Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly

by

Rizwana Kousar

Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad, Pakistan 2014

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly

A thesis submitted in the partial fulfillment of the requirements for the degree of Doctor of Philosophy

in

Biochemistry/ Molecular Biology

by

Rizwana Kousar

Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad, Pakistan 2014

DECLARATION I hereby declare that the work presented in this thesis is my own effort, except where otherwise acknowledged, and that the thesis is my own composition. No part of this thesis has been previously published or presented for any other degree or certificate.

Rizwana Kousar

Contents

CONTENTS ACKNOWLEDGEMENTS i LIST OF FIGURES ii LIST OF TABLES v LIST OF ABBREVIATIONS vi ABSTRACT ix Chapter 1 1. INTRODUCTION 1 1.1: Microcephaly 2 1.1.1: Etiology of Microcephaly 3 1.1.2: Diagnostic Criteria 3 1.2: MCPH Genetic Heterogeneity 4 1.2.1: Microcephalin/Mcph1/BRITI at MCPH1 5 1.2.2: WD repeat domain 62 (WDR62) at MCPH2 6 1.2.3: CDK5 regulatory subunit-associated protein 2 (CDK5RAP2) at MCPH3 7 1.2.4: 152 KDa Centrosomal protein (CEP152) at MCPH4 9 1.2.5: Abnormal spindle-like microcephaly-associated (ASPM) at MCPH5 9 1.2.6: Centromeric protein J (CENPJ) at MCPH6 11 1.2.7: SCL/TAL1 interrupting locus (STIL) at MCPH7 12 1.2.8: 135 KDa centrosomal protein (CEP135) at MCPH8 13 1.2.9: 63 KDa centrosomal protein (CEP63) at MCPH9 13 1.2.10: MCPH10 14 1.2.11: Cancer susceptibility candidate 5 (CASC5) at MCPH11 14 1.3: Neurogenic Etiology of MCPH 15 1.4: Approaches to MCPH Gene Identification 19 1.5: MCPH spectrum in Pakistan 20 1.6: Objective of the Study 25

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly

Contents

Chapter 2 2. MATERIALS AND METHODS 26 2.1: Families Studied 26 2.2: Blood sampling 26 2.3: Extraction of Human Genomic DNA from whole Blood 27 2.3.1: Phenol-chloroform method 27 2.3.2: Commercially designed kit method 28 2.4: Mapping of genes responsible for MCPH 28 2.4.1: Exclusion Mapping 28 2.4.1.1: Polymerase Chain Reaction (PCR) 29 2.4.1.2: Agarose Gel Electrophoresis 30 2.4.1.3: Polyacrylamide Gel Electrophoresis (PAGE) 30 2.4.2: SNP based Genotyping by Microarray 31 2.4.3: Statistical Packages for Linkage Analysis 31 2.4.4: Bioinformatics Tools 32 2.5: DNA sequencing of candidate genes 32 2.5.1: Primary PCR 32 2.5.2: Post primary PCR purification 33 2.5.3: Sequence PCR 33 2.5.4: Post sequence PCR purification 33 2.5.5: Mutation analysis 34 2.6: Amplified fragment length polymorphism (AFLP) analysis 34 Chapter 3 3. AUTOSOMAL RECESSIVE PRIMARY MICROCEPHALY 12 46 3.1: Clinical Description of Family A 46 3.2: Genotyping and linkage analysis 47 3.3: Screening of candidate genes 49 3.4: Discussion 50

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly

Contents

Chapter 4 4. AUTOSOMAL RECESSIVE PRIMARY MICROCEPHALY 2 58 4.1: Clinical description 58 4.1.1: Family B 59 4.1.2: Family C 59 4.1.3: Family D 59 4.1.4: Family E 60 4.2: Linkage Analysis of MCPH families 60 4.3: Sequencing of WDR62 gene 62 4.4: Discussion 63 Chapter 5 5. 5. AUTOSOMAL RECESSIVE PRIMARY MICROCEPHALY 5 81 5.1: Clinical description 81 5.1.1: Family F 82 5.1.2: Family G 82 5.1.3: Family H 82 5.1.4: Family I 83 5.1.5: Family J 83 5.1.6: Family K 84 5.2: Linkage analysis 84 5.3: Sequencing ASPM gene 85 5.4: Amplified fragment length polymorphism (AFLP) analysis 87 5.5: Discussion 87 6. CONCLUSION 112 7. REFERENCES 114

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly

ACKNOWLEDGEMENTS

ACKNOWLEDGEMENTS

Thanks to Almighty ALLAH, The most Gracious and most Merciful who blessed me more than I wished. I offer my praises to Hazrat MUHAMMAD (PBUH) who taught us to probe into the secrets of nature.

I would like to express my special appreciation and thanks to my supervisor Dr. Muhammad Ansar, for his dynamic supervision, keen interest, valuable suggestions, insightful discussions and encouragement throughout my research work.

I owe my deep gratitude to Prof. Dr. Wasim Ahmed. He is an icon whose research expertise, excellent teaching skills and professional devotion has enabled me to develop craze for the subject. I obliged to Chairperson Department of Biochemistry, Prof. Dr. Bushra Mirza, for providing research facilities and student friendly environment in the department.

I submit special thanks to the authorities of Higher Education Commision (HEC) for providing me research grant under indigenous scholarship scheme and International Research Support Initiative Program (IRSIP) to support this project. Most importantly, I thank all the affected patients and their families that took part in this project and made this research possible.

I would like to appreciate Dr. Jawad Hassan, Dr. Muhammad Salman Chishti, Dr. Musharraf Jelani, and Dr. Sulman Basit for being a valuable source of discussion and ideas as well.

I wish to thank every lab fellow especially Dr. Umm-e-Kalsoom, Dr. Gul Naz, Dr. Bushra Khan, Dr. Mariam Khurshid, Dr. James J Cox, Hina Mir, Dr. Muzammil Ahmed Khan, Dr. Rabia Habib and Dr. Saad Ullah Khan Wazir for their kind help, moral support and continuous motivation during my research work.

Words cannot express my feelings for the love, practical support and sacrifices of my parents, Father-in-law (Late), brothers, cousins, husband, and my cute Hania and Shaheer throughout the long journey to achieve this goal.

I would also like to thank all of my colleagues at the Department of Biology, AIOU for their cooperation and encouragement to peruse Ph. D studies.

Last but definitely not the least, I offer my regards and blessings to all of those who supported me in any respect during the completion of this project.

Rizwana

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly I

List of Figures

LIST OF FIGURES Figure Title Page No. No. 1.1 A proposed model representing how mutant MCPH proteins could 18 affect neurogenesis. 3.1 (a) Pedigree of family A showing segregation of MCPH. 52 (b) Pictures of affected individuals. 52 (c) Image of Computed Tomography (CT) scan. 52 3.2 Image of SNP data analyzed by homozygosity mapper 53 3.3 Image of dChip data analysis in family A. 54 3.4 Haplotype of family A shows HBD region flanked by markers 55 D16S3082 (3.05Mb) and D16S675 (7.9Mb) on chromosome 16p13.3-13.2. 3.5 Diagram of chromosome 16 depicts the 4.85 Mb homozygous region 57 on 16p13.2-p13.3 locus identified in family A. 4.1 (a): Pedigree of family B showing segregation of MCPH. 66 (b): Pictures of affected individuals. 66 4.2 (a): Pedigree of family C showing segregation of MCPH. 68 (b): Computerized tomographic (CT) scan. 68 4.3 Pedigrees of families (a) D, (b) E showing segregation of MCPH. 69

4.4 Haplotype of family B shows homozygosity with WDR62 flanking 70 markers on chromosome 19. 4.5 Haplotype of family C depicts homozygosity with WDR62 flanking 72 markers on chromosome 19. 4.6 Haplotype of family D demonstrate homozygosity with WDR62 73 flanking markers on chromosome 19. 4.7 Haplotype of family E shows homozygosity with WDR62 flanking 74 markers on chromosome 19. 4.8 Mutation analysis of the WDR62 gene in family B. 75 4.9 Graphical representation ofWDR62 gene and protein. 77

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly ii

List of Figures

4.10 Mutation analysis of the WDR62 gene in family C. 78 4.11 Mutation analysis of the WDR62 gene in family D. 79 4.12 Mutation analysis of the WDR62 gene in family E. 80 5.1 Pedigrees of families (a) F, (b) G showing autosomal recessive 90 MCPH. 5.2 (a) Pedigree of family H showing autosomal recessive MCPH. 92 (b) Picture of affected individual (V-8) showing reduced head 92

circumference. 5.3 a) Pedigree of family I showing autosomal recessive MCPH. 93 (b) Pictures of Affected individuals (III-3) and (IV-1) presenting 93 characteristic sloping forehead. 5.4 Pedigrees of families (a) J and (b) K showing autosomal recessive 94 MCPH. 5.5 Haplotype of the family F shows homozygosity with ASPM flanking 95 markers on chromosome 1. 5.6 Haplotype of family G shows homozygosity with ASPM flanking 96 markers on chromosome 1. 5.7 Haplotype of the family H shows homozygosity with ASPM flanking 97 markers on chromosome 1. 5.8 Haplotype analysis of the family I shows homozygosity with ASPM 98 flanking markers on chromosome 1. 5.9 Haplotype of the family J shows homozygosity with ASPM flanking 99 markers on chromosome 1. 5.10 Haplotype of the family K shows homozygosity with ASPM flanking 100 markers on chromosome 1. 5.11 (a) ASPM gene; The structure of the ASPM gene 101 (b) ASPM protein 101 5.12 Mutation analysis of the ASPM gene in Family F. 102 5.13 Mutation analysis of the ASPM gene in Family G. 103 5.14 Mutation analysis of the ASPM gene in Family H. 104 5.15 Mutation analysis of the ASPM gene in Family I. 105

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly iii

List of Figures

5.16 Mutation analysis of the ASPM gene in Family J. 106 5.17 Mutation analysis of the ASPM gene in Family K. 107

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly iv

List of Tables

LIST OF TABLES Table Title Page No. No. 1.1 A brief description of known MCPH loci/ genes to date. 23 1.2 Details of families found unlinked or linked to various MCPH loci/ genes 24 across the world. 2.1 List of microsatellite markers used to test linkage to known MCPH genes/ 35 loci involved in Autosomal recessive primary microcephaly. 2.2 List of microsatellite markers used in Family A. 37 2.3 Sequences of the primers selected for amplification and sequencing of ASPM 38 gene. 2.4 Sequences of the primers used for amplification and sequencing of WDR62 41 gene. 2.5 Sequences of the primers used for amplification of WDR58 gene. 43 2.6 Sequences of the primers used for amplification and sequencing of RBFOX1 43 gene. 2.7 Sequences of the primers used for amplification and sequencing of NDE-1 45 gene. 3.1 Description of SNP data analysed by homozygosity mapper in family A. 53 3.2 Two point and multipoint LOD score values for locus at 16p13.3-13.2 in 56 family A. 4.1 Biometric data of affected individuals of families linked to WDR62 gene. 67 4.2 Two point and multipoint LOD score values between MCPH2 locus and 71 chromosome 19 markers in families B, C, D, E. 4.3 List of mutations reported in WDR62 gene so far. 76 5.1 Clinical and biometric data of Families F-K linked at ASPM gene. 91 5.2 List of Pakistani families segregating nonsense mutation (c.3978G>A/ p. 108 Try1326X) in exon 17 of ASPM gene. 5.3 List of Homozygous mutations in ASPM gene reported so far. 109 5.4 List of compound heterozygous mutations in ASPM gene reported so far. 111 5.5 Genotypes of ASPM flanking markers based upon AFLP analysis. 111

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly v

List of Abbreviations

LIST OF ABBREVIATIONS A2BP1 Ataxin 2-binding protein 1 AFLP Amplified fragment length polymorphism ASNP ASPM N-proximal asp Drosophila gene abnormal spindle ASPM Abnormal spindle-like microcephaly-associated bp Base pair BRCT BRCA1 C-terminal BRITI BRCT-Repeat Inhibitor of hTERT CASC5 Cancer susceptibility candidate 5 CC5 Coiled-coil segment 5 CDK5 Cyclin dependent kinase 5 CDK5R1 Cyclin-dependent kinase 5 regulatory protein 1 CDK5RAP2 CDK5 regulatory subunit-associated protein 2 CENPJ Centromeric protein J CEP63 63 KDa centrosomal protein CEP135 135 KDa centrosomal protein CEP152 152 KDa Centrosomal protein CEP215 215 KDa Centrosomal protein CHK Check point kinase CHO Chinese hamster ovary cM Centimorgan CNS Central nervous system CP Cortical plate CP110 110 KDa centriolar coiled coil protein CPAP Centrosomal P4.1-associated protein CT Scan Computed tomography scan dNTPs Deoxy nucleotide triphosphate E Embryonic day EDTA Ethylene-diamine-tetra-acetic acid

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly vi

List of Abbreviations

G2 phase Gap 2 phase GFP Green florescent protein GH Glycine-histidine HBD Homozygosity by descent HC Head circumference HDF Hi-di formamide hTERT Human telomerase reverse transcriptase IBS Identical by state INCENP Inner centromere protein IQ Isoleucine glutamine IQ Intelligence quotient IZ Intermediate zone KDa Kilo-dalton KMN KNL1/ Mis12 complex/ Ndc80 complex KPK Khyber pakhtunkhwa LAP LAG-3-associated protein LIP1 LYST-interacting protein 1 LOD Logarithm of Odds M phase Mitotic phase Mb Mega base MBD Microtubule binding domain MCD Malformations of cortical development MCPH Autosomal recessive primary microcephaly MDD Microtubule-destabilizing domain MEFs Murine embryonic fibroblasts MR Mental retardation MRI Magnetic resonance imaging MT Microtubule NBS Nijmegen breakage syndrome NDE1 Nuclear distribution protein nude homolog 1

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly vii

List of Abbreviations

NE Neuroepithelial NLS Nuclear localization signal OD Optical density OFC Occipito-frontal head circumference PAGE Polyacrylamide gel electrophoresis PCC Premature chromosome condensation PCM Pericentriolar material PCR Polymerase chain reaction PIN1 Peptidyl-prolylisomerase Plk4 Polo-like kinase 4 rpm Revolution per minute SDs Standard deviations SDS Sodium dodecyle sulphate siRNA Small interference RNA SMC Structural maintenance of chromosomes SNP Single nucleotide polymorphism STIL SCL/TAL1 interrupting locus STRs Short tandem repeats SVZ Subventricular zone Taq Thermus aquaticus TCP10 T-complex 10 TE Tris- EDTA TEMED N, N, N’, N’-Tetra methylethylenediamine Tm Melting temperature VZ Ventricular zone WD Tryptophan-aspartic acid WDR58 WD repeat domain 58 WDR62 WD repeat domain 62 γTuRC Gamma tubulin ring complex

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly viii

Abstract

Abstract

Autosomal recessive primary microcephaly (MCPH; microcephaly primary hereditary) is a congenital condition caused by impairment of growth and development of foetal brain. The only associated characteristic phenotype is non-progressive intellectual disability of varying degree. Therefore, MCPH is a principal disorder to hunt for genes having critical role in prenatal brain growth. MCPH is genetically heterogeneous with 11 loci and 10 genes been mapped to date.

In the present study 11 families segregating MCPH were ascertained for genetic and molecular characterization. Prior to which clinical parameters including measurement of occipital head circumference, pedigree analysis, estimation of intelligence quotient (IQ with amended Wechsler scale), computed tomography (CT) scan, and biometric data collection, were investigated. These assessments clearly specify that under study families segregate nonsyndromic primary microcephaly with autosomal recessive mode of inheritance. After then linkage analysis based on homozygosity mapping was performed.

Whole genome SNP genotyping with 250K Nsp 1 array was carried out after exclusion mapping in selected individuals of family A. Data analysis using homozygosity mapper identified three homozygous linkage regions on chromosome 1, 10 and 16 while and analysis with dChip rule out the loci on chromosome 1 and 10. Furthermore microsatellite based genotyping of all available family members was also carried out for three putative loci. Parametric linkage analysis yielded a maximum multipoint LOD score of 3.2 at markers D16S3042 and D16S3128. This has led to the mapping of a novel locus at chromosme16p13.3-13.2 spanning 4.85 Mb region. The identified HBD interval was flanked by rs7192880 and rs11648289 and harbors 46 protein coding genes. However sequencing of Rbfox1 and WDR58 lying within the linkage interval did not identify any pathogenic sequence variant.

Microsatellite based genotyping revealed linkage of four families (B-E) to MCPH2 on chromosome 19q13.1–13.2. Multipoint linkage analysis carried out by pooling the genotype data of these families yielded a maximum LOD score of 9.5 at markers D19S554 and D19S223 tightly linked to WDR62 gene. Subsequently Sequence analysis

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly ix

Abstract of 32 coding exons and splice junction sites of WDR62 gene led to the identification of two novel (c.3232G>A/ p.Ala1078Thr; c.1942 C>T/ p.Q648X) and two known (c.1313G>A/ p.Arg438His; c.3936_3937insC/ p.Val1314ArgfsX18) sequence variants segregating with disease phenotype.

Molecular genetic analysis of six MCPH families (F-K) mapped linkage at MCPH5 locus/ASPM on chromosome 1q31. ASPM is the most prevalent gene, responsible for >50 MCPH cases worldwide. Sequence analysis of 28 coding exons and splice junction sites of ASPM gene found two novel (c. 6686-6689delGAAA/ p.R2229TfsX9; c. 77delG/ p. G26AfsX41) and three recurrent (c.9159delA/ p. K3054fsX5; c.1260- 1266delTCAAGTC/ p.Ser420fsX31, c. 3978G>A/ W1326X) mutations. AFLP analysis in two families bearing (c. 3978G>A/ W1326X) mutation revealed common disease associated haplotype suggested founder mutation in Pakistani population.

The present work also supports the high prevalance of MCPH in Pakistani families. It also supports the genetic heterogeneity of MCPH in Pakistani population. The identified mutations extend the body of evidence implicating the role of two genetic players (ASPM and WDR62) in disease associated patho-mechanisms.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly x

Abstract

The research work presented in the dissertation contributed in publishing following articles.

 Kousar R, Saqib MA, Ali G, Ahmad W, Ansar M. Novel autosomal recessive primary microcephaly locus maps to 16p13.2-p13.3. (Manuscript is under prepration)

 Kousar R, Hassan MJ, Khan B, Basit S, Mahmood S, Mir A, Ahmad W, Ansar M. Mutations in WDR62 gene in Pakistani families with autosomal recessive primary microcephaly. BMC Neurol. 2011 Oct 1;11:119.

 Nicholas AK, Khurshid M, Désir J, Carvalho OP, Cox JJ, Thornton G, Kausar R, Ansar M, Ahmad W, Verloes A, Passemard S, Misson JP, Lindsay S, Gergely F,Dobyns WB, Roberts E, Abramowicz M, Woods CG (2010). WDR62 is associated with the spindle pole and is mutated in human microcephaly. Nat Genet 42: 1010-4.

 Kousar R, Nawaz H, Khurshid M, Ali G, Khan SU, Mir H, Ayub M, Wali A, Ali N, Jelani M, Basit S, Ahmad W, Ansar M (2010). Mutation analysis of the ASPM gene in 18 Pakistani families with autosomal recessive primary microcephaly. J Child Neurol. 25(6): 715-20.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly xi

Chapter1 Introduction

INTRODUCTION

Central nervous system (CNS) (containing brain and the spinal cord) is the key organizer that gathers and integrates information and control activities of the human body. The human brain (~2% of body mass) is distinctively larger than that of any other primate, primarily due to great expansion of the cerebral cortex (Rakic, 1995). Cerebral cortex is a six layered structure that develops in an “inside-out” fashion i-e deeper layers (V/VI) are formed by earlier generated neurons while superficial layers (II/III) are occupied by later- generated neurons that migrate past the earlier ones. Thus cerebral cortex formation involves a complicated and closely regulated sequence of neuronal precursor proliferation, neuroblast migration and finally neuronal differentiation (Noctor et al., 2004).

Mammalian neocortex is a pseudostratified epithelium composed of morphologically distinct layers, including the ventricular zone (VZ), subventricular zone (SVZ), intermediate zone (IZ), and cortical plate (CP) (Buchman et al., 2010). Neurons are derived from progenitor cells residing in the ventricular zone (VZ), the region surrounding the lateral ventricles of the developing brain (Brand and Rakic, 1979). Progenitor cells including neuroepithelial cells, radial-glial cells and basal progenitors undergo four types of divisions involving symmetric proliferative division enhancing the progenitor pool, asymmetric mono-differentiative or self-renewing division, asymmetric bi-differentiative generating progeny of two different types and symmetric terminal division generating two neurons resulting in the depletion of proliferative cells (Huttner and Kosodo, 2005).

Disruptions at any phase affecting cell proliferation, neuronal migration or neuronal architecture result in malformations of cortical development (MCD). The ratio of cell proliferation vs cell differentiation determines the ultimate number of neurons or glia in the developed brain and perturbations of processes involved in the maintenance of this delicate balance may result in small brain (Farkas and Huttner, 2008).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 1

Chapter1 Introduction

1.1- Microcephaly

“Microcephaly” is a medical term that denotes a head circumference smaller than normal. Microcephaly is clinically defined by reduced occipital frontal head circumference i.e. 2 or 3 standard deviations (SDs) below the population age and sex adjusted mean. Broadly speaking microcephaly is of following two types.

 Primary Microcephaly  Secondary Microcephaly

Primary microcephaly, „true‟ or „pure‟ microcephaly and microcephaly „vera‟ are synonymous terms denoting smaller than normal head circumference present at birth. It is usually manifested by 32nd week of gestation and is non-progressive after birth. As opposed to primary microcephaly, secondary microcephaly is postnatal in which child‟s head circumference remains normal at birth and for an undefined period thereafter and then does not grow as fast as normal (Baxter et al., 2009). Thus secondary microcephaly is a progressive neurodegenerative condition while primary is usually a static developmental anomaly (Dobyns et al., 2002).

Depending upon associating phenotypes, microcephaly can be categorized into

 Nonsyndromic or isolated microcephaly  Syndromic microcephaly

When the affected individual exhibits only the typical phenotype such as sloping forehead with associated mental retardation and with no other obvious anomalies, it is termed as nonsyndromic isolated microcephaly. While in syndromic microcephaly the distinctive feature, reduced brain size, is associated with a large number of conditions and clinical manifestations other than microcephaly (Abuelo, 2007). The association of other anomalies may help in the prenatal diagnosis of syndromic microcephaly. Non syndromic microcephaly can be better diagnosed after the third trimester, since in many patients, the second-trimester head circumference (HC) measurements are usually normal (Bromley and Benacerraf, 1995).

Syndromic microcephaly can be due to environmental causes or single-gene mutation, contiguous gene deletions or duplications or gross chromosomal abnormalities (Baraitser,

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 2

Chapter1 Introduction

1990; Ross and Frias 1977; Abuelo, 2007). Syndromic microcephaly include Down's syndrome, DiGeorge syndrome, Seckel syndrome (MIM-210600), Filippi syndrome (MIM-272440), Nijmegen breakage syndrome (NBS), Jawad syndrome (Hassan et al., 2008), Smith-Lemli-Opitz syndrome (OMIM-270400), Williams syndrome (MIM- 194050) and Alpha-Thalassemia X-linked mental retardation syndrome (OMIM-301040) etc. Interestingly in some cases mutations of a gene can result in variable phenotypic presentation like Seckel and Jawad syndrome, patients harbor mutations in CtIP gene (Qvist et al., 2011).

Nonsyndromic microcephaly occurring as a discrete entity can be caused by genetic factors such as ring chromosome, mosaicism, an apparently balanced translocation and single gene mutations (Abuelo, 2007). Microcephaly following Mendelian mode of inheritance include autosomal dominant (MIM-156580), X-linked (MIM-309500) and autosomal recessive forms. Currently autosomal recessive primary microcephaly is designated as MCPH (MIM-251200) (Bond et al., 2003). MCPH is rare, with prevalence estimates between of 1:30,000 and 1:2,000,000 in European population, but much higher (One in 10,000) in some parts of Pakistan (Woods et al., 2005).

1.1.1- Etiology of Microcephaly

Microcephaly is etiologically multifactorial: environmental insults and genetic causes both are responsible for reduced brain size (Jackson et al., 1998). These may affect prenatally, perinatally, or postnatally to reduce brain growth. Common environmental factors include intrauterine infections (like rubella, cytomegalovirus, or toxoplasmosis), drugs/ alcohol taken during pregnancy, prenatal radiation exposure, maternal phenylketonuria, poorly controlled maternal diabetes, birth asphyxia and hypoxic- ischemic encephalopathy and vascular or viral induced disruption (Qazi and Reed, 1973; Ross and Frias, 1977; Corona et al, 2001).

1.1.2- Diagnostic Criteria

Microcephaly refers to occipito-frontal head circumference (OFC) below than expected for an individual‟s age and gender. The OFC is a most commonly used diagnostic tool for MCPH patients. OFC is the distance around the widest part of the head, measured by placing a measuring tape around the cranial vault passing over the forehead at front and

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 3

Chapter1 Introduction occipital area at the back of brain (Abuelo, 2007). However, earlier studies have used variable threshold to diagnose MCPH patients. Some authors use 2SDs below the mean (Opitzand Holt, 1990) where as others preferred 3SDs (Goodman and Gorlin, 1983). Interestingly variations of SD values from 2 to 3 change MCPH prevalence estimates in the general population. If -2SD is used then approximately 2 % of general population would be considered microcephalic by measurement, in contrast to 0.1 % when -3SD is used (Abuelo, 2007).

Head circumference is used as a surrogate measurement of intracranial volume and consequently estimate brain size (Wolf et al., 2004). However, modern neuro-imaging techniques such as ultrasound, X-ray, computed tomography scan (CT scan) and magnetic resonance imagings (MRI) are now routinely used to analyze brain structure. Preliminary diagnosis of microcephaly can be made by prenatal ultrasound that takes the image of fetal brain by using high-frequency sound waves.

1.2- MCPH Genetic Heterogeneity

Autosomal recessive primary microcephaly exhibits genetic heterogeneity with 11 loci (MCPH1-11) and ten genes identified to date (Table 1.1). These include, MCPH1 on chromosome 8p22-pter (Jackson et al., 1998) encoding Microcephalin (Jackson et al., 2002); MCPH2 on chromosome 19q13.12 (Roberts et al., 1999) encoding WDR62 (Nicholas et al., 2010); MCPH3 on chromosome 9q33.2 (Moynihan et al., 2000) encoding CDK5RAP2 (Bond et al., 2005); MCPH4 on chromosome 15q encoding CEP152 (Guernsey et al., 2010); MCPH5 on chromosome 1q25-q32 (Pattison et al., 2000) encoding ASPM (Bond et al.,2002); MCPH6 on chromosome 13q12.2 (Leal et al., 2003) encoding CENPJ (Bond et al., 2005); MCPH7 on chromosome 1p32.3–p33 encoding STIL (Kumar et al., 2009), MCPH8 on 4q12 encoding CEP135 (Hussain et al., 2012), MCPH9 on 3q22.2 encoding CEP63 (Sir et al., 2011), and a recently reported MCPH locus on 15q14-15.1 encodes CASC5 (Genin et al., 2012). However, the causative gene at locus 10q11.23-21.3 (Marchal et al., 2011) is yet to be identified. Six out of eleven loci (MCPH1, MCPH2, MCPH3, MCPH5, MCPH8, and MCPH9) were initially mapped in consanguineous families from Pakistan. In contrast, CEP152 was identified in a family from Canadian subpopulation, CENPJ in a Brazilian family, STIL in Indian

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 4

Chapter1 Introduction families, CASC5 in a family from Morocco and yet an orphan locus in a Turkish family. Several studies report large number of MCPH families that are found unlinked to any of the known MCPH gene/ loci, which clearly indicate involvement of more causative MCPH genes (Kumar et al., 2009; Darvish et al., 2010).

Detail of structural and functional aspect of MCPH genes known so far is as follows.

1.2.1- Microcephalin/ Mcph1/ BRITI at MCPH1

Jackson et al. (1998) mapped the first autosomal recessive primary microcephaly locus MCPH1, in two Pakistani families, spanning a 13-cM interval on chromosome 8p23. Later on the authors identified the underlying causative gene and named it as “Microcephalin” (Jackson et al., 2002), which is also known as BRITI (BRCT-Repeat Inhibitor of hTERT; the catalytic subunit of human telomerase) (Lin and Elledge, 2003). It has 14 exons and spans about 236 Kb region on chromosome 8p23. MCPH1 patient cells exhibit premature chromosome condensation (PCC) thus make MCPH1 locus allelic to human PCC syndrome (OMIM 606858) (Neitzel et al., 2002; Trimborn et al., 2004).

The full length MCPH1 protein encompasses 835 amino acids and presumably contains three BRCA1 C-terminal (BRCT) domains. These BRCT domains (85-95 amino acids) enable the microcephalin to have protein-protein and protein-DNA interactions and are found in several other proteins involved in DNA repair and cell cycle (Huyton et al., 2000; Jackson et al., 2002).

Jeffers et al. (2008) suggested that N-terminal BRCT domain (BRCT1) of Microcephalin is involved in its centrosomal localization and cell-cycle regulation, While tandem C- terminal domains (BRCT2, BRCT3) play role in DNA damage response by controlling cell cycle checkpoints. MCPH1 is recruited to double-strand DNA breaks and interacts with phosphorylated H2AX (a histone variant that marks sites of damaged DNA). Then damage signal is communicated to Check point kinase1 (CHK1) and Check point kinase 2 (CHK2) following recruitment of other mediator proteins. These kinases phosphorylate various substrates to modulate cell cycle, DNA repair and apoptosis (Wood et al., 2007).

