, LPS plus FIGURE 8. Induction of IRF8-EGFP expression in B and T cells in vitro. IFN-g, anti-IgM (which stimulates B cells), or anti-CD3/CD28 (A) Splenic B cells from WT and IRF8-EGFP mice were purified and (which stimulates T cells) (Fig. 8), the IRF8-EGFP reporter mice stimulated with LPS (20 mg/ml), IFN-g (10 ng/ml), anti-m (10 mg/ml), or CpG (1 mg/ml) overnight. The cells were then analyzed by flow cytometry. could be valuable for studying the functions of IRF8 in the settings (B) Splenocytes were cultured in the presence of anti-CD3 and anti-CD28 of inflammatory responses such as the EAE (52). Furthermore, this Dyna beads overnight. The cells were then stained with APC-labeled anti- IRF8-EGFP reporter should be useful for studying IRF8 functions CD4 Ab and analyzed by flow cytometry. Cells are gated on 7AAD2CD4+ in other cell types such as microglia and smooth muscle where IRF8 cells. The data are representative of two experiments with similar results. has been recently found to be present and function (13, 14, 61–63). by guest on September 25, 2021

Acknowledgments tein. On the other hand, a longer half-life of IRF8-EGFP would We thank Mehrnoosh Abshari for assistance in cell sorting and Alfonso over-report true expression. There are several pieces of evidence Macias for mouse colony maintenance. that argue against a poor reporter efficiency of our model. First, the targeting strategy used to generate the IRF8-EGFP fusion protein reporter preserved all natural regulatory elements of the IRF8- Disclosures EGFP locus (Fig. 1). Second, we previously showed that the The authors have no financial conflicts of interest. Fr. A cells expressed at least 100 times more IRF8 transcripts than Fr. B cells measured by quantitative real-time PCR (qPCR) (16). References Consistent with this finding, the mean fluorescence intensity of 1. Akashi, K., D. Traver, T. Miyamoto, and I. L. Weissman. 2000. A clonogenic IRF8-EGFP of the bulk Fr. A population was 6 times higher than common myeloid progenitor that gives rise to all myeloid lineages. Nature 404: Fr. B cells (Supplemental Fig. 3B), a pattern well matched by 193–197. 2. Kondo, M., I. L. Weissman, and K. Akashi. 1997. Identification of clonogenic mRNA expression. Analysis of IRF8 protein expression by in- common lymphoid progenitors in mouse bone marrow. Cell 91: 661–672. tracellular staining with a polyclonal anti-IRF8 Ab in combination 3. King, K. Y., and M. A. Goodell. 2011. Inflammatory modulation of HSCs: viewing with cell surface markers revealed similar patterns of IRF8 protein the HSC as a foundation for the immune response. Nat. Rev. Immunol. 11: 685–692. 4. Mossadegh-Keller, N., S. Sarrazin, P. K. Kandalla, L. Espinosa, E. R. Stanley, expression (Supplemental Fig. 3C). It is worth noting that the S. L. Nutt, J. Moore, and M. H. Sieweke. 2013. M-CSF instructs myeloid lineage IRF8-EGFP reporter is superior to all other available methods by fate in single haematopoietic stem cells. Nature 497: 239–243. revealing, at the single-cell level, the heterogeneity of the Fr. A 5. Nagai, Y., K. P. Garrett, S. Ohta, U. Bahrun, T. Kouro, S. Akira, K. Takatsu, and P. W. Kincade. 2006. Toll-like receptors on hematopoietic progenitor cells population. Third, similar to Fr. A, the GMP population also is stimulate innate immune system replenishment. Immunity 24: 801–812. heterogeneous for IRF8-EGFP expression (Fig. 2). If IRF8-EGFPlo 6. Nagaoka, H., G. Gonzalez-Aseguinolaza, M. Tsuji, and M. C. Nussenzweig. 