MIT’s The Weather Oldest and Largest Today: Mostly sunny, 41°F (5°C) Tonight: Mostly clear, 28°F (-2°C) Newspaper Tomorrow: Partly cloudy, chance of rain or snow, 38°F (3°C) Details, Page 2 http://tech.mit.edu/

Volume 129, Number 63 Cambridge, Massachusetts 02139 Wednesday, January 27, 2010 DSL To Reassess MIT Dining, Reduce Large Annual Deficits By Robert McQueen This past week, Colombo met Colombo said that DSL is looking Associate News editor with some of the high-level UA for new ways to assist this com- Facing an average annual deficit of members to explore new ways to munity including maintenance of $500,000 from the MIT Dining Pro- approach dining. Participants at the dorm kitchens and giving advice on gram, the Division for Student Life meeting divided the MIT community healthy food options. will be working with MIT commu- into three separate groups: cook for For example, this past semester, nity leaders this spring in an effort to yourself, self-sustaining organiza- DSL Senior Administrative Assistant improve the current dining program. tions, and house dining. Colombo Victoria Davenport offered culinary While there is no strict timeline for plans to improve dining by tailoring classes in one of the East Campus making changes to dining, Dean for to each community and meeting with kitchens to teach students how to Student Life Chris Colombo hopes housemasters, executive dining com- prepare meals on their own. to prepare a plan by the end the aca- mittees, and dining chairs. Self-sustaining communities demic year that will reduce financial The “cook for yourself ” com- include fraternities, sororities, and loss while preserving student choice. munity includes those students who independent living groups that of- As of now, no changes to the dining feed themselves and do not partici- fer a room and board plan to their program are being made. pate in the house dining program. members. Colombo made it clear that students in self-sustaining and ‘cook for yourself’ communities will MIT Community Joins not be forced to participate in house dining plans.

Several recommendations have Jasmine Florentine—The Tech been made by the Blue Ribbon Din- Much to the delight of East Campus residents, the promise of In Haiti Relief Efforts; ing Committee and Institute-Wide a horse riding event during last weekend’s Bad Ideas Compe- Planning Task Force to improve tition was not, in fact, a joke. Dominika Nawrot is seen here house dining. The final reports of riding a horse in McDermott Court on Saturday. Bad Ideas is a Students Raise Funds both called for the replacement of series of quirky IAP events that encourage their organizers to forgo “requirements and ‘good engineering practice.’” By Ziwei Hao ty projects that benefit Haitian people Dining Update, Page 15 Staff Reporter who were affected by the earthquake. After the magnitude 7 earthquake Sally Susnowitz, Director of the struck Haiti on Tuesday, January 12, MIT Public Service Center, said, “Peo- the MIT community has responded ple in Haiti will need help over a long Domeview, Projection Systems quickly by raising funds and initiat- period of time: some work might need ∞ ing relief projects. to be done from here; some might in- The Council for the Advance- volve travel to Haiti when it is safe and ment of Black Students — composed productive for students to go. Likewise, Merging, Now ‘Infinite Display’ of the executive chairs and members some of the public service work might of the Black Student Union, the Ca- involve student-initiated projects, and By John A. Hawkinson fice, and continuing now that he is a finite Display team said at kick-off ribbean Club, African Student As- some might come from the needs that News editor project manager for the Division of session yesterday. Infinite Display sociation, Chocolate City, and Black non-governmental organization and Domeview, the digital display Student Life. also adds a flat panel display in Lob- Women’s Alliance — was the first to community organizations articulate.” advertising system in the Student The Infinite Corridor projectors by 10. initiate relief efforts on campus. Members of the Media Lab are Center and the Stata Center’s Stu- have been managed by MIT Audio Like Domeview, Infinite Display The council ran a donation booth also working on projects to help dent Street is merging with the pro- Visual, and have primarily catered continues to offer three days of free in the Student Center between Janu- with rebuilding Haiti. Dale Joachim, jected advertising displays in the to Institute departments. Domeview, advertising per term to recognized ary 18 and 22 in an effort to raise a visiting scientist, led a “Haiti IAP Infinite Corridor to form a new sys- on the other hand, has primarily ca- student groups, though not in the funds. Those who donated were giv- Workshop” to discuss the current tem called “Infinite Display,” http:// tered to student groups, though both Infinite Corridor, only in the Student en the choice to support six differ- state of affairs in Haiti and to brain- infinitedisplay.mit.edu/. systems have broadened their client and Stata Center. Infinite Display is a ent organizations already working in storm innovations to benefit relief Domeview was originally a 2004 base. bit less flexible: it requires such free Haiti: Partners In Health, Red Cross, efforts. Joachim discussed using a iCampus project that was conceived The new Infinite Display takes ads to run for three consecutive days Doctors Without Borders, Catholic network of XO laptops from One by former UA President Harel M. features from both existing systems. on the three displays in W20 and the Relief Services, UNICEF, and the Laptop Per Child to relay video and Williams ’05 and former UA Treasur- Infinite Display uses Domeview’s two displays in Stata. Under Dom- UN World Food Programme. Each voice messages from Haiti. er John Velasco ’05, and it launched model of 20-second static displays, eview, groups had the discretion to organization is serving different Around 40 laptops are being tak- in 2006. In recent years, it has been rather than MIT A/V’s model of two- allot their free ads as they saw fit. needs in Haiti, such as food, first aid, en right now to be used for the relay maintained by Joshua Velasquez ’08, minute Powerpoint presentations. Infinite Display charges student or shelter. As of yesterday morning, of information, he said last week. An initially while Velasquez worked The 20-second model better fits the the booth had raised $2,941.45. eWeek Europe article posted on the for the Student Life Programs Of- attention span of passers-by, the In- Infinite Display, Page 15 In addition to their fundraising, OLPC website said 14,000 XO lap- the council is organizing a Haiti Re- tops had been sent to Haiti prior to lief Benefit Showcase this Friday, at the quake, and OLPC has pledged to 7 p.m. in Kresge Auditorium, from send more faster. which they hope to raise $10,000. The “In order for us to help recraft Sex Changes Just Got Easier! show, entitled “L’Union Fait La Force,” Haiti’s society, it’s important to un- or “Strength Through Unity,” requests derstand the citizens’ needs and The Registrar’s Office has modified its require- requirement. Many possible options were discussed, a minimum donation of $5 per person. perspectives. The technology we are ments for students to officially change their recorded and the Registrar’s Office finally decided to model Kamil S. Gedeon ’11, the Vice Presi- using is a quick way to surface the gender. Since last week, instead of requiring evi- its gender change policy after that of Massachusetts’s dent of the Caribbean Club, and Dy- voices of the people,” said Joachim. dence of sex-change surgery, students now may pro- Registry of Motor Vehicles. lon R. Rockwell ’11, the Vice Chair- He also said that Haiti’s recon- vide documentation from a licensed health care pro- After approximately two months of discussion be- man of the National Society of Black struction would benefit from MIT fessional to verify their gender with the Registrar. tween the Registrar’s Office and MIT’s Office of Gen- Engineers, are heading the event. projects involving energy efficiency. The former requirement for surgery was a “very eral Counsel to confirm the legality of the change, the “One big thing people need to “In an academic environment such high bar,” said Abigail M. Francis, program coordi- new policy was finalized. know is that the earthquake is going to as MIT, people should use Haiti as nator for LBGT services, resources, and outreach While there is no general policy among univer- have long-term effects,” said Gedeon, a case study for how to rebuild the at MIT. While many transgendered students may be sities regarding gender change, MIT’s new policy is whose family members living in Haiti society in energy-efficient way.” confident in their gender identity, they may not neces- among the most accepting, Francis said. were affected by the earthquake. Yasmine R. Doleyres ’12, who sarily wish to undergo a full sex-change because of Francis and the Trans Issues Group will monitor “While short-term monetary do- e-mailed out last week for donations financial or personal reasons. how the change affects transgendered students, work- nations are beneficial and will help and support, thanked the community “The world has moved on a bit since we devel- ing with groups such as MIT Housing and Medical out, we need to also focus on long- for its efforts. “To the campus, I’d oped [the old] policy,” said Assistant Registrar Peter and Mental Health to ensure a smooth implementa- term projects that will help the coun- like to say thank you for your sup- R. Hayes. tion of the policy. try out, as well,” he said. port. Those of us that have family The alteration to the Registrar’s policy came after “This is really a great step in the right direction … Donations to the MIT Public Ser- and friends in Haiti hope that you a four year effort by the Trans Issues Group — an in- this policy could be very helpful for trans students,” vice Center for Haiti disaster relief will continue to pray for and support formal group of students, faculty and staff who work Francis said. will be used to fund student and facul- Haiti in any way you can.” on transgendered concerns at MIT — to update the —Meghan Nelson In Short ¶¶Undergrad P.E. registration begins drive from 9 a.m. to 5 p.m. in the Ar t s Op i n i o n World & Nation ������������2 tomorrow at 10 a.m. Graduate student Bush Room (10-105). Nouvelle Vague Review Freshman FSILG Living Opinion ��������������������������4 registration starts Monday February 1. To sign up and view the class sched- ¶¶Registration Day is next Monday, Page 6 Page 4 Arts ��������������������������������6 ule, go to http://mitpe.com. February 1. Don’t forget to meet A Contemporary Outlook The Supreme Court’s Campus Life ������������������8 with your advisor. ¶¶Save a Life. On Monday, February on the Role of Music Supreme Mistake Fun ��������������������������������9 1, the Gift Of Life organization will Send news information and tips to Page 7 Page 5 Sports ��������������������������16 be coming to hold a bone marrow [email protected]. Page 2 The Tech January 27, 2010 Wo r l d & Na t i o n Courts Emerging as Battlefield for Rising Criticism for Both Fights Over Climate Change By John Schwartz The New York Times Deficit and Solutions The tiny village of Kivalina, Alaska, does not have a hotel, a restaurant or a movie theater. But it has a very big lawsuit that might affect the way By Jackie Calmes have the authority to force Congress George W. Bush left office. the nation deals with climate change. The New York Times to vote on its suggestions. But the long-term budget outlook, Kivalina, an Inupiat Eskimo community of 400 perched on a barrier WASHINGTON The debate was just the latest according to the office, is persistent island north of the Arctic Circle, is accusing two dozen fuel and utility Advocates of more aggressive demonstration of the intensity of high deficits that will accumulate to companies of helping to cause the climate change that it says is accelerat- steps to address the national debt the election-year fight shaping up drive the debt ever upward, to the ing the island’s erosion. failed on Tuesday in their effort to over the nation’s rising debt and its point that it could equal the value of Blocks of sea ice used to protect the town’s fragile coast from October create a bipartisan commission to causes and solutions. the nation’s entire economic output on, but “we don’t have buildup right now, and it is January,” said Janet press for tax increases and spending The issue will be a major theme by 2020. Mitchell, Kivalina’s administrator. “We live in anxiety during high-winds cuts, but President Barack Obama of Obama’s nationally televised With hiring lagging behind the seasons.” now plans to establish a similar pan- speech Wednesday night, as he recovery that began in the second The village wants the companies, including ExxonMobil, Shell Oil, el by executive order in his State of seeks to respond to the public’s con- half of last year, the budget office and many others, to pay the costs of relocating to the mainland, which the Union address on Wednesday. cern about the budget deficit. But his forecast that the unemployment rate could amount to as much as $400 million. The proposal for a commission responses so far, including the debt would remain at 10 percent through The case is one of three major lawsuits filed by environmental groups, died when its supporters could not commission and a proposed three- this year. That will keep Democrats private lawyers and state officials around America against big producers muster enough votes in the Senate to year freeze on domestic programs, on the defensive in a congressional of greenhouse gases. And though the village faces a difficult battle ahead, push it ahead, reflecting unwilling- drew howls of anger on Tuesday election year. But even by 2012, the cases are picking up steam. ness among many Republicans to from his party’s left, which objected when Obama faces re-election, the back any move toward tax increases to his exempting defense spending jobless rate would be just below 9 and objections among Democrats to while putting Medicare and Med- percent, the budget office project- Allies Doubt Taliban Leaders Would the prospect of deep spending cuts icaid on the chopping block. At the ed. in Medicare and Medicaid. While same time, he earned mainly deri- A $1.3 trillion deficit for this Accept Olive Branch 53 senators voted for the plan and sion from Republicans. fiscal year would equal about 9.2 By Mark Landler and Helene Cooper 46 against, it needed 60 votes to be Just before senators voted, the percent of gross domestic product. The New York Times WASHINGTON approved under Senate rules. Congressional Budget Office re- Last year’s $1.4 trillion deficit was As the Obama administration pours 30,000 additional troops into Af- The alternative panel to be estab- leased a report projecting that the nearly 10 percent of gross domestic ghanistan, it has begun grappling with the next great dilemma of this long lished by Obama will also come up deficit for this fiscal year, which product, making it the largest since war: whether to reconcile with the men who sheltered Osama bin Laden with recommendations by December ends Sept. 30, would be $1.3 trillion. World War II measured against the and still have close ties to al-Qaida. to reduce annual budget deficits and That is a slight improvement over size of the economy. The Afghan president, Hamid Karzai, has said he wants to reach out slow or reverse the growth of the na- last year’s shortfall, because of ear- But the budget office said that to the leaders of the Taliban, and administration officials acknowledge tional debt. But unlike the commis- ly, fragile signs of economic growth, additional stimulus spending and tax privately that they are considering the idea. But they warn that the plan sion proposal killed by the Senate, and it would be a return to the an- cuts could well result in a deficit for is rife with political risk at home and could jeopardize a widely-backed Obama’s bipartisan panel would not nual level projected when President this year that exceeds last year’s. effort to lure lower-ranking, more amenable Taliban fighters back into Afghan society. The debate, still in its early stages, could shape the next phase of America’s engagement in Afghanistan, officials said, and is every bit as Once Pay is Divvied Up, Little is complicated as the decision on whether to commit more soldiers, not least because it rekindles memories of the Sept. 11 terrorist attacks. On Thursday, donor countries, led by the United States, Britain and Left for Banks’ Shareholders Japan, are expected to commit $100 million a year to an Afghan fund for reintegrating the foot soldiers of the Taliban with jobs, cash and other By Eric Dash wiped out every penny of profit. After to collect a Goldman-style paycheck. inducements. But the allies are less sanguine about dealing with the Tali- The New York Times paying its employees and returning If compensation were spread evenly ban’s high command, particularly its leader, Mullah Mohammad Omar, NEW YORK billions of bailout dollars, Citigroup among the bank’s 36,200 employ- and other “hard-core” Taliban elements which, the administration bluntly Finding the winners on Wall Street posted a $1.6 billion annual loss. ees, each would take home about declared last March, were “not reconcilable.” is usually as simple as looking at pay. Granted, the bankers and traders $447,000. Rarely are bankers who lose money who work for Wall Street’s biggest But to keep up with the Goldmans, paid as well as those who make it. moneymakers are still collecting the laggards like Citigroup are handing Four Arrested in Plot to Tamper But this year is unusual. A handful richest rewards. But this bonus sea- out fat slices of their profits, leaving of big banks that are struggling in the son, banking executives are rethinking little left over for their sharehold- With Phones of Senator post-bailout world are, by some mea- how to divide the spoils. ers. Citigroup is, in effect, paying its By Campbell Robertson and Liz Robbins sures, the industry’s most magnani- Goldman Sachs, that highest of employees $1.45 for every dollar the The New York Times NEW ORLEANS mous employers. Roughly 90 cents highfliers, is doing the unthinkable. company took in last year. On average, Federal officials charged four men on Tuesday with plotting to tamper out of every dollar that these banks It is giving its employees an unusu- its workers stand to earn $94,000. with the telephone system in the New Orleans office of Sen. Mary Lan- earned in 2009 — and sometimes ally small cut of its profits — about Bank of America, meantime, is drieu, D-La. One of the men was a filmmaker who gained fame last year more — is going toward employee 45 cents out of every dollar — even spending 88 cents of every dollar it by secretly recording members of the community group ACORN giving salaries, bonuses and benefits, accord- though its paydays will, in dollar made in 2009 to compensate its work- him advice on how to set up a brothel. ing to company filings. terms, rank among the richest of all ers. At Morgan Stanley, that figure is All four of the men arrested Monday in New Orleans, each in his mid- Amid all the commotion over the time. 94 cents. JPMorgan Chase, which has 20s, were charged with entering federal property under false pretenses large bonuses that many bankers are That 45-cent figure, known as the fared better than those three, paid out with the intent of committing a felony, according to the U.S. attorney’s collecting, what stands out is not only payout ratio, represents the amount of 63 cents of every dollar. office for the Eastern District of Louisiana. They appeared in court Tues- how much the stars are making. It is compensation that Goldman is meting Citigroup, Bank of America and day, also how much of the profits that less- out relative to the pool of profits avail- Morgan Stanley — all of which have If convicted, the four would face sentences ranging from a fine to 10 er lights are taking home. able for compensation. Until recently, repaid their federal aid — defend years in prison. To compete with well-heeled ri- the ratio for most Wall Street banks their pay practices. Press officers for The filmmaker was James O’Keefe, 25, who has gained renown in vals, banks like Citigroup are giving hovered around 60 cents of every dol- the banks say a number of factors, conservative circles by poking fun at the left through pranks and under- their employees an unheard-of cut of lar, in line with other labor- and talent- from one-time accounting charges to cover video. the winnings. Citigroup paid its em- intensive industries like retailing and the constant need to lure and retain The men were arrested by U.S. marshals. ployees so much in 2009 — $24.9 health care. top producers, drove decisions about billion — that the company more than Most Americans would be thrilled compensation. We a t h e r Return of the Freeze Situation for Noon Eastern Standard Time, Wednesday, January 27, 2010