Trimborn et al. (2006) suggested that Microcephalin acts as a negative regulator of condensin II and prevents premature chromosome condensation until the onset of

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 5

Chapter1 Introduction prophase and later allows in time post mitosis decondensation. The cell-free assay established by Yamashita et al. (2011) by utilizing Xenopus egg extract demonstrate inhibition of condensin II via N-terminal domain (amino acids 1–195) of hMCPH1. Furthermore two known MCPH1 mutations (p.T27R and p.W75R) also decrease hMCPH1 based condesnin II inhibition in the cell-free assay. So in this regard it can be anticipated that misregulation of condensin II may be relevant to the etiology of MCPH1 linked microcephaly.

Microcephalin shows high expression in developing forebrain and, in particular, to the walls of the lateral ventricles in fetal brain (Xu et al., 2004). Similar studies by Jackson et al. (2002) in mouse model represent highest expression in ganglionic eminence, lateral ventricles, liver and kidney and low expression level in other tissues.

Recently Gruber et al. (2011) has evaluated the role and expression pattern of MCPH1 during mouse brain development. The authors demonstrated that MCPH1 knockout leads to under development of brain in mice by affecting neuron production specifically in ventricular zone (VZ) (lying adjacent to the lateral ventricle)/ subventricular Zone (SVZ) (lying just superfacial to VZ) of the dorsal telencephalon where it shows high level of expression at embryonic day (E) 13.5. They attributed this phenotype to spindle misalignment leading to activation of neuroprogenitor cell apoptosis. This led to conclusion that MCPH1 deficiency mainly disturbs the balance between symmetric and asymmetric division of neuroprogenitors.

1.2.2- WD repeat domain 62 (WDR62) at MCPH2

Second locus for autosomal recessive primary microcephaly was mapped on chromosome 19q13.1-13.2 in two large consanguineous families ascertained from Yorkshire, United Kingdom and Punjab, Pakistan (Roberts et al., 1999). Whole exome sequencing of candidate linkage region led to the identification of WDR62 gene in multiple families (Bilguvar et al., 2010; Nicholas et al., 2010; Yu et al., 2010).

Full length WDR62 gene (32 exons) encodes 1,523 amino acids protein which contains multiple WD40 repeats (also known as WD or β-transducin repeats) and has single CpG island and polyadenylation signal. WD-repeats usually contain 40-60 amino acids and are initiated by glycine-histidine (GH) dipeptide 11 to 24 residues from N terminus and end

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 6

Chapter1 Introduction with a tryptophan-aspartic acid (WD) dipeptide at the C terminus (Li & Roberts, 2001). Proteins with WD repeats are predicted to form a circulated beta-propeller structure. These are found in all eukaryotes carrying out variety of functions ranging from signal transduction and transcription regulation to cell cycle control and apoptosis. Two recent studies identified WDR62 as a binding partner of the centrosomal protein CEP170 (Hutchins et al., 2010) and c-Jun N-terminal kinase (JNK) (Wasserman et al., 2010).

Expression analysis using immunohistochemistry and confocal microscopy reveals that WDR62 expresses predominately in human fetal neuroepithelium (Nicholas et al., 2010). In developing mouse brain, it shows striking expression in the ventricular and subventricular zones during the period of neurogenesis in cerebral cortex (Bilguvar et al., 2010).

Nicholas et al. (2010) reported that WDR62 encodes a spindle pole protein predominately expressed in neuronal precursor cells undergoing mitosis during embryonic brain development. The authors noticed the expression of mutated WDR62-GFP fusion protein in cytoplasm but not at spindle pole during mitosis, as compared to full length, wild type WDR62-GFP construct that showed diffuse interphase expression followed by spindle pole accumulation during mitosis. They suggested that WDR62 enables the spindle poles to position the cytokinetic furrow perpendicular to ventricular lumen for enhancing the pool of neural precursors.

Bilgüvar et al. (2010) and Yu et al. (2010) reported that mutations in WDR62 cause a spectrum of cortical anomalies including corpus callosal abnormalities, polymicrogyria, schizencephaly and sub cortical heterotopia (arrested neurons). These additional malformations of cortical development (MCDs) may result due to defects in proliferation, abnormal migration of neuronal cells and their final positioning within the different cortical layers (Wollnik B, 2010). Nicholas et al. (2010) suggested that more severe microcephaly phenotype involving cerebral cortex lamination defect is the result of complete loss of Wdr62 protein due to null mutation.

1.2.3- CDK5 regulatory subunit-associated protein 2 (CDK5RAP2) at MCPH3

Moynihan et al. (2000) identified third MCPH locus in a consanguineous family of northern Pakistani origin spanning 12 cM region on chromosome 9q34. Later Bond et al.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 7

Chapter1 Introduction

(2005) further refined the MCPH3 region to 2.2 Mb by analyzing an additional family and found homozygous mutations in CDK5RAP2 in both families. The human CDK5RAP2 gene has 34 exons and spans a genomic region of 190 kb (Bond et al., 2005). It encodes 215 KDa, 1893 amino acid CDK5RAP2 protein, and also designated as centrosome associated protein 215 (CEP215). It contains a predicted N-terminal gamma tubulin ring complex binding domain (γTuRC, 59-133 amino acid) (Fong et al., 2008), two structural maintenance of chromosomes (SMC) sites (137-499 amino acid and 1395- 1653 amino acid) (Hirano, 2005), a Ser-rich motif responsible for interaction with plus- end binding protein EB1 (926-1208 amino acid) (Fong et al., 2009), and pericentrin interaction site (within 1726-1893 amino acid) (Wang et al., 2010), a C-terminal Cnn Motif 2 domain for interactions with golgi complex and calmodulin (within 1861-1870 amino acid) (Wang et al., 2010) and a C-terminal cyclin-dependent kinase 5 regulatory protein 1 (CDK5R1) interaction site (Ching et al., 2000). The abundance of coiled-coil domains enable CDK5RAP2 to form a filamentous structure, a feature associated with pericentriolar matrix scaffold proteins (Fong et al., 2008).

CDK5RAP2 was at first identified in a rat brain yeast-2-hybrid hunt for rat cerebral cortex proteins interacting with CDK5R1 (Ching et al., 2000, 2002). CDK5R1 activates cyclin dependent kinase 5 (CDK5), which later play specific roles in neurogenesis, neural migration and neurodegeneration (Kesavapany et al., 2004).

CDK5RAP2 also interacts with the γ-tubulin ring complex (γTuRC) through its conserved region, which tethers γ-tubulin to centrosome (Fong et al., 2008). Lee and Rhee, (2010) reported that inhibition of Cdk5rap2 by siRNA in HeLa cells led to increase in cell proliferation, accompanied by abnormal spindle formation and less dynein at the centrosome. These findings indicate plausible role of CDK5RAP2 in centrosome maturation via dynein-dependent transport of the pericentriolar matrix proteins. Barrera et al. (2010) reported that loss of Cdk5rap2 function in murine embryonic fibroblasts (MEFs) results in disengaged centrioles with unpaired configuration leading to multipolar spindles. Lizarraga et al. (2010) reported a MCPH3 Cdk5rap2 an/an B6.Cg mouse model in which knock out cells showed altered cleavage plane orientation as compared to normal cells. The authors argued that this is likely associated with an increase of asymmetric cell proliferation that leads to a depletion of the progenitor pool and a reduction of brain size.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 8

Chapter1 Introduction

1.2.4- 152 KDa Centrosomal protein (CEP152) at MCPH4

Guernsey et al. (2010) identified CEP152 as a causative gene in the MCPH4 linkage interval mapped in three Canadian families. A high-density genome-wide SNP array was used to identify a 14 Mb region on chromosome 15q21.1 based on number of consecutive homozygous identical by state (IBS) shared SNPs. The full length CEP152 gene encompasses 27 exons and potentially produces three alternatively spliced isoforms. Human CEP152 encodes a 1,654 amino acid protein and presumably contains eight coil coiled regions (140-250, 273-336, 359-398, 470-494, 522-569, 607-675, 832-884, 1077- 1148) (Schultz et al., 2000).

CEP152 is crucial for centriole biogenesis (Blachon et al., 2008; Dzhindzhev et al., 2010) and centrosome functioning (Varmark et al., 2007). CEP152 mutations are also responsible for Seckel syndrome (Kalay et al., 2011), a condition characterized by short stature, severe mental retardation and bird like profile. Polo-like kinase 4 (Plk4) triggers centriole formation (Bettencourt-Dias et al., 2005; Habedanck et al., 2005) by initiating a cascade including hsSas6 (Leidel et al., 2005), centrosomal P4.1-associated protein (CPAP) (Kohlmaier et al., 2009; Tang et al., 2009), CEP135 (Ohta et al., 2002), γ- tubulin, and CP110 (Kleylein-Sohn et al., 2007). CEP152 binds to Plk4‟s via its N- terminus and in the absence of CEP152; Plk4 could no longer stimulate the formation of extra centrioles, suggesting that these proteins act together in centriole biogenesis (Short, 2010). Cizmecioglu et al. (2010) reported that down regulation of CEP152 by siRNA impairs the localization of plk4 and CPAP to the centriole, suggesting that localization of CEP152 at centrosome is crucial for centrosomal recruitment of plk4 and CPAP.

Recently, Sir et al. (2011) reported that CEP152 and CEP63 (MCPH9 protein) forms a distinct ring around parental centriole, which disappears in CEP63 deficient cells indicating that centrosomal accumulation of CEP152 is CEP63 dependent. It is suggested that both proteins act in a complex that is crucial for maintaining normal centrosome numbers.

1.2.5- Abnormal spindle-like microcephaly-associated (ASPM) at MCPH5

Pattison et al. (2000) reported the fifth locus, MCPH5 mapped to an 8-cM region on chromosome 1q31. Later the underlying gene was identified and termed as ASPM. The

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 9

Chapter1 Introduction human ASPM gene, the ortholog of the Drosophila gene abnormal spindle (asp) consists of 28 exons and approximately spans a 62 kb genomic region. Full length ASPM protein is predicted to contain an N-terminal microtubule-binding domain, two calponin homology domains (common in actin binding proteins), up to 81 calmodulin binding isoleucine glutamine (IQ) motifs (Kouprina et al., 2005), two highly conserved N- terminal short ASNP (ASPM N-proximal) repeats, an armadillo-like sequence and a C- terminal region (Saunders et al., 1997; Bond et al., 2002, 2003; Kouprina et al., 2005; Rhoads and Kenguele, 2005).

In Zebra fish, aspm gene expresses specifically in proliferating cells in the CNS during early development. Aspm knock down in Zebra fish embryos resulted in cell cycle arrest leading to apoptotic cell death (Kim et al., 2011).

Initially, Higgins et al. (2010) signify the role of human ASPM in the regulation of mitosis, due to its localization at spindle microtubules during anaphase. The siRNA based reduction of ASPM in the cultured U2OS osteosarcoma cells, shifts plane of division from symmetrical to asymmetrical. Additionally siRNA mediated ASPM depletion also induces cytokinesis failure and apoptosis. Pulvers et al. (2010) described that in aspm mutant mice, mild microcephaly was observed without obvious increase in apoptosis, supporting the notion that MCPH is caused by defects in embryonic neural progenitor proliferation.

Normally in developing mice neocortex, neurogenesis starts at around embryonic day, E10.5 and lasts until E19 while neurons generated from cortical progenitor cells at embryonic day E14.5 and E16.5 make up the more superficial layers (II to V) of the neocortex (Camarero et al., 2006; Buchman et al., 2010). Buchman et al. (2011) described the importance of ASPM in proper neurogenesis and neuronal migration while studying Wnt signling pathway in developing mouse brain. The authors pointed out that ASPM is a positive regulator of Wnt signaling, a pathway involved in embryogenesis. Furthermore they investigated the effect of ASPM knockdown on multiple stages of brain development and reported that depletion of neural progenitors, decreased mitotic activity, premature neuronal differentiation and defective neuronal migration especially at E16 are the outcome of knockdown.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 10

Chapter1 Introduction

The currently available data indicates that ASPM participate in spindle organization, spindle positioning and cytokinesis in all dividing cells and C-terminus of the protein is essential for these functions.

1.2.6- Centromeric protein J (CENPJ) at MCPH6

Centromere-associated protein J (CENPJ) is also referred as centrosomal protein 4.1- associated protein (CPAP) because of its centrosomal localization and interaction with the head domain 4.1 protein 135 splice variant (4.1R-135) (Hung et al., 2004) or LAG-3- associated protein (LAP) or LYST-interacting protein 1 (LIP1). CPAP contains five coiled coil segments and a glycine repeated segment termed as G-box. Fifth coiled-coil segment 5 (CC5) and the G-box are termed as C-terminal Tcp10 domain due to its similarity with t-complex responder gene. CPAP also possess microtubule-destabilizing domain, MDD (PN2-3, residues 311-422, including coiled-coil 2) and microtubule binding domain, MBD (A5N, residues 423-607, including coiled-coil 3), which indicate its association with γ tubulin ring complex (Hung et al., 2000, 2004; Hsu et al., 2008) Experimental data generated by Hsu et al. (2008) suggests that CPAP binds to tubulin heterodimer through MDD and inhibit microtubule (MT) polymerization within cells.

CPAP plays an important role in centrosome function, including centrosome duplication, centriole assembly, centriole cohesion and control of centriole length. The centrosome cohesion is a prerequisite of centriole duplication and keeps the distance between the two centrioles less than 2µm (Meraldi and Nigg, 2001; Faragher and Fry, 2003). Zhao et al. (2010) reported that both partial depletion of CPAP by siRNA and over expression of the C terminus of CPAP induce an increase in centrosome splitting, indicating that CPAP functions in centrosome cohesion. In another study CPAP depletion by siRNA alters centrosome integrity and induces multipolar spindles (Cho, 2006).

Recently, Kitagawa et al. (2011) identified that CENPJ is a centriole enriched protein that resides at or near centrioles in U2OS cells. They also highlighted the importance of two CPAP domains (PN2-3 and CC4) in the centriole formation; a prerequisite for spindle positioning in human cells. They also reported that known CPAP mutations reside in or lack TCP domain (Bond et al., 2005; Gul et al., 2006) resulting in the impaired/ aberrant spindle assembly.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 11

Chapter1 Introduction

1.2.7- SCL/TAL1 interrupting locus (STIL) at MCPH7

Kumar et al. (2009) mapped autosomal recessive primary microcephaly 7 locus to an 8.39 Mb region on chromosome 1p32.3-p33 between markers D1S2797 and D1S417. Later they identified three different homozygous mutations in STIL (MIM 181590) gene in five MCPH7 linked families. STIL gene (also known as SIL/ TAL1 interrupting locus) consists of 18 exons distributed over 70 kb.

STIL cDNA encodes a cytosolic 150-kDa serine, proline, and asparagine rich protein which lacks significant homology with the currently known functional protein families or motifs (Aplan et al., 1991). The encoded human protein lacks membrane spanning domain but contains a putative nuclear localization signal (NLS) along with a TGF-beta like C-terminal domain (Karkera et al., 2002).

Data from HeLa and HEK293T cells indicate that endogenous STIL is expressed at the poles of the mitotic spindle in the metaphase. STIL is phosphorylated during mitosis, a process essential for its interaction with PIN1 (peptidyl-prolylisomerase) which inturn regulates a subset of mitotic phosphor proteins (Campaner et al., 2005). STIL expression is regulated by transcription factor E2F, thus required for E2F induced transition through mitosis (Erez et al., 2008). Moreover, knock-down of STIL in cancer cells caused a mitotic arrest through a severely delayed entrance into mitosis (G2 to M phase transition), decreased activation of the CDK1 (CDC2) - cyclin B complex and induces apoptosis in a p53 independent manner (Erez et al., 2007).

Pfaff et al. (2007) reported that loss-of-function mutation in zebra fish SIL leads to increased rates of mitosis, disorganized mitotic spindles and often lack one or both centrosomes. It indicates that STIL is crucial for regulation of mitosis and normal centrosomal function.

STIL is orthologue of Drosophila Ana2 and C. elegans SAS-5 (Stevens et al., 2010), both are essential for centriole formation in these invertebrate systems (Delattre et al., 2004). Few recent studies indicate that STIL interacts directly with CPAP and indirectly with hSAS6 (a key centriolar protein) (Kitagawa et al., 2011; Tang et al., 2011; Vulprecht et al., 2012). These studies showed that STIL and hSAS6 are recruited first to the primitive

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 12

Chapter1 Introduction site at the base of nascent procentriole then CPAP joins the site having STIL/ hSAS6 to assemble microtubules (Tang et al., 2009).

1.2.8- 135 KDa Centrosomal protein (CEP135) at MCPH8

Autosomal recessive primary microcephaly 8 was mapped at 4p14-4q12 in a consanguineous northern Pakistani family with a disease interval delimited by rs12498424 (physical position 40,631,476bp) and rs13134527 (physical position 58,702,130bp) (Hussain et al., 2012). The authors identified a homozygous single base- pair (bp) deletion in CEP135 gene by direct sequencing of the candidate gene.

CEP135 contains 26 exons and encodes a 135-KDa centrosomal protein (CEP135) consisting of 1140 amino acids. It is a helical protein which is found at the centrosome throughout the cell cycle and plays role in centriole biogenesis (Kleylein-Sohn et al., 2007). Knockdown of CEP135 in Chinese hamster ovary (CHO) cells resulted in disorganized interphase and mitotic spindle microtubules showed bipolar and multipolar orientation (Ohta et al., 2002). Hussain et al. (2012) also demonstrated that primary CEP135 patient fibroblasts as well as cells transfected with a plasmid encoding the mutant protein exhibit multiple centrosomes and disorganized microtubule network.

1.2.9- 63 KDa Centrosomal protein (CEP63) at MCPH9

A single, concordant homozygous locus of 24 Mb was identified in a consanguineous Pakistani family by homozygosity mapping on chromosome 3 flanked by small tandem repeats (STRs) D3S3513 and D3S1569 (Sir et al., 2011). The identified genomic region harbors two strong candidate genes; CEP70 and CEP63 which encode centrosomal proteins, but DNA sequencing results in the identification of pathogenic mutations in the later gene. CEP63 contains 14 coding exons occupying 2,109 bp and encodes a protein product of 703 amino acids.

Löffler et al. (2011) described the role of CEP63 in mitotic entry by recruiting Cdk1 to centrosomes. Sir et al. (2011) reported that CEP63 functions in maintaining centrosome number. Authors further suggested that CEP63 is not a core centriole assembly factor as CEP63KO did not result in complete depletion of centrosomes. Its deficiency might delay the procentriole assemblage process which can effect centrosome duplication cycle. In

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 13

Chapter1 Introduction human cells CEP63 forms a discrete ring of approximately 280 nm around the proximal end of the parental centriole. CEP63 interacts via its C-terminal part forming a complex with CEP152 (MCPH4 protein). However co-localization of both proteins is interrupted in CEP63- deficient cells derived from MCPH patients indicating that presence of CEP63 is crucial for normal functioning of CEP152.

It has been found by studying developing mouse neocortex that centrosomes are asymmetrically distributed; progenitors retain the centrosome containing the old mother centriole while new mother centriole goes to newborn neurons. Delayed procentriole assembly by mutated CEP63 might impair centriole engagement affecting centrosome/ neuron numbers required for normal brain growth.

1.2.10- MCPH10

In a Turkish MCPH family autozygosity mapping identified a homozygous region of 15.8 Mb on chromosome 10q11.23-21.3 (Marchal et al., 2011), but causative sequence variant at this locus still awaits discovery. The authors studied chromosomal segregation during mitosis and found high rate of chromosome non disjunction in patient cells. They postulated that non disjunctions result due to abnormal anaphase distribution of regulators like Aurora B and inner centromere protein (INCENP).

1.2.11- Cancer susceptibility candidate 5 (CASC5) at MCPH11

Genin et al., (2012) identified a 3.7 Mb linkage interval at 15q14-15.1 in three Moroccan families segregating autosomal recessive primary microcephaly. These families share 2.7 Mb-long haplotype within the linkage region. In one of these families, MCPH4 locus was initially reported by Jamieson et al. (1999). The authors identified a rare mutation c.6125 G>A in CASC5 gene. Furthermore sequencing of all coding exons and splice junction sites of CEP152 gene, which is located 7 Mb outside the shared region, did not identify any mutation in the affected members of remaining three families.

The CASC5 gene is comprised of 27 exons and encodes a 265 KDa protein which localizes at the kinetochore. CASC5 belongs to KMN (KNL1/ Mis12 complex/ Ndc80 complex) network of proteins which facilitates the docking of chromosome kinetochores to the microtubule apparatus. Correct docking ensures adequate segregation of sister

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 14

Chapter1 Introduction chromatids at anaphase, and is vital for spindle checkpoint of the mitotic cycle (Kiyomitsu et al., 2007).

Fietz et al. (2012) analyzed transcriptome of human and mouse fetal neocortex and reported that CASC5 gene is up regulated in the human ventricular zone. VZ is a germinal region where neural progenitor cell division takes place during neocortex expansion therefore mutant CASC5 affects cell proliferation in the VZ.

1.3- Neurogenic Etiology of MCPH

MCPH is a primary disorder of neurogenesis as almost all MCPH genes are expressed in neuroepithelium. Mutated products of MCPH genes affect neurogenic mitosis as well as neuronal migration (Thornton and Woods, 2009; Wollnik, 2010), consequently result in reduced fetal brain growth. Central nervous system is mainly composed of neurons which arise by division of neuroepithelial cells that act as primary progenitors. During neurogenesis in humans, progenitor cells residing in VZ and SVZ first divide symmetrically to enhance the required pool of precursor cells. These precursor cells then undergo limited rounds of asymmetric cell division to produce neurons and regenerate progenitor cells (Huttner and Kosodo, 2005). The young neurons migrate through the IZ for reaching in the CP, where they fully differentiate.

During mammalian embryogenesis between 13th and 20th weeks of gestation, the number of neurons increase by about 5 billion cells (Samuelsen et al., 2003). It is generally postulated that during this period, roughly 500 to 1000 precursor cells divide every second to generate on average over 1000 neurons reaching cortical plate in a second (Buchman et al., 2010). Any disturbance that affects the balance between symmetric and asymmetric cell division of neural progenitors located in VZ and SVZ of the developing neocortex will ultimately lead to reduced neuron number. In addition to reduced neuro- progenitor division, increased apoptosis during neurogenesis can also decrease neuron number (O‟Driscoll et al., 2006).

Mutations in ten MCPH genes identified so far cause autosomal recessive primary microcephaly in humans. Almost all of these gene products are enriched at centrosomes, indicating that MCPH might have roots in centrosome defects. Centrosome consist of a pair of centriole surrounded by amorphous pericentriolar material (PCM) having proteins

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 15

Chapter1 Introduction like γ tubulin, γ TuRC and pericentrin. During peak phases of neurogenesis in mouse neocortex, it was observed that radial glial progenitors staying in the VZ inherit old mother centriole while differentiating neural cells that leaves the VZ receives new mother centriole. This asymmetric inheritance was suggested to be responsible for regulating the differential behaviors of renewing progenitors and their differentiating progeny in the developing mammalian neocortex (Wang et al, 2009).

Anyway, due to limited knowledge it is difficult to rationalize at the moment why brain size is reduced as a result of mutation in any of the known MCPH genes? However a common patho-mechanism switching on neurogenesis could be proposed by interlinking all known MCPH proteins (Figure 1.1).

Three MCPH genes ASPM (MCPH5), WDR62 (MCPH2) and STIL (MCPH7) encode spindle pole proteins. The assembly and orientation of mitotic spindle ensures appropriate chromosome segregation in addition to determination of cell fate (Siller and Doe, 2009). Position of central spindle marks the direction of cytokinetic cleavage furrow which ultimately determine the fate of the resulting cells (Götz and Huttner, 2005).

Different studies have indicated centrosome and spindle pole localization of ASPM in the murine embryonic neuroepithelial (NE) cells, primary stem cells and progenitor cells of mammalian brain (Zhong et al., 2005; Fish et al., 2006). It is believed that ASPM, WDR62 and STIL protein products participate in spindle organization and spindle positioning, and thus required to direct cytokinetic furrow. Interestingly, in neural progenitor cells switch from proliferative to neurogenic division results in the down- regulation of ASPM, which initially maintains symmetrical cell divisions (Higgens et al., 2010; Nicholas et al., 2010; Kitagawa et al., 2011).

Recent studies also demonstrate the role of MCPH1 in maintaining spindle orientation during neurogenesis. It achieves this in mouse neocortex by coupling centrosomal cycle with mitotic entry through the Chk1_Cdc25 pathway (Gruber et al., 2011). MCPH1 is also a DNA damage response protein controlling centrosome number (Brown et al., 2010) and its deficiency may lead to PCC in early G2 phase in addition to delayed post mitotic decondensation.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 16

Chapter1 Introduction

CASC5 gene mutated in MCPH11 is a member of kinetochore KMN network. It affects mitotic cycle by disturbing spindle checkpoint. Its knockdown in HeLa cells resulted in misalignment of chromosome thus result in premature entry into mitosis. Several other MCPH proteins (CEP63, CEP135, CEP152, CDK5RAP2 and CNPJ) are involved in centrosome function. Among these CEP63 and CEP152 forms a ring around parental centrioles (Sir et al., 2011). Cep152 further interacts with Plk4 which results in the induction of cascade involving CPAP (Tang et al., 2009) and CEP135 (Ohta et al., 2002). Both proteins are required at different stages of procentriole formation. At the same time, CPAP dimerization during interphase maintains centrosome cohesion which prevents untimely splitting (Zhao et al., 2010). CPAP also interacts with STIL that is also a key centriole duplication factor, controlling centriole number in human cells. Its over expression leads to centriole amplification by forming multiple centrioles surrounding pre-existing mother centriole. Conversely, siRNA-mediated depletion of STIL hinders centriole duplication (Arquint et al., 2012).

CDK5RAP2 functions in maintaining centriole engagement and cohesion to regulate centriole duplication in mice (Barrera et al., 2010; Barr et al., 2010). CDK5RAP2 associates via its carboxy terminal region with pericentrin, a pericentriolar material protein implicated in MOPDII that recruits CDK5RAP2 to the centrosome. Knockdown of Cdk5rap2 had significant effect upon makeup of the progenitor pool during neurogenesis. It results in proportionate decrease in apical progenitors, while increase in basal progenitors (Buchman et al., 2010). Apical progenitors can maintain progenitor pool by self-renewing while basal progenitors usually undergo a single terminal neurogenic division (Noctor et al., 2008). So mutant CDK5RAP2 might result in depletion of progenitor pool which ultimately affects brain growth. Yet unidentified causative gene at another locus on chromosome 10 might have role in cellular mitosis as patient‟s cells exhibited defects in chromosome segregation. Deficiency of MCPH gene products known so far affects several cellular mechanisms including DNA-damage repair, recruitment of proteins to centrosomes, cell-cycle progression, spindle alignment and cleavage plane orientation and symmetric to asymmetric switch etc.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 17

Chapter1 Introduction

Premature MCPH1 Chromosome Entry CASC5

Immature CENPJ,CEP135 Centrosome CDK5RAP2 CEP152,CEP63

ASPM Impaired Spindle STIL Allignment WDR62

Chromosome Segregation MCPH10 Defect

Figure 1.1: A proposed model representing how mutant MCPH proteins could affect neurogenesis. Adopted and amended from Thornton and Woods, (2009).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 18

Chapter1 Introduction

1.4- Approaches to MCPH Gene Identification

Homozygosity mapping together with linkage analysis has been extensively used to identify genes responsible for inherited disorders including MCPH. It is a gene mapping method applicable to recessive disorders in inbred populations. It is based on principle of identifying a common homozygous interval (homozygous by descent) among the genome of affected offspring produced by consanguineous matings (Sheffield et al., 1995). It is based on assumption, that parents are related and a disease-causing mutation is present in a chromosomal segment. The chromosomal segments are transmitted to the affected child through paternal and maternal lines from an ancestor common to both parents. These homozygous by descent (HBD) regions were traditionally mapped through microsatellite markers based homozygosity mapping.

Linkage analysis is used to assign statistical significance to HBD regions identified by homozygosity mapping. Linkage is the tendency of two or more genetic loci to be transmitted together during meiosis due to presence in close proximity to each other on a chromosome. Linkage analysis exploits the use of two types of statistical approaches, parametric or model based and non-parametric or model-free. Parametric linkage analysis is mostly suitable for monogenic disorders showing Mendelian mode of inheritance. These mapping approaches require genetic markers like short tandem repeats (STRs), single nucleotide polymorphisms (SNPs) and copy number variations (CNVs). Microsatellite markers are more polymorphic and thus more informative than individual SNPs which are bi-allelic and occur at a frequency of approximately 0.3–1 SNP/kb throughout the human genome (Marth et al., 2001).

Thus main limitation of homozygosity mapping lies in the requirement of consanguineous families, but several researchers have used this strategy to identify underlying genes in sporadic cases with suspicion of remote consanguinity (Otto et al., 2008; Tan et al., 2013). In principle, three offsprings from a 1st cousin marriage are adequate to map a locus with significant statistical value (LOD score above 3). The level of inbreeding and family structure affects the LOD score. It is predicted that 6% (1/16) of the genome of a child born from first cousins will be homozygous which on average will produce a homozygous segment of 20 cM in size. Offspring of second cousins are

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 19

Chapter1 Introduction expected to share 1/64 of their genome; offspring of double–first cousins 1/8 and offspring of incestuous union would share ¼ of their genome. This indicates that high level of inbreeding results in the mapping of large homozygous segments (Woods et al., 2006).

In case of MCPH, most of genes/ loci were mapped by using microsatellite based homozygosity mapping. Majority of MCPH loci (MCPH1-7) were initially mapped in large single families by performing genome wide scan with microsatellite markers spaced at ~5-10 cM. Most of these loci (e.g MCPH2, MCPH3, MCPH4, MCPH5) were mapped to large chromosomal regions, which were later refined by using different genomic microarray. However in recent years researchers have used 10K and 250K SNP arrays to map new MCPH genes. A 250K array was used to map MCPH gene, CEP135 in a Pakistani family (Hussain et al., 2012). But causative variant was identified by using whole-exome sequencing (WES), which signifies the importance of WES in disease gene identification. In this case, genome wide SNP data was initially analyzed to detect HBD region, followed by analysis and filtering of variants identified by WES. The rare variant identification in the large HBD region was greatly enhanced by the use of SNP databases and 1000 genome data. Additionally, 10K SNP array was used to map a novel MCPH locus on chromosome 10 in a Turkish family with three affected individuals (Marchal et al., 2011).