2000. Immunization and infection change the number of recombination acti- GMPs were underreported, prolonged culture would be expected to vating gene (RAG)-expressing B cells in the periphery by altering immature yield similar frequencies of progeny cells generated from IRF8- lymphocyte production. J. Exp. Med. 191: 2113–2120. EGFPlo and IRF8-EGFPint GMPs. To the contrary, these GMP 7. Naik, S. H., L. Perie´, E. Swart, C. Gerlach, N. van Rooij, R. J. de Boer, and T. N. Schumacher. 2013. Diverse and heritable lineage imprinting of early subsets exhibited distinct developmental potentials (Fig. 3). Fourth, haematopoietic progenitors. Nature 496: 229–232. IRF8 expression in rapidly cycling GCs is increased at both the 8. D’Amico, A., and L. Wu. 2003. The early progenitors of mouse dendritic cells RNA and protein levels (37, 48, 49). When GCs mature to PCs, and plasmacytoid predendritic cells are within the bone marrow hemopoietic precursors expressing Flt3. J. Exp. Med. 198: 293–303. IRF8 is rapidly downregulated (37, 50, 51). Consistent with this, 9. Manz, M. G., D. Traver, T. Miyamoto, I. L. Weissman, and K. Akashi. 2001. Dendritic the IRF8-EGFP reporter revealed the same patterns of expression cell potentials of early lymphoid and myeloid progenitors. Blood 97: 3333–3341. 10. Traver, D., K. Akashi, M. Manz, M. Merad, T. Miyamoto, E. G. Engleman, and in that GCs express higher levels and PCs express markedly lower I. L. Weissman. 2000. Development of CD8a-positive dendritic cells from levels of IRF8-EGFP than naive B cells (Supplemental Fig. 2). a common myeloid progenitor. Science 290: 2152–2154. 1776 HETEROGENEOUS EXPRESSION OF IRF8 IN LYMPHOMYELOID CELLS

11. Wu, L., A. D’Amico, H. Hochrein, M. O’Keeffe, K. Shortman, and K. Lucas. 36. Medina, K. L., S. N. Tangen, L. M. Seaburg, P. Thapa, K. A. Gwin, and 2001. Development of thymic and splenic dendritic cell populations from dif- V. S. Shapiro. 2013. Separation of plasmacytoid dendritic cells from B-cell- ferent hemopoietic precursors. Blood 98: 3376–3382. biased lymphoid progenitor (BLP) and Pre-pro B cells using PDCA-1. PLoS 12. Fogg, D. K., C. Sibon, C. Miled, S. Jung, P. Aucouturier, D. R. Littman, ONE 8: e78408. A. Cumano, and F. Geissmann. 2006. A clonogenic bone marrow progenitor 37. Lee, C. H., M. Melchers, H. Wang, T. A. Torrey, R. Slota, C. F. Qi, J. Y. Kim, specific for macrophages and dendritic cells. Science 311: 83–87. P. Lugar, H. J. Kong, L. Farrington, et al. 2006. Regulation of the germinal center 13. Horiuchi, M., K. Wakayama, A. Itoh, K. Kawai, D. Pleasure, K. Ozato, and gene program by interferon (IFN) regulatory factor 8/IFN consensus sequence- T. Itoh. 2012. Interferon regulatory factor 8/interferon consensus sequence binding protein. J. Exp. Med. 203: 63–72. binding protein is a critical transcription factor for the physiological phenotype 38. Naik, S. H., P. Sathe, H. Y. Park, D. Metcalf, A. I. Proietto, A. Dakic, S. Carotta, of microglia. J. Neuroinflammation 9: 227. M. O’Keeffe, M. Bahlo, A. Papenfuss, et al. 2007. Development of plasmacytoid 14. Masuda, T., M. Tsuda, R. Yoshinaga, H. Tozaki-Saitoh, K. Ozato, T. Tamura, and and conventional dendritic cell subtypes from single precursor cells derived K. Inoue. 2012. IRF8 is a critical transcription factor for transforming microglia in vitro and in vivo. Nat. Immunol. 8: 1217–1226. into a reactive phenotype. Cell Reports 1: 334–340. 