By John Agard 130°W 125°W 120°W 115°W 110°W 105°W 100°W 95°W 90°W 85°W 80°W 75°W 70°W 65°W 60°W Staff Meteorologist 40°N The small warm-up that has occurred in the Boston area at the beginning of this week has had many people thinking that the worst part of the winter is 1004 over, and that spring is just around the corner. With temperatures in the 50s°F 1034 (above 10°C) for most of the day on Monday, several parts of the Charles 35°N River have even begun to unfreeze. Astronomically, however, there are still two months remaining in the win- ter season, and more of the coldest weather of the year almost certainly still lurks ahead. In fact, while high temperatures will remain above the freezing 1024 point for today and tomorrow, the passage of a cold front tomorrow night will 30°N see temperatures dive into the teens °F (below 6°C). A few light rain or snow showers may pass through Thursday afternoon

ahead of the cold front, which will pass over the area tomorrow night, sending 1027 temperatures plunging to around 20°F (-7°C). Even colder air will arrive Fri- 25°N day night, with temperatures lower than 15°F (-10°C), additionally ushering 1012 in a chance of snow showers for the weekend.

Extended Forecast Today: Mostly sunny, high 41°F (5°C). Winds W at 8–14 mph. Tonight: Mostly clear, low 28°F (-2°C). Winds SW at 4–8 mph. Weather Systems We ather Fronts Precipitation Symbols Other Symbols Snow Rain Fog Tomorrow: Partly cloudy with a chance of light rain or snow in the afternoon, High Pressure Trough - - - Showers high 38°F (3°C). Winds SW at 10–16 mph. Thunderstorm

Q Q Q Q Wa rm Front Light Low Pressure Haze Friday: Sunny and breezy with highs in the low 20s°F (-6°C). LLLLL Cold Front Moderate Compiled by MIT Saturday: A chance of snow showers, highs around 20°F (-7°C). Hurricane Q Q Meteorology Staff L L Stationary Front Heavy and The Tech January 27, 2010 Wo r l d & Na t i o n The Tech Page 3

Democrats Put Lower Priority Cameron’s ‘Avatar’ Tops His ‘Titanic’ As Highest Grosser On Health Bill By Michael Cieply The New York Times LOS ANGELES By David M. Herszenhorn this year to work on the health bills approach. James Cameron’s science-fiction epic A“ vatar” has passed his “Titan- and Robert Pear passed in 2009 by the Senate and the Some Democrats said they did ic” to become history’s highest-grossing film, with a sizable boost from The New York Times House. not expect any action on health care higher-priced tickets for 3-D and Imax showings. WASHINGTON Reid said he and the House speak- legislation until late February at the “Avatar,” like other contemporary films, has also benefited from the With no clear path forward on er, Nancy Pelosi, were working to map earliest, perhaps after Congress re- steady inflation of ticket prices —today’s average is $7.46, up from $4.69 major health care legislation, Demo- out a way to complete a health care turns from a weeklong recess after in 1998 when “Titanic” was in theaters — meaning that “Titanic” had cratic leaders in Congress effectively overhaul in coming months. “There Presidents’ Day. But the Democrats to sell many more tickets to reach box-office totals like A“ vatar’s.” But slammed the brakes on President Ba- are a number of options being dis- stand to lose momentum, and every “Avatar” remains poised to keep going for weeks if not months. rack Obama’s top domestic priority cussed,” he said, emphasizing “proce- day closer to the November election Through Monday its ticket sales around the world reached $1.86 bil- on Tuesday, saying they no longer felt dural aspects” of the issue. could reduce their chances of passing lion, edging past the $1.84 billion in sales posted by “Titanic,” which pressure to move quickly on a health At the same time, two centrist a far-reaching bill. came out in December 1997. Through Monday “Avatar” took in about bill after eight months of setting dead- Democrats who are up for re-election The gear shifting by Democrats $554.9 million in domestic theaters, placing it just behind “Titanic,” with lines and missing them. this year, Sens. Blanche Lincoln of underscored how the health care effort sales of $600.8 million, in the domestic box-office rankings, and just The Senate majority leader, Harry Arkansas and Evan Bayh of Indiana, had been derailed by the Republican ahead of “The Dark Knight,” a Warner Brothers film from 2008, which Reid, D-Nev., deflected questions said they would resist efforts to mus- victory in the Massachusetts special took in $533.3 million. about health care. cle through a health care bill using a election last week, which effectively The performance of “Avatar” is particularly striking because the film “We’re not on health care now,” parliamentary tactic called budget denied Democrats the 60th vote they — a leading Oscar contender this year — reached its summit so quickly. Reid said. “We’ve talked a lot about reconciliation, which seemed to be the need to overcome a Republican fili- it in the past.” easiest way to advance the measure. buster in the Senate. Originally, Reid He added, “There is no rush,” and The White House had said in re- wanted to finish a bill early last Au- Verizon Posts Loss, Citing Charge noted that Congress still had most of cent days that it would support that gust. Related to Layoffs By Jenna Wortham The New York Times Haiti’s Quake Set Children Adrift Verizon reported a fourth-quarter loss of $653 million on Tuesday, mostly because of costs related to layoffs, despite a 10 percent increase in revenue. In a World of Chaos The company also said it planned to cut an additional 13,000 jobs this year. By Deborah Sontag “broken people,” she said. with the smell of death still fouling The company said it added 2.2 million wireless subscribers in the The New York Times Growing closer, she saw her moth- the air, children can be seen in every quarter, up substantially from the 1.2 million added a year earlier. CROIX DES BOUQUETS, Haiti er, lifeless. She froze, she said, even- devastated corner resiliently kicking The quarterly loss came to 23 cents a share and contrasted with a prof- Not long after 14-year-old Daphne tually watching as her mother’s body soccer balls, flying handmade kites, it of $1.24 billion, or 43 cents a share a year earlier. It took a charge of $3 Joseph escaped her collapsed house on was dumped in a wheelbarrow and her singing pop songs and ferreting out billion, or 66 cents a share, related to severance expenses in the quarter. the day of the earthquake, she boarded only parent vanished into the chaos. textbooks from the rubble of their Revenue rose to $27.1 billion, from $24.65 billion in the period a year a crowded jitney with her uncle and “I wanted to kill myself,” Daphne schools. But as Haitian and interna- earlier, much of it because of the acquisition of the Alltel Corp. Still, crawled in traffic toward the capital, said in a whisper. tional groups begin tending to the the results fell short of Wall Street expectations. “Like all U.S. carriers, where her single mother sold beauty Haiti’s children, 45 percent of the neediest among them, many children Verizon has felt the impact of the macro environment in 2009,” wrote products in the Tete Boeuf market- population, are among the most disori- are clearly traumatized and at risk. Julien Blin, an independent analyst who keeps a keen eye on the wireless place. “Mama,” she said she repeated ented and vulnerable of the survivors “There are health concerns, mal- industry, in a note to clients Tuesday. “However, we should start to see to herself. “Mama, I’m coming.” of the earthquake. By the many tens of nutrition concerns, psychosocial is- signs of recovery in 2010.” Abandoning the slow-moving jit- thousands, they have lost their parents, sues and, of course, we are concerned During a call to investors and analysts on Tuesday, Verizon’s chief fi- ney, Daphne, petite and delicate, got their homes, their schools and their that unaccompanied children will be nancial officer, John Killian, said the company would continue to trim separated from her uncle and jumped bearings. They have sustained head exploited by unscrupulous people who costs to combat the deterioration of its residential wireline phone busi- onto a motorcycle-for-hire. She ar- injuries and undergone amputations. may wish to traffic them for adoption, ness and its corporate business that is still recovering from the recession. rived alone at a marketplace in ruins They have slept on the street, foraged for the sex trade or for domestic ser- Over the last two years, the company eliminated 26,000 jobs in its wire- and ran, in her dusty purple sandals, for food and suffered nightmares. vitude,” said Kent Page, a spokesman line sector. Verizon employs about 223,000 people. toward a pile of debris laced with Two weeks after the earthquake, for UNICEF.