It is very likely that genome wide scan of highly consanguineous families with SNP arrays can result in identification of multiple HBD regions. Identification of disease causative variants in such families will be a really difficult task, but can be facilitated by the use of WES data. However, in these cases identification of disease causative variant will require additional supportive data, especially from functional studies to associate a potential WES variant with disease phenotype.

1.5- MCPH spectrum in Pakistan

Currently available data (Muhammad et al., 2009; Kousar et al., 2010; Mahmood et al., 2011; Kousar et al., 2011; Hussain et al., 2012, Sajid et al., 2012; Memon et al., 2013) indicates that MCPH is a frequently occurring genetic disorder in Pakistani population.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 20

Chapter1 Introduction

To date 136 MCPH Pakistani families bearing mutation in MCPH genes have been reported (Table 1.2).

Interestingly six MCPH loci (MCPH1, 2, 3, 5, 8, 9) were first mapped in the Pakistani families. Additionally number of mutations in ASPM, WDR62, MCPH1, CDK5RAP2, CEP135, CEP63, CEP152, and CENPJ genes have been found in Pakistani population. ASPM being the most vulnerable gene as 83 mutations have been found in ASPM-linked Pakistani families. The most common ASPM mutation is c.3978G>A/ p.Try1326X which was detected in 26 families (Gul et al., 2006, 2007; Muhammad et al., 2009; Kousar et al., 2010; Sajid et al., 2012).

Mutations in CENPJ, MCPH1, CEP152, CEP135 and CDK5RAP2 are rare cause of MCPH in Pakistani population. Two mutations each in CENPJ (c.17delC/ p.Thr6fsX3 and c. 3243delTCAG) (Bond et al., 2005; Gul et al., 2006), Microcephalin (c.74C>G/ p.Ser25X; c.1179delG/ p.Arg393SerfsX50) (Jackson et al., 2002; Sajid et al., 2012), CEP152 gene (c. 3149T>C/ p.Leu1050Pro, c. 3676-3678delAAC/ p.Asn1226del) (Sajid et al., 2012), CEP135 gene (c. 970delC/ P.Glu324SerfsX2) (Hussain et al., 2012), CDK5RAP2 gene (c.246 T>A/ p.Tyr82X, c.4005-15A>G / p.Arg1334SfsX5) (Tom et al., 2011) has been reported so far. Eleven mutations in WDR62 gene have been identified in Pakistani families originating from Punjab, Khyber Pakhtunkhwa (KPK) and Sind provinces (Nicholas et al., 2010; Kousar et al., 2011; Memon et al., 2013). Most of the mutations found in MCPH linked Pakistani families are in homozygous state except in three pedigrees segregating MCPH5, where compound heterozygous condition prevails. Bond et al. (2003) reported a northern ASPM linked Pakistani family with heterozygous mutation c.3663delG/ p.Arg1221fs in exon 15 causing frame shift and c. 9984+1G>T in intron 25 removing splice donor site and truncating protein after adding 29 novel amino acids. The affected individual carrying heterozygous mutation had head circumference 9SDs below the mean with more profound degree of mental retardation. Two additional compound heterozygous mutations in ASPM gene has been reported in Pakistani families (MCP18 and MCP35) (Muhammad et al., 2009). The authors identified c.3055C>T/ p.Arg1019X and c.7894C>T/ p.Glu2632X; c.3978G>A/ p.Try1326X and c.9319C>T/ p.Arg3107X in families MCP18 and MCP35 respectively. The affected individuals of

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 21

Chapter1 Introduction both families displayed milder phenotype (HC -6 SD) than all other patients bearing homozygous mutation ascertained during the study.

It has been reported that 61 MCPH Pakistani families have been found unlinked to known MCPH loci (Table 1.2). It indicates remarkable locus heterogeneity for MCPH in Pakistani population and also indicates scope for the identification of additional MCPH genes.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 22

Chapter1 Introduction

Table 1.1- A brief description of known MCPH loci/ genes.

Locus Chromosome Gene Protein Cellular Function location *MCPH1 8p23 MCPH1 Microcephalin Nucleus/ DNA Damage Chromatin repair, chromosome condensation

*MCPH2 19q13.12– WDR62 WD-repeat Nucleus, Spindle maintenance q13.2 protein 62 centrosomal to position during mitosis cytokinetic furrow

*MCPH3 9q33.2 CDK5RAP2 Cyclin-dependent Centrosome/ Regulation of kinase 5 regulatory Midbody microtubule associated protein 2 function/Centrosome Maturation

MCPH4 15q15–q21 CEP152 152 KDa Centrosome Involved in centriol centrosomal duplication protein

*MCPH5 1q31.3 ASPM Abnormal spindle- Peri- Positioning of like, microcephaly centrosomal/ mitotic spindles associated Midbody during embryonic Neurogenesis

MCPH6 13q12.12 CENPJ Centromeric Centrosome/ Centriole length protein J Midbody control/ microtubule function

MCPH7 1p33 STIL SCL/TAL1 Peri- Spindle organization interrupting locus centrosomal / Cell cycle progression

*MCPH8 4p14-4q12 CEP135 135 KDa Centrosome centriole biogenesis centrosomal protein

*MCPH9 3q22.2 CEP63 63 KDa Centrosome maintaining centrosomal centrosome number protein MCPH10 10q11.23- Not known - - - 21.3 MCPH11 15q14–15.1 CASC5 Cancer kinetochore Docking of susceptibility kinetochores to the candidate 5 microtubules * Locus first mapped in Pakistani population

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 23

Chapter1 Introduction

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 24

Chapter1 Introduction

1.6- Objective of the Study

The prime objective of present study is to ascertain Pakistani families with autosomal recessive primary microcephaly and map genes/ loci segregating with MCPH phenotype by homozygosity mapping. Additionally, sequencing of the known/ candidate genes will be carried to identify mutations segregating with disease phenotype.

This study will be performed using traditional linkage approaches blended with the modern day techniques like SNPs based microarray. The generated data will facilitate the understanding of disease pathology that can be helpful for the counseling of affected subjects.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 25

Chapter2 Materials and methods

MATERIAL AND METHODS 2.1- Families Studied Approval to conduct this study was taken from Quaid-I-Azam University institutional Review board. Written informed consent was obtained from elders of the affected and normal family members who agreed to participate in the present study. In the current study, 11 Pakistani families exhibiting autosomal recessive primary microcephaly (MCPH) were recruited from different areas of Pakistan. After thorough discussion with the elders of these families, pedigrees were drawn in accordance to published methods (Bennett et al., 1995). In the pedigrees, males are portrayed by squares and females by circles. These symbols were filled for the affected individuals while left blank for healthy individuals. Individuals within a generation were denoted by Arabic numerals. Double lines in the pedigrees depict the consanguineous marriages while diagonal line over a square or circle represent deceased individual.

The mode of inheritance of disease was inferred by pedigree analysis. Primary microcephaly was diagnosed by measuring occipital head circumferences of the affected and normal individuals of each family. The subjects with reduced occipital head circumferences (3 SD below the adjusted age and sex related mean of the corresponding population) were considered for the current study. Detailed clinical history of the affected probands was taken from elders of each family to rule out syndromic forms to enable selection of families with primary microcephaly. Where possible, at least one affected proband of respective family was clinically assessed at nearby hospital for radiological (X-rays and CT scan) and neurological examinations. Intelligence quotient (IQ) scores for the affected individuals of the family were measured by customized (Urdu version) Wechsler Scale to assess degree of mental retardation as a clinical feature associated with primary microcephaly.

2.2- Blood Sampling

The blood samples were collected from available affected and healthy family members 1/2 by 10 ml syringes (0.8 X 38 mm 21G x 1 ) and from children below 2 years of age by butterflies in standard potassium EDTA vacutainer tubes (BD, USA). The blood samples

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 26

Chapter2 Materials and methods were brought in a laboratory at the Department of Biochemistry, Quaid-i-Azam University, Islamabad and immediately processed for extraction of genomic DNA.

2.3- Extraction of Human Genomic DNA from Whole Blood

In most of cases genomic DNA from venous blood was extracted in accordance with standard Phenol-chloroform method (Sambrook et al., 1989). However GenEluteTM blood genomic DNA isolation kit (Sigma-Aldrich MO, USA) was used for DNA isolation from samples with less blood volume by following manufacturer’s protocol provided with kit.

2.3.1- Phenol-chloroform Method

For extraction of genomic DNA, 0.75 ml of venous blood was taken in a 1.5 ml microcentrifuge tube (Axygen, USA) and mixed with equal volume of solution A [10 mMTris of pH 7.5 (BDH, England), 0.32 M Sucrose (BDH, England), 5 mM MgCl2 (Sigma-Aldrich MO, USA), 1% v/v Triton X-100 (Sigma-Aldrich MO, USA)] and was kept at room temperature for 10-15 minutes. For thorough mixing, tubes were inverted manually several times and were centrifuged at 13,000 rpm for 1 minute in a centrifuge (Microfuge®18, Beckman CoulterTM, USA). Supernatant was discarded and pellet was re-suspended in 400 µl of solution A and centrifuged again as described above. This time nuclear pellet was re-suspended in 400 µl of solution B [10 Mm Tris pH 7.5, 2 mM EDTA of pH 8.0], 12 µl of 20% SDS solution and 5 µl of proteinase K (20 mg/ml) and incubated at 370C overnight. After 24 hours, 500 µl of fresh mixture of equal volume of solution C (Phenol, BDH, England) and solution D (1 volume of isoamyl alcohol and 24 volumes of chloroform) was added in samples and mixed thoroughly. The samples were centrifuged for 10 minutes at 13,000 rpm. As a result, upper layer in the form of aqueous phase was separated and was transferred to a fresh 1.5 ml microcentrifuge tube. The same process was repeated after adding equal volume of solution D. Finally 55 µl of 3M sodium acetate (pH 6) and equal volume of isopropanol or double volume of absolute alcohol (100% pure ethanol) was added to the isolated aqueous layer. Genomic DNA was precipitated after inverting sample tubes several times and centrifugation at 13000 rpm for 10 minutes. The DNA pellet was washed with 70% ethanol and dried in the vacuum concentrator 5301 (Eppendorf, Germany) for 5-10 minutes. After evaporation of residue

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 27

Chapter2 Materials and methods ethanol, DNA was dissolved in appropriate amount (100-200 µl) of TE [Tris (pH 8.0,10 mM), EDTA (0.1 mM)] buffer and was quantified by Nanodrop-1000 spectrophotometer (Thermo Scientific, Wilmington, USA) by taking optical density (OD) at 260 nm. DNA stock was stored at 4°C for subsequent analysis. 2.3.2- Commercially Designed Kit Method

Genomic DNA extraction from peripheral blood, collected in small amount (<750 µl) was carried out by using GenEluteTM blood genomic DNA kit (Sigma-Aldrich MO, USA). In a 1.5 ml microcentrifuge tube (Axygen, USA), 200 µl blood along with 20 µl of proteinase K solution (16.8 UI) and 200 µl of lysis solution C (GeneEluteTM Sigma- Aldrich MO, USA) was poured and incubated at 55oC for 10 minutes after vortexing for 15-20 seconds. After that, 200 µl of 100% ethanol was added to the resulting lysate. The whole content was then shifted to a freshly prepared mini-prep binding column and centrifuged at 7,000 rpm for 60 seconds. The flow-through was discarded and the column was transferred into a labeled fresh 2 ml collection tube. It was re-centrifuged at 7,000 rpm for 60 seconds after pouring 500 µl of wash solution. Flow-through was discarded and column was again transferred into a labeled fresh 2 ml collection tube. Again, 500 µl of wash solution was poured to the column and this time centrifugation was carried out at 12,000-13,000 rpm for 180 seconds. The flow-through was discarded and column was transferred to a labeled new collection tube of 2 ml. Later preheated (65oC) 200 μl of elution buffer (EB) was poured to the column and incubated at room temperature for 5 minutes. Finally DNA was eluted by centrifugation at 7,000 rpm for 1 minute. The eluted DNA was quantified by Nanodrop-1000 spectrophotometer (Thermo Scientific, Wilmington, USA) at optical density of 260 nm and stored at 4oC.

2.4- Mapping of Genes Responsible for MCPH

2.4.1- Exclusion Mapping

In the current study, 11 families diagnosed for autosomal recessive MCPH were initially tested for linkage to eleven MCPH loci by using homozygosity mapping approach. Table 2.1 summarizes known MCPH genes and flanking polymorphic microsatellite markers, genotyped in the collected families. Genetic and physical locations of the microsatellite markers were in accordance with the Rutgers second-generation combined linkage

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 28

Chapter2 Materials and methods physical map (build 36.2) of the human genome (Matise et al., 2007). Variable number of microsatellite markers, were used for exclusion of each known locus, in 11 MCPH families, depending on distance to known gene, length of mapped locus and heterozygosity level. Usually 2-3 microsatellite markers are enough to evaluate linkage to a chromosomal region, but we preferred to use more markers to avoid issues with non- informative results and genotyping errors. As currently available microsatellite markers are not characterized in Pakistani population, so selection of 1-2 markers is not a right choice for candidate gene analysis. Additionally, selection of multiple markers for each locus, allow better multi-point linkage analysis.

The available DNA samples of both affected and normal members of each family were genotyped with STR markers (Table 2.1) to detect homozygosity by descent (HBD), which segregate with disease phenotype and is shared by all affected individuals of the respective family. Once HBD was detected in a region containing known gene, respective gene was sequenced in the entire family to find causative sequence variant that segregate with MCPH phenotype. While unlinked family was processed for single nucleotide polymorphism (SNP) based genome scan.

2.4.1.1- Polymerase Chain Reaction (PCR)

Polymerase chain reaction was performed to amplify candidate alleles, in a 200 µl tube (Axygen, USA). The PCR reaction mixture was prepared by adding 1 μl sample DNA (40 ng), 0.5 μl dNTPs (10 mM), 0.3 μl of each forward and reverse primer (0.1 μM), one unit of Taq DNA polymerase (Fermentas, UK), 2.5 μl 10X buffer (100 mMTris-HCl, pH

8.3, 500 mM KCl) and 1.8 μl MgCl2 (25 mM) (MBI Fermentas, Life Sciences, UK) in 18.3 μl PCR water to make final volume 25 μl. The resulting mixture was vortexed and centrifuged for few seconds for thorough mixing. The PCR tubes were kept in T3000 thermo cycler (Biometra® Germany) and standard conditions set for amplification were as follows

a) One cycle for denaturing template DNA at 96°C for 5 minute b) One cycle consisting of denaturation of DNA into single strands at 96°C for 60 seconds, 60 seconds at 57°C or with a slight variation of ± 2°C for primers annealing to their complementary sequences on either side of the target

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 29

Chapter2 Materials and methods

sequence, 60 seconds at 72°C for extension of complementary DNA strands from each primer, repeated 35-40 times. c) Final extension for 10 minutes at 72°C

2.4.1.2- Agarose Gel Electrophoresis

The amplified PCR products of each microsatellite marker were resolved and detected on 2% (2 g of agarose in 100 ml 1X Tris-Borate-EDTA buffer) ethidium bromide stained agarose gel. For this purpose, 5 μl of each amplified product was mixed with 3 μl of tracking dye (0.25% bromophenol blue and 40% sucrose) and loaded into the wells. Electrophoresis was performed at 100 volts for 20-25 minutes and gel was placed on a UV Transilluminator (Biometra, Germany) for visualization.

2.4.1.3- Polyacrylamide Gel Electrophoresis (PAGE) Finally, PCR amplified product of each microsatellite marker was resolved on 8% non- denaturing polyacrylamide gel for allele separation. 8 % PAGE solution was prepared by mixing 5 ml 10X TBE (Tris 0.89 M, Borate 0.89 M, EDTA 0.02 M), 17.5 l TEMED (N, N, N’, N’-Tetra methylethylenediamine) (Sigma-Aldrich MO, USA), 350 μl 10% APS (Ammonium persulphate) (Sigma-Aldrich MO, USA), 13.5 ml 30% acrylamide solution [29 g acrylamide (MERCK, Germany) and 1g N, N’ Methylene-bisacrylamide (BDH, England)] in 31.13 ml distilled water to make final volume 50 ml. Gel casting apparatus was made of two glass plates tightly packed by placing one horizontal and two vertical spacers of 1.5 mm thickness at margins. Gel solution was poured in between the plates carefully by avoiding air bubbles and was allowed to polymerize for half an hour at room temperature. Gel plates were inserted in vertical gel electrophoresis apparatus (Whatman, Biometra, Germany) containing 1X TBE buffer. PCR products mixed with tracking dye were loaded into the wells and electrophoresis was performed at 110 volts for approximately 2 hours depending on the size of each amplicon. At last, ethidium bromide (10 µg/ml) stained gels were kept on UV transilluminator for visualization and images were taken by Digital camera DC 290 (Kodak, Digital Sciences, USA) and analyzed to score alleles for affected and normal individuals of all the studied families.

Linkage to known MCPH loci was established based on the observation that all affected individuals of a family showed characteristic homozygous pattern for disease allele while

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 30

Chapter2 Materials and methods normal subjects had heterozygous allele pattern. In case, the affected subjects had heterozygous allele pattern for the genotyped markers from the corresponding MCPH locus then that family was considered unlinked to that locus.

2.4.2- SNP based Genotyping by Microarray

The unlinked family was selected for high density genome wide scan with SNP arrays. Human 250K Nsp1 array (Affymetrix, USA), which contains approximately 250,000 SNPs, was performed by The Centre for Applied Genomics, The Hospital for Sick Children, Toronto, Canada by following manufacturer's instructions. For this purpose genomic DNA of the selected individuals was quantified by Nanodrop-1000 spectrophotometer (Thermo Scientific, Wilmington, USA) at optical density of 260 nm and diluted to 50 ng/ μl concentration.

The obtained data was analyzed through dChip software (http://biosun1.harvard.edu/complab/dchip/) and Homozygosity mapper (http://www.homozygositymapper.org/) to find homozygosity by descent (HBD) regions shared by the affected individuals. The boundaries and flanking SNPs of each HBD region were identified in the SNP data of initially selected individuals. Each HBD region was further evaluated in all available family members by genotyping microsatellite markers (Table 2.2) present within the initial homozygous region. These markers were selected from UCSC genome browser (http://genome.ucsc.edu/) or Rutgers combined physical maps (Matise et al., 2007). The microsatellite markers for respective regions were genotyped as described in section 2.4.1.3.

2.4.3- Statistical Packages for Linkage Analysis

PEDCHECK (O'Connell and Weeks, 1998), PEDSTATS (Wigginton and Abecasis, 2005) packages were used to eliminate Mendelian inconsistencies in genotyping data. Two point analysis was computed for pair wise comparison between trait locus and genotyped marker loci using Merlin program (Abecasis et al., 2002). Multipoint analysis was carried out for simultaneous analysis of several linked loci by using Merlin and Allegro 2 programs (Gudbjartsson et al., 2005). For these analysis disease allele frequency of 0.001 and an autosomal recessive mode of inheritance was selected.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 31

Chapter2 Materials and methods

2.4.4- Bioinformatics Tools

Genes located in the linkage interval were searched through University of California, Santa Cruz (UCSC) (http://genome.ucsc.edu/) and National Center for Biotechnology Information (NCBI) Entrez Genome Map Viewer (Build 36.2) (http://www.ncbi.nlm.nih.gov/mapview/). Candidate genes were selected on the basis of their expression profile in gene paint (http://www.genepaint.org/Frameset.html), gene cards (http://www.genecards.org) and Gepis tissue (http://www.cgl.ucsf.edu/cgi- bin/genentech/genehub-gepis/web_search). The DNA sequences of candidate genes were downloaded from UCSC and Ensemble Human Genome Server (http://www.ensembl.org/index.html). Primer for PCR-amplification of exons and splice junction sites of the genes were designed through Primer 3 software (version 0.4.0) (http://frodo.wi.mit.edu/primer3/) and SNPs in the primer sequences were checked through in-silico PCR option in UCSC Genome browser.

2.5- DNA sequencing of candidate genes

In order to seek pathogenic sequence variants, ASPM gene was sequenced in six families, WDR62 in four families and WDR58, RBFOX1, NDE1 genes in one family. The primers were designed through Primer3 software version 0.4.0 (http://frodo.wi.mit.edu/primer3/). Table 2.3-7 represents sizes of amplified products and optimal annealing temperature of primers used to sequence candidate genes. Gene sequencing involved following steps.

2.5.1- Primary PCR

The coding regions of genes and flanking ~20 bp intronic region was PCR-amplified with primers from intronic regions. PCR conditions were same as described in section 2.4.1.1. except doubling the reaction volume to 50 μl. To amplify GC rich 1st and last exons 50 μl working reaction volume was prepared by mixing 0.5 μl bio-Taq (5U/μl) (Bioline, UK), 25 μl FailSafe TM PCR 2X Premix J (FSP995J) (Epicentre, USA), 1 μl each of reverse and forward primer, 1.2 μl DNA template in 18 μl dH2O. The thermal cycle conditions include initial denaturation cycle at 96°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, primers annealing at 55°C for 30 seconds and polymerization at 72°C for one minute, and final extension for 5 minutes at 72°C. PCR product was analyzed on 2% agarose to detect specific amplifications.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 32

Chapter2 Materials and methods

2.5.2- Post primary PCR purification

Amplicons showing size specific band on 2% agarose gel were purified by using Gene JETTM PCR purification kit, (Fermentas, USA). After adding 60 μl of binding solution (H1) (Tris-HCl, concentrated Guanidine HCl, EDTA, and Isopropanol) to the primary PCR product, the sample was mixed thoroughly by vortexing. Then the mixture was loaded to a spin cartridge and was centrifuged at 13000 rpm for 1 minute. After discarding flow through, 500 µl alcohol-containing wash buffer (H2) (NaCl, EDTA, Tris- HCl) was added to the column, to remove Taq DNA polymerase, un-reacted primers, buffer and dNTPs, and centrifuged at 13000 rpm for 1 minute. The samples were again centrifuged to remove residual solution and 30 μl of preheated (at 65oC) Tris-EDTA buffer (10 mM Tris-HCl: pH 8.0, 0.1 mM EDTA) was poured to elute the DNA.

2.5.3- Sequence PCR

Sequencing PCR for purified amplicons was performed by using ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit v3.1 (PE Applied Biosystems). 10 μl sequencing reaction mixture was prepared by adding 1 μl DNA template, 1 μl 5X sequencing buffer, 1 μl forward or reverse primer, 1 μl ready reaction mix (RR) in 6 μl PCR water. PCR conditions for sequencing reaction were same as in Section 2.4.1.1 except decreasing the time duration for initial denaturation to 3 minutes and then for subsequent denaturation and annealing to 30 seconds while increasing the polymerization time to 4 minutes.

2.5.4- Post sequence PCR purification

Sequencing PCR product mixed with 70 μl 100% ethanol was centrifuged at 13,000 rpm for 20 minutes in 1.5 ml microcentrifuge tube. After carefully discarding supernatant, 200 μl of 70% ethanol was added into the tubes and these were again centrifuged at 13,000 rpm for 15 minutes. Supernatant was discarded and 15 μl of Hi-Di Formamide (HDF) was added to resuspend the pellet. Finally, 0.5 ml septa tubes carrying purified DNA were kept in ABI Prism 310 Automated DNA Sequencer (PE, Applied Biosystems, Foster City, CA, USA) for sequencing.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 33

Chapter2 Materials and methods

2.5.5- Mutation analysis

The sequencing data was analyzed through Bioedit version 7.0.5 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Bioedit, sequence alignment software (version 6.0.7.) was used to compare sequencing data with reference sequence to find causative sequence variants. The identified mutation segregating with the disease phenotype within the family was then checked in a panel of 50-100 control individuals of Pakistani origin to seek the possibility of neutral polymorphism. In case of missense mutations, sequences were aligned through Clustal W (www.ebi.ac.uk/clustalw/) software to detect conservation patterns.

2.6- Amplified fragment length polymorphism (AFLP) analysis

Amplified fragment length polymorphism (AFLP) analysis was carried out to determine allele sizes of three markers in two families that bear a mutation, already identified in several families of Pakistani and Indian origin. For the purpose, modified forward primers carrying additional sequence of 16 nucleotides at 5’ tail were used to amplify the corresponding genomic regions. These modified primers were used to amplify the respective genomic regions from the DNA samples of affected and normal individuals of both families. For fragment analysis, 3 μl D3 labeled PCR product from selected individuals was transferred to the sample plate (Beckman UK) along with 25 μl mixture (containing 3 μl size standard and 210 μl of sample loading solution (Beckman USA) for 8 wells). Finally genotyping was carried out using automated genetic analyzer (CEQ8800, Beckman, UK), and allele sizes for each markers were determined through comparison with size standards.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 34

Chapter2 Materials and methods

Table 2.1: List of microsatellite markers used to test linkage to known MCPH genes/ loci.

S. Locus Cytogenetic Gene Markers cM* Mb+ No. location

1 MCPH1 8p22-pter D8S1099 15.08 6.16 MCPH1/ Microcephalin / D8S1742 17.00 6.20 BRIT1(BRCT D8S277 17.64 6.50 inhibitor of D8S561 18.13 6.60 telomerase 1) D8S1706 19.19 6.92

2 MCPH2 19q13.12 WDR62 D19S719 55.67 38.60 D19S416 56.28 38.76 D19S245 56.28 38.78 D19S224 61.85 41.21 D19S220 62.62 43.12 D19S554 65.80 45.30 D19S223 66.09 46.08 D1S197 67.72 46.82 D19S900 69.41 48.85 D19S559 70.77 50.02

3 MCPH3 9q34 CDK5RAP2/ D9S1872 128.65 120.82 CEP215 D9S1116 131.02 122.03 (centrosomal D9S1682 132.42 124.03 protein 215) D9S1881 135.52 126.01

4 MCPH4 15q21.1 CEP152 D15S659 43.74 44.16 D15S132 45.29 44.98 D15S1024 46.89 46.33 D15S978 47.92 47.06 D15S220 48.57 49.86

5 MCPH5 1q31.3 ASPM D1S518 194.95 185.80 D1S2823 197.10 188.76 D1S2625 197.51 190.53 D1S533 199.81 192.32 GATA135F2 200.75 193.85 D1S2816 200.91 194.91 D1S1660 202.04 196.87 D1S1726 202.61 197.54 D1S1723 205.58 199.65

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 35

Chapter2 Materials and methods

D1S2686 207.90 200.90

6 MCPH6 13q12.12 CENPJ/CPAP D13S787 8.75 23.27 (centrosomal D13S1243 10.6 23.70 Protein 4.1 D13S742 11.71 24.18 associated D13S1294 13.94 25.37 protein) D13S221 14.98 25.47

7 MCPH7 1p33 STIL / SIL D1S2797 79.35 46.64 D1S3714 79.72 47.39 D1S2720 80.58 47.61 D1S3315 80.88 47.64 D1S2748 81.97 50.07

8 MCPH8 4q12 CEP135 D4S1594 69.43 54.60 D4S237 72.39 55.80 D4S3019 74.06 57.30 D4S2638 75.27 58.20 D4S1569 76.56 59.30

9 MCPH9 3q22.2 CEP63 D3S3713 143.25 134.73 D3S1238 144.35 135.39 D3S1590 145.99 136.43 D3S3528 146.5 137.60

10 MCPH10 10q11.23– unknown D10S1754 67.79 49.18 21.3 D10S1577 69.18 51.96 D10S539 71.95 54.73 D10S1227 74.30 57.19 D10S549 76.28 60.49 D10S1640 79.21 63.13 D10S1715 81.25 65.58

11 MCPH11 15q14–15.1 CASC5 D15S194 36.78 36.13 D15S1012 37.16 36.79 D15S1044 38.97 37.45 D15S994 41.37 38.36 D15S784 42.12 41.70

*Genetic distance (centi Morgan) and + physical distance (mega base pairs) are according to the second-generation combined linkage physical map of the human genome (Built 36.2) (Matise et al., 2007). The HGNC name is highlighted in bold for each gene, although the most common alternatives are also given.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 36

Chapter2 Materials and methods

Table 2.2: List of microsatellite markers used in Family A.

Chromosome Cytogenetic Markers cM* Mb+ location

1 1p31 D1S1665 108.3 73.94 D1S2876 112.04 78.69 D1S2882 116.61 82.74 D1S207 116.48 82.25 D1S2807 116.97 82.98 D1S1159 116.48 82.62

10 10q11.23-q22 D10S196 69.37 51.81 D10S1762 72.54 54.89 D10S549 76.35 60.49 D10S522 84.48 68.53 D10S195 94.38 77.28 D10S605 97.25 78.92 D10S201 99.44 80.69

16 16p13.2-p13.3 D16S3082 7.82 3.05 D16S423 13.92 5.98 D16S3042 17.06 6.66 D16S3128 17.48 6.97 D16S418 19.19 7.57 D16S675 19.7 7.90 D16S3052 20.76 8.11 D16S406 21.97 8.39 *genetic distance (centi Morgan) and +physical distance (mega base pairs) are according to the second-generation combined linkage physical map of the human genome (Built 36.2) (Matiseet al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 37

Chapter2 Materials and methods

Table 2.3: Sequences of the primers selected for amplification and sequencing of ASPM gene.