39. Onai, N., A. Obata-Onai, M. A. Schmid, T. Ohteki, D. Jarrossay, and 15. Becker, A. M., D. G. Michael, A. T. Satpathy, R. Sciammas, H. Singh, and M. G. Manz. 2007. Identification of clonogenic common Flt3+M-CSFR+ plas- D. Bhattacharya. 2012. IRF-8 extinguishes neutrophil production and promotes macytoid and conventional dendritic cell progenitors in mouse bone marrow. dendritic cell lineage commitment in both myeloid and lymphoid mouse pro- Nat. Immunol. 8: 1207–1216. genitors. Blood 119: 2003–2012. 40. Nelson, N., Y. Kanno, C. Hong, C. Contursi, T. Fujita, B. J. Fowlkes, 16. Wang, H., C. H. Lee, C. Qi, P. Tailor, J. Feng, S. Abbasi, T. Atsumi, and E. O’Connell, J. Hu-Li, W. E. Paul, D. Jankovic, et al. 1996. Expression of IFN H. C. Morse, III. 2008. IRF8 regulates B-cell lineage specification, commitment, regulatory factor family proteins in lymphocytes: induction of Stat-1 and IFN and differentiation. Blood 112: 4028–4038. consensus sequence binding protein expression by T cell activation. J. Immunol. 17. Holtschke, T., J. Lo¨hler, Y. Kanno, T. Fehr, N. Giese, F. Rosenbauer, J. Lou, 156: 3711–3720. K. P. Knobeloch, L. Gabriele, J. F. Waring, et al. 1996. Immunodeficiency and 41. Tamura, T., P. Tailor, K. Yamaoka, H. J. Kong, H. Tsujimura, J. J. O’Shea, chronic myelogenous leukemia-like syndrome in mice with a targeted mutation H. Singh, and K. Ozato. 2005. IFN regulatory factor-4 and -8 govern dendritic of the ICSBP gene. Cell 87: 307–317. cellsubsetdevelopmentandtheirfunctionaldiversity.J. Immunol. 174: 2573– 18. Aliberti, J., O. Schulz, D. J. Pennington, H. Tsujimura, C. Reis e Sousa, 2581. K. Ozato, and A. Sher. 2003. Essential role for ICSBP in the in vivo development 42. Robb, L. 2007. Cytokine receptors and hematopoietic differentiation. Oncogene Downloaded from of murine CD8a+ dendritic cells. Blood 101: 305–310. 26: 6715–6723. 19. Ginhoux, F., K. Liu, J. Helft, M. Bogunovic, M. Greter, D. Hashimoto, J. Price, 43. Rieger, M. A., P. S. Hoppe, B. M. Smejkal, A. C. Eitelhuber, and T. Schroeder. N. Yin, J. Bromberg, S. A. Lira, et al. 2009. The origin and development of 2009. Hematopoietic cytokines can instruct lineage choice. Science 325: nonlymphoid tissue CD103+ DCs. J. Exp. Med. 206: 3115–3130. 217–218. 20. Scheller, M., J. Foerster, C. M. Heyworth, J. F. Waring, J. Lo¨hler, G. L. Gilmore, 44. Miller, J. P., D. Izon, W. DeMuth, R. Gerstein, A. Bhandoola, and D. Allman. R. K. Shadduck, T. M. Dexter, and I. Horak. 1999. Altered development and 2002. The earliest step in B lineage differentiation from common lymphoid cytokine responses of myeloid progenitors in the absence of transcription factor, progenitors is critically dependent upon interleukin 7. J. Exp. Med. 196: 705–

interferon consensus sequence binding protein. Blood 94: 3764–3771. 711. http://www.jimmunol.org/ 21. Schiavoni, G., F. Mattei, P. Sestili, P. Borghi, M. Venditti, H. C. Morse, III, 45. Bar-On, L., T. Birnberg, K. L. Lewis, B. T. Edelson, D. Bruder, K. Hildner, F. Belardelli, and L. Gabriele. 2002. ICSBP is essential for the development of J. Buer, K. M. Murphy, B. Reizis, and S. Jung. 2010. CX3CR1+CD8a+ dendritic mouse type I interferon-producing cells and for the generation and activation of cells are a steady-state population related to plasmacytoid dendritic cells. Proc. CD8a+ dendritic cells. J. Exp. Med. 196: 1415–1425. Natl. Acad. Sci. USA 107: 14745–14750. 22. Tsujimura, H., T. Tamura, and K. Ozato. 