Interested in the new ENERGY MINOR? Both courses are options that meet part of the requirements for this minor. 12.348 Global Climate Change: 12.340 Global Warming

Economics, Science and Policy Science M 3-5, W 3-4 E25- 117 TR 9:30-11 54-1615

What are the implications of these 2 graphs for: ENERGY • ENVIRONMENT • ECONOMICS? Learn the science that can provide some answers. Page 4 The Tech January 27, 2010 Op i n i o n Letters To The Editor

greatness and terribleness of bands is univer- That’s not to say that I don’t agree with Chairman Re: ‘How the sally held by the l33t), Fisher says we need a Fisher that Spring Weekend acts haven’t been Austin Chu G rock band that writes “new” music — 1) “new that great. But unlike Fisher, I don’t think a ral- Editor in Chief Boy Bands Killed and good” does not translate to “I’d want to see lying call will make students choose Kings of Nick Bushak ’10 Mainstream Rock’ that live” and 2) calling music “new” is like Leon over Ben Folds. I do, however, think that Business Manager “discovering” the New World (serious people a rational, serious, non-condescending attempt Mark Thompson ’11 Wah-wah-wah-why-wasn’t-I-born-in-the- know it’s all a lie). to have acts be chosen in a representative de- 60’s arguments seem to be the calling card of Regardless, people aren’t living in a para- mocracy instead of a democracy (i.e. vote for Managing Editor our generation. Subtract a few years and I’m lyzing wake from Boy Bands. Lots of people people who you think know about music/live Steve Howland ’11 sure you’d get the calling card of the generation just don’t like The Shins or The Strokes or shows and would get a good act) could work. Executive Editor before us. And so on. maybe Spoon. Lots of people don’t hail rock But until then, you probably won’t get far by Michael McGraw-Herdeg G It doesn’t bother me that Matt Fisher thinks and roll as the God of music (what about The telling people who democratically elected the News Staff current popular music is garbage, but leave Roots? Jay-Z? Daft Punk?). Lots of people last years’ bands that they have bad taste in mu- Editors: John A. Hawkinson ’98, Jeff Guo ’11, Pearl Jam out of it. know it’s only particles anyway so you might as sic. And please, leave Pearl Jam out of it. (Seri- Natasha Plotkin ’11; Associate Editors: Pearle Besides acting like music is objective (i.e. well have a fun band instead of an extra serving ously, have you seen their live performances?) Lipinski ’12, Maggie Lloyd ’12, Ana Lyons assuming his opinions about the goodness and of vegetables and intellectualism. Brian C. Wheeler ’10 ’12, Robert McQueen ’12; Staff: Vinayak Ranade G, Daniela Cako ’09, Elijah Jordan Turner ’11, Jingyun Fan ’12, Ziwei Hao ’12, Camille Z. McAvoy ’12, Sandhya Rawal ’12, Zeina Siam ’12, Margaret Cunniff ’13, Joy E. Late to the Party Lee ’13, Meghan Nelson ’13, Jessica J. Pourian ’13, Yuliya Preger ’13, Divya Srinivasan ’13; Meteorologists: Brian H. Tang G, Allison A. Democrats Will Find It Difficult to Siphon Populist Energy from the Right Wing G, Angela Zalucha G, Elizabeth Maroon ’10, Vince Agard ’11. Democrats will face charges that they’re put- does, the response from Fox News was apo- Production Staff Keith Yost ting trees before working men and women. On plectic rage, but on MSNBC, where the presi- Associate Editors: Divya Chhabra ’13, Connor immigration, Democrats will draw the ire of dent should have heard nothing but love for his Kirschbaum ’13, Aislyn Schalck ’13; Staff: The french politician Alexandre Ledru- blue collar voters who think they’re being re- plan to extend insurance to millions, he instead Joanna Kao ’13. Rollin, upon seeing a crowd marching through placed. And on financial reform, where Demo- received indifference and apathy. Scapegoat- Opinion Staff Paris, supposedly once said: “There go my crats should be enjoying a target-rich political ing insurance companies may have made good Editors: Joseph Maurer ’12, Ethan Solomon people. I must find out where they’re going so hunting ground, old hands like John McCain politics on paper, but in practice it created a ’12; Staff: Florence Gallez G, Alejandro Rogers conflict in the message and denied Democrats B. G, Gary Shu G, David Weinberg G, Keith A. I can lead them.” In the wake of their humili- are already beating them to the punch, de- Yost G, Josh Levinger ’07, Daniel Yelin ’10, ating defeat in Massachusetts, many Demo- manding things like a return of Glass-Steagall the energy they should have mustered from Ryan Normandin ’13. cratic strategists are now embracing the spirit and railing against banker excesses. On almost their own base. Sports Staff of Ledru-Rollin, urging their party to adopt a any issue, the Democrats are going to find that For the sake of good policy, as well as their Editor: David Zhu ’12; Staff: Aaron Sampson more “Main Street” tone in order to survive the Republicans have populist cards of their own, electoral future, Democrats should not contort ’10, Michael Gerhardt ’12, Nydia Ruleman ’12, mid-term elections this November. and that there is a difference between being themselves into populist positions. Instead, Russell Spivak ’13. For the left wing, which has always viewed pro-union and being pro-labor. their chances for success next November will Arts Staff itself as the unappreciated champion of the In truth, the health care debate itself is a be best maximized by taking centrist stances Editor: S. Balaji Mani ’10; Associate Editors: common man, it is natural to think that the role prime example of how force-fitting populist and arguing them with honesty and transpar- Maggie Liu ’12, Samuel Markson ’12; Staff: of populist will come easy: bash some corpora- narratives to liberal economic policies is a rec- ency. Despite the energy imparted by the Tea Sudeep Agarwala G, Bogdan Fedeles G, Matt tions, rail against some monied interests, be- ipe for trouble. Democrats couched health care Party Movement, Republicans are still a party Fisher ’10, Joyce Kwan ’10, Joanne Y. Shih ’10, moan the unfairness of free trade, and soon, all reform in anti-corporate, pro-little guy terms struggling to bridge the distance between their Kevin Wang ’10, Tracy Kambara ’11, Sun K. those angry tea partiers will be eating out of from the very beginning. Rather than waxing moderate and conservative wings. If Demo- Kim ’11, Yü Linlin Huang ’13, Emily Nardoni ’13, Jenny Xie ’13. your hand. academically about information asymmetries crats raise issues on which they can find bi- Reality will be cruel to these liberal illu- and the legitimate economic rationale for in- partisan support, and argue them in a way that Photography Staff sions. For while Democrats are quick to claim surance mandates, Democrats decided that invites left-leaning Republicans to break from Editors: David M. Templeton ’08, Andrea Robles ’10; Associate Editors: Vibin Kundukulam ’11, that they represent the economic interests of such honesty was too cerebral for the common the party proper, they will draw a dividing line Jessica Liu ’13, Sunny X. Long ’13, Sam Range the working class, their recent voting history voter, and instead they told a simplistic story through the GOP that will force populists to ’13; Staff: Vincent Auyeung G, David Da He has done them no favors. The bailout of Wall about the evilness of insurance companies and pick sides. As the left-wing base is now pain- G, Perry Hung G, Sheng-Ying Aithne Pao G, Street was passed with mostly Republican, not the plight of the sick and poor. fully learning, nothing defeats an activist spirit Arthur Petron G, Melissa Renée Schumacher G, Democratic, dissent. The fiscal stimulus, af- The nuance between despising private in- like the cynicism that comes through fighting Martin Segado G, Noah Spies G, John Z. Sun ter failing to bring unemployment down, now surance companies and reforming insurance your own kind. G, Scott Johnston ’03, Martha Angela Wilcox ’08, Eric D. Schmiedl ’09, Biyeun Buczyk ’10, seems like only so much business-as-usual markets turned out to be an important one. Democrats, rather than trying to find some David Chen ’10, Helen Hou ’10, Monica Kahn Beltway pork. The back room politics of the Insurance mandates hardly sound like punitive vein of popular thinking to exploit, should have ’10, Corey Kubber ’10, Alice Li ’10, Diane Rak health care reform — awarding sweetheart vengeance against evil corporations. In some faith in the proposition that a good idea, hon- ’10, Jongu Shin ’10, Christian J. Ternus ’10, deals to powerful unions and recalcitrant states regards, they can even sound like the oppo- estly argued, will win public support. Embrac- Michael Yu ’10, Dhaval Adjodah ’11, Jasmine — gives those who received no such special site: rewarding the supposed misbehavior of ing centrism now may seem to some on the Florentine ’11, Dan Kubaczyk ’11, Michael treatment the feeling that they’re the suckers in corporate giants with millions of captive new left like capitulation. But the real capitulation Y. McCanna ’11, Michael Meyer ’11, Aaron Thom ’11, Allison M. Alwan ’12, Yuanyu Chen all of this. customers. This did not go unnoticed by those would be to take another sound policy, like in- ’12, Rachel Fong ’12, Jessica Lin ’12, Rui Luo Future issues are just as likely to yield little who bought into the evil insurers theory. As surance mandates, and ruin it through populist ’12, Andrew Shum ’12, Meng Heng Touch ’12, traction with populists. On climate change, could be expected with anything the President whitewashing. Jennifer L. Wong ’12, Feng Wu ’12, Melanie Adams ’13, Arfa Aijazi ’13, Cole Houston ’13, Elijah Mena ’13, Oscar A. Viquez Rojas ’13. Campus Life Staff Let’s Regulate the Freshmen in FSILGs. Editor: Michael T. Lin ’11; Staff: Roberto Perez-Franco G, Christine Yu ’11; Cartoonists: Michael Ciuffo ’11, Ben Peters ’11, Michael Benitez ’12. likely that the illicit practice today largely con- move in. Competition between houses and Michael McGraw-Herdeg sists of freshmen men moving into fraternities. pressure from administrators would give these Business Staff The program should exclude FSILGs which rules teeth. Advertising Manager: Greg Steinbrecher ’12; Operations Manager: Sherry Yan ’11; Staff: An unknown number of second-semester are unsafe (for example, any which get fresh- For years MIT has required that freshmen Wendy Cheng ’13, Moya Chin ’13, Jennifer freshmen choose to live in their fraternities, men dangerously drunk), which compromise pay for two semesters of dorm housing but qui- Fong ’13. technically breaking MIT rules, and the Insti- freshmen’s schoolwork (so much that the fresh- etly ignored students who break the rule and Technology Staff tute does not regulate the practice. Everyone men see formal action from the Committee on move out. (See the Nov. 1, 2002 Tech article Director: Quentin Smith ’10. knows about it. Regulating the practice, rather Academic Performance), or which try to force “Some Frosh Live in Fraternities.”) This is no than pretending it does not exist, would pro- any pledge to move in. And MIT should prom- surprise: you can’t really stop adults from do- Editors at Large tect MIT students from whatever risks it may ise students a “get-out-of-FSILG-free card” in ing what they want. Contributing Editors: Caroline Huang ’10, Jessica Witchley ’10, William Yee ’10, Arkajit incur. the form of a guaranteed space in a dormitory The rule, meant to keep freshmen in dor- Dey ’11, Monica Gallegos ’11, Robin L. Dahan I propose that for a two-year trial, MIT in students’ sophomore fall. mitories, probably keeps some freshmen closer ’12; Senior Editors: Brian Hemond G, Charles should let freshmen opt out of spring semester By “exclude” I mean that FSILGs who to dorms because they don’t enjoy feeling like Lin G, Andrew T. Lukmann G, Ramya Sankar housing and move into a recognized fraternity, didn’t qualify for the program would face re- they wasted their money. Even so, some stu- G, Satwiksai Seshasai G, Shreyes Seshasai G, sorority, or independent living group. I’ll say ally big problems, like suspension, if anyone Benjamin P. Gleitzman ’09, Ricardo Ramirez “FSILG” for conciseness, although it is very found out they were illicitly letting freshmen FSILG, Page 5 ’09, Nick Semenkovich ’09, Angeline Wang ’09, Praveen Rathinavelu ’10. Advisory Board be given higher priority. Once submitted, all letters become property of Paul E. Schindler, Jr. ’74, V. Michael Bove ’83, Opinion Policy Barry S. Surman ’84, Robert E. Malchman The Tech, and will not be returned. Letters, columns, and cartoons may ’85, Deborah A. Levinson ’91, Jonathan E. D. Editorials are the official opinion of The Tech. They are written also be posted on The Tech’s Web site and/or printed or published in any Richmond PhD ’91, Karen Kaplan ’93, Saul by the editorial board, which consists of Chairman Austin Chu, Edi- other format or medium now known or later that becomes known. The Blumenthal ’98, Frank Dabek ’00, Daniel Ryan tor in Chief Nick Bushak, Managing Editor Steve Howland, Execu- Tech makes no commitment to publish all the letters received. Bersak ’02, Eric J. Cholankeril ’02, Jordan tive Editor Michael McGraw-Herdeg, Opinion Editors Joseph Mau- Guest columns are opinion articles submitted by members of the Rubin ’02, Nathan Collins SM ’03, Keith J. rer and Ethan Solomon, and Senior Editor Andrew T. Lukmann. MIT or local community and have the author’s name in italics. Col- Winstein ’03, Akshay R. Patil ’04, Tiffany Dohzen ’06, Beckett W. Sterner ’06, Marissa Dissents are the opinions of signed members of the editorial umns without italics are written by Tech staff. Vogt ’06, Zachary Ozer ’07, Omari Stephens board choosing to publish their disagreement with the editorial. ’08, Marie Y. Thibault ’08, B. D. Colen. Letters to the editor, columns, and editorial cartoons are writ- Production Staff for This Issue ten by individuals and represent the opinion of the author, not neces- To Reach Us Staff: David M. Templeton ’08, Steve Howland sarily that of the newspaper. Electronic submissions are encouraged The Tech’s telephone number is (617) 253-1541. E-mail is the eas- ’11, Divya Chhabra ’13, Connor Kirschbaum and should be sent to [email protected]. Hard copy submissions iest way to reach any member of our staff. If you are unsure whom to ’13, Aislyn Schalck ’13. should be addressed to The Tech, P.O. Box 397029, Cambridge, contact, send mail to [email protected], and it will be directed to