S. Primer Name Sequence (5'→3') Tm Product No. 0C size (bp)

1 ASPM-1F TTCACTCCCACGACCTCTAC 58 512 2 ASPM-1R TCTCCAATCGTCAACCTTCC 60 3 ASPM-2F GAGACTATCTGTTCTATTGC 46 570 4 ASPM-2R TAATGGTATCCCAAAGACTC 52 5 ASPM-3.1F ACTAGGAAATGCAGAAGAGC 54 581 6 ASPM-3.1R AAGGAAGTTTCAGTTACAGC 51 7 ASPM-3.2F AATGAATGCCATGGTGCAAC 62 662 8 ASPM-3.2R GCTTTGGGAGATTTTGAACC 59 9 ASPM-3.3F AGATAATTCACAGCCTGTGC 55 555 10 ASPM-3.3R TTTTCATGTTCACCCACTGC 59 11 ASPM-3.4F CGTCCAATACTTTCTGCCAC 58 582 12 ASPM-3.4R GCTAAGGAAATGTACCCAGC 56 13 ASPM-4F GGTTTATGGTCTGTGACTTC 52 458 14 ASPM-4R AGTTGACACAATATCCTGTC 50 15 ASPM-5F AAATGCTTTCAGCTCTTTCC 56 420 16 ASPM-5R AATGAACAGGGAATTATGCC 56 17 ASPM-6F AGATTGGCCTAAGGAGTAAG 53 498 18 ASPM-6R ATATGCCAGTTTTACCTGTC 52 19 ASPM-7F TTCCCACTGATATACTCTCC 52 428 20 ASPM-7R TTGTCATTACGTGCAACACC 58 21 ASPM-8F TCCTTAGGTTATGGTCTGCC 56 370 22 ASPM-8R GAAGGGAGAGTACTAGAAGC 50 23 ASPM-9F TTTATTTGTGCTTGCTACCC 56 392 24 ASPM-9R GCATTCCTATTTTACTCCTC 51 25 ASPM-10F GAGCAACTTTTAGAAAGATC 49 462 26 ASPM-10R ATTGTACTACTTGAAAGAGC 46 27 ASPM-11F TAAGAACTCTACTTGCCGAC 52 460 28 ASPM-11R TTTTCTCTGTGCCTATCCAC 55

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 38

Chapter2 Materials and methods

29 ASPM-12F GAATTAAGTGATGAGCATGG 53 322 30 ASPM-12R TTACTGGGGCAAAATAAACC 57 31 ASPM-13F TCAGTGTAGATGGTGTTTGC 54 565 32 ASPM-13R GAGGGAAAGTTTGCTTACAC 54 33 ASPM-14F CCTTGTAGATTTGTCACTCC 52 394 34 ASPM-14R AAGGAGAAATTAGCCGTAGC 55 35 ASPM-15F CAGTTCTCTGGATATGTCTC 49 468 36 ASPM-15R GTTGTTTGTATGAGTCGAGC 53 37 ASPM-16F CAGAAGATGATAGTAAGTAC 41 306 38 ASPM-16R CTTAATAATGCCATACATCC 50 39 ASPM-17F TGTAGGGGTGTTTTATTTCC 54 395 40 ASPM-17R CTTCATCACATTTTGCCTTC 56 41 ASPM-18.1F GAATTGGCTACAGGTATATC 49 676 42 ASPM-18.1R GGTTAGTATGGACACTTTTC 48 43 ASPM-18.2F AAGAGCTTTTAGAGAATGGC 53 725 44 ASPM-18.2R TCATCTTAACAGTTGACTGC 51 45 ASPM-18.3F GCATATAGAGGGATGCAAGC 57 811 46 ASPM-18.3R TGGCCATTCTAAAAGCAGAC 58 47 ASPM-18.4F TGGTACAGGGCGTACAAGAC 59 1015 48 ASPM-18.4R GTGTTGCTGCAGTCTGCATC 61 49 ASPM-18.5F ATTCAACACATGCACAGGGC 62 814 50 ASPM-18.5R GTCTGAGATAATGCTGCCTC 55 51 ASPM-18.6F AAAGGATGCGAGAGATGCAC 60 906 52 ASPM-18.6R TAATAATGGCAGCCTGGTGC 61 53 ASPM-18.7F ATCAGACAATGGCATTCTGC 59 852 54 ASPM-18.7F ATACTCTGCTTCCTGTGAAC 52 55 ASPM-18.8F GTACGAACTATTCAGGCTGC 55 766 56 ASPM-18.8R TTACTAGTGCCCTTTCCCTC 56 57 ASPM-19F GAGTCATGATATGACTATGC 47 509 58 ASPM-19R TAAAGGCTATGCTCTATCTC 49 59 ASPM-20F AAATTCTGTCATTGCCTTTC 54 370 60 ASPM-20R GATGTGTGTGAAATAAATGC 51

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 39

Chapter2 Materials and methods

61 ASPM-21F TGACAGTCAGTGCTCTTGTCAC 59 583 62 ASPM-21R ACCCTTGGCTTACACCTTCA 60 63 ASPM-22F AAGGCTAAATGTTGTACGAC 52 472 64 ASPM-22R CTCTGAGTTATGAGTTACAC 44 65 ASPM-23F TGAGTTATTCTACCGGCTAATGC 60 453 66 ASPM-23R AATGCCTCTGTGGAAAGCTG 60 67 ASPM-24F GAAATGTATGTGATCATGTC 48 405 68 ASPM-24R ACACACACAGGTAAATTTAC 47 69 ASPM-25F TCTTGAGGCCTTAAAACACC 57 376 70 ASPM-25R AGCCCTAGTGATGAGTAAAC 51 71 ASPM-26F TGGCTATACTAAGTATGGAC 47 546 72 ASPM-26R TGCTAGGATACTTTTCTCTC 49 73 ASPM-27F AGAGCAAGAGAGACCATCTC 54 414 74 ASPM-27R TCTCCACTGAAAAGCACATC 56 75 ASPM-28F ATGTGTTCAGGAGTAGCTAC 49 291 76 ASPM-28R ACACGGAGAGCAAAAATCAC 58 F = forward or left primer, R = reverse or right primer, bp = base pairs, Tm = Melting temperature, 0C = degree centigrade

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 40

Chapter2 Materials and methods

Table 2.4 - Sequences of the primers used for amplification and sequencing of WDR62 gene.

S. Primer Sequence (5'→3') Tm Product No. Name 0C Size (bp)

1 WDR62-1F CGCTTAATCAGGCATCCAGT 60 600 2 WDR62-1R GCAGCGAGGAGAAAGTGG 60 3 WDR62-2F GAAGCTCAGTGTGGGTGTTG 59 456 4 WDR62-2R TCTTTCCCAGAATCGCTGTC 60 5 WDR62-3F GGAGGAGGAGGAGACCAGAG 60 399 6 WDR62-3R CGCTCTAGCCAGCAGAGATT 60 7 WDR62-4F CCCCATTTCTCTGTGTGCTT 60 806 8 WDR62-4R GCATGTCACAGGTGCTCAAT 60 9 WDR62-5F GTTTCCCCATACAGCAGCTC 60 375 10 WDR62-5R CCCTCAAATCTCAGGGAGAA 60 11 WDR62-6F TCATTCTTGGACTGCTGCTG 60 589 12 WDR62-6R GCTCACTGCCTTGCCTATGT 60 13 WDR62-7F GAGGCCTAAGGCTGCTCTGT 61 363 14 WDR62-7R GATGGGTATTTGTGGGATGG 60 15 WDR62-8F GGGAAAAGTAGAATTGGAGCA 58 598 16 WDR62-8R CCCGCCTCATTTTTCTTCAG 62 17 WDR62-9F TTTCTTGTTTATTTTTAGCATAGA 58 697 AGG 18 WDR62-9R CTCCCATCATGGCTCTCG 60 19 WDR62-10F ACCCAGTGCTACCATCGTCT 60 835 20 WDR62-10R GGGAGCTGTTCATGGGATTA 60 21 WDR62-11F GAAAAGTGGTTGTGCATGTCT 58 400 22 WDR62-11R CAGCCACTCTGGTCTCAGG 59 23 WDR62-12F GGTGGTGAGGAGGTGAAATG 60 592 24 WDR62-12R GGGGTTTCACCATGTTGTCT 60 25 WDR62-13F TACAGAGTCCCACCCAGACC 60 597 26 WDR62-13R GAGCAAGACTCTGCCTCAAAA 60 27 WDR62-14F ACTGAGCTTGCAGTGTGTGG 60 497

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 41

Chapter2 Materials and methods

28 WDR62-14R TGGGGAAGGGCTCTGTAAAT 61 29 WDR62-15F GTTGTTACTGCTGCGGTGGT 61 558 30 WDR62-15R TGACACCAAGACTCCCACAA 60 31 WDR62-16F GGTGTGTTTTCCAGGAGCAT 60 681 32 WDR62-16R GGTCAGGGACTGCTCTGTTC 60 33 WDR62-17F TGATGTGTTTCTAGTGGGGAGA 60 382 34 WDR62-17R AACAAGGTCATGGGCAAAAC 60 35 WDR62-18F CCCACGGTTTAAGTTTGCAT 60 349 36 WDR62-18R CTGTCTCACTGAGCCTGGAA 59 37 WDR62-19F TGTGTGAAATGTCCGTGTCG 62 466 38 WDR62-19R GTCTGCCTTGGGAAGTCTTG 60 39 WDR62-20F GTGCCACACCTCTTCCTCAT 60 487 40 WDR62-20R CACCTGGAACCAGGGAACTA 60 41 WDR62-21F AGGGGGCATTTGGAGGAG 62 398 42 WDR62-21R CAGAATCCTCAGGCAGCAG 60 43 WDR62-22F GTTCAGCCAAGCCCCTTT 60 599 44 WDR62-22R CCACCTGAAATGGAGAAAGC 60 45 WDR62-23F CCCACTGAGCCTGGAAGAC 61 397 46 WDR62-23R GCTCTCCACTCACCCTCCT 60 47 WDR62-24F TGCTTCACTCTTGACCTGAGC 61 793 48 WDR62-24R CGTAAGGCAGGGAGCTGTAA 60 49 WDR62-25F AGGCTGAAGAGACCCTGGAG 61 986 50 WDR62-25R GTCCCAGGGTTTAGCACAAA 60 51 WDR62-26F AGTTGGCTCAGCTCCAAAGA 60 801 52 WDR62-26R GAAGGTGGAGACCAGCTCAG 60 53 WDR62-27F ACAGGCTGCAGACCACCTT 61 592 54 WDR62-27R CCATGCTCTCCACTGACAGA 60 F = forward or left primer, R = reverse or right primer, bp = base pairs, Tm = Melting temperature, 0C = degree centigrade

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 42

Chapter2 Materials and methods

Table 2.5- Sequences of primers used for amplification and sequencing of WDR58 gene.

S. Primer Sequence (5'→3') Tm Product No. Name 0C Size (bp)

1 WDR58-1F GGGAGGGTATCCGGCTTA 60 365 2 WDR58-1R AAATAGCCCAGGCAAAACAG 59 3 WDR58-2F GCCTCAAAAGAAGGCTGAGA 60 528 4 WDR58-2R AGATGTCGATCGGTGGAAAC 60 5 WDR58-3F CAGCTTGTCCTCTGCTTTGA 60 670 6 WDR58-3R CACCGTGAAAGTCCCAGTTT 60 7 WDR58-4F CTTTCTGCCTCATCCTGCTC 60 781 8 WDR58-4R GAAGGTGACGTGCTTCTGTG 59 9 WDR58-5F GTCCTCTTCTCCCCCAACTC 60 840 10 WDR58-5R GCCCCCATTCATAGAAAGAA 59 F = forward or left primer, R = reverse or right primer, bp = base pairs, Tm = Melting temperature, 0C = degree centigrade

Table 2.6- Sequences of the primers selected for amplification and sequencing of RBFOX1 gene.

S. Primer Name Sequence (5'→3') Tm Product No. Co Size(bp)

1 RBFOX1-1F GGCAAGCTGTTCCCAAAATA 60 550 2 RBFOX1-1R TTCAGCCATGAGAGATGTCG 60 3 RBFOX1-2F GCCACAGACCCTCATGTCTT 60 672 4 RBFOX1-2R ATGATGAGGGTGGGCTTAGG 61 5 RBFOX1-3F TGAACAGCGTCGGTTAAGAA 59 743 6 RBFOX1-3R AGCCACAATATACCTGCAGACT 58 7 RBFOX1-4F AAAGCAGACATGCACACAGG 60 499 8 RBFOX1-4R ACTGAACCCGATGTCTTTCC 60 9 RBFOX1-5F TCGCTTAATTATTGCACATCTCA 60 481

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 43

Chapter2 Materials and methods

10 RBFOX1-5R CATCCACCTTTCAGCGGTAT 60 11 RBFOX1-6F GACATTGCTTTATTGAAATGATTTGT 60 468 12 RBFOX1-6R TCCATTTGCCTTTGTTGTGA 60 13 RBFOX1-7F CTAAGGCAGGGGGCTTTGT 61 400 14 RBFOX1-7R GAAGTGGCATGGGAGACAGA 61 15 RBFOX1-8F CGTGCTGCTCTCTGCTTTTT 61 460 16 RBFOX1-8R CTTAGCAAGGTGCTCCACTG 59 17 RBFOX1-9F TGCCGTTGTCTCCAACCT 60 400 18 RBFOX1-9R ACCCCACTAAACAGCCAGTG 60 19 RBFOX1-10F AAGGCATTCATCTTAAATCCTTAGA 59 683 20 RBFOX1-10R TCATGGAAACAGCACCCATA 60 21 RBFOX1-11F GCTCTTCTTTTGGGATGTGC 60 471 22 RBFOX1-11R GCCCTCTCTCTATGGGGACT 60 23 RBFOX1-12F GTCCCCGCATGCTTATTTC 60 435 24 RBFOX1-12R TCAAAGTTAGCAAAATGCCTAATG 60 25 RBFOX1-13F GCAACCATGTTAAATGCACAA 60 469 26 RBFOX1-13R CATGCACTACATTGCCAAGA 59 27 RBFOX1-14F ATTTCTTTAGGAGGAGCTATTGG 57 500 28 RBFOX1-14R AAATACACAGAACAAAATATCTGAG 57 G 29 RBFOX1-15F TTCTACTCATTGCAAAATTAAATCA 57 834 30 RBFOX1-15R GGCTAAAGGAGGGTGGTTCT 60 31 RBFOX1-16F GGCAGTCTCTGCTGATGTGA 60 657 32 RBFOX1-16R TCCTGAAAAGAAGGGTATGACTG 60 33 RBFOX1-17F TGAATCACACAATTGAACTCCA 60 497 34 RBFOX1-17R CAATGATGTCAAACAAATTCCA 59 35 RBFOX1-18F GGGTGTTGATTGCCTCCTT 60 834 36 RBFOX1-18R GCAAGGAAGTTGCCCACTAA 60 37 RBFOX1-19F CGTCCTCTCACTTCCCGTTA 60 697 38 RBFOX1-19R AGAAAACTGCATGCCAAAGC 60 F = forward or left primer, R = reverse or right primer, bp = base pairs, Tm = Melting temperature, 0C = degree centigrad

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 44

Chapter2 Materials and methods

Table 2.7-Sequences of primers used for amplification and sequencing of NDE-1 gene.

S. Primer Name Sequence (5'→3') Tm Product No. Co Size (bp) 1 NDE1-1F GGATTGTGTTTTGTTTGGGTTT 60 816 2 NDE1-1R CAACATAGCGAGACCCCTGT 60 3 NDE1-2F AAGGTAATTCAGGCTTGATATTTTT 58 599 4 NDE1-2R GTTCCTTCTTCCAGCCAAGC 61 5 NDE1-3F GGAGTGTGGTGGGAGGAGTA 60 982 6 NDE1-3R TAGCATTTCCCCTGGTAAGG 59 7 NDE1-4F TTTAATGCTGGTTGGCATTG 60 791 8 NDE1-4R CCAGAGGCAGAATCCCAATA 60 9 NDE1-5F CACCAACCCTAAGCAAGGAC 60 699 10 NDE1-5R ATCCCCAAGAACATCCCAGT 61 11 NDE1-6F TGTGATGCGGTTAACTACGG 60 695 12 NDE1-6R CAGGGATGCTAAAGGAGCAG 60 13 NDE1-7F TGGCATATACGTTGGATTCCT 59 837 14 NDE1-7R CCGTGAGTAGCAGCTGTAGAA 58 15 NDE1-8F CGTTTTGTGTGACCTTGGAA 60 499 16 NDE1-8R GGTGGCAGGTAAGGATGAAA 60 17 NDE1-9F GGTGCTGGTACCCAGAAAAG 60 587 18 NDE1-9R CTCCAACGAGGAGACATGGT 60 F = forward or left primer, R = reverse or right primer, bp = base pairs, Tm = Melting temperature, 0C = degree centigrade

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 45

Chapter 3 MCPH12

Autosomal recessive primary microcephaly 12

Autosomal recessive primary microcephaly (MCPH) (MIM251200) is a rare manifestation of compromised neurogenic division resulting in significantly reduced brain with mild to moderate mental retardation. MCPH has been found in various populations across the world including Arab, Caucasian, Indian, Pakistani, Turkish, African, Brazilian, Morrocian, Mexican, and Dutch etc. However, incidence of MCPH varies among these populations from 1.3 to 150 per 100,000. In non-consanguineous white population, incidence is 1 per million as compared to one in 10,000 in consanguineous populations like Pakistan (Mahmood et al., 2011).

MCPH is a genetically heterogeneous trait associated to date with eleven genetic loci (MCPH1-11) mapped on different human chromosomes. Mutations in ten different genes (Microcephalin, WDR62, CDK5RAP2, CEP152, ASPM, CENPJ, STIL, CEP63 (Sir et al. 2011), CEP135 (Hussain et al., 2012) and CASC5 (Genin et al., 2012)) have been identified till now. Mutations in Microcephalin, CDK5RAP2, CEP152, STIL, CEP63, CEP135 and CASC5 are less frequent as compared to ASPM, WDR62, and CENPJ. These genes have been identified through linkage analysis of MCPH families with multiple affected individuals. But genetic analysis of several MCPH families from different populations ruled out the involvement of currently known MCPH genes (Gul et al., 2006; Kumar et al., 2009; Darvish et al., 2010; Hussain et al., 2012; Soltani Banavandi et al., 2012), which indicate the plausible involvement of additional genes.

In the present study, genetic linkage analysis in a consanguineous Pakistani family (Family A) with autosomal recessive primary microcephaly identified a novel locus mapped to chromosome 16p13.3-13.2.

3.1- Clinical Description of Family A

This is a six generation consanguineous Pakistani family, ascertained from Sind province of Pakistan. The family (Figure 3.1a) contains three affected individuals (V-3, V-6, VI-3) born to unaffected parents. The family pedigree showed segregation of the microcephaly in autosomal recessive pattern. Detailed clinical analysis of all affected individuals of the family was performed at local Government hospital. The information recorded by

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 46

Chapter 3 MCPH12 medical staff and clinical history shared by elders of the family revealed that microcephaly was congenital in all affected individuals. Pre and postnatal history collected for each affected individual of this family ruled out involvement of environmental causative factor. The affected female (V-3) was 8 years old while affected males (V-6, VI-3) were 20 and 2 years old, respectively. The affected male individual (V- 6) was short stature and exhibited slightly abnormal movements. Mild to moderate, non- progressive mental retardation with speech problem was observed in two affected individuals (V-3, V-6) but could not evaluate the degree of MR in baby boy (VI-3) at the time of visit. On examination, head circumferences of affected individuals varied from 39 cm (-9 SD) to 46 cm (-12 SD) which is below the age- and gender-related means (Figure 3.1b). None of the affected individuals exhibited epilepsy or autism since childhood.

The computerized tomography (CT) scan (Figure 3.1c) performed on affected individual V-6 did not show gross structural abnormalities. It presented normal ventricles, cerebral volume and posterior fossa structures. Furthermore there was no evidence of mass lesion, edema and midline shift.

3.2- Genotyping and linkage analysis

Initially linkage analysis based on microsatellite markers was performed to test the involvement of currently known MCPH genes. Because of high prevalence of ASPM mutations in the Pakistani population, all available members (IV-5, IV-6, V-1, V-2, V-3, V-4, V-5, V-6, VI-1, VI-2, VI-3) of family A were genotyped with ASPM flanking markers (Table 2.1). Affected members showed heterozygous pattern for different parental alleles at these markers. After excluding MCPH5 locus, the family A was tested for linkage to rest of the known MCPH loci (MCPH 1-11) by genotyping flanking microsatellite markers. Finally haplotypes were constructed for each locus. Analysis of haplotypes did not reveal any region of homozygosity by descent (HBD) shared by all affected individuals which could segregate with the disease phenotype.

After excluding linkage to known MCPH genes/ loci, three individuals (IV-5, V-6, VI-3) of this family were selected for genome scan to identify the causative gene. In order to plan a cost effective strategy for SNP based genome scan, affected individuals (V-6 and VI-3) were selected from two different loops of the pedigree. This selection was also

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 47

Chapter 3 MCPH12 sought to reduce number of non-informative segments plausibly shared by affected siblings V-3 and V-6. The genome wide scan with Human 250K Nsp1 array (Affymetrix, Santa Clara, CA, USA) was performed by The Centre for Applied Genomics, The Hospital for Sick Children, Toronto, Canada by following manufacturer's instructions.

Microarray data obtained from each of the three individuals was subjected to Homozygosity mapper (Lin et al., 2004) that identified homozygous intervals in the whole genome by considering both affected individuals (V-6, VI-3) as case and a normal (IV-5) as control. A high density SNP array contains large number of SNPs and consequently can result in higher rate of non-informative genotypes, especially in consanguineous families. Initially we analyzed data with default block length but it yields several false negative results. But after customizing block length at value 700 (higher the block value, larger will be homozygous block of SNPs), homozygous regions (shared by both affected individuals V-6 and VI-3) were identified on chromosome 1, 10, and 16 (Figure 3.2). A high block value (700) was used to reduce number of false negative produced due to extensive stretches of uninformative SNPs. These include 7.92 Mb regions on 1p31.1 flanked by SNPs rs11210478 and rs17574933, 18.9 Mb region on 10q11.23-q22.1 flanked by SNPs rs11003482 and rs2256199 while 3.96 Mb region identified on chromosome 16p13.3-13.2 was present between SNPs rs130021 and rs7196984. The detail has been summarized in table 3.1.

Subsequently, SNP genotype data of one normal (IV-5) and both affected (V-6, VI-3) members was further subjected to dChip software (Lin et al., 2004). The data analysis revealed homozygosity in normal individual IV-5 at regions identified by homozygosity mapper on chromosome 1 and 10 (Figure 3.3), while a 4.85 Mb shared homozygous region was also identified on chromosome 16 and was flanked by markers rs7192880 and rs11648289.

In order to validate these findings, microsatellite markers were selected from Rutgers combined linkage physical map (Matise et al., 2007) to genotype all available family members (IV-5, IV-6, V-1, V-2, V-3, V-4, V-5,V-6, VI-1, VI-2, VI-3) for three identified chromosomal regions mentioned in table 3.1. Genotyping of microsatellite markers within identified interval on chromosome 1 (D1S1665, D1S2876, D1S2882, D1S207,

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 48

Chapter 3 MCPH12

D1S2807, D1S1159) and 10 (D10S196, D10S1762, D10S549, D10S522, D10S195, D10S605, D10S201) did not elucidate linkage in the complete family. While three affected individuals were found homozygous for microsatellite markers D16S423, D16S3042, D16S3128, D16S418 and normal individuals showed heterozygous pattern for parental alleles suggesting the linkage of this family to chromosome 16p13.3-13.2. Haplotype was constructed based on the genotyping data of available family members and is presented in figure 3.4. Haplotype analysis revealed 11.88 cM HBD region shared by three affected individuals (V-3, V-6, VI-3) and is delineated by markers D16S3082 and D16S675. This HBD region (chr16:3,117,144-7,970,219; 4.85Mb: hg19 assembly) almost overlaps with analyzed 250K Nsp1 array data (chr16:3,111,203-7,797,128; hg19 assembly). Analysis of SNP data obtained for three (two affected and one normal) individuals revealed a 4.68Mb homozygous region and is flanked by SNPs rs7188573 and rs7196984.

Parametric linkage analysis carried out by using allegro version 2 (Gudbjartsson et al., 2005) of chromosome 16 markers yielded a maximum multipoint LOD score of 3.32 at markers D16S3042 and D16S3128. Two-point linkage analysis performed by using MLINK program (Cottingham et al., 1993) for fine mapping loci yielded a maximum two-point LOD score of 1.69 for markers D16S423, D16S3042, D16S3128 and D16S418 (Table 3.2).

3.3- Screening of candidate genes

University of California Santa Cruz (UCSC; http://genome.ucsc.edu/cgi-bin/hgGateway) and ensemble (http://www.ensembl.org/Homo-sapiens) human genome browser found 46 known genes within 11.88cM linkage interval flanked by markers D16S3082 and D16S675 on chromosome 16p13.2-p13.3. Initially all coding exons and splice junction sites of a known gene NDE1 associated with MCPH phenotype, located 7.7Mb outside the linkage interval was sequenced using 9 primer sets (Table 2.7) to find possible mutation. But analysis of the sequencing data did not reveal any mutation segregating with the disease pathology. Then two additional genes, A2BP1 (ataxin 2-binding protein 1)/ RBFOX1 (RNA binding protein, fox-1 homolog (C. elegans) and WDR58 based on

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 49

Chapter 3 MCPH12 putative functional and expression data were selected from the candidate linkage interval for mutation screening.

A2BP1/ RBFOX1 gene comprised of 16 exons (assembly NCBI36/ hg18), encodes Ataxin-2 binding protein 1 that has an RNP motif, and has high expression in brain. While WDR58 (WD repeat domain 58) contains 12 coding exons and is a member of WD repeat protein family. The second most common primary microcephaly type MCPH2 is also caused by mutated WDR62 protein (Bilgüvar et al., 2010; Nicholas et al., 2010; Yu et al., 2010). But sequencing of all coding exons of WDR58 and A2BP1 genes did not identify any disease causing variant. Therefore, the involvement of these two genes in causing autosomal recessive primary microcephaly at MCPH12 locus in our family is not supported.

3.4- Discussion

The present investigation described a large consanguineous family, originated from a remote region in Sind province of Pakistan. Clinical features of the affected members of this family are compatible with autosomal recessive primary microcephaly. The CT scan performed on the affected male V-6 was generally normal and showed normal ventricles and cerebral volume and is in line with the majority of the MCPH cases that does not reveal severe brain anomalies.

In the current family, SNP genotyping technology mapped a novel locus for autosomal recessive primary microcephaly to chromosome 16p13.3-13.2. It spans genetic interval of 11.88 cM corresponding to 4.85 Mb according to Rutgers combined linkage-physical map build 36.2 of the human genome (Matise et al., 2007). This region contains several known genes of potential interest (Figure 3.5) however two genes A2BP1/ RBFOX1 and WDR58 were selected for sequencing to find disease associated variant.

However, a gene NDE1 (nudE nuclear distribution E homolog 1) mapped on 16p13.11 has been reported to cause extreme microcephaly with lissencephaly (Ghannad, 2011; Bakircioglu et al., 2011). The authors reported that NDE1 express in developing neuroepithelium and especially localizes to mitotic spindles in apical neural precursor cells. Deficiency of NDE1 thus leads to defects in neurogenesis and cortical lamination. However, critical region (4.85 Mb) identified in affected individuals of family A does not

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 50

Chapter 3 MCPH12 contain NDE1 gene. But due to relevant role of NDE1, this gene was sequenced in Family A to see the possible disease associated mutation but sequencing of all exons and splice junction sites of NDE1 did not reveal any pathogenic sequence variant.

A2BP1/ RBFOX1/ FOX1 gene encodes an RNA binding protein that shows high expression in human brain. It is a neuron specific splicing factor, predicted to regulate the alternative splicing of widespread network of genes involved in neuronal differentiation and maintenance. Fogel et al. (2012) suggested that RBFOX1 may act as a molecular switch for differentiating neuronal progenitors into functional neurons. Few known microcephaly genes like ASPM, WDR62 and STIL are known to play similar roles in balancing symmetric and asymmetric divisions of neuronal cells. So disruption in their molecular mechanisms can lead to defective neuronal differentiation.

WDR58 belongs to WDR family of proteins. WD-repeats (also known as β-transducin repeats) are minimally conserved domains of approximately 40-60 amino acids that are initiated by glycine-histidine (GH) dipeptide 11 to 24 residues from N terminus and end with a tryptophan-aspartic acid (WD) dipeptide at the C terminus (Li and Roberts, 2001).WD-containing proteins are predicted to form a circulated beta-propeller structure. These are found in all eukaryotes and are implicated in a variety of functions ranging from signal transduction and transcription regulation to cell cycle control and apoptosis. Another member of this family, WDR62 has been implicated in causing second most common microcephaly subtype, MCPH2. Mutated WDR62 gene is responsible for severe brain malformations involving pachygyria with cortical thickening and hypoplasia of the corpus callosum, schizencephaly and polymicrogyria along with microcephaly (Bilgüvar et al., 2010; Nicholas et al., 2010; Yu et al., 2010; Bhat et al., 2011). However the CT scan of one affected individual (V-6) of our family did not reveal the presence of significant dysmorphic features.

Sequencing of all coding exons of WDR58 and A2BP1 genes did not identify any pathogenic mutation. Therefore, the involvement of these two genes in causing autosomal recessive primary microcephaly in this family is not supported. Further fine mapping and sequencing of additional candidate genes is required to identify MCPH causative gene in family A.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 51

Chapter 3 MCPH12

(a)

I:1 I:2

II:1 II:2 II:3 II:4

III:1 III:2 III:3 III:4

IV:1 IV:2 IV:3 IV:4 IV:5* IV:6*

V:1* V:2* V:3* V:4* V:5* V:6*

VI:1* VI:3* VI:2*

(b) (c)

i i ii

Figure 3.1: (a) Pedigree of family A showing segregation of MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages. The family members available for blood collection are marked by *. (b) Pictures of affected individuals (i) V-6, (ii) V-3 depicts characteristic slopping forehead without significant facial dysmorphism. (c) Image of computed tomography (CT) scan performed on the affected individual V-6 show normal brain architecture.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 52

Chapter 3 MCPH12

Figure 3.2- Image of SNP data analyzed by homozygosity mapper showing three significant regions (red bars) of homozygosity-by-descent (HBD) on chromosome 1, 10 and 16.