2003. Cutting edge: IFN consensus 46. Shigematsu, H., B. Reizis, H. Iwasaki, S. Mizuno, D. Hu, D. Traver, P. Leder, sequence binding protein/IFN regulatory factor 8 drives the development of N. Sakaguchi, and K. Akashi. 2004. Plasmacytoid dendritic cells activate type I IFN-producing plasmacytoid dendritic cells. J. Immunol. 170: 1131– lymphoid-specific genetic programs irrespective of their cellular origin. Immu- 1135. nity 21: 43–53. 23. Yamamoto, M., T. Kato, C. Hotta, A. Nishiyama, D. Kurotaki, M. Yoshinari, 47. Schonheit, J., C. Kuhl, M. L. Gebhardt, F. F. Klett, P. Riemke, M. Scheller, M. Takami, M. Ichino, M. Nakazawa, T. Matsuyama, et al. 2011. Shared and G. Huang, R. Naumann, A. Leutz, C. Stocking, et al. 2013. PU.1 level-directed distinct functions of the transcription factors IRF4 and IRF8 in myeloid cell chromatin structure remodeling at the Irf8 gene drives dendritic cell commit- development. PLoS ONE 6: e25812. ment. Cell Rep. 3: 1617‑1628. by guest on September 25, 2021 24. Hambleton, S., S. Salem, J. Bustamante, V. Bigley, S. Boisson-Dupuis, 48. Cattoretti, G., R. Shaknovich, P. M. Smith, H. M. Ja¨ck, V. V. Murty, and J. Azevedo, A. Fortin, M. Haniffa, L. Ceron-Gutierrez, C. M. Bacon, et al. 2011. B. Alobeid. 2006. Stages of germinal center transit are defined by B cell tran- IRF8 mutations and human dendritic-cell immunodeficiency. N. Engl. J. Med. scription factor coexpression and relative abundance. J. Immunol. 177: 365: 127–138. 6930–6939. 25. Wang, H., J. Ye, L. W. Arnold, S. K. McCray, and S. H. Clarke. 2001. A VH12 49. Shin, D. M., C. H. Lee, and H. C. Morse, III. 2011. IRF8 governs expression of transgenic mouse exhibits defects in pre-B cell development and is unable to genes involved in innate and adaptive immunity in human and mouse germinal make IgM+ B cells. J. Immunol. 167: 1254–1262. center B cells. PLoS ONE 6: e27384. 26. Metcalf, D., L. Di Rago, and S. Mifsud. 2002. Synergistic and inhibitory 50. Martinez, A., S. Pittaluga, M. Rudelius, T. Davies-Hill, D. Sebasigari, interactions in the in vitro control of murine megakaryocyte colony formation. T. J. Fountaine, S. Hewitt, E. S. Jaffe, and M. Raffeld. 2008. Expression of the Stem Cells 20: 552–560. interferon regulatory factor 8/ICSBP-1 in human reactive lymphoid tissues and 27. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression B-cell lymphomas: a novel germinal center marker. Am. J. Surg. Pathol. 32: data using real-time quantitative PCR and the 2(2DDC(T)) Method. Methods 25: 1190–1200. 402–408. 51. Zhou, J. X., C. H. Lee, C. F. Qi, H. Wang, Z. Naghashfar, S. Abbasi, and 28. Laricchia-Robbio, L., T. Tamura, T. Karpova, B. L. Sprague, J. G. McNally, and H. C. Morse, III. 2009. IFN regulatory factor 8 regulates MDM2 in germinal K. Ozato. 2005. Partner-regulated interaction of IFN regulatory factor 8 with center B cells. J. Immunol. 183: 3188–3194. chromatin visualized in live macrophages. Proc. Natl. Acad. Sci. USA 102: 52. Yoshida, Y., R. Yoshimi, H. Yoshii, D. Kim, A. Dey, H. Xiong, J. Munasinghe, 14368–14373. I. Yazawa, M. J. O’Donovan, O. A. Maximova, et al. 2014. The transcription 29. Pronk, C. J., D. J. Rossi, R. Ma˚nsson, J. L. Attema, G. L. Norddahl, C. K. Chan, factor IRF8 activates integrin-mediated TGF-b signaling and promotes neuro- M. Sigvardsson, I. L. Weissman, and D. Bryder. 