The Tech (ISSN 0148-9607) is published on Tuesdays and Fridays dur- Mass. 02139-7029, or sent by interdepartmental mail to Room W20- the appropriate person. You can reach the editor in chief by e-mailing ing the academic year (except during MIT vacations), Wednesdays during January, and monthly during the summer by The Tech, Room W20-483, 84 483. All submissions are due by 4:30 p.m. two days before the date [email protected]. Please send press releases, requests for coverage, Massachusetts Avenue, Cambridge, Mass. 02139. Subscriptions are $50.00 of publication. and information about errors that call for correction to news@tech. per year (third class). Postmaster: Please send all address changes to our mailing address: The Tech, P.O. Box 397029, Cambridge, Mass. 02139- Letters, columns, and cartoons must bear the authors’ signatures, mit.edu. Letters to the editor should be sent to [email protected]. 7029. Telephone: Editorial: (617) 253-1541. Business: (617) 258-8324. Facsimile: (617) 258-8226. Advertising, subscription, and typesetting rates addresses, and phone numbers. Unsigned letters will not be accepted. The Tech can be found on the World Wide Web at http://tech.mit. available. Entire contents © 2010 The Tech. Printed on recycled paper by The Tech reserves the right to edit or condense letters; shorter letters will edu. Mass Web Printing Company. January 27, 2010 Op i n i o n The Tech Page 5 The Supreme Court’s Supreme Mistake

care than job creation, and they are disgusted tice Stevens, who wrote the dissenting opinion elected. President Obama has already said he Ryan Normandin with the million-dollar bonuses that banks are of the Court: intends to go to Congress and ask for a strong, still doling out to the very people that helped “In the context of election to public office, bipartisan response to this decision. While I On Thursday, January 21, the Supreme drive this country’s economy into the ground. the distinction between corporate and human have no doubt he will get one, there is little that Court, under the excuse of “freedom of speech,” In this climate, America needs politicians who speakers is significant. Although they make can be done by the executive and legislative invited heightened levels of corruption back will represent the interests of the people, who enormous contributions to our society, corpora- branches at this point. into political campaigns with a ruling that has will stand up to Wall Street’s untethered greed, tions are not actually members of it. They can- It is therefore up to the people. Midterm the potential to damage the democratic system and who are not afraid to act contrary to what not vote or run for office. Because they may be elections are coming up this year. Every citizen of elections. In 2002, the Bipartisan Campaign the lobbyists want. Yet the Supreme Court’s 5-4 managed and controlled by nonresidents, their that wields a vote has the power to decide what Reform Act, usually referred to as the McCain- ruling will do precisely the opposite. interests may conflict in fundamental respects they want. Expect to be bombarded with ads Feingold Act, was passed by Congress. This The Court uses the First Amendment, which with the interests of eligible voters. The finan- from huge, rich corporations and other special landmark legislation prohibited corporations establishes freedom of speech, to justify its rul- cial resources, legal structure, and instrumen- interests. They will ruthlessly strike at candi- and labor unions from using their money to run ing. It is extremely ironic, as it will accomplish tal orientation of corporations raise legitimate dates whose election would be harmful to them ads supporting or opposing election candidates the exact opposite. Already, the wealthiest citi- concerns about their role in the electoral pro- and support those whose policies would help in the 30 days before a presidential primary zens and the wealthiest corporations wield a cess. Our lawmakers have a compelling con- their special interests. Yet remember what these and in the 60 days before general elections. Af- disproportional amount of power and influence stitutional basis, if not also a democratic duty, interests did to us. We can allow ourselves to be ter Thursday’s ruling, which struck down this while oftentimes, the only voice that the poor to take measures designed to guard against swayed by the new power that our government part of the law, in addition to two previous rul- and the middle-class have is their vote. And the the potentially deleterious effects of corporate has handed the corrupters of democracy, or ings supporting it, big business was handed a corporations try to steal this away by attempting spending in local and national races.” we can listen to the voices within us, the ones political megaphone with which it could both to influence voters through ads before the 30 It is highly unfortunate that the other Jus- that remind us of what happened the last time drown out the average citizen and try to con- or 60 day ban preceding the election. Now, the tices could not recognize the clarity of judg- regulations on Wall Street were loosened too trol politicians to an even greater extent than voice of the many will be even further smoth- ment exercised by Justices Stevens, Ginsberg, extensively. Remember that we have the power it does today. ered by the money-laden shout of the few. The Breyer, and Sotomayor. to keep the special interests at bay, the power to It is no secret that our economy is not in same few that are responsible, in no small part, With the new ruling, politicians who sup- shape our government, and the power to vote great shape. We are still struggling to recover for this recession. Legally, McCain-Feingold port rich corporations legislatively are the ones — one power that corporations do not have. from the recession that was largely brought does not even violate the First Amendment, it who will benefit from corporate campaign The Supreme Court may have made it easier on by banks and financial institutions on Wall simply restricts corporate entities in a specified spending. In other words, the people who act for corruption to enter into the democratic sys- Street. Citizens are upset over what they see time-span to maintain the integrity of the elec- contrary to what you and I need are the ones tem, but it is up to us, as it always has been, to as an administration more focused on health tion process. I could not agree more with Jus- who are going to have an easier time getting ensure that it does not. Regulation Could Improve FSILG Safety