Table 3.1- Description of SNP data analysed by homozygosity mapper in family A. Chr. Cytogenetic band Start SNP End SNP Region size (Mb)

1 1p31.1 rs11210478 rs17574933 7.92

10 10q11.23-q22.1 rs11003482 rs2256199 18.9

16 16p13.3-13.2 rs130021 rs7196984 3.96

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 53

Chapter 3 MCPH12

a b c

V-6 VI-3 V-5 V-6 VI-3 V-5 V-6 VI-3 V-5

Figure 3.3: Image of dChip data analysis in family A. Individual data for three chromosomes is presented in the form of columns (V-6, IV-3 are affected and V-5 is unaffected). The regions on chromosome 1 and 10 are excluded because of homozygosity in normal individual V-5. Allele pattern of SNPs on chromosome 1 (a), 10 (b) and 16 (c). Red block depicts shared homozygous region on chromosome 16 and is flanked by rs7192880 and rs11648289. Blue blocks indicate the homozygous region while yellow blocks depict heterozygous regions.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 54

Chapter 3 MCPH12

I:1 I:2

II:1 II:2 II:3 II:4

III:1 III:2 III:3 III:4

IV:1 IV:2 IV:3 IV:4 IV:5* IV:6*

rs7188573 00 00 D16S3082 7.82cM 21 21 rs8049130 00 00 D16S423 13.92cM 21 21 D16S3042 17.06cM 21 21 D16S3128 17.48cM 21 21 D16S418 19.19cM 21 21 D16S675 19.7cM 21 12 D16S3052 20.76cM 21 12 D16S406 21.97cM 21 12 rs11648289 00 00

V:1* V:2* V:3* V:4* V:5* V:6* rs7188573 00 00 00 00 21 11 D16S3082 7.82cM 21 12 21 21 21 11 rs8049130 00 00 00 00 21 11 D16S423 13.92cM 21 12 11 21 21 11 D16S3042 17.06cM 21 12 11 21 21 11 D16S3128 17.48cM 21 12 11 21 21 11 D16S418 19.19cM 21 12 11 21 21 11 D16S675 19.7cM 12 21 21 11 21 11 D16S3052 20.76cM 12 21 21 11 21 11 D16S406 21.97cM 12 11 11 12 21 11 rs11648289 00 00 00 00 21 12

VI:1* VI:2* VI:3* rs7188573 00 00 12 D16S3082 7.82cM 12 11 11 rs8049130 00 00 11 D16S423 13.92cM 12 12 11 D16S3042 17.06cM 12 12 11 D16S3128 17.48cM 12 12 11 D16S418 19.19cM 12 12 11 D16S675 19.7cM 21 21 12 D16S3052 20.76cM 21 21 12 D16S406 21.97cM 11 11 12 rs11648289 00 00 12

Figure 3.4: Haplotype of family A shows HBD region flanked by markers D16S3082 (3.05Mb) and D16S675 (7.9Mb) on chromosome 16p13.3-13.2. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centi Morgan) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007). Bold SNP markers represent genotypes of 3 individuals selected for SNP microarray. Region between rs7188573 and rs11648289 contains 687 SNPs (162 SNPS were informative), but only one is shown here.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 55

Chapter 3 MCPH12

Table 3.2: Two point and multipoint LOD score values for locus at 16p13.3-13.2 in family A.

Markers Genetic Physical Multipoint Two-point LOD Score Distance Distance LOD score results at recombination (cM)* (Mb)+ fraction zero

D16S3082 7.82 3.05 -Infinity - Infinity D16S423 13.92 5.98 3.2956 1.6906 D16S3042 17.06 6.66 3.3248 1.6906 D16S3128 17.48 6.97 3.3254 1.6906 D16S418 19.19 7.57 3.3148 1.6906 D16S675 19.7 7.90 - Infinity - Infinity D16S3052 20.76 8.11 - Infinity - Infinity D16S406 21.97 8.39 -0.9908 -1.0406

*Genetic distance (centi Morgan) and +physical distance (Mega base pairs) are according to the second-generation combined linkage physical map of the human genome (Built 36.2) (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 56

Chapter 3 MCPH12

16p 16q

D16S675 D16S3082

WDR58 RBFOX1 NDE1 DNASE1 SEPT12 CLUAP1

Figure 3.5: Diagram of chromosome 16 depicts a 4.85 Mb homozygous region on 16p13.2-p13.3 identified in family A. The potential candidate genes are also shown between the flanking markers.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 57

Chapter 4 MCPH2

Autosomal recessive primary microcephaly 2

MCPH2 locus was initially mapped on chromosome 19q13.1-13.2 in two families, including one from Punjab province of Pakistan (Roberts et al., 1999). Later high throughput sequencing of multiple MCPH2 linked families resulted in the identification of WDR62 gene (Bilgüvar et al., 2010; Nicholas et al., 2010; Yu et al., 2010). WDR62 gene mutations are associated with broad spectrum clinical manifestation predominately causing autosomal recessive primary microcephaly (Bilgüvar et al., 2010; Nicholas et al., 2010; Yu et al., 2010; Bhat et al., 2011). Till now, twenty four mutations in WDR62 gene have been identified in MCPH2 linked families from European, Indian, Caucasian, Mexican, Turkish, Saudi and Pakistani populations.

WDR62 protein (a member of WD repeat family of proteins) contains multiple WD40 or β-transducin repeats and a C terminal region containing several potential phosphorylation sites. Alternatively spliced WDR62 transcripts encode a long protein with 1523 amino acid residues (isoform 1) and a shorter protein with 1518 amino acids (isoform 2). WDR62 protein localizes to spindle pole and regulate positioning of cytokinetic furrow for proper neuroprogenitor cell division (Nicholas et al., 2010). Recently Bogoyevitch et al. (2012) demonstrated the role of WDR62 protein in spindle maintenance and mitotic progression in a cell cycle dependent manner. They reported that JNK phosphorylated WDR62 protein is involved in organizing metaphase spindles during mitosis. Depletion of WDR62 product results in spindle orientation defects, disorganized chromosomes and delayed mitotic progression thus affects neurogenesis.

In the present chapter four unrelated consanguineous Pakistani families (B-E), segregating MCPH are presented. Homozygosity mapping revealed the linkage of these families to MCPH2 locus. Sequence analysis of WDR62 gene identified two novel (c.3232G>A, c.1942 C>T) and two recurrent mutations.

4.1- Clinical description

Affected individuals of four families (Family B- E) included in this study, exhibited congenital and non-progressive nature of MCPH. The pedigree analysis of each family depicts that affected individuals were produced by normal parents.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 58

Chapter 4 MCPH2

The description of the affected individuals of these families is given below.

4.1.1- Family B

This large family (Figure 4.1a) consisted of four affected persons in two consanguineous loops with autosomal recessive mode of inheritance. Five affected individuals including two females (IV-1, IV-4) and three males (IV-2, IV-5, IV-6) along with six normal individuals (III-1, III-2, III-3, III-4, IV-3, IV-7) were available for blood collection. The affected individuals had predominant sloping forehead without any signs of facial dysmorphism (Figure 4.1b), seizures, epilepsy and autism. These are mild to severe mentally retarded. Additional biometric and clinical information of affected individuals of family B is represented in table 4.1.

4.1.2- Family C

Family C (Figure 4.2a) consists of two affected individuals in a single consanguineous loop. Both patients (IV-1, IV-2) were clinically examined at children hospital, Lahore. Blood samples were collected from both parents (III-3, III-4) and their two affected children (IV-1 and IV-2). Both affected individuals had abnormal sleeping habits. Other related clinical features have been recorded in table 4.1.

The computerized tomography (CT) scan of affected member IV-1 exposed reduced volume of right cerebral hemisphere and prominent extra axial cerebrospinal spaces showing poorly defined gyral and nuclei pattern (Figure 4.2b). However there was no indication of local area of brain attenuation and intra-cerebral blood.

4.1.3- Family D

Family D (Figure 4.3a) comprises three (V-2, V-3, V-5) affected female individuals in fifth generation. These affected females have noticeably reduced head circumference at birth. They lack self-care concept and exhibit poor speech development, only limited to a few words. None of the affected female has any history of seizure. Head circumference and other related features are recorded in table 4.1. Parents of affected individuals have normal intelligence and head circumference. Venous blood was drawn from three affected (V-2, V-3, V-5) and four normal (IV-1, IV-2, V-1, V-6) individuals.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 59

Chapter 4 MCPH2

4.1.4- Family E

This family (Figure 4.3b) comprises three affected male individuals (IV-3, IV-6, IV-8) in a single consanguineous loop. These affected male individuals were born after an uncomplicated pregnancy and delivery with a normal birth weight, but had reduced head circumference. These individuals exhibit aggressive behavior and poor speech development. Blood samples were taken from three affected (IV-3, IV-6, IV-8) and seven normal (III-1, III-2, IV-2, IV-4, IV-5, IV-7, IV-9) individuals. Additionally collected clinical information is recorded in table 4.1.

4.2- Linkage Analysis of MCPH Families

After excluding linkage to MCPH5 locus harboring ASPM gene, these four families were tested for linkage to other known MCPH genes/ loci by genotyping a set of polymorphic microsatellite markers represented in table 2.1.

In Family B five available affected (IV-1, IV-2, IV-4, IV-5, IV-6) members were found homozygous for three microsatellite markers D19S554, D19S223, D19S400, while six normal individuals (III-1, III-2, III-3, III-4, IV-3, IV-7) showed heterozygous pattern for different parental alleles indicating presence of homozygosity by descent (HBD) on chromosome 19. Later, three additional microsatellite markers D19S224, D19S408 and D19S574 were genotyped in the entire family which revealed the segregation of a 7.25Mb homozygous region. The identified critical region was shared by all five affected individuals and was delineated by markers D19S224 and D19S408 (Figure 4.4). Two- point linkage analysis with Merlin yielded LOD score above 3.0 with markers D19S554, D19S223, D19S400 (Table 4.2). Linkage data also supports the identification of minimum critical region in family B, which overlaps with MCPH2 locus (Roberts et al., 1999) and contains WDR62 (NM_001083961) gene ((Bilgüvar et al., 2010 Nicholas et al., 2010; Yu et al., 2010) which was later sequenced in all available members of family B.

In Family C, both affected individuals (IV-1, IV-2) were homozygous for six microsatellite markers D19S224, D19S220, D19S422, D19S223, D19S400 and D19S197. Only affected individual VI-2 was heterozygous at marker D19S559, due to a recombination event between markers D19S197 and D19S559 (Figure 4.5). A maximum

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 60

Chapter 4 MCPH2 two-point LOD score of 1.1 (θ = 0) was observed at marker D19S422 (Table 4.2). The identified extended HBD region is shared by both affected individuals and also overlaps with MCPH2 locus.

In family D, four normal (IV-1, IV-2, V-1, V-6) and three affected (V-2, V-3, V-5) individuals were genotyped for microsatellite markers D19S245, D19S224, D19S422, D19S223 and D19S197. All affected females (V-2, V-3, V-5) were found homozygous for three markers D19S224, D19S422, D19S223, while normal individuals were heterozygous. Analysis of haplotype revealed a HBD region shared by all affected individuals and is delineated by markers D19S245 and D19S197 (Figure 4.6). Two-point linkage analysis yielded LOD score above 1.7 with markers D19S224, D19S422 and D19S223 (Table 4.2). However negative LOD scores were obtained for both boundary determining markers.

All available members (III-1, III-2, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8, IV-9) of family E were genotyped with microsatellite markers D19S719, D19S416, D19S245, D19S220, D19S223 and D19S900. Haplotype analysis revealed the presence of an extended region of homozygosity in three affected (IV-3, IV-6, IV-8) individuals of this family. The centromeric boundary of this region was defined by an ancestral recombination, while telomeric boundary was determined by a recombination between markers D19S223 and D19S900 observed in affected individuals IV-6 and IV-8 (Figure 4.7). This led to the identification of a 13.74 cM HBD region shared by three affected male individuals. A maximum two-point LOD score of 2.1 (θ = 0) was observed at markers D19S416, D19S245, D19S220 and D19S223 (Table 4.2). Two-point LOD score and haplotype analysis clearly delineates HBD region by markers D19S719 and D19S900, which also overlaps with MCPH2 locus.

Two point Linkage analysis performed by pooling the genotype data of four (B-E) families yielded a maximum two point LOD score of 9.5 at markers D19S554 and D19S223. A multipoint LOD score of 8.0 and above was obtained for five markers flanked by D19S224 (61.85 cM) and D19S197 (67.72 cM) (Table 4.2).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 61

Chapter 4 MCPH2

4.3- Sequencing of WDR62 gene

Initially, DNA sequence analysis of the entire coding region of WDR62 gene in family B, identified a missense mutation (c.3232G>A) in exon 27 (Figure 4.8). At protein level this substitution leads to change of Alanine (GCA) with Threonine (ACA) at amino acid position 1078 (p.Ala1078Thr) (Table 4.3). This missense mutation occurs in the C terminus of WDR62 and was present in homozygous state in all affected individuals of family B. The parents (III-1, III-2, III-3, III-4) of affected individuals were obligate carriers. The alteration (c.3232G>A; p.Ala1078Thr) was absent in 190 ethnically matched normal Pakistani individuals.

Subsequently WDR62 gene was sequenced in (two affected individuals from each family) the remaining MCPH2 linked families (C-E). Sequence analysis of these families found one novel and two recurrent mutations. The identified mutations affect various domains of WDR62 protein (Figure 4.9). All 32 coding exons and splice junction sites of WDR62 gene were sequenced by using a set of 27 primer pairs mentioned in table 2.4.

Sequence analysis of family C revealed a single base pair transversion (c.1942 C>T) in exon 15 (Figure 4.10) in both affected individuals (IV-1, IV-2). Both parents (III-3, III-4) were heterozygous for mutant (T) and wild (C) type allele. This mutation alters CAG codon (Gln) with TAG codon (Stop), resulting in a premature stop codon at position 648 (p.Q648X). The premature termination caused by Q648X mutation results in a truncated protein lacking nearly half of WDR62 protein at C terminus (Figure 4.9).

Similarly, a G to A transition at nucleotide position 1313 (c.1313G>A) was identified in two affected female (V-2, V-3) individuals of family D. This transition in exon 10 replaces CGC (Arg) with CAG (His) codon (Figure 4.11), resulting in the replacement of amino acid arginine with histidine (p.Arg438His) at 438 position. Subsequently, screening of exon 10 in the remaining (IV-1, IV-2, V-1, V-6) family members revealed the presence of homozygous p.Arg438His mutation in the third affected female individual (V-5). This missense mutation alters arginine amino acid which is highly conserved in chimpanzee, mouse and rat WDR62 protein.

In family E, a homozygous single base pair insertion (c.3936_3937insC) in exon 30 was initially observed in two affected individuals (IV-3, IV-6). This c.3936-3937insC

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 62

Chapter 4 MCPH2 mutation (Figure 4.12) changed the reading frame, resulting in a premature stop codon 50 base pair downstream (p.Val1314ArgfsX18). The mutation was also present in homozygous state in the third affected individual (IV-8), heterozygous state in parents while normal off-springs were either homozygous or heterozygous for wild type allele. This mutation results in a truncated protein, which presumably lacks 191 amino acids at C-terminus.

These three mutations were homozygous in affected individuals and found heterozygous in obligate carriers. To rule out the possibility of neutral polymorphisms, a panel of 100 control individuals of Pakistani origin was screened for these mutations and none of these mutations, identified in families B, C, D and E, was detected in the control samples.

4.4- Discussion

In humans, WDR62 gene is the second major causative factor for autosomal recessive primary microcephaly. Detailed clinical analysis of WDR62 linked families led to the identification of certain distinguishing features of diagnostic importance. These features mainly include pachygyria, lissencephaly with cortical thickening and hypoplasia of the corpus callosum, schizencephaly and polymicrogyria, sub cortical heterotopias and sometime asymmetry in brain stem (Bilgüvar et al., 2010; Nicholas et al., 2010; Yu et al., 2010; Bhat et al., 2011).

This study describes genetic analysis of four (Family B-E) MCPH families recruited from Sind and Punjab provinces of Pakistan. Family B consisting of five available affected individuals was initially linked to MCPH2 locus on chromosome 19q13.1–13.2. This family belongs to a group of six families which were used to identify WDR62 gene by using SNP microarrays, genome capture and massive parallel sequencing techniques (Nicholas et al., 2010). Subsequent screening of WDR62 in family B revealed a novel missense mutation (c.3232G>A) substituting alanine residue with threonine in exon 27.

After then WDR62 was sequenced in rest of three MCPH2 linked families, which led to the identification of three mutations; including a nonsense mutation (c.1942 C>T; p.Q648X) in family C, a missense mutation (c.1313G>A; p.Arg438His) in family D and a homozygous single base pair insertion (c.3936_3937insC; p.Val1314ArgfsX18) in family E.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 63

Chapter 4 MCPH2

Two mutations c.1313G>A (p.Arg438His) and c.3936_3937insC (p.Val1314ArgfsX18) identified in this study have been reported earlier. Former was identified by Nicholas et al. (2010) and Sajid et al. (2012) in two large Pakistani families comprised of six and four affected individuals, respectively. Affected individuals of family D with p.Arg438His mutation could not exhibit self-care skills and were unable to read and write. These clinical features were also observed in affected individuals of families reported by Hussain et al. (2011).

While later has been reported in a Caucasian and a Turkish family (Nicholas et al., 2010; Yu et al., 2010). The affected individual of these families showed delayed motor development along with limitation in verbal expression. MRI of the brain revealed polymicrogyria, simplified gyral pattern while corpus callosum had reduced splenium and an incomplete genu. Nicholas et al. (2010) compared brain MRI of a patient bearing missense (p.Arg438His; also found in family D) mutation with an affected individual having frameshift (p.Val1314ArgfsX18; also found in family E) mutation. They found that affected individual with missense mutation showed simplified gryal pattern, while additional cerebral cortical abnormalities were observed in patient with truncating mutation. Association of truncating mutations in WDR62 with severe brain malformation has also been reported by several other studies (Bhat et al., 2011; Memon et al., 2013). The affected individuals (IV-3, IV-6, IV-8) of family E (with p.Val1314ArgfsX18 mutation) also exhibit severe clinical features, but unfortunately CT and MRI scan facilities were not available to make better comparison.

Missense mutation p.Ala1078Thr identified in family B lies within the C terminus of WDR62, and this region show divergence from the Drosophila ortholog of WDR62 and the human homolog MAPKBP1 (Nicholas et al., 2010). It seems that alanine is not a much conserved residue, as the wild-type amino acid is found only in primates. Therefore, this alteration is of unknown pathogenicity.

However, two mutations p.Q648X and p.Val1314ArgfsX18 detected in the affected individuals of family C and E, respectively create premature stop codons in the C terminal region of WDR62 protein. In absence of NMD, mutation found in family C results in a truncated protein containing first nine WD repeat along with some part of

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 64

Chapter 4 MCPH2

10th WD repeat. This truncated protein is expected to lack rest of the WD repeats along with C terminal region. Similarly, mutation found in family E creates a truncated protein lacking a part of C terminal domain. Cohen-Katsenelson et al. (2011) reported the interaction of WDR62 protein with c-Jun N-terminal kinase 2 (JNK2) and JNK2 activating kinase MKK7 (MAPK7) via a D domain motif located at the C-terminus. Therefore, it is being speculated that loss of C terminus (fully or partially) in truncated proteins may cause severe brain malformations in affected individuals of families C and E.

According to in print data, WDR62 gene bears 8 missense and 16 protein truncating mutations identified throughout WDR62 gene including two missense (p.Ala1078Thr, p.Arg438His) and two protein truncating (p.Q648X, p.Val1314ArgfsX18) mutations found in the current study (Nicholas et al., 2010; Kousar et al., 2011). Indeed, truncating mutations in WDR62 may lead to nonsense mediated decay which results in complete lack of WDR62 at the spindle poles of the dividing neuronal precursor cells. Nicholas et al. (2010) investigated the expression pattern of WDR62 in young and old neurons that has just migrated to the outer layer of cortical plate and found nuclear and spindle pole localization in migrated neurons and dividing cells, respectively. This led to a presumptive assumption that defective WDR62 protein cannot be targeted to spindle poles, which disturbs neurogenic division resulting in primary microcephaly with additional distinctive features.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 65

Chapter 4 MCPH2

a

I:1 I:2 I:3 I:4

II:1 II:2 II:3 II:4

III:1* III:2* III:3* III:4*

IV:I* IV:2* IV:3* IV:4* IV:5* IV:6* IV:7*

b

Figure 4.1 (a): Pedigree of family B showing segregation of MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages. The family members available for blood collection are marked by *. (b): Pictures of affected individuals (i) Lateral facial view of affected individual IV-5, (ii)Top head view of affected male IV-6, (iii) Frontal facial view of affected female IV-1.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 66

Chapter 4 MCPH2

Table 4.1: Biometric data of affected individuals of families linked to WDR62 gene.

Family Individual Age HC Remarks ID ID (years) (cm) (Gender) B IV:1 (FM) 7 40 Moderate to severe mental IV:2 (M) 8 41 retardation, all can recognize

IV:4(FM) 20 43 relatives except IV:1, No history of IV:5 (M) 10 39 seizures, epilepsy and autism I IV:5 ( M) IV:6 (M) 17 43

C IV:1 (M) 6.5 40 Severe mental retardation, Aggressive Behavior, Motor delays, IV:2 (M) 3.5 35 speech problem, No history of epilepsy, abnormal sleeping habits

D V:2 (FM) 8 40 Unable to do self-care, Could not V:3 (FM) 9 40 read and write, No history of V:5 (FM) 4 36 seizures

E IV:3 (M) 2 32 Severe mental retardation, IV:6 (M) 7 38 Developmental delays, Difficulties IV:8 (M) 14 42 in recognizing objects, Aggressive Behavior, poor speech development

HC: Head circumference

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 67

Chapter 4 MCPH2

a I:1 I:2

II:1 II:2 II:3 II:4 II:5 II:6 II:7 II:8 II:9 II:10

III:1 III:2 III:3* III:4* III:5 III:6 III:7

IV:I* IV:2*

b

Figure 4.2 (a): Pedigree of family C showing segregation of MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages. The family members available for blood collection are marked by *. (b): The computerized tomographic (CT) scan of the affected individual from family C. The axial CT scan depicts ill-defined gyral and nuclei pattern in the affected individual (IV-1).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 68

Chapter 4 MCPH2

a I:1 I:2

II:1 II:2 II:3 II:4

III:1 III:2 III:3 III:4

IV:I* IV:2* IV:3 IV:4

V:I* V:2* V:3* V:4 V:5* V:6* V:7 V:8

b

I:1 I:2

II:1 II:2 II:3 II:4

III:1* III:2*

IV:I IV:2* IV:3* IV:4* IV:5* IV:6* IV:7* IV:8* IV:9*

Figure 4.3: Pedigrees of families (a) D and (b) E showing segregation of MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages. The family members available for blood collection are marked by *.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 69

Chapter 4 MCPH2

I:1 I:2 I:3 I:4

II:1 II:2 II:3 II:4

III:1* III:2* III:3* III:4* D19S224 61.85cM 1 2 2 1 2 1 1 1 WDR62 D19S554 65.80cM 1 2 2 1 2 1 1 2 D19S223 66.02cM 1 2 2 1 2 1 1 2 D19S400 66.57cM 1 2 2 1 2 1 1 2 D19S408 69.10cM 1 2 2 1 2 1 1 2 D19S574 70.77cM 1 1 2 1 2 1 1 2

IV:I* IV:2* IV:3* IV:4* IV:5* IV:6* IV:7* D19S224 61.85cM 1 1 1 1 2 1 1 1 1 1 1 1 1 1 WDR62 D19S554 65.80cM 1 1 1 1 2 1 1 1 1 1 1 1 1 2 D19S223 66.02cM 1 1 1 1 2 1 1 1 1 1 1 1 1 2 D19S400 66.57cM 1 1 1 1 2 1 1 1 1 1 1 1 1 2 D19S408 69.10cM 1 1 1 1 1 1 2 1 1 1 1 1 1 2 D19S574 70.77cM 1 1 1 1 1 1 2 1 1 1 1 1 1 2

Figure 4.4: Haplotype of family B shows homozygosity with WDR62 flanking markers on chromosome 19. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 70

Chapter 4 MCPH2

Table 4.2. Two point and multipoint LOD score values between MCPH2 locus and chromosome 19 markers in families B, C, D and E.

Markers cM* bp+ Two point LOD score (at θ=0) Total Total Family Family Family Family Two point Multipoint B C D E LOD Score LOD score (at θ=0) D19S719 55.67 38605668 0 0 0 -Inf -Inf -Inf D19S416 56.28 38760451 0 0 0 2.13 2.13 4.25

D19S245 56.28 38789927 0 0 -1.80 2.13 0.33 4.25

D19S224 61.85 41219844 -Inf 0.90 1.75 0 -Inf -Inf WDR62 D19S220 62.62 43123390 0 0.90 0 2.13 3.03 6.06 D19S422 63.12 43861825 0 1.10 1.88 0 2.98 5.96 D19S554 65.80 45301323 3.11 0 0 0 3.11 3.11 D19S223 66.02 46086644 3.11 0.90 1.75 2.13 7.89 12.67 D19S400 66.57 46219294 3.11 0.90 0 0 4.01 4.91 D19S197 67.72 46824243 0 0.90 -Inf 0 -Inf -Inf D19S408 69.10 48739098 -Inf 0 0 0 -Inf -Inf D19S900 69.41 48859097 0 0 0 -Inf -Inf -Inf D19S574 70.77 49815349 -Inf 0 0 0 -Inf -Inf D19S559 70.77 50022028 0 -Inf 0 0 -Inf -Inf *genetic distance (centi Morgan) and +physical distance (base pairs) are according to the second generation combined linkage physical map of the human genome (Built 36.2) (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 71

Chapter 4 MCPH2

I:1 I:2

II:1 II:2 II:3 II:4 II:5 II:6 II:7 II:8 II:9 II:10

III:1 III:2 III:3* III:4* III:5 III:6 III:7 D19S224 61.85cM 2 1 1 2 WDR62 D19S220 62.62cM 2 1 1 2 D19S422 63.12cM 3 1 1 2 D19S223 66.02cM 2 1 1 2 D19S400 66.57cM 2 1 1 2 D19S197 67.72cM 2 1 1 2 D19S559 70.77cM 2 1 1 3

IV:I* IV:2* D19S224 61.85cM 1 1 1 1 WDR62 D19S220 62.62cM 1 1 1 1 D19S422 63.12cM 1 1 1 1 D19S223 66.02cM 1 1 1 1 D19S400 66.57cM 1 1 1 1 D19S197 67.72cM 1 1 1 1 D19S559 70.77cM 1 1 1 2

Figure 4.5: Haplotype of family C depicts homozygosity with WDR62 flanking markers on chromosome 19. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 72

Chapter 4 MCPH2

I:1 I:2

II:1 II:2 II:3 II:4

III:1 III:2 III:3 III:4

IV:I* IV:2* IV:3 IV:4 D19S245 56.28cM 2 1 1 2 D19S224 61.85cM 2 1 2 1 WDR62 D19S422 63.12cM 2 1 2 1 D19S223 66.02cM 2 1 2 1 D19S197 67.72cM 1 2 2 1

V:I* V:2* V:3* V:4 V:5* V:6* V:7 V:8 D19S245 56.28cM 1 2 1 2 1 2 1 2 1 2 D19S224 61.85cM 2 1 1 1 1 1 1 1 2 1 WDR62 D19S422 63.12cM 2 1 1 1 1 1 1 1 2 1 D19S223 66.02cM 2 1 1 1 1 1 1 1 2 1 D19S197 67.72cM 2 1 2 1 1 1 2 1 1 1

Figure 4.6: Haplotype of family D demonstrate homozygosity with WDR62 flanking markers on chromosome 19. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matiseet al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 73

Chapter 4 MCPH2

I:1 I:2

II:1 II:2 II:3 II:4

III:1* III:2* D19S719 55.67cM 2 1 2 1 D19S416 56.28cM 1 2 2 1 D19S245 56.28cM 1 2 2 1 WDR62 D19S220 62.62cM 1 2 2 1 D19S223 66.02cM 1 2 2 1 D19S900 69.41cM 1 2 2 1

IV:I IV:2* IV:3* IV:4* IV:5* IV:6* IV:7* IV:8* IV:9*

D19S719 55.67cM 1 1 1 1 1 1 1 1 1 1 2 1 2 1 1 1 D19S416 56.28cM 2 1 1 1 2 1 2 1 1 1 2 1 1 1 2 1 D19S245 56.28cM 2 1 1 1 2 1 2 1 1 1 2 1 1 1 2 1 WDR62 D19S220 62.62cM 2 1 1 1 2 1 2 1 1 1 2 1 1 1 2 1 D19S223 66.02cM 2 1 1 1 2 1 2 1 1 1 2 1 1 1 2 1 D19S900 69.41cM 2 1 1 1 2 1 2 1 2 1 2 1 1 2 2 1

Figure 4.7: Haplotype of family E shows homozygosity with WDR62 flanking markers on chromosome 19. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 74

Chapter 4 MCPH2

Figure 4.8: Mutation analysis of the WDR62 gene in family B. Sequence chromatogram of normal individual in upper panel, carrier in middle panel and affected in lower panel showing mutation (c.3232G>A).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 75

Chapter 4 MCPH2

Table 4.3: List of mutations reported in WDR62 gene so far.