2007. Elucidation of the phe- inflammation. Immunity 40: 187–198. notypic, functional, and molecular topography of a myeloerythroid progenitor 53. Chopin, M., C. Seillet, S. Chevrier, L. Wu, H. Wang, H. C. Morse, III, G. T. Belz, cell hierarchy. Cell Stem Cell 1: 428–442. and S. L. Nutt. 2013. Langerhans cells are generated by two distinct PU.1- 30. Rumfelt, L. L., Y. Zhou, B. M. Rowley, S. A. Shinton, and R. R. Hardy. 2006. dependent transcriptional networks. J. Exp. Med. 210: 2967–2980. Lineage specification and plasticity in CD19- early B cell precursors. J. Exp. 54. Alter-Koltunoff, M., S. Goren, J. Nousbeck, C. G. Feng, A. Sher, K. Ozato, Med. 203: 675–687. A. Azriel, and B. Z. Levi. 2008. Innate immunity to intraphagosomal pathogens 31. Inlay, M. A., D. Bhattacharya, D. Sahoo, T. Serwold, J. Seita, H. Karsunky, is mediated by interferon regulatory factor 8 (IRF-8) that stimulates the ex- S. K. Plevritis, D. L. Dill, and I. L. Weissman. 2009. Ly6d marks the earliest pression of macrophage-specific Nramp1 through antagonizing repression by stage of B-cell specification and identifies the branchpoint between B-cell and T- c-Myc. J. Biol. Chem. 283: 2724–2733. cell development. Genes Dev. 23: 2376–2381. 55. Fehr, T., G. Schoedon, B. Odermatt, T. Holtschke, M. Schneemann, 32. Ng, A. P., M. Kauppi, D. Metcalf, L. Di Rago, C. D. Hyland, and M. F. Bachmann, T. W. Mak, I. Horak, and R. M. Zinkernagel. 1997. Crucial role W. S. Alexander. 2012. Characterization of thrombopoietin (TPO)-responsive of interferon consensus sequence binding protein, but neither of interferon reg- progenitor cells in adult mouse bone marrow with in vivo megakaryocyte and ulatory factor 1 nor of nitric oxide synthesis for protection against murine lis- erythroid potential. Proc. Natl. Acad. Sci. USA 109: 2364–2369. teriosis. J. Exp. Med. 185: 921–931. 33. Nutt, S. L., D. Metcalf, A. D’Amico, M. Polli, and L. Wu. 2005. Dynamic 56. Hein, J., V. A. Kempf, J. Diebold, N. Bucheler,€ S. Preger, I. Horak, A. Sing, regulation of PU.1 expression in multipotent hematopoietic progenitors. J. Exp. U. Kramer, and I. B. Autenrieth. 2000. Interferon consensus sequence binding Med. 201: 221–231. protein confers resistance against Yersinia enterocolitica. Infect. Immun. 68: 34. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, and K. Hayakawa. 1408–1417. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in 57. Ko, J., A. Gendron-Fitzpatrick, and G. A. Splitter. 2002. Susceptibility of IFN normal mouse bone marrow. J. Exp. Med. 173: 1213–1225. regulatory factor-1 and IFN consensus sequence binding protein-deficient mice 35. Tudor, K. S., K. J. Payne, Y. Yamashita, and P. W. Kincade. 2000. Functional to brucellosis. J. Immunol. 168: 2433–2440. assessment of precursors from murine bone marrow suggests a sequence of early 58. Scharton-Kersten, T., C. Contursi, A. Masumi, A. Sher, and K. Ozato. 1997. B lineage differentiation events. Immunity 12: 335–345. Interferon consensus sequence binding protein-deficient mice display impaired The Journal of Immunology 1777

resistance to intracellular infection due to a primary defect in interleukin 12 p40 from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways. Nat. induction. J. Exp. Med. 186: 1523–1534. Neurosci. 16: 273–280. 59. Turcotte, K., S. Gauthier, D. Malo, M. Tam, M. M. Stevenson, and P. Gros. 2007. 62. Minten, C., R. Terry, C. Deffrasnes, N. J. King, and I. L. Campbell. 2012. IFN Icsbp1/IRF-8 is required for innate and adaptive immune responses against in- regulatory factor 8 is a key constitutive determinant of the morphological and tracellular pathogens. J. Immunol. 