FSILG, from Page 4 My proposal might not save movers money al. I can only hope that given a choice, free of dormitories,” surely he would have said so. — they could end up paying a FSILG’s house unfair coercion, most students truly interested Further, if freshmen in FSILG houses face dents move out but continue to pay for a non- tax instead of an empty room’s rent. But MIT in the dorm lifestyle would continue to try it safety hazards, shouldn’t MIT be regulating the service. This proposal would correct that un- would lose little money despite the move-outs out. practice? A blanket rule that everyone breaks is fairness and help fill every dorm with people because dorm space is in high demand. (A ca- Tracking and regulating freshman move- pointless. A nuanced rule that does not outright who really wanted to be there. veat: MIT might lose the revenue it gets from outs would rid MIT of the embarrassment of ban status quo but gives houses an incentive Empty beds contribute little to dorm cul- crowding — filling dorm rooms beyond their seeing newspaper columns that say “an un- to comply would do a better job of achieving ture. But those same beds could house students official capacity, an unpopular and uncom- known number of second-semester freshmen Vest’s goal, making fraternity culture safer. returning from medical or academic leaves of fortable result of unexpectedly high freshman choose to live in their fraternities, technically I’m thinking about this issue now because absence, entering their ninth semesters of un- yields — if crowded students move out and breaking MIT rules, and the Institute does not Brian Neltner G wrote to many dorm mailing dergraduate study, or coming back to the dorms can’t be replaced.) regulate the practice.” lists with a proposal to let second-semester after living elsewhere. Those students actually Dorm residents would see few downsides. This proposal would be an enormous change freshmen live in FSILGs, visible online at want to live in an MIT dorm. Rents could go up slightly, if it turns out that to a dictum President Emeritus Charles M. Vest http://fsilg-housing.org/. He sparked thoughtful I don’t know how many freshmen — call actually living in a room costs more than rent- announced in 1998, that all freshmen must live discussion on many of those lists. Although his them “movers” — spend the spring with their ing an empty bed. House taxes wouldn’t go as in dormitories beginning fall 2001 (later “fall proposal felt unconvincing, as though it were FSILG. But I’ve talked to many students who far if more people came to dorm events. And 2002” after Simmons Hall construction de- trying to say “we promise FSILGs won’t hurt know someone whose freshman roommate students counting on AWOL roommates to lays). This followed the September 1997 alco- freshmen,” I may have missed some nuance wasn’t around much during the fall and disap- give them a little more breathing room would hol poisoning death of freshman Phi Gamma since I’m an outsider to the FSILG community. peared in the spring (some move all their posses- simply lose. (I enjoyed a Bexley “freshman Delta pledge Scott S. Krueger; in 2000, MIT Plenty of people at MIT know more about sions out of the room before the spring starts). double” to myself in spring 2005. It was OK.) apologized for its lax alcohol policies and gave what’s going on in FSILG-land than I do. We Because movers spend so little time in their To be sure, more than today’s illicit “mov- the Krueger family $4.75 million. deserve to understand why administrators and nominal dorm — at most, only their first se- ers” might leave. Today, some freshmen split How could MIT change its president emeri- FSILG leaders are satisfied with the status mester — halls which participate in “in-house time between the dorm and their FSILG and tus’s freshmen-in-dormitories rule without quo, an unenforced rule barring an unregu- rush” and value their culture have an incentive ultimately decide to stay in the dorm. Given a seeming historically insensitive or losing po- lated practice that happens all the time. Let to avoid students who might join a FSILG. choice in the spring, they might leave, depriv- litical capital? Well, by ignoring the status quo us know what’s going on — write to letters@ Halls that play the game poorly are penalized ing the dorm of their companionship and fur- since 2002, MIT has deliberately missed the tech.mit.edu. by a conspicuous absence of freshman boys in ther widening the dorm-FSILG divide. Dorms point. If Vest had meant “freshmen must pay Michael McGraw-Herdeg is The Tech’s ex- their lounges. would lose some of these people in this propos- for dormitories,” not “freshmen must live in ecutive editor. Page 6 The Tech January 27, 2010 Ar t s Concert Review INTERVIEW All Covers, All the Time Many Nouvelle Vague Interprets Decades Past By S. Balaji Mani Reasons to Arts Editor Nouvelle Vague Supported by Clare and The Reasons Somerville Theatre, Cambridge, MA Love Boston January 24, 2009 A Brief Discussion With unday night at Somerville Theatre saw an eclectic pairing of the young Clare Manchon Clare and the Reasons with the more experienced bossa-jukebox of Nou- By S. Balaji Mani S Arts Editor velle Vague. In support of their second album Arrow, Clare Manchon, her co-collaborator husband Olivier Manchon and multi-instru- lare Manchon, lead vocalist and song- mentalist Bob Hart opened the night with a writer of Clare and The Reasons, an- set of mellow numbers. With Ms. Manchon’s swered a few of The Tech’s questions voice the primary foundation for most songs, C after supporting Nouvelle Vague at the backing “Reasons” shuffled between xy- Somerville Theatre on Sunday. lophones, violin, makeshift drumkits, key- The Tech: You come from a very musical boards, and even a bowed saw to fill in the family. Was there a lot of support from your gaps. Melodies, such as the chorus for “Ooh family to go into music or did they encourage You Hurt Me So,” are easy to grasp, albeit due you to do other things? to its repetitive nature. While the songs were Clare Manchon: Ironically, there was the simplistic, Ms. Manchon’s lyrics are readily most support from my mother, Sheila, who is candid and conversational. She even sings a a school teacher. She’s just generally one of few songs in French, her husbands native lan- those magical always supportive moms. guage. The last three songs comprised what TT: What have you learned from touring Ms. Manchon dubbed the “scientific portion with Nouvelle Vague and watching them per- of the spectacular,” a closing set which kicked form? off with the tongue-in-cheek “Pluto.” The song CM: They are lovely people and great per- begins in French, addressing the late planet formers indeed, they know how to get the au- and its recent reconsideration-of-planethood S. Balaji Mani—The Tech dience involved. Our music is very different as reported by the New York Times. The verse Vocalist Karina Zeviani from Sao Paulo, Brazil channels Sting as she sings a contempla- though, but I enjoy watching them. is then repeated, in English, fully clarifying tive cover of The Police’s “So Lonely” with Nouvelle Vague at Somerville Theatre last TT: Do you have any plans to collaborate the message of the song for the majority of Sunday, January 24th. with either of the composers/arrangers in Nou- the audience. velle Vague? The most climatic parts of the set occurred of bossa nova-tinged covers of popular eight- nedys catalog), “Melt With You” (a Modern CM: Not as of now. when the instrumentation was most fitting: ies and nineties punk songs. The band combed English classic), and “Blister In The Sun” TT: You went to school in Boston. Where Mr. Manchon’s arrangements allowed Ms. through its three records to select the most (the Violent Femmes’ most memorable an- did you go, and what attachment do you have Manchon’s vocals to sit comfortably along- worthy tracks, paying equal tribute to every them). “Blister” was one of many songs that to the city? side Hart’s clarinet and his own French horn. one of its releases. The haunting “Making breathed new life on stage, contrary to its CM: Yes, Berklee College of Music. When Stage banter linked every song together in a Plans for Nigel,” an XTC cover, shifted the more subdued recorded version on Nouvelle I was at Berklee it was like living in a music sometimes abrupt fashion, eliciting groans song’s original beat and revealed Zeviani and Vague’s latest release, 3. Noguerra prompted bubble, not really living in Boston. When you (after Mr. Manchon’s many party jokes) and Noguerra’s textured vocals. The set’s dynam- the audience to clap out the well-known drum go to Berklee you eat, sleep, breathe music, or gentle laughter (in response to snippets of life ics moved nicely between lighter, softer songs, fill that bookends each verse, a feature of the at least you ought to. as a touring band). The set concluded with a and fast-paced chansons that stayed true to song curiously understated on the studio take. TT: Are you particularly excited to play hefty rendition of the Genesis staple “That’s their punk nature. The audience took a nice The group came out for two shorter encore at Somerville Theatre, a venue so “close to All,” which kept the audience focused upon breather when Zeviani and Libaux performed sets, cadged by audience applause. Nouvelle home” for you? Mr. Manchon’s trained violin work. Ms. Man- the Sex Pistols’ “God Save the Queen,” as a Vague’s distinct musicianship and allegiance CM: We loved playing there because it chon delivered one of her best vocal perfor- duet. Zeviani prodded the audience to join in to the bossa nova style provided a formulaic sounds so good. It’s very rare to fine beauti- mances of the night on this set closer. for the final chorus: “No future / No future for yet entertaining show. While the traditional ful old theatres that are so well maintained and The French collective Nouvelle Vague, the you / No future for me.” bossa beat pervaded every song, it had the filled with a professional reliable crew, it’s al- night’s headliner, came on shortly after the Nouvelle Vague survives almost com- transformative ability to achieve what few most like being in Europe! opening set starting things off with a brood- pletely on its fresh take on nostalgia. Voices covers do well: to extract the key elements of TT: What was music and performing like ing version of The Police’s “So Lonely.” The could be heard scattered throughout the audi- a classic song, and show how those elements during your college days? brains behind the band, keyboardist Marc ence, echoing the familiar lyrics of such ‘old’ withstand deliberate genre mutation. CM: It was experimentation. It was finding Collin and guitarist Olivier Libaux, were songs. The over-sexed interplay between the Nouvelle Vague will continue to tour what works and what doesn’t. The best thing joined by vocalists Helena Noguerra and overtly feminine chanteuses contributed to throughout February, and will be joined by about the college days was all the extreme tal- Karina Zeviani, bassist Oliver Smith, and this new perspective, especially on songs like Clare and the Reasons for its upcoming Can- ent all around me, I wanted to be a sponge; too drummer Spencer Cohen to perform a night “Too Drunk To Fuck” (from the Dead Ken- ada gigs. bad I’m just a human.