S.No. cDNA Protein Location Reference (Exon) Nicholas et al., 2010; 1 193G>A Val65Met 2 Yu et al., 2010 2 363delT Asp112MetfsX5 4 Yu et al., 2010 3 332G>Ca Arg111Th 3 Hussain et al., 2012 4 535_536insA Met179fsX21 5 Bhat et al., 2011 5 671G>C Trp224Ser 6 Bilguvar et al., 2010 6 c.900C>A Cys300X 8 Bhat et al., 2011 7 1043+1G>A Ser348RfsX63 8 Yu et al., 2010 8 1143delAa H381PfsX48 9 Memon et al., 2013 9 1194G>Aa Trp398X 9 Hussain et al., 2012 10 1198G E400K 9 Bacino et al., 2012 11 1313G>Aa Arg438His 10 Nicholas et al., 2010; Hussain et al., 2012; Present study 12 1408C>T Gln470X 11 Bilguvar et al., 2010 13 1531G>Aa Asp511Asn 11 Nicholas et al., 2010; Kousar et al., 2011 14 1576G>T Glu526X 12 Bilguvar et al., 2010 15 1576G>A Glu526Lys 12 ″ 16 1942 C>Ta Gln648X 15 Present study 17 2867+4_c2867 Ser956CysfsX38 Intr. 23 Yu et al., 2010 +7delGGTG 18 3232G>Aa Ala1078Thr 27 Present study 19 3361delGa Ala1121GlnfsX6 28 Hussain et al., 2012 20 3503G>Aa Trp1168X 29 ″ 21 3839_3855delGCCA Gly1280AlafsX21 30 Yu et al., 2010 ; AGAGCCTGCCCTG Bilguvar et al., 2010 22 3936dupC/ Val1314ArgfsX18/ 30 Nicholas et al ., 2010; 3936_3937incCa Val1314GlyfsX17 Yu et al., 2010; Present study 23 4205delTGCC Val1402GlyfsX12 31 Bilguvar et al., 2010 24 4241dupTa Leu1414LeufsX41 31 Nicholas et al., 2010 aThe amino acid change found in Pakistani family

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 76

Chapter 4 MCPH2

Figure 4.9: Graphical representation of WDR62 gene and protein. On left side gene is shown from 5′ to 3′, from bottom to top with exons according to scale and introns are shown as an artificial fixed interval for clarity. The positions of known homozygous mutations are also shown (in Pakistani families with red color). On right side, WDR62 protein is shown with positions of known mutations identified in Pakistani families.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 77

Chapter 4 MCPH2

Figure 4.10: Mutation analysis of the WDR62 gene in family C. Sequence chromatogram of normal individual in upper panel, carrier in middle panel and affected in lower panel showing mutation (c.1942C>T).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 78

Chapter 4 MCPH2

Figure 4.11: Mutation analysis of the WDR62 gene in family D. Sequence chromatogram of normal individual in upper panel and affected in lower panel depicts a known mutation (c.1313G>A).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 79

Chapter 4 MCPH2

Figure 4.12: Mutation analysis of the WDR62 gene in family E. Sequence chromatogram of normal individual in upper panel, carrier in middle panel and affected in lower panel showing mutation (c.3936_3937insC).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 80

Chapter5 MCPH5

Autosomal recessive primary microcephaly 5

Fifth MCPH locus (MCPH5) was simultaneously mapped on chromosome 1q31 in families of Pakistani (Pattison et al., 2000) and Turkish origin (Jamieson et al., 2000). Later, Bond et al. (2002) identified Abnormal Spindle-like Microcephaly-associated (ASPM) gene in the linkage interval of MCPH5 in northern Pakistani families. The coding sequence of ASPM gene is 10434 bp long that can be alternatively spliced into two isoforms. The full length mRNA encodes 3477 amino acid protein while alternatively spliced mRNA lack exon 18 and encodes a 1,892 amino acid protein. ASPM protein localizes to the centrosome in the interphase and to mitotic spindle poles, from prophase through telophase in the neural progenitor cells of embryonic human neocortex (Fish et al., 2006).

ASPM is the principal MCPH gene, responsible for causing reduced brain volume in >50% cases irrespective of specific ethnic background (Mahmood et al., 2009). The ASPM mutations have been reported from various populations across the world including Caucasian, Pakistani, Arab, Indian, Turkish, Yemeni, Algeria, African, Dutch, Germans and Europe etc. Interestingly 44 mutations (53%) have been found in MCPH5 linked Pakistani families. These include 20 nonsense mutations causing immediate stop codon, 21 small deletions or insertions leading to change in reading frame, and 3 splice site mutations resulting in premature stop codon. Most often mutations in ASPM gene are found in homozygous state while rarely compound heterozygous condition has also been identified (Muhammad et al., 2009; Saadi et al., 2009; Passemard et al., 2009).

In the present chapter six unrelated consanguineous Pakistani families (F-K), segregating autosomal recessive primary microcephaly are presented. Homozygosity mapping revealed the linkage of these families at MCPH5 locus. Sequence analysis of ASPM gene identified three novel and two recurrent mutations.

5.1- Clinical Description

The clinical detail of the affected individuals of the families (F-K) linked at ASPM gene is explained below.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 81

Chapter5 MCPH5

5.1.1- Family F Family F resides in Sind province of Pakistan. The family members follow their strict social custom and traditionally marry within their own community resulting in high rate of consanguineous marriages. The pedigree drawing (Figure 5.1a) indicates six generations with three affected males (IV-1, IV-2, V-4) and two affected females (VI-1, VI-2). The pedigree analysis shows that affected individuals were produced by the unaffected parents and the affected status was independent of the sex suggesting that the MCPH is transmitted in autosomal recessive manner. Microcephaly is congenital in all affected individuals. Detailed interviews and careful evaluations of affected individuals indicate the presence of mild to moderate mental retardation without additional associated neurological abnormalities. Other relevant clinical data is presented in table 5.1. Blood samples were collected from nine family members including available four affected (IV-2, V-4, VI-1, VI-2) and five normal individuals (III-3, IV-3, V-1, V-2, V-3) for further analysis. 5.1.2-Family G

This family also belongs to a remote village in Sind province of Pakistan. The pedigree was constructed after careful investigations with the family elders. The four-generation pedigree (Figure 5.1b) shows 15 individuals including three affected members in a single loop. Analysis of pedigree is strongly suggestive of autosomal recessive mode of inheritance.

Microcephaly is congenital and was evident at birth of each affected individual. Affected individual are moderately mentally retarded, with no associated abnormality. Average head circumferences of affected individuals are in the range of 36 to 40 cm. Additional features are recorded in table 5.1. Six normal (III-1, III-2, IV-1, IV-2, IV-5, IV-6) and three affected individuals including one male (IV-4) and two females (IV-3, IV-7) were available for blood sampling.

5.1.3- Family H

Family H belongs to Khyber Pakhtunkhwa Province and comprises five affected individuals in four loops (Figure 5.2a). The clinical analysis of the affected individuals clearly represents segregation of congenital autosomal recessive microcephaly. History

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 82

Chapter5 MCPH5 taken from elders of the family indicates that microcephaly was present by birth in the affected individuals and no environmental causes of small head circumference could be ascertained. The affected individuals bear no dysmorphic features and distinct growth disorder. But an inconsistent small head with prominent slopping forehead was observed (Figure 5.2b) in all affected individuals. Ages of the affected individuals varied between 5 and 12 years at the time of study. Head circumference and other related features have been recorded in table 5.1. Blood samples were collected from three affected (V-1, V-6, V-8) and seven normal (IV-5, IV-6, IV-7, IV-10, V-3, V-5, V-7) individuals.

5.1.4- Family I

This family was ascertained from Punjab province of Pakistan. It is four generation family (Figure 5.3a) which shows autosomal recessive mode of transmission of MCPH. This family comprised of four affected individuals including a female (IV-2) and three males (III-3, IV-1, IV-4). Compilation of available clinical information suggests that MCPH was congenital in each affected individual and was not associated to environmental causes. The facial features of the affected individuals are normal except an indistinct slopping forehead (Figure 5.3b). Average head circumferences of affected and normal individuals are 36 cm and 52 cm, respectively. Other clinical information collected at the time of study was recorded in table 5.1. Blood samples were collected from seven individuals including three affected (III-3, IV-1, IV-2) and two normal members (IV-3, IV-5) available at the time of visit.

5.1.5-Family J

Family J (Figure 5.4 a) was recruited from Khyber Pakhtunkhwa Province, Pakistan. This family has five affected individuals in two loops including three males (IV-1, IV-2, IV-3) and two females (IV-6, IV-7). All affected individuals have reduced head circumference at birth. Parents of the affected individuals were phenotypically normal and have no signs of MCPH. Ages of the affected individuals varied between 8 and 22 years at the time of study. Additional clinical information of affected individuals is recorded in table 5.1. Collection of blood samples was carried out from four affected (IV-1, IV-2, IV-3, IV-7) and six normal (III-1, III-2, III-4, III-5, IV-5, IV-8) individuals.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 83

Chapter5 MCPH5

5.1.6- Family K

This large kindred with primary microcephaly is located in Bannu district of Khyber Pakhtunkhaw. The family members traditionally marry within their own community. The family pedigree (Figure 5.4b) consists of five generations with seven affected individuals including four males (V-2, V-5, V-13, V-14) and three females (V-3, V-8, V-9). Affected individuals were produced by normal parents thus suggests autosomal recessive inheritance of MCPH. The pedigree analysis shows that the parents IV-1 and IV-2, IV-4 and IV-5, IV-6 and IV-7 are phenotypically normal but resulted in two (V-2, V-3), three (V-5, V-8, V-9), and two (V-13, V-14) affected children respectively. Mental retardation is mild to moderate in affected individuals without any other associated abnormality. Other relevant clinical data of affected individuals is presented in 5.1. The facial features of the affected individuals are normal except an inconsistent slopping forehead (Figure 5.4 c). Blood collection was carried out from parents (IV-1 and IV-2, IV-4 and IV-5, IV- 6 and IV-7) and their affected (V-2, V-3, V-5, V-8, V-9, V-13, V-14) and normal off- springs (V-1, V-4, V-6, V-7, V-10, V-11, V-12, V-15).

5.2- Linkage analysis

Because of high prevalence of ASPM mutations in different world populations including Pakistan, these families (F-K) were initially checked for linkage to ASPM gene. Initially, polymorphic microsatellite markers D1S518 (194.95), D1S2823 (197.1cM), D1S2625 (197.51cM), D1S533 (199.81cM), D1S1183; GATA135F02 (200.75cM), D1S2816 (200.91cM), D1S2840 (201.85cM), D1S1660 (202.04cM), D1S1726 (202.61cM), D1S306 (205.58cM), D1S2686 (207.9cM) were genotyped in all available affected and normal individuals of each family.

In family F (Figure 5.5) four available affected individuals (IV-2, V-4, VI-1, VI-2) were found homozygous for three microsatellite markers D1S1183, D1S2816 and D1S1660 while five normal individuals (III-3, IV-3, V-1, V-2, V-3) showed heterozygous allele pattern. The identified 10.8 cM HBD region shared by four affected individuals and delineated by markers D1S2823 and D1S2686 overlaps with MCPH5 locus.

All affected individuals (IV-3, IV-4, IV-7) of the family G (Figure 5.6) were found homozygous at markers D1S2816, D1S1660, D1S306 while unaffected individuals of the

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 84

Chapter5 MCPH5 family were heterozygous at these markers. The shared HBD region of 8.09 cM in this family overlaps with MCPH5 linkage interval harboring ASPM gene.

In family H, all available individuals (IV-5, IV-6, IV-7, IV-10, V-1, V-3, V-5, V-6, V-7, V-8) were genotyped with markers D1S2625, D1S533, GATA135F02, D1S2840, D1S2686. Available affected members (V-1, V-6, V-8) showed homozygous alleles for markers D1S533, GATA135F02, D1S2840 (Figure 5.7). None of the affected individual have heterozygous allele pattern within shared critical HBD region of 10.39 cM. This linkage interval also overlaps with the MCPH5 locus.

In family I, HBD region delineated by markers D1S518 and D1S2686 was identified by analyzing genotypes of all available individuals with markers D1S518, D1S2625, GATA135F02, D1S1660 and D1S2686. Both available affected males and one female were found homozygous for markers D1S2625, GATA135F02 and D1S1660 while normal members were found heterozygous at these markers (Figure 5.8). The linkage interval of published MCPH5 locus encompasses the identified HBD region of 12.95 cM in this family. Available affected members of family J (Figure 5.9) were found homozygous for markers D1S2823, D1S2816, D1S1723 while normal members showed heterozygous pattern for different parental alleles. Analysis of haplotype revealed minimal critical region delineated by markers D1S518 and D1S2655, which defines a 12.82cM HBD region shared by all affected individuals of this family. This identified minimum critical interval overlaps with MCPH5 locus and contains ASPM gene.

In large consanguineous family (K) all affected members (four males and three females) were found homozygous for markers D1S2625, D1S1183, D1S1660, and D1S1726 (Figure 5.10). Normal individuals showed heterozygous allele pattern for the same markers. Analysis of haplotype indicates the segregation of a 10.53 cM HBD region delineated by markers D1S518 and D1S1678. This identified homozygosity region also overlaps with linkage interval of MCPH5 locus.

5.3- Sequencing ASPM gene

After establishing linkage of families F-K to MCPH5 locus harboring ASPM gene, initially two affected and one carrier individual were selected from each family for DNA sequencing. All coding exons (28) and splice junction sites of ASPM gene were

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 85

Chapter5 MCPH5 sequenced by using 38 sets of primer pairs given in table 2.3. Subsequent analysis of sequencing results led to the identification of pathogenic sequence variant in each family. Two of these identified mutations affect microtubule binding domain while three truncate ASPM protein at IQ repeat domain (Figure 5.11).

In family F, DNA sequence analysis revealed a novel homozygous 4 bp deletion at nucleotide position 6686 (c. 6686-6689delGAAA) (Figure 5.12) in exon 18 leading to frame shift and premature stop codon (p.R2229TfsX9) 26 bp downstream in the same exon. This tetra- nucleotide deletion identified in isoleucine glutamine repeat was present in the heterozygous state in obligate carriers.

Another novel mutation involving a single base pair deletion at nucleotide position 77 (c. 77delG) (Figure 5.13) was identified in exon 1 in family G. This alteration shifted the reading frame and introduced a premature termination codon 122 bp (p.G26AfsX41) downstream within microtubule binding domain. This mutation was present in homozygous state in affected individuals while in the heterozygous state in obligate carriers.

Sequence analysis of exon 21 in affected members of family H identified 1bp deletion at nucleotide position 9159 (c.9159delA) (Figure 5.14) resulting in frame shift leading to premature termination, 4 codons downstream within IQ repeat. This deletion segregated with the MCPH phenotype in family H.

In family I sequence analysis of exon 3 revealed a 7bp deletion (c.1260- 1266delTCAAGTC) at nucleotide position 1260 (Figure 5.15) producing frame shift and premature termination codon 93 bp downstream (p.Ser420fsX31) in the same exon. The genetic change was present in a heterozygous state in the obligate heterozygous carriers of the family. This deletion truncates ASPM protein within microtubule binding domain.

In family J and K, DNA sequence analysis revealed a G to A transition at nucleotide position 3978 (c. 3978G>A) (Figure 5.16 and Figure 5.17) in exon 17 of the gene, producing immediate premature stop codon (W1326X) within IQ repeat motif (Table 5.2).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 86

Chapter5 MCPH5

The mutations identified in the present study are in homozygous state and none of the mutation is in compound heterozygous state. Known homozygous and compound heterozygous mutations in ASPM gene are listed in table 5.3 and 5.4 respectively. To ensure that these five mutations does not represent a neutral polymorphism in Pakistani population, a panel of 50 unrelated ethnically matched control individuals were screened but none of identified mutation was detected outside the studied families.

5.4- Amplified fragment length polymorphism (AFLP) analysis

Selected members in families J (III-1, III-2, IV-5) and K (IV-1, IV-2, V-2) were analyzed for amplified fragment length polymorphism (AFLP) analysis using three markers (D1S2823, D1S2816, D1S1723) with modified forward primers carrying additional sequence of 16 nucleotides at 5 tail. The number of alleles obtained for these markers and their respective sizes in both families were consistent with a previous study (Valeed, 2010). The analysis revealed three allele each for marker D1S2823 and D1S2816 of size 94 bp, 96bp, 100bp and 207bp, 211bp, 213bp respectively while only two alleles for marker D1S1723 of size 175bp, 177bp. The detail of these has been summarized in table 5.5. Haplotype constructed from AFLP results indicated that 96, 207 and 175 is the disease associated haplotype for markers D1S2823, D1S2816 and D1S1723 respectively which is shared by affected members of both families (J and K). This clearly indicates the presence of c. 3978G>A mutation on ancestral haplotype defined by 96, 207 and 175 alleles of markers D1S2823, D1S2816 and D1S1723, respectively.

5.5- Discussion

Mutations in ASPM gene at MCPH5 locus is most prevalent cause of MCPH in human across the world including Pakistan. Therefore, geneticists indorse to sequence ASPM gene while studying molecular genetics of MCPH cases.

The present investigation described six consanguineous families located and ascertained from remote areas in Sind, Punjab and Khyber Pakhtunkhaw provinces of Pakistan. Clinical and pedigree analysis of these families indicated that microcephaly was present by birth in the affected individuals and was accompanied by typical sloping forehead and mild to moderate mental retardation. Degree of mental retardation even varies among affected members of the same family. Seizures and epilepsy was not reported in the

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 87

Chapter5 MCPH5 affected individuals. However speech problem and sleep disturbance was found in few subjects of these families.

Families F-K with multiple affected individuals showed linkage to ASPM on chromosome 1q31. Subsequently, sequence analysis of the gene detected two novel deletions (c. 6686-6689delGAAA, c.77delG) in families F and G respectively while two reported deletions (c.9159delA, c.1260-1266delTCAAGTC) have been identified in families H and I respectively. In the present study a homozygous non sense mutation (c. 3978G>A/ p. W1326X) reported earlier in two Indian families (Kumar et al., 2004) have been detected in two families, J and K. This mutation in homozygous as well as in heterozygous state has been detected in twenty four other Pakistani families (Gul et al., 2006, 2007; Muhammad et al., 2009; Kousar et al., 2009; Hussain et al., 2012). All these families were sampled from North West Frontier province (NWFP) which is now renamed as Khyber Pakhtunkhwa (KPK). On examining the haplotypes of these families bearing W1326X, it was observed that this mutation appeared on a very similar background, suggesting that G>A substitution at nucleotide 3978 in these twenty four families was due to the same mutation event. This proposes a founder mutation having common ancestors in Pakistan.

To verify this assumption AFLP analysis was performed to find allele sizes by genotyping three markers (D1S2823, D1S2816, D1S1723) flanking ASPM gene on selected individuals of both families. The haplotype analysis based on AFLP results depicted a common diseased haplotype. Similar results have been found in another study on three MCPH5 linked families originated from Khyber Pakhtunkhaw province (Valeed, 2010), pointing a common ancestor in Pakistani population.

Mutant ASPM is a major contributor of MCPH in Pakistani population. To date, 83 distinct mutations have been identified in ASPM gene including 5 sequence variants identified in the current study. These involve a single base pair deletion mutation (p.G26AfsX41) in exon 1 and 7-bp deletion mutation (p.Ser420fsX31) in exon 3. Both mutations truncated the ASPM within putative microtubule binding domain, while a nonsense mutation (W1326X) in exon 17 truncated the ASPM within second IQ repeat motif. Two other deletion mutations including a novel 4-bp deletion (p.R2229TfsX9) in

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 88

Chapter5 MCPH5 exon 18 and a single bp deletion (p.Lys3053fs) in exon 21 resulted in truncated ASPM protein lacking 41 IQ and 6 IQ domains, respectively along with carboxy terminal region. The proteins having IQ motifs are often regulated by calmodulin (Willingham et al., 1983) thus loss of IQ domains in truncated ASPM proteins presumably effect their regulation leading to abnormal functioning. Furthermore possibility of truncated ASPM mRNA degradation via nonsense mediated decay (NMD) pathway and instability of the truncated ASPM protein could not be neglected which result in complete loss of ASPM protein.

In a recent study, Passermard et al. (2009) performed clinical and neurological evaluations of several MCPH patients with compound heterozygous ASPM mutations. The authors reported that MCPH affected Francian guy bearing c.77delG/ p.G26AfsX41 mutation showed hyperactivity with aggressive behavior, delayed motor development and borderline intelligence. His MRI scan depicted regular brain architecture with normal gyral pattern as in most of the MCPH cases. While an Algerian patient having c. 66868_89delGAAA/ p.R2229TfsX9 mutation had severe mental retardation with noticeable sleep disturbance. MRI scan of patient’s brain exposed partial agenesis of the corpus callosum, focal parietal cortical dysplasia and enlarged horns of lateral ventricles. In the later case presence of severe brain anomalies indicates that ASPM might be involved in neuron migration as well as in cortical layering.

Of the five mutations identified in the present study, four result in frame shift leading to premature stop codon while one introduce an immediate stop codon in ASPM gene. These might result in complete lack or abnormal production of ASPM protein. ASPM is a spindle pole protein and identified mutations might cause early switch from symmetric to asymmetric division, resulting in depletion of neural progenitor pool.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 89

Chapter5 MCPH5

a I:1 I:2

II:1 II:2 II:3 II:4 II:5 II:6

III:1 III:2 III:3* III:4 III:5

IV:1 IV:2* IV:3* IV:4 IV:5 IV:6 IV:7

V:1* V:2* V:3* V:4* V:5

VI:1* VI:2*

b

I:1 I:2

II:1 II:2 II:3 II:4

III:1* III:2*

IV:I* IV:2* IV:3* IV:4* IV:5* IV:6* IV:7*

Figure 5.1: Pedigrees of families (a) F, (b) G showing autosomal recessive MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 90

Chapter5 MCPH5

Table 5.1: Clinical and biometric data of Families F-K linked at ASPM gene.

Family Origin Affected Age HC Remarks ID individual (years ) (cm) ID at the time (Gender) of study F Sind IV-2 (M) 23 43 Mild to moderate MR, No V-4 (M) 20 44 seizures, Unable to speak , VI-1 (FM) 4 37 read and write VI-2 (FM) 6 37 G Sind IV-3 (FM) 19 40 Moderate MR, No IV-4 (M) 16 39 epilepsy IV-7 (FM) 10 36

H Khyber V-3 (M) 5 40 Mild to moderate MR, Pakhtun- V-6 (M) 9 NA Speech un-understandable, khwa V-8 (FM) 12 44 No fits

I Punjab III-3 (M) 33 43 Moderate MR, Aggressive IV-1 (M) 22 36 behavior, No self care IV-2 (FM) 20 41 skills

J Khyber IV-1 (M) 22 43 Moderate MR, Partly self Pakhtun- IV-2 (M) 10 38 care skills, sleep khwa IV-3 (M) 8 36 disturbance IV-6 (FM) 18 41 K Bannu V-2 (M) NA NA Mild to Moderate (Khyber V-3 (FM) 13 38 MR, speaking problem, Pakhtun- V-5 (M) 20 39 some time self injurious khwa) V-8 (FM) 8 NA behaviour V-9 (FM) 15 NA V-13 (M) 12 40 V-14 (M) 27 37.5 HC: Head Circumference MR: Mental retardation M: Male FM: Female

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 91

Chapter5 MCPH5

a I:1 I:2 I:3 I:4

II:1 II:2 II:3 II:4 II:5 II:6 II:7

III:1* III:2 III:3 III:4 III:5 III:6 III:7

IV:I IV:2 IV:3 IV:4 IV:5* IV:6* IV:7* IV:8 IV:9 IV:10*

V:2 V:3* V:4 V:5* V:6* V:7* V:8* V:I*

b

Figure 5.2: (a) Pedigree of family H showing autosomal recessive MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages. (b) Picture of affected individual (V-8) showing reduced head circumference.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 92

Chapter5 MCPH5

I:1 I:2

II:1 II:2 II:3 II:4

III:1* III:2* III:3*

IV:I* IV:2* IV:3* IV:4 IV:5* IV:6 IV:7

Figure 5.3: (a) Pedigree of family I showing autosomal recessive MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages. (b) Pictures of Affected individuals (III-3) and (IV-1) presenting characteristic sloping forehead.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 93

Chapter5 MCPH5

a

I:1 I:2 I:3 I:4

II:1 II:2 II:3 II:4 II:5 II:6 II:7 II:8

III:1* III:2* III:3 III:4* III:5*

IV:I* IV:2* IV:3* IV:4 IV:5* IV:6 IV:7* IV:8* IV:9 IV:10

b I:1 I:2

II:1 II:2 II:3 II:4

III:1 III:2 III:3 III:4

VI:1* VI:2* VI:3 VI:4* VI:5* VI:6* VI:7* VI:8

V:1* V:2* V:3* V:4* V:5* V:6* V:7* V:8* V:9* V:10* V:11* V:12* V:13* V:14* V:15*

c

Figure 5.4: Pedigrees of families (a) J and (b) K showing autosomal recessive MCPH. Clear and filled symbols represent normal and affected individuals respectively. Crossed lines over the symbol mark the deceased individuals. Double line between individuals represents consanguineous marriages. (c) Affected individuals (V-3) and (V-13) did not show any dysmorphic facial features except reduced head circumference with sloping forehead.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 94

Chapter5 MCPH5

I:1 I:2

II:1 II:2 II:3 II:4 II:5 II:6

III:1 III:2 III:3* III:4 III:5 D1S2823 197.1cM 1 2 D1S1183 200.75cM 1 2 ASPM D1S2816 200.91cM 1 2 D1S1660 202.04cM 1 2 D1S2686 207.9cM 1 2

IV:1 IV:2* IV:3* IV:4 IV:5 IV:6 IV:7 D1S2823 197.1cM 1 2 1 2 D1S1183 200.75cM 1 1 1 2 ASPM D1S2816 200.91cM 1 1 1 2 D1S1660 202.04cM 1 1 1 2 1 1 1 2 D1S2686 207.9cM

V:1* V:2* V:3* V:4* V:5 D1S2823 197.1cM 1 2 1 2 1 1 1 2 D1S1183 200.75cM 1 2 1 2 1 2 1 1 ASPM D1S2816 200.91cM 1 2 1 2 1 2 1 1 D1S1660 202.04cM 1 2 1 2 1 2 1 1 D1S2686 207.9cM 1 2 1 2 1 2 1 1

VI:1* VI:2* D1S2823 197.1cM 1 2 1 2 D1S1183 200.75cM 1 1 1 1 ASPM D1S2816 200.91cM 1 1 1 1 D1S1660 202.04cM 1 1 1 1 1 1 21 D1S2686 207.9cM

Figure 5.5: Haplotype of family F shows homozygosity with ASPM flanking markers on chromosome 1. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centi Morgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 95

Chapter5 MCPH5

I:1 I:2

II:1 II:2 II:3 II:4

III:1* III:2*

D1S533 199.81cM 12 12 D1S2816 200.91cM 12 12 ASPM D1S1660 202.04cM 12 12 D1S306 205.58cM 12 12 D1S2686 207.9cM 12 12

IV:I* IV:2* IV:3* IV:4* IV:5* IV:6* IV:7*

D1S533 199.81cM 12 12 12 12 12 12 12 D1S2816 200.91cM 12 12 11 11 12 12 11 ASPM D1S1660 202.04cM 12 12 11 11 12 12 11 D1S306 205.58cM 12 12 11 11 12 12 11 D1S2686 207.9cM 12 11 21 11 12 11 21

Figure 5.6: Haplotype of family G shows homozygosity with ASPM flanking markers on chromosome 1. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centi Morgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 96

Chapter5 MCPH5

I:1 I:2 I:3 I:4

II:1 II:2 II:3 II:4 II:5 II:6 II:7

III:1* III:2 III:3 III:4 III:5 III:6 III:7

D1S2625 197.51cM 12 D1S533 199.81cM 12 GATA135F02 200.75cM 1 2 ASPM D1S2840 201.85cM 12 D1S2686 207.9cM 12

IV:I IV:2 IV:3 IV:4 IV:5* IV:6* IV:7* IV:8 IV:9 IV:10*

D1S2625 197.51cM 12 12 12 12 D1S533 199.81cM 12 12 12 12 GATA135F02 200.75cM 12 12 12 12 ASPM D1S2840 201.85cM 12 12 12 12 D1S2686 207.9cM 12 12 12 12

V:I* V:2 V:3* V:4 V:5* V:6* V:7* V:8* D1S2625 197.51cM 11 12 12 12 12 12 D1S533 199.81cM 11 12 12 11 12 11 GATA135F02 200.75cM 11 12 12 11 12 11 ASPM D1S2840 201.85cM 11 12 12 11 12 11 D1S2686 207.9cM 12 11 12 11 12 11

Figure 5.7: Haplotype of family H shows homozygosity with ASPM flanking markers on chromosome 1. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 97

Chapter5 MCPH5

I:1 I:2

II:1 II:2 II:3 II:4

III:1* III:2* III:3* D1S518 194.95cM 12 12 12 D1S2625 197.51cM 12 12 11 GATA135F02 200.75 cM 12 12 11 ASPM D1S1660 202.04cM 12 12 11 D1S2686 207.9 cM 12 12 11

IV:I* IV:2* IV:3* IV:4 IV:5* IV:6 IV:7

D1S518 194.95cM 12 11 12 12 D1S2625 197.51cM 11 11 12 12 GATA135F02 200.75 cM 1 1 11 12 12 ASPM D1S1660 202.04cM 11 11 12 12 D1S2686 207.9 cM 11 12 12 11

Figure 5.8: Haplotype of family I shows homozygosity with ASPM flanking markers on chromosome 1. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 98

Chapter5 MCPH5

I:1 I:2 I:3 I:4

II:1 II:2 II:3 II:4 II:5 II:6 II:7 II:8

III:1* III:2* III:3 III:4* III:5* D1S518 194.95cM 12 12 12 12 D1S2823 197.1 cM 12 12 12 12 D1S2816 200.91 cM 12 12 12 12 ASPM D1S1723 205.58cM 12 12 12 12 D1S2655 207.77cM 12 12 12 12

IV:I* IV:2* IV:3* IV:4 IV:5* IV:6 IV:7* IV:8* IV:9 IV:10 D1S518 194.95cM 11 11 11 12 12 12 D1S2823 197.1 cM 11 11 11 12 11 12 D1S2816 200.91 cM 11 11 11 12 11 12 ASPM D1S1723 205.58cM 11 11 11 12 11 12 D1S2655 207.77cM 12 11 11 12 11 12

Figure 5.9: Haplotype of family J shows homozygosity with ASPM flanking markers on chromosome 1. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 99

Chapter5 MCPH5

I:1 I:2

II:1 II:2 II:3 II:4

III:1 III:2 III:3 III:4

IV:1* IV:2* IV:3 IV:4* IV:5* IV:6* IV:7* IV:8 D1S518 199.4 cM 1 2 1 2 1 2 1 2 1 1 1 2 D1S2625 197.51 cM 1 2 1 2 1 2 1 2 1 2 1 2 D1S1183 200.75 cM 1 2 1 2 1 2 1 2 1 2 1 2 ASPM D1S1660 202.04 cM 1 2 1 2 1 2 1 2 1 2 1 2 D1S1726 202.61 cM 1 2 1 2 1 2 1 2 1 2 1 2 D1S1678 209.93 cM 1 2 1 2 1 2 1 2 1 2 1 2

V:1* V:2* V:3* V:4* V:5* V:6* V:7* V:8* V:9* V:10* V:11* V:12* V:13* V:14* V:15* D1S518 199.4 cM 1 1 1 2 1 1 1 1 1 2 1 1 1 2 1 2 1 1 1 2 1 2 1 1 1 2 1 1 1 1 D1S2625 197.51 cM 1 2 1 1 1 1 1 2 1 1 1 2 1 2 1 1 1 1 1 2 1 2 1 2 1 1 1 1 1 2 D1S1183 200.75 cM 1 2 1 1 1 1 1 2 1 1 1 2 1 2 1 1 1 1 1 2 1 2 1 2 1 1 1 1 1 2 ASPM D1S1660 202.04 cM 1 2 1 1 1 1 1 2 1 1 1 2 1 2 1 1 1 1 1 2 1 2 1 2 1 1 1 1 1 2 D1S1726 202.61 cM 1 2 1 1 1 1 1 2 1 1 1 2 1 2 1 1 1 1 1 2 1 2 1 2 1 1 1 1 1 2 D1S1678 209.93 cM 1 2 1 1 1 2 1 1 1 1 1 2 1 2 1 2 1 2 1 2 1 1 1 2 1 2 1 2 1 2

Figure 5.10: Haplotype of family K shows homozygosity with ASPM flanking markers on chromosome 1. For each genotyped individual (marked by *), haplotypes of microsatellite markers are shown below the symbol. The genetic positions (centiMorgan; cM) are according to Rutgers combined linkage physical map build 36.2 (Matise et al., 2007).