179: 2467–2476. molecular properties of microglia in the CNS. PLoS ONE 7: e49851. 60. Tamura, T., and K. Ozato. 2002. ICSBP/IRF-8: its regulatory roles in the de- 63. Zhang, S. M., L. Gao, X. F. Zhang, R. Zhang, L. H. Zhu, P. X. Wang, S. Tian, velopment of myeloid cells. J. Interferon Cytokine Res. 22: 145‑152. D. Yang, K. Chen, L. Huang, et al. 2014. Interferon regulatory factor 8 modu- 61. Kierdorf, K., D. Erny, T. Goldmann, V. Sander, C. Schulz, E. G. Perdiguero, lates phenotypic switching of smooth muscle cells by regulating the activity of P. Wieghofer, A. Heinrich, P. Riemke, C. Ho¨lscher, et al. 2013. Microglia emerge myocardin. Mol. Cell. Biol. 34: 400–414. Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 The Journal of Immunology

Corrections

Wang, H., M. Yan, J. Sun, S. Jain, R. Yoshimi, S. M. Abolfath, K. Ozato, W. G. Coleman, Jr., A. P. Ng, D. Metcalf, L. DiRago, S. L. Nutt, and H. C. Morse, III. 2014. A reporter mouse reveals lineage-speciﬁc and heterogeneous expression of IRF8 during lymphoid and myeloid cell differentiation. J. Immunol. 193: 1766–1777.

The institutional afﬁliations of the second and eighth authors were published incorrectly. The corrected author line is shown below along with the corrected afﬁliations. Also, the funding footnote is incorrect. The corrected footnote is shown below.

Hongsheng Wang,* Ming Yan,†,‡ Jiafang Sun,* Shweta Jain,* Ryusuke Yoshimi,x Sanaz Momben Abolfath,* Keiko Ozato,{ William G. Coleman, Jr.,†,‡ Ashley P. Ng,‖,# Donald Metcalf,‖,# Ladina DiRago,‖ Stephen L. Nutt,‖,# and Herbert C. Morse, III*

*Virology and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, MD 20852; †Division of Intramural Research, National Institute on Minority Health and Health Disparities, National Institutes of Health, Bethesda, MD 20892; ‡Laboratory of Biochemistry and Genetics, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; xDepartment of Internal Medicine and Clinical Immunology, Yokohama City University Graduate School of Medicine, Yokohama 236-0004, Japan; {Program in Genomics of Differ- entiation, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892; ‖Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria 3052, Australia; and #Department of Medical Biology, University of Melbourne, Parkville, Victoria 3010, Australia

This work was supported by the Intramural Research Program of the National Institutes of Health’s National Institute of Allergy and Infectious Diseases (to H.W., J.S., S.J., S.M.A., and H.C.M.), the National Institute of Child Health and Human Development (to R.Y. and K.O.), the National Institute of Diabetes and Digestive and Kidney Diseases (to M.Y. and W.G.C.), and the National Institute on Minority Health and Health Disparities (to M.Y. and W.G.C.). A.P.N., L.D., and D.M. were supported by Program Grant 1016647 and Independent Research Institutes Infrastructure Support Scheme Grant 361646 from the Australian National Health and Medical Research Council. This work was also supported by the Carden fellowship (to D.M.) from the Cancer Council of Victoria, a Cure Cancer Australia/Leukaemia Foundation Australia postdoctoral fellowship, a Lions fellowship from the Cancer Council of Victoria (to A.P.N.), and the Victorian State Government Operational Infrastructure. S.L.N. was supported by an Australian Research Council Future fellowship. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1490036