Concert Review Sunday Afternoons by the Brook Randall Scarlata and Jeremy Denk Perform Schubert’s ‘Schöne Müllerin’ board, or Mathias Goerne with Alfred Bren- dall Scarlata are consummate musicians for While the musicians were certainly capable By Sudeep Agarwala del. This turns out to be a great service to the whom the early Romantic song cycle is cer- in their penetrative reading of this music, ex- STAFF WRITER genre, changing lieder performances from tainly technically feasible. The central chal- tended movements such as Die liebe Farbe or Randall Scarlata, baritone party music or concert hall fare to something lenge in Sunday’s concert was to coalesce in a Trockne Blumen, seemed to lack the motiva- Jeremy Denk, piano more meaningful. Today, performances are narrative — to agree on what story Schubert tion and presence that the faster movements Isabella Stewart Gardner Museum free to achieve their more intimate consum- is trying to tell, or how he tells it. embodied. January 17, 2010 mation. Accomplished accompanists paired Faster movements of the work were cer- For the hackneyed poetry and music that with talented soloists produce a performance tainly more thrilling than the slower ones; hails from the completely different generation eremy Denk? Accompanist? Before you more informed to the musical underpinnings Das Wandern and Wohin?, the opening move- that is Die Schöne Müllerin, the combination scoff: of the composers’ work. ments of the twenty-song cycle, launched the of both musicians made the performance a Things are changing to a new para- Sunday afternoon’s performance at the audience into Schubert’s world of the bab- patent success. In narrative structure, Schu- Jdigm. The past century saw the rise of Isabella Stuart Gardiner Museum was, of bling brook and the love-lorn miller. Much of bert’s work sprang alive in surprisingly mod- the lied (German art song) to the ranks of course, a perfect example of all this. Bari- this momentum was lost upon the first slow ern colors. Scarlata’s rich baritone, although high art. Whereas even as late as the end tone Randall Scarlata is, of course, accom- movement, Danksagung an den Bach. This sometimes strained in the upper registers, of the nineteenth century, lieder were origi- plished in his own rite, but it was surprising is not to say that work lost much of its in- subdued the vehement drama that might of- nally composed for private performance in to see Jeremy Denk as accompanist for such timacy during these slower movements; Der fend a modern aesthetic. This subtler sense small saloons, gatherings of friends (cf., the a work. Denk (whose poignantly amusing Neugierige, a spectacular juxtaposition of of drama was reflected in Denk’s piano — Schubertiade, if you can imagine), the early thoughts on the life of a concert pianist can lullaby music with more mature lied and even always supportive of the voice, but never twentieth century saw the rise of this music be found at http://jeremydenk.net/blog) has aria-form music, particularly showcased declamatory in the moments that suggest to concert halls and major venues, great voic- repeatedly graced stages world-wide, more Denk’s and Scarlata’s ability to interact on protracted passion from the piano narrative. es (Fritz Wunderlich, Renata Tebaldi, Maria than successfully plumbing the depths of a musical level, smoothly transitioning be- The culminating vision of both singer and Callas, to name a few) towered over trem- technical interpretative and difficulty as a tween the different genres written in a single pianist plumbed the psychological depths of bling pianists obliging musical accuracy and solo pianist. To see such an accomplished musical idea. Schubert’s work to present a chilling view of artistic vision to accommodate the draconian pianist accompany Schubert’s song cycle no The work’s pivotal song, Pause, a solemn romantic love. interpretation of celebrity soloist. doubt raised brows. meditation on persisting through unrequited What a relief the Isabella Stuart Gardiner But we’re slowly beginning to un-hear Not that there was any doubt, but the com- love (and where the listener begins to ques- Museum concert series provides for us re- the sins of our predecessors: the line be- bination of Jeremy Denk with Randall Scar- tion the Miller’s sanity), lacked the vigor viewers who are wracked with guilt about twee nsoloist and accompanist is becoming lata was fundamentally successful. Sunday’s and vehemence of the earlier half of the pro- voicing opinions about performances and blurred. YouTube, for instance, features none performance provided a well-balanced tra- gram, but to a particular end, preferring the music. All performances in the ISGM con- other than Daniel Barenboim accompanying versal of Schubert’s Schöne Müllerin in the defeated melancholy of depression and in- cert series are available for free download Thomas Quasthoff in Schubert’s Winterreise. Tapestry Room of the early twentieth century sanity to another easy interpretation of mad- on their classical podcast, “The Concert” Recent recordings by Ian Bostridge feature mansion. Ability was certainly not lacking ness and anger. Much of this bitter malaise — more information can be found at www. none other than Mitsuko Uchida at the key- on the stage: both Jeremy Denk and Ran- tainted the second half of the song cycle. gardnermuseum.org. January 27, 2010 Ar t s The Tech Page 7 CD REVIEW Exhibit Review Kid Cudi Represents New A Contemporary Outlook Wave of Hip Hop On the Role of Music Surprises from a Middle-Class, Suburban Hipster ‘Seeing Songs,’ Media-Based Exhibit, Delves into The Meaning of Music By Jeff Chen like us, has no street cred; has never shot Kid CuDi a man or gone broke. But he has pain and Man on the Moon paranoia, and masks the mental scarring By Kathryn Dere At first glance it seems as if the photo Produced by Kid Cudi. Kanye West, Plain Pat caused by his father’s death with hallucino- “Seeing Songs” booth has gone crazy, or the convicts prepar- Motown / Pgd genics and bad relationships. And boy does Boston Museum of Fine Arts ing to take their mug shots have decided, in a Released September 15, 2009 he milk it. Through Feb 21, 2010 fit of desperation, to let the better half of their First, the bad. CuDi’s singing isn’t quite spontaneity flow. These are actually just every- ’m a big fan of hip hop. I mean real hip up to American Idol standards, and his tiny usic pervades our lives, but is it day, normal people and watching them is like hop, not the buckets of factory-produced range of mumbling semitones can get tiring. more than just an accessory? How watching ourselves in the mirror during those horse vomit that passes off as main- Bafflingly, CuDi is also, at best, a lacklus- do you know that it is anything more crazy private dance parties in the outskirts of I stream radio these days. In particular, ter lyricist. One of his cleverest bits in the Mthan a presence in your pocket, bar- our rooms. Come on, even Taylor Swift does the next time I hear Jason Derulo say his own arguably superb song “Soundtrack 2 My rier to unwanted noise, or to make up for the it. name, I will strongly consider seceding from Life,” “The moon will illuminate my room expanse of empty wall space? The “Seeing As the song continues, the thirty people the U.S. But give me a good hip hop album, and soon I’m consumed by my doom,” is im- Songs” exhibition at Boston’s Museum of Fine sing and move with the music, some awkward- be it afrocentric, alternative, fusion, gangsta, mediately followed by unnecessarily vulgar- Arts delves into the role of music as an integral ly and self-consciously, some only too aware or political, and I’ll be a happy camper for ity: “Once upon a time nobody gave a fuck part of our lives. of the chance to call attention to themselves, weeks. Good rappers like Talib Kweli, Mos / it’s all said and done and my cock’s been On the surface there are just the pictures. and others completely oblivious of the captive Def, Nas, and Lupe speak from the soul, and sucked,” cutting the flow dead in its tracks. In Richard Avedon’s colorful lithographs of the audience that the camera brings: there’s the girl it’s always a treat to peer introspectively into some songs, the lyrics are downright stupid: Beatles grace the front of the exhibition. Herb on the side whose soulful, yet controlled, ren- their minds. But part of the pleasure comes “Girls that I dated, it’s ok I am not mad yo / Hitts, responsible for immortalizing stars such dition of “Like a Virgin” fails to bring more from the fact that I’ve got almost nothing in Unless you stabbed me in the heart, no love as Tina Turner, Bruce Springsteen, and David than the occasional head movement into the common with the artist. I never grew up in the ho / this shit is so ill.” Sorry, Scotty, but it’s Bowie on gelatin silver photographs, gets his mix; the guy whose smoldering eyes suggest projects. I don’t know what it’s like to have just not. own wall. And going a little deeper, Joseph mild insanity, rather than his probably intended a gun by my side at all times, and I’ve never But what CuDi lacks in flow he makes up Grigeley’s Songs Without Words, a collection of look; the portrait with vigorous head nodding gone hungry from lack of money. So what for with immense creative spirit. It’s nearly prints derived from musicians as photographed to accompany a rather pained expression and can I expect in an album by a middle-class, impossible to pin down his style. One of the by the New York Times, explores the dual com- very curly hair. The man with the crazy eyes suburban hipster from Cleveland, Ohio? early tracks, “Up Up & Away,” is an upbeat merciality and mysteriousness of music. brandishes a strip of white mesh, twisting it Actually, quite a lot, and more than part anthem about tackling a new day and shak- The highlight of the exhibition, however, about in front of him as a prop for his one-man of it due to strong support from industry vet- ing off social stigmata. Immediately after- must be Candace Greitz’s Queen (Portrait of show. erans Ratatat, MGMT, Plain Pat, Emile, and ward, “Heart of a Lion” takes a darker turn, Madonna). From a wall come thirty screens They have moved on to the slower “Crazy mentor Kanye West. KiD CuDi represents a revealing a man in emotional crisis. “Please arranged into a grid, collectively singing the For You” by now, and people start to close their new wave of hip hop, propelled not by ghet- save a cudi that needs some help,” he moans. entire 73 minutes of Madonna’s Immaculate eyes and sway along with the music. The song tos, gangs and clubs, but the suburban middle “Hyyerr” is a throwback to sexual, 70’s style Collection. There are no actual images of Ma- comes to an end, but most keep dancing silent- class. Content changes too, focusing on the Marvin Gaye stylings. It’s all never been donna. Instead, thirty different faces of thirty ly and others take sips from a water bottle. And self, and the hardships of life as a whole. done before, and even with all the glitches, different people fill up thirty different screens. through all of this, for a few wavering seconds, Man on the Moon is KiD CuDi’s explo- you really feel witness to the birth of a new These sing their favorite songs in unison, with there remains the sound of a lone voice softly ration into his own melancholy; the album subgenre. KiD CuDi is just that, after all — a resulting sound reminiscent of a particularly hanging onto the last note. Then all is silent. has a lazy, droning, melodic vibe that has a kid. Who knows where his limits are as an boisterous night of group karaoke (without the And the next song in the album begins. Life gradually become CuDi’s trademark. CuDi, adult? backup music). moves on.

“Universally admired as one of the most adventurous pianists to arrive on the jazz scene in WHAT’S AHEAD years.” —Los Angeles Times Grammy-nominated jazz pianist Brad Mehldau is one of the most exciting musicians in his Brad Mehldau field today. A daredevil improviser and interpreter of music typically outside of the jazz canon, Friday, February 5, 8 p.m. ($35, $30, $25) Mehldau is at the forefront of musicians pushing at the boundaries of the art form. He will Sanders Theatre, 45 Quincy St., Cambridge perform a very special solo concert. For tickets and information call world music / CRASHarts (617) 876-4275 Buy online: http://www.worldmusic.org

Sean Tang—The Tech Violinist Sarita Uranovsky, clarinetist Molly Walker, and pianist Hiskao Hiratsuka play a musical piece dedicated to Noam Chomsky at a concert honoring the MIT Professor of Linguistics on Friday evening in Kresge Auditorium. Page 8 The Tech January 27, 2010 Ca m p u s Li f e Brouhaha Rhythm The Price Is Within the Acceptable Margin of Error By Michael T. Lin on sale, I leave to you to decide. examining the price tags, it occurred to me transitioned from Lego-sized pink bricks of Campus Life Editor By far, my biggest problem in food pur- that unless I was throwing away three-quar- bubble gum to petite litmus strips of “chew- I’ve never been very good at grocery shop- chasing is spoilage, the inexorable creep of ters of my milk, a near-impossibility given ing gum” that could fit in a USB port without ping. For one thing, I’m constantly snacking, time that turns both a human being and a my cereal (and Oreo) consumption, I could much trouble. Apparently, the health-con- which means that walking down the chips and package of sandwich cheese into a wrinkled, invest in a ceiling-height industrial refrigera- scious among us found soaking our teeth in cookies aisle is just asking to load up on more useless mess. Buying tor and still save money a sugary putty objectionable and unhygienic, munchies. For another, there’s so much variety fresh fruit one piece at in the long term. It takes for some reason. in products that I can’t tell what’s inexpensive a time is endlessly im- In the course of grocery up more space than my As for the party balloons, I searched left, and what’s a ripoff. Music and movie shop- practical, especially if bed and my desk put to- right, above, below, and behind the candles ping are easy by comparison — anything un- grapes are on the menu, shopping … the ease gether, but it makes for and cake icing, only to find that, silly me, der fifteen dollars is a bargain (except perhaps but it often feels like a lovely conversation they were stocked next to the frozen concen- Plan 9 From Outer Space), anything under most of what I buy will with which one locates piece. trated orange juice. Meanwhile, in the process five dollars is a steal — but groceries are a dif- spoil otherwise. On the a particular product is One thing I’ve of searching for them, I found discount flea ferent beast altogether. Even considering that flip side, for a very brief learned in the course treatments and two-foot-long wooden cook- I’d watched Supermarket Sweep as a child, I period of time, I started inversely proportional to of grocery shopping is ing skewers in the same bin. Go figure. Now, was much more interested in the “run like a buying the ultra-hyper- that the ease with which if you’ll excuse me, I’ve got some shopping to maniac around the supermarket” than the ex- super-duper-pasteurized how mundane it is. one locates a particular do. Don’t ask why, but I need to get ahold of pected retail prices of anything. For instance, milk with no regard to product is inversely pro- some waterproof, plain white, off-brand, size the Oreos at Shaw’s are in yellow-tag Purga- price. I imagined that the convenience of hav- portional to how mundane it is. Last night, I 8 tennis shoes, and a fluorescent donut-shaped tory, meaning that it’s always the same price ing milk that would last longer in an active spent close to an hour trying to find bubble tape dispenser. Shouldn’t take more than two every time I go, and seemingly have been volcano than mere-mortal milk would on the gum and party balloons. I don’t know when seconds, if my theory is correct. The cocktail for the past three years. Whether that means surface of Mars would be worth the added ex- this happened, but at some point in the last toothpicks, on the other hand, will likely take they’re actually never on sale or perpetually pense. Shortly thereafter, upon more closely decade, our halitosis-plagued generation has the better part of a week.

RBA and REX

Dorm Security

LEDs & airports Give a damn?

Don’t just stew in silence...

Be heard! Write opinion for The Tech. [email protected] January 27, 2010

Page 9

Steal My Comic by Michael Ciuffo

38 Wall painting ACROSS 2 Nastase of tennis 28 Hidden 39 “__ Tu” (1974 hit) 1 Puppy’s bite 3 Child’s toy 29 Power option 40 Burn a bit 4 Calyx parts weapon 30 Reuben ingredient 41 “__ Hall” 10 Lady’s address 4 W. __ Maugham 31 Lag behind 42 Patriotic women’s 14 Inn order 5 Pencil’s end 32 Monica with a soc. 15 Rainbow band 6 Hair line racket 43 Part 3 of sign 16 Opera song 7 “Diana” singer 35 Mold and smut 45 Nuisance 17 By way of 8 T-shirt size 38 Seacows 46 Hotel employee 18 Start of a 9 Do a judge’s job 40 Shoe polish 47 Acquire broker’s sign 10 Bucks and brand 50 Up to something 20 Nodding response bulls 43 Stand in line 52 Cartoonist Keane 21 Como __ Usted? 11 Locality 44 Surrounded by 55 End of sign 22 Confront boldly 12 Broadcasts 45 Peels 57 Period 23 Aesop’s loser 13 Actor Dillon 47 Switch positions 58 Taxi charge

Solution, page 10 25 New Mexico art 19 The King’s middle 48 Boyfriend 59 Founder of Taoism colony name 49 Pool pull-over 60 Cassowary cousin 26 Part 2 of sign 24 Robert and Alan 50 Yanks 3rd 61 Has dinner 30 Dol. divisions 25 “__ Coming to baseman 62 Accounting 33 Island leader? Take Me Away, 51 French actor activities 34 Creative Coward Ha, Haaa!” Jacques 63 Current craze 35 Fairway alert 26 Let loose 53 “__ la Douce” 36 Prey on the mind 27 “A Rage to Live” 54 Praise highly DOWN 37 Clever author 56 Greek letter Crossword Puzzle Crossword 1 Blue shade

4 1 5 8 5 1

digits 1 through 9. 9 1 3 5 8 and 3 by 3 grid contains and 3 by so that each column, row, so that each column, row, exactly one of each the exactly 4 8 Instructions: in the grid Fill by Scott Adams by