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 100

Chapter5 MCPH5

Figure 5.11: (a) ASPM gene; The structure of the ASPM gene with 28 exons indicating position of mutations identified in the current study. (b) ASPM protein; Showing Microtubule binding domain (MBD), two calponin homolgy domains (CH), isolucine glutamine domain (IQ) and carboxy terminal domain with position of mutations.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 101

Chapter5 MCPH5

Figure 5.12: Mutation analysis of ASPM gene in Family F. Sequence chromatogram of normal individual in upper panel, carrier in middle panel and affected in lower panel shows presence of deletion mutation (c.6686-6689delGAAA) detected in affected individuals of family F.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 102

Chapter5 MCPH5

Figure 5.13: Mutation analysis of ASPM gene in Family G. Sequence chromatogram of normal individual in upper panel, carrier in middle panel and affected in lower panel shows presence of deletion mutation (c.77delG) detected in affected individuals of family G.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 103

Chapter5 MCPH5

Figure 5.14: Mutation analysis of ASPM gene in Family H. Sequence chromatogram of normal individual in upper panel and affected in lower panel shows presence of deletion mutation (c.9159delA) detected in affected individuals of family H.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 104

Chapter5 MCPH5

Figure 5.15: Mutation analysis of the ASPM gene in Family I. Sequence chromatogram of normal individual in upper panel and affected in lower panel shows presence of deletion mutation (c.1260-1266delTCAAGTC) detected in affected individuals of family I.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 105

Chapter5 MCPH5

Figure 5.16: Mutation analysis of ASPM gene in Family J. Sequence chromatogram of normal individual in upper panel, carrier in middle panel and affected in lower panel shows nonsense mutation (c.3978G>A) detected in affected individuals of family J.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 106

Chapter5 MCPH5

Figure 5.17: Mutation analysis of ASPM gene in Family K. Sequence chromatogram of normal individual in upper panel, carrier in middle panel and affected in lower panel shows nonsense mutation (c.3978G>A) detected in affected individuals of family K.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 107

Chapter5 MCPH5

Table 5.2- List of Pakistani families segregating nonsense mutation (c.3978G>A/ p. Try1326X) in exon 17 of ASPM gene.

S. Family ID No. of State of No. of Reference No. affected mutation families offsprings 1 MCP19 4 Homozygous 4 Gul et al., 2006 2 MCP20 2 3 MCP21 6 4 MCP22 8

5 MCP37 7 Homozygous 1 Gul et al., 2007

6 MCP51 4 Homozygous 9 Kousar et al., 2009/ 7 MCP54 3 Present study 8 MCP55 1 9 MCP58 3 10 MCP60 2 11 MCP61 5 12 MCP74 NA 13 MCP76 4 14 J 5

15 K 7 Homozygous 1 Present study

16 MCP48 4 Homozygous 8 Hussain et al., 2012 17 MCP51 4 18 MCP52 2 19 MCP56 4 20 MCP57 2 21 MCP64 5 22 MCP65 3 23 MCP92 4

24 MCP31 6 Compound 3 Muhammad et al., 2009 heterozygous 25 MCP32 4 Homozygous 26 MCP34 4

The families (1-26) were ascertained from KPK province of Pakistan.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 108

Chapter5 MCPH5

Table 5.3: List of Homozygous mutations in ASPM gene reported so far.

S. Nucleotide change Amino acid change Ethnic group Reference No. 1 c.74delG p.Arg25fs Caucasian Nicholas et al.,2009 2 c. 77delG p.G26AfsX41 Pakistani Present study 3 c.297+1460_3391242d Loss of microtubular Caucasian Nicholas et al.,2009 el21844 binding domain 4 c.349C>T p.Arg117X Caucasian Bond et al., 2003 Indian 5 c.440delA p.Lys147fs Caucasian Nicholas et al.,2009 6 c.577C>T p.Gln193X Caucasian ″ 7 c.719_720delCT p.Ser240fs Pakistan Bond et al., 2002 8 c.1152_1153delAG p.Ser384fs Caucasian Nicholas et al.,2009 9 c.1179delT p.Pro393fs Caucasian ″ 10 c.1258_1264delTCTC p.Ser420fs Pakistani Bond et al., 2002 AAG 11 c.1260_1266delTCAA p.Ser420fs Pakistani Gul et al., 2006 GTC Present study 12 c.1366G>T p.Glu456X Turkish Nicholas et al.,2009 13 c.1406_1413delATCC p.Asn469fs Caucasian ″ TAAA 14 c.1590delA p.Lys530fs Caucasian ″ 15 c.1727_1728delAG p.Lys576fs Yemeni Bond et al., 2003 16 c.1959_1961delCAAA p.Asn653fs Caucasian, ″ Saudi Arabian 17 c.1990C>T p.Gln664X Pakistani Bond et al., 2003 18 c.2101C>T p.Glu701X Pakistani Kousar et al., 2009 19 c.2761-25A>G Creates ‘‘AG’’ motif Caucasian Nicholas et al.,2009 between branch site and splice acceptor site, exon 10 skipped, exon 11 frame shift with 30 novel aa then stop 20 c.2936+5G>T Removes splice donor site, Pakistani Bond et al., 2003 additional 2 aa then stop 21 c.2938C>T p.R980X Pakistani Muhammad et al., 2009

22 c.2967G>A p.Trp989X Caucasian Nicholas et al.,2009 23 c.3055C>T p.Arg1019X Caucasian ″ 24 c.3082G>A Removes splice donor site, Pakistani Bond et al., 2003 additional 3 aa then stop 25 c.3188T>G p.Leu1063X Pakistani Nicholas et al.,2009 26 c.3477_3481delCGCT p.A1160fs Pakistani Muhammad et al., 2009 A 27 c.3527C>G p.Ser1176X Jordian Bond et al., 2003 28 c.3663delG p.Arg1221fs Pakistani ″ 29 c.3710C>G p.Ser1237X Caucasian Nicholas et al.,2009 30 c.3741+1G.A Removes splice donor site, Caucasian ″ additional 9 novel aa then stop 31 c.3796G>T p.Glu1266X African ″ 32 c.3811C>T p.Arg1271X Dutch, Asian Bond et al., 2003 33 c.3978G>A p.Trp1326X Pakistani, Kumar et al., 2004 Indian Present study

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 109

Chapter5 MCPH5

34 c.4581delA p.Gly1527fs Pakistani Bond et al., 2003 35 c.4795C>T p.Arg1599X Pakistani ″ 36 c.4855_4856delTA p.Tyr1619fs Pakistani Nicholas et al.,2009 37 c.5136C>A p.Tyr1712X Pakistani Gul et al.,2007 38 c.5149delA p.Ile1717fs Pakistani ″ 39 c.6189T>G p.Tyr2063X Yemeni Shen et al., 2005 40 c. 6651_6654delAACA p.Thr2218TyrfsX8X France Passemard et al., 2009 41 c.6335_6336delAT p.His2112fs Pakistani Nicholas et al.,2009 42 c. 6686- p.R2229TfsX9 Pakistani Present study 6689delGAAA 43 c.6732delA p.Y2245fs Pakistani Muhammad et al., 2009 44 c.7489_7493delTATA p.Tyr2497fs Caucasian Nicholas et al.,2009 T 45 c.7761T>G p.Tyr2587X Pakistani Bond et al., 2002 46 c.7782_7783delGA p.Gln2594fs Pakistani, Nicholas et al.,2009 Caucasian 47 c.7859_7860delAG p.Gln2620fs Arab ″ 48 c.7895 C>T p.Glu 2632X Pakistani Bond et al., 2003 49 c.8130_8131delAA p.Thr2710fs Caucasian Nicholas et al.,2009 50 c.8378delT p.Met2793fs Pakistani ″ 51 c.8508_8509delGA p.Gln2836fs Pakistani ″ 52 c.8668C>T p. Glu2890X Pakistani Muhammad et al., 2009 53 c.8844delC p.Ala2948fs Caucasian Nicholas et al.,2009 54 c.9118_9119insCATT p.Tyr3040fs Pakistani Gul et al., 2006 55 c.9159delA p.Lys3053fs Pakistani Bond et al., 2002 Present study 56 c.9178C>T p.Gln3060X Indian, Nicholas et al.,2009 Caucasian 57 c.9190C>T p.Arg3064X Pakistani, Bond et al., 2003 Dutch 58 c.9238A>T p.Leu3080X Pakistani Nicholas et al.,2009 59 c. 9492T>G p.Y3164X Pakistani Kousar et al., 2009 60 c.9557C>G p.Ser3186X Pakistani Bond et al., 2003 61 c.9595A>T p.K3199X Pakistani Muhammad et al., 2009 62 c.9677_9678insG p.C3226fs Pakistani ″ 63 c.9681delA p.Thr3227fs Pakistani Nicholas et al.,2009 64 c.9686_9690delTTAA p.Ile3229SerfsX10X Lebanonian Passemard et al., 2009 A 65 c.9697C>T p.R3233X Pakistani Muhammad et al., 2009 66 c.9730C>T p.Arg3244X Pakistani Gul et al., 2007 67 c.9745_9746delCT p.Leu3249fs Pakistani Nicholas et al.,2009 68 c.9754delA p.Arg3252fs Yemeni Bond et al., 2003 69 c.9789T>A p.Tyr3263X Pakistani Nicholas et al.,2009 70 c.9984+1G>T Removes splice donor site, Pakistani Bond et al., 2003 additional 29 novel aa then stop 71 c.1002delA p.V335fs Pakistani Muhammad et al., 2009 72 c.10059C>A p.Tyr3353X Pakistani Gul et al., 2007 73 Translocation Loss of IQ and European Pichon et al., 2004 armadillo domains FS frame shift;

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 110

Chapter5 MCPH5

Table 5.4: List of compound heterozygous mutations in ASPM gene reported so far.

S. Nucleotide change Amino acid change Ethnic group Reference No. 1 c.3055C>T+ c.7894C>T p.R1019X+ p.Glu2632X Pakistani Muhammad et al., 2009 2 c.3978G>A+c.9319C>T p. W1326X+ p. Arg3107X Pakistani ″

3 c.2389C>T+c.7781_778 p.Arg797X+ p.Gln2594fsX6 Algerian Saadi et al., 2009 2delAG 4 c.77delG+c. 6232 T>C p.Gly26AlafsX42X+p.Arg2078 France Passemard et al., StopX 2009 5 c.8190_8191delAG+c.82 p.Glu2731LysfsX18X+p. France ″ 73 T>A Leu2758StopX 6 c.1630_1634delATCTT p.Tyr544SerfsX9X France ″ +deletion of ASPM gene 7 c.3945_3946delAG+c.81 p.Arg1315SerfsX2X+p.Arg273 German ″ 91_8194delGAAA 2LysfsX4X 8 c.9319 C>T+c.9507delG p.Arg3107StopX+p.Ile3170Leu France ″ fsX9X 9 c.2389 C>T+ c. 4074 p.Arg797StopX+p.Trp1358X Morrocians ″ G>A (adopted) 10 c.2389C>T+c.6686_668 p.Arg797StopX+p.Arg2229Thr Lebnonian/ ″ 9delGAAA fsX10X Algerian FS frame shift;

Table 5.5: Genotypes of ASPM flanking markers based upon AFLP analysis.

Individuals Status D1S2823 D1S2816 ASPM D1S1723 (197cM) (200cM) (205cM) Family III-1 Carrier 94/96 211/207 G/A 177/175 J III-2 96/100 207/213 G/A 175/177 ″ IV-5 Affected 96 207 A 175

Family IV-1 Carrier 94/96 211/207 G/A 177/175 K IV-2 ″ 96/100 207/213 G/A 175/177 V-2 Affected 96 207 A 175

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 111

Conclusion

CONCLUSION

Genetic disorders with recessive mode of inheritance are common in several isolated populations living in remote areas of Pakistan, primarily due to high rate of consanguineous unions. In these areas of Pakistan birth rate is comparatively high, which consequently results in a large family with more affected individuals. Such families provide an ideal opportunity to map and identify disease causative genes. This study also signifies the importance of such families for the identification of MCPH causative genes and mutations.

Our study highlights the existence of further genetic heterogeneity of MCPH in Pakistani population. It is anticipated that identification of MCPH causative gene at a novel locus mapped on chromosome 16p13.3-13.2 will expand our understanding about disease pathogenesis. All currently known MCPH genes encode centrosomal or spindle pole proteins and have important role in proliferation of neural progenitors during fetal brain development. So it is anticipated that a gene with similar function may be involved in this family mapped to chromosome 16. Future functional studies can be performed on this family to detect abnormalities of centrosomal proteins important for cell proliferation. The study also proved the utility of SNP based microarray in the detection of disease associated HBD regions in consanguineous families with multiple loops. However similar approach can be used for the molecular diagnosis of MCPH patients.

On the basis of genetic analysis of collected families, we can conclude that ASPM (5 mutations) and WDR62 (4 mutations) are major genetic players responsible for autosomal recessive MCPH in Pakistan. This study also supports the notion that WDR62 mutations result in severe brain malformations in addition to primary microcephaly, especially in MCPH patients with nonsense mutations.

The study also indicates that sequence variant (c.3978G>A; W1326X) is the most common sequence variant in ASPM gene in a specific population group of Pakistan. This sequence variant (c. 3978G>A/W1326X) has been identified in two families from Khyber Pakhtunkhwa (KPK) increasing the number of MCPH families bearing this mutation from the same territory to 26.Our data indicates involvement of a founder mutation having common ancestors in KPK population. The haplotype constructed on the basis of

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 113

Conclusion

AFLP analysis indicates 96 (D1S2823), 207 (D1S2816) and 175 (D1S1723) as disease associated haplotype shared by affected individuals of both families.

As traditional sequencing analysis in unlinked family failed to detect causative gene, exome sequencing can be used for affected individual in family A. Identification of novel and known mutations in the present study expand the spectrum of MCPH phenotype in Pakistani population. This study also signifies the importance of classic as well as modern approaches for molecular diagnosis of MCPH patients with similar clinical presentation. However molecular diagnosis can be easier in patients with detectable brain malformations associated with WRD62 mutations, but for other MCPH patients, causative genes can be mapped either by using STR or SNP markers. For positive families, gene present in the linked region should be sequenced to identify the pathogenic variants responsible for MCPH phenotype. This strategy can be successfully used to identify MCPH causative variations in single index/proband with MCPH. Our findings also suggest the screening of ASPM and WRD62 genes in MCPH patients/families of Pakistani origin. This is of great significance for the identification of carriers, genetic counseling and prenatal diagnosis as a first step to minimize the recessive disorders.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 114

Chapter 6 References

REFERENCES

Abecasis GR, Cherny SS, Cookson WO, Cardon LR (2002). Merlin-rapid analysis of dense genetic maps using sparse gene flow trees. Nat Genet. 30(1): 97-101.

Abuelo D ( 2007). Microcephaly syndromes. Semin Pediatr Neurol. 14(3): 118-27.

Aplan PD, Lombardi DP, Kirsch IR (1991). Structural characterization of SIL, a gene frequently disrupted in T cell acute lymphoblastic leukemia. Mol Cell Biol. 11(11): 5462-9.

Arquint C, Sonnen KF, Stierhof YD, Nigg EA (2012). Cell-cycle regulated expression of STIL controls centriole number in human cells. J Cell Sci. 125: 1342-52.

Bacino CA, Arriola LA, Wiszniewska J, Bonnen PE (2012). WDR62 missense mutation in a consanguineous family with primary microcephaly. Am J Med Genet A. 158 (3): 622-5.

Bakircioglu M, Carvalho OP, Khurshid M, Cox JJ, Tuysuz B, Barak T, Yilmaz S, Caglayan O, Dincer A, Nicholas AK, Quarrell O, Springell K, Karbani G, Malik S, Gannon C, Sheridan E, Crosier M, Lisgo SN, Lindsay S, Bilguvar K, Gergely F, Gunel M, Woods CG (2011). The essential role of centrosomal NDE1 in human cerebral cortex neurogenesis. Am J Hum Genet. 88(5): 523-35.

Baraitser B (1990). Microcephaly. In: The Genetics of neurological disorders. Oxford monograph on medical genetics. Vol. 18. (Motulsy AG, Bobrow M, Harper PS, Scriver C, eds). Oxford: Medical Publishers, 26-33.

Barr AR, Kilmartin JV, Gergely F (2010). CDK5RAP2 functions in centrosome to spindle pole attachment and DNA damage response. J Cell Biol. 189 (1): 23-39.

Barrera JA, Kao LR, Hammer RE, Seemann J, Fuchs JL, Megraw TL (2010). CDK5RAP2 regulates centriole engagement and cohesion in mice. Dev Cell. 18(6): 913-926.

Baxter PS, Rigby AS, Rotsaert MH, Wright I (2009). Acquired microcephaly: causes, patterns, motor and IQ effects, and associated growth changes. Pediatrics. 124(2): 590-5.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 114

Chapter 6 References

Bennett RL, Steinhaus KA, Uhrich SB, O'Sullivan CK, Resta RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J (1995). Recommendations for standardized human pedigree nomenclature. Pedigree Standardization Task Force of the National Society of Genetic Counselors. Am J Hum Genet. 56(3): 745-52.

Bettencourt-Dias M, Rodrigues-Martins A, Carpenter L, Riparbelli M, Lehmann L, Gatt MK, Carmo N, Balloux F, Callaini G, Glover DM (2005). SAK/PLK4 is required for centriole duplication and flagella development. Curr Biol. 15(24): 199-207.

Bhat V, Girimaji SC, Mohan G, Arvinda HR, Singhmar P, Duvvari MR, Kumar A (2011). Mutations in WDR62, encoding a centrosomal and nuclear protein, in Indian primary microcephaly families with cortical malformations. Clin Genet. 80(6): 532-40.

Bilgüvar K, Oztürk AK, Louvi A, Kwan KY, Choi M, Tatli B, Yalnizoğlu D, Tüysüz B, Cağlayan AO, Gökben S, Kaymakçalan H, Barak T, Bakircioğlu M, Yasuno K, Ho W, Sanders S, Zhu Y, Yilmaz S, Dinçer A, Johnson MH, Bronen RA, Koçer N, Per H, Mane S, Pamir MN, Yalçinkaya C, Kumandaş S, Topçu M, Ozmen M, Sestan N, Lifton RP, State MW, Günel M (2010). Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations. Nature. 467: 207-10.

Blachon S, Gopalakrishnan J, Omori Y, Polyanovsky A, Church A, Nicastro D, Malicki J, Avidor-Reiss T (2008). Drosophila asterless and vertebrate Cep152 Are orthologs essential for centriole duplication. Genetics. 180: 2081-2094.

Bogoyevitch MA, Yeap YY, Qu Z, Ngoei KR, Yip YY, Zhao TT, Heng JI, Ng DC (2012). WD40-repeat protein 62 is a JNK-phosphorylated spindle pole protein required for spindle maintenance and timely mitotic progression. J Cell Sci. 125: 5096-109.

Bond J, Roberts E, Springell K, Lizarraga SB, Scott S, Higgins J, Hampshire DJ, Morrison EE, Leal GF, Silva EO, Costa SM, Baralle D, Raponi M, Karbani G,Rashid Y, Jafri H, Bennett C, Corry P, Walsh CA, Woods CG (2005). A

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 115

Chapter 6 References

centrosomal mechanism involving CDK5RAP2 and CENPJ controls brain size. Nat Genet. 37: 353-355.

Bond J, Roberts E, Mochida GH, Hampshire DJ, Scott S, Askham JM, Springell K, Mahadevan M, Crow YJ, Markham AF, Walsh CA, Woods CG (2002). ASPM is a major determinant of cerebral cortical size. Nat Genet. 32(2): 316-20.

Bond J, Scott S, Hampshire DJ, Springell K, Corry P, Abramowicz MJ, Mochida GH, Hennekam RC, Maher ER, Fryns JP, Alswaid A, Jafri H, Rashid Y, Mubaidin A, Walsh CA, Roberts E, Woods CG (2003). Protein-truncating mutations in ASPM cause variable reduction in brain size. Am J Hum Genet. 73(5): 1170-7.

Brand S, Rakic P (1979). Genesis of the primate neostriatum: [3H] thymidine auto- radiographic analysis of the time of neuron origin in the rhesus monkey. Neuroscience. 4: 767-778.

Bromley B, Benacerraf BR (1995). Difficulties in the prenatal diagnosis of microcephaly. J Ultrasound Med. 14: 303-305.

Brown JA, Bourke E, Liptrot C, Dockery P, Morrison CG (2010). MCPH1/BRIT1 limits ionizing radiation-induced centrosome amplification. Oncogene. 29(40): 5537-44.

Buchman JJ, Durak O, Tsai LH (2011). ASPM regulates Wnt signaling pathway activity in the developing brain. Genes Dev. 25(18): 1909-14.

Buchman JJ, Tseng HC, Zhou Y, Frank CL, Xie Z, Tsai LH (2010). Cdk5rap2 interacts with pericentrin to maintain the neural progenitor pool in the developing neocortex. Neuron. 6(3): 386-402.

Camarero G, Tyrsin OY, Xiang C, Pfeiffer V, Pleiser S, Wiese S, Götz R, Rapp UR (2006). Cortical migration defects in mice expressing A-RAF from the B-RAF locus. Mol Cell Biol. 26 (19): 7103-15.

Campaner S, Kaldis P, Izraeli S, Kirsch IR (2005). Sil phosphorylation in a Pin1 binding domain affects the duration of the spindle checkpoint. Mol Cell Biol. 25(15): 6660-72.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 116

Chapter 6 References

Ching YP, Qi Z, Wang JH (2000). Cloning of three novel neuronal Cdk5 activator binding proteins. Gene 242: 285-294.

Ching YP, Pang AS, Lam WH, Qi RZ, Wang JH (2002). Identification of a neuronal Cdk5 activator-binding protein as Cdk5 inhibitor. J Biol Chem. 277 (18): 15237- 40.

Cho JH, Chang CJ, Chen CY, Tang TK (2006). Depletion of CPAP by RNAi disrupts centrosome integrity and induces multipolar spindles. Biochem Biophys Res Commun. 339(3): 742-7.

Cizmecioglu O, Arnold M, Bahtz R, Settele F, Ehret L, Haselmann-Weiss U, Antony C, Hoffmann I (2010). Cep152 acts as a scaffold for recruitment of Plk4 and CPAP to the centrosome. J Cell Biol. 191(4): 731-9.

Cohen-Katsenelson K, Wasserman T, Khateb S, Whitmarsh AJ, Aronheim A (2011). Docking interactions of the JNK scaffold protein WDR62. Biochem J. 439(3): 381-90.

Corona-Rivera JR, Corona-Rivera E, Romero-Velarde E, Hernández-Rocha J, Bobadilla- Morales L, Corona-Rivera A (2001). Report and review of the fetal brain disruption sequence. Eur J Pediatr. 160: 664-667.

Cottingham RW Jr, Idury RM, Schäffer AA (1993). Faster sequential genetic linkage computations. Am J Hum Genet. 53(1): 252-63.

Darvish H, Esmaeeli-Nieh S, Monajemi GB, Mohseni M, Ghasemi-Firouzabadi S, Abedini SS, Bahman I, Jamali P, Azimi S, Mojahedi F, Dehghan A, Shafeghati Y, Jankhah A, Falah M, Soltani Banavandi MJ, Ghani-Kakhi M, Garshasbi M, Rakhshani F, Naghavi A, Tzschach A, Neitzel H, Ropers HH, Kuss AW, Behjati F, Kahrizi K, Najmabadi H (2010). A clinical and molecular genetic study of 112 Iranian families with primary microcephaly. J Med Genet. 47(12): 823-8.

Delattre M, Leidel S, Wani K, Baumer K, Bamat J, Schnabel H, Feichtinger R, Schnabel R, Gönczy P (2004). Centriolar SAS-5 is required for centrosome duplication in C. elegans. Nat Cell Biol. 6(7): 656-64.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 117

Chapter 6 References

Dobyns WB (2002). Primary microcephaly: new approaches for an old disorder. Am J Med Genet. 112: 315-317.

Dzhindzhev NS, Yu QD, Weiskopf K, Tzolovsky G, Cunha-Ferreira I, Riparbelli M, Rodrigues-Martins A, Bettencourt-Dias M, Callaini G, Glover DM (2010). Asterless is a scaffold for the onset of centriole assembly. Nature. 467(7316): 714-8.

Erez A, Castiel A, Trakhtenbrot L, Perelman M, Rosenthal E, Goldstein I, Stettner N, Harmelin A, Eldar-Finkelman H, Campaner S, Kirsch I, Izraeli S (2007). The SIL gene is essential for mitotic entry and survival of cancer cells. Cancer Res. 67: 4022- 27.

Erez A, Chaussepied M, Castiel A, Colaizzo-Anas T, Aplan PD, Ginsberg D, Izraeli S (2008). The mitotic checkpoint gene, SIL is regulated by E2F1. Int J Cancer. 123: 1721-25.

Faragher AJ, Fry AM (2003). Nek2 kinase stimulates centrosome disjunction and is required for formation of bipolar mitotic spindles. Mol Biol Cell. 14: 2876-89.

Farkas L M, Huttner W B (2008). The cell biology of neural stem and progenitor cells and its significance for their proliferation versus differentiation during mammalian brain development. Cur Opin Cell Biol. 20: 707-715.

Fietz SA, Lachmann R, Brandl H, Kircher M, Samusik N, Schröder R, Lakshmanaperumal N, Henry I, Vogt J, Riehn A, Distler W, Nitsch R, Enard W, Pääbo S, Huttner WB (2012). Transcriptomes of germinal zones of human and mouse fetal neocortex suggest a role of extracellular matrix in progenitor self- renewal. Proc Natl Acad Sci U S A. 109 (29): 11836-41.

Fish JL, Kosodo Y, Enard W, Paabo S, Huttner WB (2006). Aspm specifically maintains symmetric proliferative divisions of neuroepithelial cells. Proc Natl Acad Sci USA. 103: 10438-43.

Fogel BL, Wexler E, Wahnich A, Friedrich T, Vijayendran C, Gao F, Parikshak N, Konopka G, Geschwind DH (2012). RBFOX1 regulates both splicing and

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 118

Chapter 6 References

transcriptional networks in human neuronal development. Hum Mol Genet. 21(19): 4171-86.

Fong KW, Hau SY, Kho YS, Jia Y, He L, Qi RZ (2009). Interaction of CDK5RAP2 with EB1 to track growing microtubule tips and to regulate microtubule dynamics. Mol Biol Cell. 20 (16): 3660-70.

Fong KW, Choi YK, Rattner JB, Qi RZ (2008). CDK5RAP2 is a pericentriolar protein that functions in centrosomal attachment of the gamma-tubulin ring complex. Mol Biol Cell. 19 (1):115-125.

Genin A, Desir J, Lambert N, Biervliet M, Van Der Aa N, Pierquin G, Killian A, Tosi M, Urbina M, Lefort A, Libert F, Pirson I, Abramowicz M (2012). Kinetochore KMN network gene CASC5 mutated in primary microcephaly. Hum Mol Genet. 21(24): 5306-17.

Ghannad M (2011). The essential role of NDE1 in extreme microcephaly. Clin Genet. 80(3): 1-2.

Götz M, Huttner WB (2005). The cell biology of neurogenesis. Nat Rev Mol Cell Biol. 6(10): 777-88.