5 7 2 9

7 4 ® 7 5 9 4 8

Solution, page 10 5 2 6 Dilbert Sudoku 4 2 9 Page 10 The Tech January 27, 2010

Solution to Sudoku from page 9 7 6 4 8 1 2 3 9 5 Grad students working in energy… 8 5 3 9 6 4 1 7 2 9 2 1 3 7 5 6 8 4 1 4 6 2 9 8 5 3 7 5 8 7 1 4 3 2 6 9 There is still time to provide key feedback 2 3 9 7 5 6 8 4 1 to the MIT Energy Education Task Force on 6 7 2 5 3 9 4 1 8 3 9 5 4 8 1 7 2 6 ways to improve curriculum and career 4 1 8 6 2 7 9 5 3 development that’s focused on energy. Solution to Crossword from page 9

Complete the short survey by February 12th to be eligible for one of four $50 gift certificates to Amazon.com Henisi. Pat, cor sum nos doloreet elesseq uatuera esectem doloboreet, con heniscidunt at, quat dolobore diam, veliquisl el ut adip eraesto duis dolor sum ex exeros ea faci ea amcommo lorper adit nullaor at, commy nosto odolenim nostrud et laore feu facidunt alit lutetue modolor accum ea am, quamcon sequat wisl ullam, consequat. Iquat. Ut el iure feugait elit, quis adionsectet ex endre facip er accum zzrit lor sustis aut verit, sed modolor eraessim et dolore duis nisis ad minit in vendrem quatums andigna feuissed enim zzriusci tem nos dipsusto od magniat wismod tat, voluptat. Ut amcon volesequisl iure deliscillam quatetum dolorpe riusto del eriusto core facilit, qui tem nonsenim zzriustrud dolore conse molestrud modolore corpercilla feu faccum quisci blan volut iustrud minim ipsum ad magnibh esequatem qui bla con volor sectem zzrit eum nonum ese dolortisis amconullaore vulla feu feu feu feum duipsus tionsectem erci tet aci endreet lor si. Magnim do doloreet, conulput wisi ex ex eu facincilit alit iustissed eugue vel dolore vent www.surveymonkey.com/s/mitgradsurvey

Many thanks, LEGAL COUNSEL Kathy Araujo and Jordan Kwok MIT students, family, employers and Graduate Student Reps start-ups seeking U.S. legal counsel, MIT Energy Education Task Force campus or office consultation. Call: James Dennis Leary, Esq. 321-544-0012

Reminder to all Juniors!

Associate Consultant Internship Resume Submission Deadline

Date: Thursday, January 28, 2010 Time: BY 11:59 p.m.

Include resume with SAT scores, cover letter with office preferences, and unofficial transcript. Students studying abroad should note that in their cover letters.

Applications must be submitted through BOTH Career Bridge and www.joinbain.com. First round interviews will be held on-campus on Monday, February 8, 2010.

We have Guitar Hero 3 and 1050 watts of audio.

[email protected] January 27, 2010 The Tech Page 11 Thirty Years After Therac-25, Rad. Problems Abound In Texas, George Garst now risks: It has created new avenues are chronically underreported, and a ernment health officials announced By Walt Bogdanich wears two external bags – one for for error in software and operation, patchwork of laws to protect patients late last year. The overdoses were The New York Times urine and one for fecal matter – be- but those mistakes can be more dif- from harm are weak or unevenly ap- first discovered at Cedars-Sinai In New Jersey, 36 cancer pa- cause of severe radiation injuries he ficult to detect. As a result, a single plied, creating an environment where Medical Center, a major Los An- tients at a veterans hospital in East suffered after a medical physicist error that becomes embedded in a the new technology has outpaced its geles hospital, where 260 patients Orange were overradiated – and 20 who said he was overworked failed treatment plan can be repeated in oversight, where hospitals that vio- received up to eight times more ra- more received substandard treat- to detect a mistake. The overdose multiple radiation sessions. late safety rules, injure patients and diation than intended. ment – by a medical team that was never reported to the authorities Many of these mistakes could fail to report mistakes often face lit- Those errors continued for 18 lacked experience in using a ma- because rules did not require it. have been caught had basic checking tle or no punishment, The New York months and were detected only chine that generated high-powered These mistakes and the failure protocols been followed, accident re- Times has found. after patients started losing their beams of radiation. The mistakes, of hospitals to quickly identify ports show. But there is also a grow- In this largely unregulated mar- hair. The federal Food and Drug which have not been publicly re- them offer a rare look into the vul- ing realization among those who ketplace, manufacturers compete by Administration is still struggling to ported, continued for months be- nerability of patient safeguards at work with this new technology that offering the latest in technology, with understand and untangle the phys- cause the hospital had no system in a time when increasingly complex, some safety procedures are outdated. only a cursory review by the govern- ics underlying the flawed protocols. place to catch the errors. computer-controlled devices are “Scientific societies haven’t been ment, and hospitals buy the equip- The FDA has issued a nationwide In Louisiana, Landreaux A. fundamentally changing medical able to keep up with the rapid pace of ment to lure patients and treat them alert for hospitals to be especially Donaldson received 38 straight radiation, delivering higher doses technical improvements,” said Jeffrey more quickly. Radiation-generating careful when using CT scans on overdoses of radiation, each nearly in less time with greater precision F. Williamson, a professor of radia- machines are so ubiquitous that used possible stroke victims. twice the prescribed amount, while than ever before. tion oncology, who leads the medi- ones are even sold on eBay. Although the overdoses at Ce- undergoing treatment for prostate Serious radiation injuries are cal physics division at the Massey “Vendors are selling to anyone,” dars-Sinai were displayed on com- cancer. He was treated with a ma- still infrequent, and the new equip- Cancer Center at Virginia Common- said Eric E. Klein, a medical physi- puter screens, technicians adminis- chine so new that the hospital made ment is undeniably successful in di- wealth University in Richmond. cist and professor of radiation on- tering the scans did not notice. In a miscalculation even with training agnosing and fighting disease. But Hospitals, too, are lagging, some- cology at Washington University in New York City, technologists who instructors still on site. the technology introduces its own times failing to provide the neces- St. Louis. “New technologies were also did not watch their treatment sary financial support to operate the coming into the clinics without computers contributed to two dev- sophisticated devices safely, accord- people thinking through from Step astating radiation injuries docu- ing to accident reports and medical 1 to Step 112 to make sure every- mented in an article in The Times physicists, who set up and monitor thing is going to be done right.” on Jan. 24. radiological devices. And manufac- A national testing service re- The incidents not only highlight turers sometimes sell machines be- cently found unacceptable varia- the peril of placing too much trust fore all the software bugs are identi- tions in doses delivered by a now in computers, they also raise ques- Up to fied and removed, records show. common form of machine-generat- tions about the training and over- SPERM DONORS At a 2007 conference on ra- ed radiation called Intensity Modu- sight of medical physicists and ra- NEEDED $1100 a month! diation safety, medical physicists lated Radiation Therapy, or IMRT diation therapists. went so far as to warn that radia- To help institutions achieve more Despite the pivotal role medi- Healthy MEN in college or with a college degree wanted for our tion oncology “does indeed face a consistency, an association of med- cal physicists play in ensuring pa- sperm donor program. crisis.” The gap between advanc- ical physicists issued new IMRT tient safety, at least 16 states and ing technology and outdated safety guidelines in November. the District and Columbia do not Minimal time commitment protocols leaves “physicists and ra- The problems also extend to require licensing or registration. Help people fulfill their dreams of starting a family. diation oncologists without a clear equipment used to diagnose dis- “States can be either very tough or Receive free health and genetic screenings. strategy for maintaining the quality ease. very lax,” said Dr. Paul E. Wallner, and safety of treatment,” the group More than 300 patients in four a director of the American Board of APPLY ONLINE: reported. hospitals – and possibly many more Radiology. Government regulators have been – were overradiated by powerful CT Eight states allow technolo- www.SPERMBANK.com slow to respond. Radiation accidents scans used to detect strokes, gov- gists to perform medical imaging other than mammographies with no credentials or educational require- ments. In those states, said Robert Pizzutiello, a medical physicist in New York who is part of a move- ment to license all medical physi- cists, “you could drive a truck in the morning and operate an X-ray in the afternoon.” SPRING BREAK

Spring Break comes to life... Live Concerts Awesome VIP Parties Beautiful Beaches Scenic Cliff Jumping Spectacular Sunsets Book Your Trip Today! Contact:

www.ststravel.com By K. Collins and C. Celio

Maslab Mobile Autonomous Systems Laboratory Don’t say The 2010 Final Competition 01/29/09, 5:30 PM, 26-100 Tech didn’t tell Key Words: vision-based robotics; autonomous; artificial intelligence; navigation of unknown playing field; mapping; odometry; feedback and controls; cross-disciplinary (Course 2 meets Course 6); Ubuntu GNU/Linux; Eee PCs; Java; multi-threaded; green/black six-bit barcodes to assist in navigation; yellow balls, yellow goals; red balls, red you MIThenge goals; student-run; industry sponsorship; sleeping in lab; robots on fire; Skynet; kill-switch highly recommended. was today. maslab.mit.edu Page 12 The Tech January 27, 2010

There are some financial firms where technology doesn’t take a back seat. The D. E. Shaw group is a highly successful investment and technology development firm with an international reputation and a decidedly different approach to doing business. We offer a stimulating work environment and colleagues from the strongest technical programs in the world. They’re not conventional “financial types,” but then again, neither are we.

The firm currently has openings in quantitative analysis, software development, proprietary trading, and information technology, to name a few. Our work environment is challenging but surprisingly flexible—from the clothes you wear to the time you get to the office, it’s pretty much up to you. And we compensate our extraordinary people extraordinarily well.

Application deadline January 30 On-campus interviews February 9

The D. E. Shaw group will host on-campus interviews for select positions on February 9. To submit an application, please visit:

www.deshaw.com/recruit/jobs/OC/MIT

Please note that you must apply both through CareerBridge and our Web site. All applications must be received by January 30.

Members of the D. E. Shaw group do not discriminate in employment matters on the basis of race, color, religion, gender, pregnancy, national origin, age, military service eligibility, veteran status, sexual orientation, marital status, disability, or any other protected class.

www.deshaw.com/recruit/jobs/OC/MIT January 27, 2010 The Tech Page 13

Pearl Art and Crafts Goes Under Cambridge art and craft mecca Pearl Art is going out of business this week. The store is offering 75 percent discounts, and has been mobbed with customers waiting in lines at the register for more than an hour long last night. Pearl, located at 579 Mass. Ave, in Central Square, has been a reli- able and reasonably-priced source for art supplies with a good selec- Master’s in Human Behavior tion quite near to campus for decades. About 70 percent of the stock is sold out, but many physically large A new degree program for careers in business, items remain, such as foamcore sheets. Pearl’s 800 telephone customer service line said their last day government advocacy, and public service would be Friday, and employees at the store seemed uncertain. The Cambridge Chronicle reported the store would be open through Sun- day, and Pearl’s corporate offices did not return calls for comment. Pearl is closing several of its stores in other cities as well. Pearl is survived by Artist and Craftsman Supply, across the street at 580 Mass. Ave, and Utrecht Art Supply at 1030 Mass Ave. Both stores are slightly more geared towards the professional artist com- munity than Pearl was. —John A. Hawkinson

Eating Disorder Treatment Treatment of Adults Suffering from Anorexia and Bulimia Nervosa Informed clinicians refer their clients to Laurel Hill Inn. LHI provides the most effective treatment and deploys the highest staff-to-client ratio in New England. We provide extensive programming in a highly structured and supervised non-institutional therapeutic setting. Evening, day, and residential treatment as well as This is an accelerated program designed especially for weekly support groups in West Medford and West Somerville. Call Linda at 781 396-1116 or visit www.laurelhillinn.com. those who have received their bachelor’s degree in a social science field. An MHB degree trains for careers in: advertising, public relations, human resources, Royal Bengal corporate communication, lobbying, marketing, and Boston’s only authentic BengaliCuisine restaurant numerous others where knowledge of human behavior 313Mass.Ave., Cambridge is essential for effective job performance. Open Daily Except Monday (617) 491-1988 11:30 am–11:30 pm T: Red Line, Bus#1–CentralSquare Lunch Buffet $7.95 10% Discount on $15 Application deadline: March 1 Reasonably Priced Dinners (or more) order with MIT ID. http://college.usc.edu/MHB Free delivery for orders over $10. Take-out, platters, and catering available. http://www.royalbengalrestaurant.com/ University of Southern California Register for classes Monday! Page 14 The Tech January 27, 2010 Hillel at MIT presents… CACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACGAGCCCAT CCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAG GCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTGAGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTAC CACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGC CACTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACGAGC CCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACC GGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTGAGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCA CTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGenetic GAGCCACTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAAC GAGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATG AACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTGAGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGA GCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGG TCAGGAGCCACTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATScreening! GAACGAGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGG CATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTGAGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTC Advanced sign up required! Sign up online at: www.med.nyu.edu/genetics or for more information email Rifka at [email protected] When: February 2nd 2010 9:00am - 1:00pm Where: Stratton Student Center, Bldg W20, Room 400

**Check out our Facebook group “Genetic Screening: Have you been tested?” http://www.facebook.com/home.php? #/group.php?gid=24573467809&ref=ts Human Genetics Program January 27, 2010 The Tech Page 15 93 Random Hall Residents Share One Washer

Random Hall, MIT’s smallest dorm, is unique he said. from other MIT dormitories in that it provides res- Since returning to campus this January, Rodri- idents with “free” use of its laundry facilities. But guez said that he ordered the necessary parts to fix since finals week of last term, all but one of the wash- the two broken washing machines but had to wait ers has been out of commission, generating a stir two weeks in order for the appropriate paperwork for among Random’s 93 residents. funding to clear. Residents pay an $80 house tax at the beginning “I am now essentially at the mercy of UPS as to of each term, from which a portion is used to help when I can fix the washers,” he said. cover the cost of upkeep of the hall- owned and oper- Although only a fraction of Random residents ated machines. But, otherwise, the use of the dorm’s have been residing in the dormitory since the begin- three washers and four dryers is free; all other dorms ning of IAP, one of them, John “Sweet Tea” Dormi- require 75¢ a load. ny ’13 expressed concern about the lack of multiple Students living in Random have historically main- machines saying “when we moved into MIT Hous- tained their own laundry facilities by electing hall ing, we agreed to a contract stating MIT would pro- members to serve as laundry chairs, or in Random vide laundry machines.” parlance, “laundry empresses.” These paid positions As long as only one functional washer remains, are part of Random’s house government and include “Randomites [will] have just 1.8 hours a week to the responsibilities of fixing machines when they wash clothes, assuming 24/7 use of the laundry break, as well as ordering replacement parts when machine” when all Random residents return for the necessary. spring semester, Dorminy said. According to laundry empress Alexander V. Ro- “It is inconvenient to see that the one washer avail- driguez ’11, there is currently only one working able is almost constantly being used,” Rodriguez said washer but four working dryers at Random. “Due “but it is certainly not anywhere near bad enough to to the unfortunate timing of the washers breaking— force students to use outside facilities.” finals week, I was unable to tend to them at the time,” —Ana Lyons Colombo Seeks Student Choice, Financial Stability for Dining Dining Update, from Page 1 Committee was formed by the UA well the DSL implements it. “It’s in March 2009 to produce a report about the details,” Bennie said. “For the current $300 half-off meal fee in recommending dining reforms. Its example, how will the new plan deal favor of a declining-balance system. report, released on May 4, 2009, with IAP?” In the proposed declining-balance recommends changing the current UA Dining Committee Chair system, students living in dorms $300-per-semester House Dining Adam Bockelie ’11 also met with with dining halls would pay a $600 Membership to a $300 declining Colombo to discuss the state of din- semesterly fee and, in exchange, re- balance plan and suggests closing ing. Several rumors were circulating ceive dining dollars, money similar three dining halls in favor of a large, around campus about the removal to TechCASH that can be spent on centralized dining hall, among other and lack of upkeep of kitchens, food. According to the Task Force’s recommendations. but Bockelie said that they were all final report, the new system would Tom Gearty, DSL Director of false. “Some claim that the qual- net approximately $200,000 by 2014 Communications, said that the DSL ity of kitchens are being neglected,” if implemented in Fall 2010. The is looking for a robust dining pro- said Bockelie, “but you can easily task force’s final report can be found gram that gives students choice. submit a work order to fix whatever at http://web.mit.edu/instituteplan- Meal options should be varied and is broken.” ning/reports.html. be able to tend to both dietary re- Next month, Bockelie, Colom- No recommendations made by strictions and nutritional needs, The bo, and others involved with din- the Blue Ribbon Committee and DSL is working to craft solutions ing will be traveling down to Yale Institute-Wide Task Force are bind- that reduce or eliminate the annual University to observe and talk with ing. Instead, all recommendations deficit. those behind their dining program. were presented to Colombo, and he UA President Mike A. Bennie Colombo said that he does not in- will work with community leaders ’10 met with Colombo last week to tend to duplicate Yale’s program at before deciding the direction dining discuss dining. Bennie said that he MIT, but instead is searching for will take. believes the success of the new plan ideas and possible improvements An all-student Dining Proposal will be partly determined by how that could be made at MIT. MIT A/V, Copytech, Pool Efforts To Manage Digital Ad Systems Infinite Display, from Page 1 face that allowed advertisers to view, Yesterday’s presentation was at- upload, and remove their slides. That tended by about forty MIT staff groups $20/day for all screens, $10 interface goes away in Infinite Dis- and almost no students. It spent a for just W20/Stata, or $15 for the play; advertisers upload their slides significant portion of time address- Infinite and Lobby 10. MIT Depart- through a web form and then wait to ing good design tips for slides. The ments will have to pay $35 for all hear back from the Infinite Display team also stressed that Copytech screens, $20 for W20/Stata, or $25 team. staff will be available to help with for the Infinite and Lobby 10. Non- The team “tried to wrap the technical questions and problems MIT entities will pay more, though Domeview interface around Visix,” with slide design and format con- their content must be of benefit to the Velasquez said, but they did not suc- versions. The Infinite Display team MIT community, the team said. ceed. said they wanted to provide “one Infinite Display, like the former The Infinite Display system is stop shopping” for campus adver- corridor system, is managed using coordinated by the Office of Enter- tising. enterprise digital signage software prise Services within the Division of Infinite Display will accept only called Visix. Domeview had a cus- Student Life, and is operated by MIT PNG and JPEG formats, and will not tom web-based management inter- Audio/Visual and Copytech. accept Microsoft Powerpoint files. Page 16 The Tech January 27, 2010 Sp o r t s Up c o m i n g Ho m e Ev e n t s Friday, January 29 Rifle — Bean Pot 6 p.m., duPont Range

Saturday, January 30 Rifle — Bean Pot 9 a.m., duPont Range Men’s and Women’s Swimming and Diving vs. Amherst College 1 p.m., Z-Center Pool

Sunday, January 31 Rifle — Bean Pot 9 a.m., duPont Range

Sc o r e b o a r d

Aaron Thom—The Tech Saturday evening, alumni of the MIT Ice Hockey program faced off against alumni of the Boston Men’s Basketball Bruins in a fundraising event for the current MIT team. The Bruins won 13-11. MIT alumni from as Wednesday, January 20, 2010 early as the Class of 1966 (Robert Silver and M. Loren Wood) came together to help raise funds for Springfield College 56 the team which was cut last year. MIT 67 Saturday, January 23, 2010 Wheaton College 60 Swimming and Diving Women’s Captain Jillian R. Reddy ’11 led her MIT 57 team with an top-50 finish. Behind her, Sarah J. Lad- Teams Remain Undefeated erman ’12 edged out competitors by just hundredths Women’s Basketball of a second to finish 59th. With Win Over Tufts On the men’s team, Jason D. Pier ’12 had another Wednesday, January 20, 2010 top-25 finish, coming in 22nd for the day. Next, Worcester Polytechnic Institute 43 The MIT Swimming and Diving teams dominated Michael J. Yurkerwich ’11 had a difficult first run, MIT 47 Tufts University this weekend to remain undefeated. but raced a 25th place second run to finish 40th. The men’s team swept the 200 backstroke, with Rounding things out was Kevin A. Rustagi ’11, who freshmen Brendan F. Liu ’13, Brendan T. Deveney earned his first ever slalom finish this weekend. He Squash ’13 and Ron Rosenberg ’13 racking came in 63rd. Wednesday, January 20, 2010 up first, second and third respectively. On Sunday, Laderman represented the entire Connecticut College 9 Deveney also earned fourth in the 200 women’s team in its 10th place finish. She came in butterfly. Co-captain Rastislav Racz 59th individually. For the men’s team, each individu- MIT 0 ’10 won the 100 and 200 breaststroke, al had a noteworthy finish: Pier was 29th, Yurkerwich and contributed to a MIT win in 34th, and Rustagi 72nd. Men’s Swimming & Diving the 400 medley relay with teammates Rosenberg, Next weekend the team will continue their season Toomas R. Sepp ’11 and Luke R. Cummings ’10. racing at Gunstock and Blackwater/Proctor. Saturday, January 23, 2010 The women’s team exhibited similarly spectacular —Alexis Dale, Team Representative Tufts University 127 performances. Co-captain Amy E. Jacobi ‘11 swept MIT 168 the field, winning 2 relays and 2 individual races for the Engineers. Hailey E. Kopp ’13 captured second place with a season best in the 1000 freestyle, while Wheaton Hands No. 8 MIT Women’s Swimming & Diving Sydney A. Giblin ’12 paired with Elina L. Hu ’13 to Saturday, January 23, 2010 grab first and second in the 200 IM. Emily F. Pitts Its First Division III Loss of Tufts University 127.5 ’12 also achieved career-best performances in the 200 IM and 200 butterfly. The Basketball Season MIT 172.5 The women’s diving team cleaned house, Wheaton College put on an impressive shooting securing second through fourth on one-meter and display to hand No. 8 MIT its first loss in 17 games Men’s Volleyball second through seventh on three-meter. Kristie L. against a Division III opponent Saturday. The Lyons D’Ambrosio ’10 attained NCAA qualifying scores connected on 48.8 percent of their Wednesday, January 20, 2010 on both boards. Not to be outdone, the men’s diving shots, including 10 of 19 from three- Lesley College 0 team also performed personal bests on both boards. point range. MIT’s record falls to 16-2. MIT 3 The MIT swimming and diving teams will have William Tashman ’13 and Mitchell Friday, January 22, 2010 their last home meet this Saturday against Amherst H. Kates ’13 were the high scorers for University. MIT, finishing with 15 apiece. Tash- Baruch College 3 —Diana LaScala-Gruenewald, Team Member man added nine rebounds and four steals. William MIT 1 E. Bender ’12 had a double-double with 12 points SUNY New Paltz 0 and rebounds. The Cardinal and Gray held a 33-26 advantage on the glass but shot just 4-20 from three- MIT 3 Alpine Skiing Competes in point range. Saturday, January 23, 2010 The Engineers will look to bounce back on Elms College 0 Slaloms Wednesday, January 27 when they travel to Coast On Saturday and Sunday, the MIT Ski Team Guard. MIT 3 competed in Slalom and Giant Slalom at Waterville —Mindy Brauer, DAPER Staff Emmanuel College 0 Valley, and had several exciting finishes. MIT 3

This space donated by The Tech

Elijah Mena—The Tech Portia M. Jones ’12 (left) and Hazel L. Briner ’11 (center) compete in the Women’s 55 Meter Hurdles at the MIT Coed Invitational held Saturday at the Johnson Indoor Track. Jones placed second with a time of 8.74 seconds.