Gruber R, Zhou Z, Sukchev M, Joerss T, Frappart PO, Wang ZQ (2011). MCPH1 regulates the neuroprogenitor division mode by coupling the centrosomal cycle with mitotic entry through the Chk1-Cdc25 pathway. Nat Cell Biol. 13(11): 1325-34.

Gudbjartsson DF, Thorvaldsson T, Kong A, Gunnarsson G, Ingolfsdottir A (2005). Allegro version 2. Nat Genet. 37(10): 1015-6.

Guernsey DL, Jiang H, Hussin J, Arnold M, Bouyakdan K, Perry S, Babineau-Sturk T, Beis J, Dumas N, Evans SC, Ferguson M, Matsuoka M, Macgillivray C, Nightingale M, Patry L, Rideout AL, Thomas A, Orr A, Hoffmann I, Michaud JL, Awadalla P, Meek DC, Ludman M, Samuels ME (2010). Mutations in centrosomal protein CEP152 in primary microcephaly families linked to MCPH4. Am J Hum Genet. 87(1): 40-51.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 119

Chapter 6 References

Gul A, Hassan MJ, Mahmood S, Chen W, Rahmani S, Naseer MI, Dellefave L, Muhammad N, Rafiq MA, Ansar M, Chishti MS, Ali G, Siddique T, Ahmad W (2006 ). Genetic studies of autosomal recessive primary microcephaly in 33 Pakistani families: Novel sequence variants in ASPM gene. Neurogenetics 7(2): 105-10.

Gul A, Tariq M, Khan MN, Hassan MJ, Ali G, Ahmad W (2007). Novel protein- truncating mutations in the ASPM gene in families with autosomal recessive primary microcephaly. J Neurogenet. 21(3): 153-63.

Habedanck R, Stierhof YD, Wilkinson CJ, Nigg EA (2005). The Polo kinase Plk4 functions in centriole duplication. Nat Cell Biol. 7:1140-1146.

Hassan MJ, Chishti MS, Jamal SM, Tariq M, Ahmad W (2008). A syndromic form of autosomal recessive congenital microcephaly (Jawad syndrome) maps to chromosome 18p11.22-q11.2. Hum Genet. 123(1): 77-82.

Higgins J, Midgley C, Bergh AM, Bell SM, Askham JM, Roberts E, Binns RK, Sharif SM, Bennett C, Glover DM, Woods CG, Morrison EE, Bond J (2010). Human ASPM participates in spindle organisation, spindle orientation and cytokinesis. BMC Cell Biol. 11: 85.

Hirano T (2005). SMC proteins and chromosome mechanics: from bacteria to humans. Philos Trans R Soc Lond B Biol Sci. 360: 507-514.

Hsu WB, Hung L, Tang CJC, Su CL, Chang Y, Tang TK (2008). Functional characterization of the microtubule-binding and -destabilizing domains of CPAP and d-SAS-4. Exp Cell Res. 314: 2591-2602.

Hung LY, Tang CJ, Tang TK (2000). Protein 4.1R-135 interacts with a novel centrosomal protein (CPAP) which is associated with the g-tubulin complex. Mol Cell Biol. 20: 7813-7825.

Hung LY, Chen HL, Chang CW, Li BR, Tang TK (2004). Identification of a novel microtubule-destabilizing motif in CPAP that binds to tubulin heterodimers and inhibits microtubule assembly. Mol Biol Cell. 15(6): 2697-706.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 120

Chapter 6 References

Hussain MS, Baig SM, Neumann S, Nürnberg G, Farooq M, Ahmad I, Alef T, Hennies HC, Technau M, Altmüller J, Frommolt P, Thiele H, Noegel AA, Nürnberg P (2012). A truncating mutation of CEP135 causes primary microcephaly and disturbed centrosomal function. Am J Hum Genet. 90(5): 871-8.

Hutchins JR, Toyoda Y, Hegemann B, Poser I, Hériché JK, Sykora MM, Augsburg M, Hudecz O, Buschhorn BA, Bulkescher J, Conrad C, Comartin D, Schleiffer A, Sarov M, Pozniakovsky A, Slabicki MM, Schloissnig S, Steinmacher I, Leuschner M, Ssykor A, Lawo S, Pelletier L, Stark H, Nasmyth K, Ellenberg J, Durbin R,Buchholz F, Mechtler K, Hyman AA, Peters JM (2010). Systematic analysis of human protein complexes identifies chromosome segregation proteins. Science. 328: 593-599.

Huttner WB, Kosodo Y (2005). Symmetric versus asymmetric cell division during neurogenesis in the developing vertebrate central nervous system. Curr Opin Cell Biol. 17(6): 648-57.

Huyton T, Bates PA, Zhang X, Sternberg MJ, Freemont PS (2000). The BRCA1 C- terminal domain: structure and function. Mutat Res. 460: 319-332.

Jackson AP, McHale DP, Campbell DA, Jafri H, Rashid Y, Mannan J, Karbani G, Corry P, Levene MI, Mueller RF, Markham AF, Lench NJ, Woods CG (1998). Primary autosomal recessive microcephaly (MCPH1) maps to chromosome 8p22-pter. Am J Hum Genet. 63: 541-546.

Jackson AP, Eastwood H, Bell SM, Adu J, Toomes C, Carr IM, Roberts E, Hampshire DJ, Crow YJ, Mighell AJ, Karbani G, Jafri H, Rashid Y, Mueller RF, Markham AF, Woods CG (2002). Identification of microcephalin, a protein implicated in determining the size of the human brain. Am J Hum Genet. 71(1):136-42

Jamieson CR, Fryns JP, Jacobs J, Matthijs G, Abramowicz MJ (2000). Primary autosomal recessive microcephaly: MCPH5 maps to 1q25-q32. Am J Hum Genet. 67(6): 1575-7.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 121

Chapter 6 References

Jamieson CR, Govaerts C, Abramowicz MJ (1999). Primary autosomal recessive microcephaly: homozygosity mapping of MCPH4 to chromosome 15. Am J Hum Genet. 65(5): 1465-9.

Jeffers LJ, Coull BJ, Stack SJ, Morrison CG (2008). Distinct BRCT domains in Mcph1/Brit1 mediate ionizing radiation induced focus formation and centrosomal localization. Oncogene. 27(1): 139 44.

Kalay E, Yigit G, Aslan Y, Brown KE, Pohl E, Bicknell LS, Kayserili H, Li Y, Tüysüz B, Nürnberg G, Kiess W, Koegl M, Baessmann I, Buruk K, Toraman B,Kayipmaz S, Kul S, Ikbal M, Turner DJ, Taylor MS, Aerts J, Scott C, Milstein K, Dollfus H, Wieczorek D, Brunner HG, Hurles M, Jackson AP, Rauch A, Nürnberg P,Karagüzel A, Wollnik B (2011). CEP152 is a genome maintenance protein disrupted in Seckel syndrome. Nat Genet. 43(1): 23-6.

Karkera JD, Izraeli S, Roessler E, Dutra A, Kirsch I, Muenke M (2002). The genomic structure, chromosomal localization, and analysis of SIL as a candidate gene for holoprosencephaly. Cytogenet Genome Res. 97(1-2): 62-7.

Kesavapany S, Li BS, Amin N, Zheng YL, Grant P, Pant HC (2004). Neuronal cyclin- dependent kinase 5: role in nervous system function and its specific inhibition by the Cdk5 inhibitory peptide. Biochim Biophys Acta. 1697(1-2): 143-53.

Kim HT, Lee MS, Choi JH, Jung JY, Ahn DG, Yeo SY, Choi DK, Kim CH (2011). The microcephaly gene aspm is involved in brain development in zebrafish. Biochem Biophys Res Commun. 409(4): 640-4.

Kitagawa D, Vakona kis I, Olieric N, Hilbert M, Erat MC, Flückiger I, Gönczy P, Steinmetz MO (2011). Structural basis of the 9-fold symmetry of centrioles. Cell. 144(3): 364-75.

Kiyomitsu T, Obuse C, Yanagida M (2007). Human Blinkin/ AF15q14 is required for chromosome alignment and the mitotic checkpoint through direct interaction with Bub1 and BubR1. Dev Cell. 13(5): 663-76.

Kleylein-Sohn J, Westendorf J, Le Clech M, Habedanck R, Stierhof YD, Nigg EA (2007). Plk4-induced centriole biogenesis in human cells. Dev Cell. 13: 190-202.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 122

Chapter 6 References

Kohlmaier G, Loncarek J, Meng X, McEwen BF, Mogensen MM, Spektor A, Dynlacht BD, Khodjakov A, Gönczy P (2009). Overly long centrioles and defective cell division upon excess of the SAS-4-related protein CPAP. Curr Biol. 19:1012-18.

Kouprina N, Pavlicek A, Collins NK, Nakano M, Noskov VN, Ohzeki J, Mochida GH, Risinger JI, Goldsmith P, Gunsior M, Solomon G, Gersch W, Kim JH, Barrett JC, Walsh CA, Jurka J, Masumoto H, Larionov V (2005). The microcephaly ASPM gene is expressed in proliferating tissues and encodes for a mitotic spindle protein. Hum Mol Genet. 14: 2155- 65.

Kousar R, Hassan MJ, Khan B, Basit S, Mahmood S, Mir A, Ahmad W, Ansar M (2011). Mutations in WDR62 gene in Pakistani families with autosomal recessive primary microcephaly. BMC Neurol. 11:119.

Kousar R, Nawaz H, Khurshid M, Ali G, Khan SU, Mir H, Ayub M, Wali A, Ali N, Jelani M, Basit S, Ahmad W, Ansar M (2010). Mutation analysis of the ASPM gene in 18 Pakistani families with autosomal recessive primary microcephaly. J Child Neurol. 25(6): 715-20.

Kumar A, Blanton SH, Babu M, Markandaya M, Girimaji SC (2004). Genetic analysis of primary microcephaly in Indian families: novel ASPM mutations. Clin Genet. 66: 341-348.

Kumar A, Girimaji SC, Duvvari MR, Blanton SH (2009). Mutations in STIL, encoding a pericentriolar and centrosomal protein, cause primary microcephaly. Am J Hum Genet. 84 (2): 286-90.

Leal GF, Roberts E, Silva EO, Costa SM, Hampshire DJ, Woods CG (2003). A novel locus for autosomal recessive primary microcephaly (MCPH6) maps to 13q12.2. J Med Genet. 40: 540-542.

Lee S, Rhee K (2010). CEP215 is involved in the dynein dependent accumulation of pericentriolar matrix proteins for spindle pole formation. Cell Cycle. 9(4): 774-83.

Leidel S, Delattre M, Cerutti L, Baumer K, Gönczy P (2005). SAS-6 defines a protein family required for centrosome duplication in C. elegans and in human cells. Nat Cell Biol. 7: 115-125.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 123

Chapter 6 References

Li D, Roberts R (2001). WD-repeat proteins: structure characteristics, biological function, and their involvement in human diseases. Cell Mol Life Sci. 58 (14): 2085-97.

Lin M, Wei LJ, Sellers WR, Lieberfarb M, Wong WH, Li C. (2004). dChipSNP: Significance Curve and Clustering of SNP-Array-Based Loss-of-Heterozygosity Data. Bioinformatics. 20: 1233-40.

Lin SY, Elledge SJ (2003). Multiple tumor suppressor pathways negatively regulate telomerase. Cell. 113(7): 881-9.

Lizarraga SB, Margossian SP, Harris MH, Campagna DR, Han AP, Blevins S, Mudbhary R, Barker JE, Walsh CA, Fleming MD (2010). Cdk5rap2 regulates centrosome function and chromosome segregation in neuronal progenitors. Development. 137(11): 1907-17.

Löffler H, Fechter A, Matuszewska M, Saffrich R, Mistrik M, Marhold J, Hornung C, Westermann F, Bartek J, Krämer A (2011). Cep63 recruits Cdk1 to the centrosome: implications for regulation of mitotic entry, centrosome amplification, and genome maintenance. Cancer Res. 71 (6): 2129-39.

Mahmood S, Ahmad W, Hassan MJ (2011). Autosomal Recessive Primary Microcephaly (MCPH): clinical manifestations, genetic heterogeneity and mutation continuum. Orphanet J Rare Dis. 6: 39.

Marchal JA, Ghani M, Schindler D, Gavvovidis I, Winkler T, Esquitino V, Sternberg N, Busche A, Krawitz P, Hecht J, Robinson P,Mundlos S, Graul-Neumann L, Sperling K, Trimborn M, Neitzel H (2011). Misregulation of mitotic chromosome segregation in a new type of autosomal recessive primary microcephaly. Cell Cycle. 10(17): 2967-77.

Marth G, Yeh R, Minton M, Donaldson R, Li Q, Duan S, Davenport R, Miller RD, Kwok PY (2001). Single-nucleotide polymorphisms in the public domain: how useful are they? Nat Genet. 27(4): 371-2.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 124

Chapter 6 References

Matise TC, Chen F, Chen W, De La Vega FM, Hansen M, He C, Hyland FC, Kennedy GC, Kong X, Murray SS, Ziegle JS, Stewart WC, Buyske S (2007). A second- generation combined linkage-physical map of the human genome. Genome Res. 17(12): 1783-86.

Memon MM, Raza SI, Basit S, Kousar R, Ahmad W, Ansar M (2013). A novel WDR62 mutation causes primary microcephaly in a Pakistani family. Mol Biol Rep. 40(1): 591-5.

Meraldi P, Nigg EA (2001). Centrosome cohesion is regulated by a balance of kinase and phosphatase activities. J Cell Sci. 114(Pt 20): 3749-57.

Moynihan L, Jackson AP, Roberts E, Karbani G, Lewis I, Corry P, Turner G, Mueller RF, Lench NJ, Woods CG (2000). A third novel locus for primary autosomal recessive microcephaly maps to chromosome 9q34. Am J Hum Genet. 66: 724-7.

Muhammad F, Mahmood Baig S, Hansen L, Sajid Hussain M, Anjum Inayat I, Aslam M, Anver Qureshi J, Toilat M, Kirst E, Wajid M, Nürnberg P, Eiberg H, Tommerup N, Kjaer KW (2009). Compound heterozygous ASPM mutations in Pakistani MCPH families. Am J Med Genet A. 149A (5): 926-30.

Neitzel H, Neumann LM, Schindler D, Wirges A, Tonnies H, Trimborn M, Krebsova A, Richter R, Sperling K (2002). Premature chromosome condensation in humans associated with microcephaly and mental retardation: a novel autosomal recessive condition. Am J Hum Genet. 70:1015- 22.

Nicholas AK, Swanson EA, Cox JJ, Karbani G, Malik S, Springell K, Hampshire D, Ahmed M, Bond J, Benedetto DD, Fichera M, Romano C, Dobyns WB, Woods CG (2009). The molecular landscape of ASPM mutations in primary Microcephaly. J Med Genet. 46: 249-253.

Nicholas AK, Khurshid M, Désir J, Carvalho OP, Cox JJ, Thornton G, Kausar R, Ansar M, Ahmad W, Verloes A, Passemard S, Misson JP, Lindsay S, Gergely F,Dobyns WB, Roberts E, Abramowicz M, Woods CG (2010). WDR62 is associated with the spindle pole and is mutated in human microcephaly. Nat Genet. 42: 1010-4.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 125

Chapter 6 References

Noctor SC, Martínez-Cerdeño V, Ivic L, Kriegstein AR (2004). Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat Neurosci. 7(2): 136-44.

Noctor SC, Martínez-Cerdeño V, Kriegstein AR (2008). Distinct behaviors of neural stem and progenitor cells underlie cortical neurogenesis. J Comp Neurol. 508: 28- 44.

O'Connell JR, Weeks DE (1998). PedCheck: a program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet. 63(1): 259-66.

O'Driscoll M, Jackson AP, Jeggo PA (2006). Microcephalin: a causal link between impaired damage response signalling and microcephaly. Cell Cycle. 5(20): 2339- 44.

Ohta T, Essner R, Ryu JH, Palazzo RE, Uetake Y, Kuriyama R (2002). Characterization of Cep135, a novel coiled-coil centrosomal protein involved in microtubule organization in mammalian cells. J Cell Biol. 156: 87-99.

Otto EA, Helou J, Allen SJ, O'Toole JF, Wise EL, Ashraf S, Attanasio M, Zhou W, Wolf MT, Hildebrandt F (2008). Mutation analysis in nephronophthisis using a combined approach of homozygosity mapping, CEL I endonuclease cleavage, and direct sequencing. Hum Mutat. 29 (3): 418-26.

Passemard S, Titomanlio L, Elmaleh M, Afenjar A, Alessandri JL, Andria G, de Villemeur TB, Boespflug-Tanguy O, Burglen L, Del Giudice E, Guimiot F, Hyon C, Isidor B, Mégarbané A, Moog U, Odent S, Hernandez K, Pouvreau N, Scala I, Schaer M, Gressens P, Gerard B, Verloes A (2009). Expanding the clinical and neuroradiologic phenotype of primary microcephaly due to ASPM mutations. Neurology. 73(12): 962-9.

Pattison L, Crow YJ, Deeble VJ, Jackson AP, Jafri H, Rashid Y, Roberts E, Woods CG (2000). A fifth locus for primary autosomal recessive microcephaly maps to chromosome 1q31. Am J Hum Genet. 67: 1578-1580.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 126

Chapter 6 References

Pfaff KL, Straub CT, Chiang K, Bear DM, Zhou Y, Zon LI (2007 ). The zebra fish cassiopeia mutant reveals that SIL is required for mitotic spindle organization. Mol Cell Biol. 27(16): 5887-97.

Pichon B, Vankerckhove S, Bourrouillou G, Duprez L, Abramowicz MJ (2004). A translocation breakpoint disrupts the ASPM gene in a patient with primary microcephaly. Eur J Hum Genet. 12(5): 419-21.

Pulvers JN, Bryk J, Fish JL, Wilsch-Bräuninger M, Arai Y, Schreier D, Naumann R, Helppi J, Habermann B, Vogt J, Nitsch R, Tóth A, Enard W, Pääbo S, Huttner WB (2010). Mutations in mouse Aspm (abnormal spindle-like microcephaly associated) cause not only microcephaly but also major defects in the germline. Proc Natl Acad Sci USA. 107(38):16595-600.

Qazi QH, Reed TE (1973). A problem in diagnosis of primary versus secondary microcephaly. Clin Genet. 4: 46-52.

Qvist P, Huertas P, Jimeno S, Nyegaard M, Hassan MJ, Jackson SP, Børglum AD (2011). CtIP Mutations Cause Seckel and Jawad Syndromes. PLoS Genet. 7(10): e1002310.

Rakic P (1995). A small step for the cell, a giant leap for mankind: a hypothesis of neocortical expansion during evolution. Trends Neurosci. 18 (9): 383-388.

Rhoads A, Kenguele H (2005). Expression of IQ-motif genes in human cells and ASPM domain structure. Ethn Dis. 15: S5-88-9.

Roberts E, Hampshire DJ, Springell K, Pattison L, Y Crow, Jafri H, Corry P, Kabani G, Mannon J, Rashid Y, Keen J, Bond J, Woods CG (2002). Autosomal recessive primary microcephaly: an analysis of locus heterogeneity and phenotypic variation. J Med Genet 39: 718-721.

Roberts E, Jackson AP, Carradice AC, Deeble VJ, Mannan J, Rashid Y, Jafri H, McHale DP, Markham AF, Lench NJ, Woods CG (1999). The second locus for autosomal recessive primary microcephaly (MCPH2) maps to chromosome 19q13.1-13.2. Eur J Hum Genet. 7: 815-820.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 127

Chapter 6 References

Ross JJ, Frias JL (1977). Microcephaly. In: Congenital malformations of the brain and skull, Vinken PJ, Bruyn GW (ed). Elsevier Holland Biomedical Press 30: 507-24.

Saadi A, Borck G, Boddaert N, Chekkour MC, Imessaoudene B, Munnich A, Colleaux L, Chaouch M (2009). Compound heterozygous ASPM mutations associated with microcephaly and simplified cortical gyration in a consanguineous Algerian family. Eur J Med Genet. 52(4): 180-4.

Sajid Hussain M, Marriam Bakhtiar S, Farooq M, Anjum I, Janzen E, Reza Toliat M, Eiberg H, Kjaer K, Tommerup N, Noegel A, Nürnberg P, Baig S, Hansen L (2012). Genetic heterogeneity in Pakistani microcephaly families. Clin Genet. 83(5): 446-51.

Sambrook J, Fritsch EF, Maniatis T (1989). In: Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Samuelsen GB, Larsen KB, Bogdanovic N, Laursen H, Graem N, Larsen JF, Pakkenberg B (2003). The changing number of cells in the human fetal forebrain and its subdivisions: a stereological analysis. Cereb Cortex. 13(2): 115-22.

Saunders RD, do Carmo Avides M, Howard T, Gonzalez C, Glover DM (1997). The Drosophila gene abnormal spindle encodes a novel microtubule-associated protein that associates with the polar regions of the mitotic spindle. J Cell Biol. 137: 881- 90.

Schultz J, Copley RR, Doerks T, Ponting CP, Bork P (2000). SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res. 28:231-34.

Sheffield VC, Weber JL, Buetow KH, Murray JC, Even DA, Wiles K, Gastier JM, Pulido JC, Yandava C, Sunden SL (1995). A collection of tri- and tetranucleotide repeat markers used to generate high quality, high resolution human genome-wide linkage maps. Hum Mol Genet. 4(10): 1837-44.

Shen J, Eyaid W, Mochida GH, Al-Moayyad F, Bodell A, Woods CG, Walsh CA (2005). ASPM mutations identified in patients with primary microcephaly and seizures. J Med Genet. 42(9): 725-9

Short Ben ( 2010). Cep152 and Plk4 form a double act. J Cell Biol. 191(4): 695.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 128

Chapter 6 References

Siller KH, Doe CQ (2009). Spindle orientation during asymmetric cell division. Nat Cell Biol. 11: 365-74.

Sir JH, Barr AR, Nicholas AK, Carvalho OP, Khurshid M, Sossick A, Reichelt S, D'Santos C, Woods CG, Gergely F (2011). A primary microcephaly protein complex forms a ring around parental centrioles. Nat Genet. 43(11): 1147-53.

Soltani Banavandi MJ, Kahrizi K, Behjati F, Mohseni M, Darvish H, Bahman I, Abedinni SS, Ghasemi Firouzabadi S, Jafari E, Ghadami Sh, Sabbagh F, Kavoosi GR, Najmabadi H ( 2012). Investigation of genetic causes of intellectual disability in kerman province, South East of iran. Iran Red Crescent Med J. 14(2): 79-85.

Stevens NR, Dobbelaere J, Brunk K, Franz A, Raff JW (2010). Drosophila Ana2 is a conserved centriole duplication factor. J Cell Biol. 188(3): 313-23.

Tan C, Del Gaudio D, Dempsey M, Arndt K, Botes S, Reeder A, Das S (2013). Analysis of ASPM in an ethnically diverse cohort of 400 patient samples: perspectives of the molecular diagnostic laboratory. Clin Genet. doi: 10.1111/cge.12172.

Tang CJ, Fu RH, Wu KS, Hsu WB, Tang TK (2009). CPAP is a cell cycle regulated protein that controls centriole length. Nat Cell Biol. 11: 825-831.

Tang CJ, Lin SY, Hsu WB, Lin YN, Wu CT, Lin YC, Chang CW, Wu KS, Tang TK (2011). The human microcephaly protein STIL interacts with CPAP and is required for procentriole formation. EMBO J. 30(23): 4790-804.

Thornton GK, Woods CG (2009). Primary microcephaly: do all roads lead to Rome? Trends Genet. 25(11): 501-10.

Tom Kim, John SY Park, Paul Lee, Yan Jin, Song-bin Fu, Jesusa L Rosales, Ki-Young Lee (2011). Novel alternatively spliced variant form of human CDK5RAP2. Cell Cycle. 10(6): 1010–1012.

Trimborn M, Bell SM, Felix C, Rashid Y, Jafri H, Griffiths PD, Neumann LM, Krebs A, Reis A, Sperling K, Neitzel H, Jackson AP (2004). Mutations in microcephalin cause aberrant regulation of chromosome condensation. Am J Hum Genet. 75(2): 261-6.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 129

Chapter 6 References

Trimborn M, Schindler D, Neitzel H, Hirano T (2006). Misregulated chromosome condensation in MCPH1 primary microcephaly is mediated by condensin II. Cell Cycle. 5 (3): 322-326.

Valeed (2010). Molecular analysis of ASPM gene. M. Phil Thesis Quaid-i-Azam University, Islamabad Pakistan.

Varmark, H., S. Llamazares, E. Rebollo, B. Lange, J. Reina, H. Schwarz, and C. Gonzalez (2007). Asterless is a centriolar protein required for centrosome function and embryo development in Drosophila. Cur Biol. 17: 1735- 1745.

Vulprecht J, David A, Tibelius A, Castiel A, Konotop G, Liu F, Bestvater F, Raab MS, Zentgraf H, Izraeli S, Krämer A (2012). STIL is required for centriole duplication in human cells. J Cell Sci. 125(Pt 5): 1353-62.

Wang X, Tsai JW, Imai JH, Lian WN, Vallee RB, Shi SH (2009). Asymmetric centrosome inheritance maintains neural progenitors in the neocortex. Nature. 461(7266): 947-55.

Wang Z, Wu T, Shi L, Zhang L, Zheng W, Qu JY, Niu R, Qi RZ (2010). Conserved motif of CDK5RAP2 mediates its localization to centrosomes and the Golgi complex. J Biol Chem. 285(29): 22658-65.

Wasserman T, Katsenelson K, Daniliuc S, Hasin T, Choder M, Aronheim A (2010). A novel c-Jun N-terminal kinase (JNK)-binding protein WDR62 is recruited to stress granules and mediates a non classical JNK activation. Mol Biol Cell. 21: 117-130.

Wigginton JE, Abecasis GR (2005). PEDSTATS: descriptive statistics, graphics and quality assessment for gene mapping data. Bioinformatics. 21(16): 3445-7.

Willingham MC, Wehland J, Klee CB, Richert ND, Rutherford AV, Pastan IH (1983). Ultrastructural immuno-cytochemical localization of calmodulin in cultured cells. J Histochem Cytochem. 31(4): 445-61.

Wolf H, Julin P, Gertz HJ, Winblad B, Wahlund LO (2004). Intracranial volume in mild cognitive impairment, Alzheimer’s disease and vascular dementia: evidence for brain reserve? Int J Geriatr Psychiatry. 19: 995-1007.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 130

Chapter 6 References

Wollnik B (2010 ). A common mechanism for microcephaly. Nat Genet. 42(11): 923-4.

Wood J, Singh N, Mer G, Chen J (2007). MCPH1 functions in an H2AX-dependent but MDC1 independent pathway in response to DNA damage. J Biol Chem. 282: 35416-423.

Woods CG, Cox J, Springell K, Hampshire DJ, Mohamed MD, McKibbin M, Stern R, Raymond FL, Sandford R, Malik Sharif S, Karbani G, Ahmed M, Bond J,Clayton D, Inglehearn CF (2006). Quantification of homozygosity in consanguineous individuals with autosomal recessive disease. Am J Hum Genet. 78(5): 889-96.

Woods CG, Bond J, Enard W (2005). Autosomal recessive primary microcephaly (MCPH): a review of clinical, molecular, and evolutionary findings. Am J Hum Genet. 76(5): 717-28.

Xu X, Lee J, Stern DF (2004). Microcephalin is a DNA damage response protein involved in regulation of CHK1 and BRCA1. J Biol Chem. 279: 34091-94.

Yamashita D, Shintomi K, Ono T, Gavvovidis I, Schindler D, Neitzel H, Trimborn M, Hirano T (2011). MCPH1 regulates chromosome condensation and shaping as a composite modulator of condensin II. J Cell Biol. 194 (6): 841-54.

Yu TW, Mochida GH, Tischfield DJ, Sgaier SK, Flores-Sarnat L, Sergi CM, Topçu M, McDonald MT, Barry BJ, Felie JM, Sunu C, Dobyns WB, Folkerth RD, Barkovich AJ, Walsh CA (2010). Mutations in WDR62, encoding a centrosome- associated protein, cause microcephaly with simplified gyri and abnormal cortical architecture. Nat Genet. 42: 1015-20.

Zhao L, Jin C, Chu Y, Varghese C, Hua S, Yan F, Miao Y, Liu J, Mann D, Ding X, Zhang J, Wang Z, Dou Z, Yao X (2010). Dimerization of CPAP orchestrates centrosome cohesion plasticity. J Biol Chem. 285(4): 2488-97.

Zhong X, Liu L, Zhao A, Pfeifer GP, Xu X (2005). The abnormal spindle-like, microcephaly-associated (ASPM) gene encodes a centrosomal protein. Cell Cycle. 4: 1227-1229.

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 131

Chapter 6 References

Electronic Database and Software Information

 Ensemble Genome Browser URL: http//www.ensemble.org/ index.html  UCSC Genome Bioinformatics URL: http//www.genome.ucsc.edu  Human Gene Mutation Database URL: http//www.hgmd.org  Online Mendelian Inheritance in Man URL: http//www.ncbi.nlm.nih.gov  dChip URL: http:// biosun1.harvard.edu/complab/dchip  Homozygosity mapper URL:http://www.homozygositymapper.org  National Center for Biotechnology Information (NCBI) Entrez Genome Map Viewer URL: http://www.ncbi.nlm.nih.gov/mapview  Gene Paint URL:http://www.genepaint.org/Frameset.html  Gene Cards URL:http://www.genecards.org  Gepis Tissue URL:http://www.cgl.ucsf.edu/cgi-bin/genentech/genehub-gepis/web_search  Primer 3 (version 0.4.0) URL:http://frodo.wi.mit.edu/primer3  Bio-edit (version 7.0.5 ) URL:http://www.mbio.ncsu.edu/BioEdit/bioedit.html

Mapping of Genes Responsible for Autosomal Recessive Primary Microcephaly 132