Role of Fzr1 in Embryogenesis

ROLE OF FZR1 IN EMBRYOGENESIS

SEAH KAY YI MICHELLE

BSC. (HONS I)

PH.D THESIS

Statement of Originality

This thesis contains no material which has been accepted for the award for any other Degree or Diploma in any University or other tertiary institution and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text. I give consent to this copy of my thesis, when deposited in the University library, being made available for loan and photocopying subject to the provisions of the Copyright Act 1968.

Seah Kay Yi Michelle

17th December 2012

Page | ii

Acknowledgements

I would like to sincerely express my appreciation and gratitude to my supervisors, Keith and Janet for giving me this opportunity and to share their wisdom and guidance throughout my PhD.

I would also like to extend my thanks to all the lab members including Evan, Jess, Julie, Kyra, Nicole, Phoebe, Simon, Sophia, Suzanne and Yan. Thank you for your company and help throughout my PhD, it has made this an enjoyable experience in the lab.

To my family especially Popo, Mummy and Daddy, thank you for the endless love, support and understanding that you have showered upon me. For that, I will be eternally grateful. Thank you for moulding me into the person that I am today, for without all of you, I will not be where I am today. I love you and will always be your little girl.

To Clara, my BFF, thank you for your encouragements and to always be there for me. I will treasure our intellectual and bimbo moments. The fun and laughter have been missed. To Huili, thank you for the visits, support and the crazy times we shared. To David, for introducing me into this wonderful world of research, your guidance was invaluable. To all my friends and relatives back home, thank you for all the love and support.

To Brown Bear and Zee Zee, for all your endless love and company, you will be missed dearly. To Timbre, your bountiful happiness and affection has made the trying times easier and the journey more interesting.

Last but not least, I would like to thank Wai Shan. Thank you for being there for me through the good times and bad, the happy and sad, the crazy and sane, you have been a great source of strength and inspiration. Thank you for always believing in me and sharing this journey. Thank you for all the wonderful memories, they will be cherished. I await for what lies ahead in the future.

Page | iii

Abstract

The Anaphase-Promoting Complex (APC) is an E3 ubiquitin ligase that targets many cell cycle associated proteins for degradation by the 26S proteasome. APC activity is in part controlled by binding to one of its co-activators, and here the focus of the study was on the co-activator Fizzy- Related 1 (Fzr1). When this thesis was started, antisense knockdown studies had shown that Fzr1 is involved in the maintenance of Germinal Vesicle (GV) stage arrest; the fidelity of chromosome segregation during the first meiotic division; and measurable APCFzr1 activity had been observed following fertilization. Although these antisense experiments had used controls, it was still appropriate to question whether any of these observations were due to off-target effects. Moreover, it was important to ask how relevant Fzr1 was to the process of meiosis in vivo, given thus far only in vitro studies had been performed. During the course of my studies, a transgenic knockout of Fzr1 was independently created, and using embryos from these mice, it was found that this APC activator has a crucial role in endoreduplication, and was needed for trophoblast giant cell formation and placentation. However, due to the presence of maternal Fzr1 contribution, its role in early preimplantation embryogenesis or meiosis could not be addressed.

Here in this thesis, I created an oocyte-specific Fzr1 knockout from breeding mice that had loxP elements inserted into the Fzr1 gene with those carrying the Zp3-Cre recombinase promoter. Breeding results in progeny that have an oocyte-specific deletion in their Fzr1 gene. I was able to determine that knockout females produce viable metaphase II eggs capable of generating live pups when fertilized. Therefore, even though measurable activity of APCFzr1 has been detected at various stages of meiosis, this APC activator was not an essential meiotic gene. I investigated an optimal culture media suitable to sustain preimplantation development of B6CBF1 hybrid and C57Bl6 fertilized embryos and parthenotes to the blastocyst stage. Using parthenotes from knockout females, I was able to show that Fzr1 is involved in the process of pronuclear fusion at syngamy in zygotes. Its loss also resulted in delayed and asynchronous cleavage divisions of blastomeres; which led either to arrest of embryos at the 2-cell stage or premature initiation of compaction in 4-cell stage embryos that then failed to develop to form blastocysts. Additionally, I developed a miRNA construct that achieved Fzr1-/- knockdown in embryos and also showed a 2-cell arrest phenotype. Examination of 1- and 2-cell Fzr1-/- parthenotes also showed an increased incidence of chromosomal instability, demonstrated by the formation of micronuclei and fragmented DNA. In summary, work of this thesis found that Fzr1 is not an essential meiotic gene, as knockdown studies may have suggested, but instead was remarkably essential for early embryonic development. Page | iv

Table of Contents

Statement of Originality ...... ii

Acknowledgements ...... iii

Abstract ...... iv

List of Tables ...... xiv

List of Figures ...... xv

List of Abbreviations ...... xix

1. Introduction ...... - 1 -

1.1. Female gametogenesis ...... - 1 -

1.1.1. Overview of female meiosis ...... - 2 -

1.1.2. Fertilization and egg activation ...... - 4 -

1.1.3. Syngamy ...... - 6 -

1.2. Overview of Embryogenesis ...... - 10 -

1.2.1. Timing of cell cycle in early embryogenesis ...... - 11 -

1.2.2. Embryonic genome activation ...... - 12 -

1.2.3. 2-cell block ...... - 14 -

1.2.4. Compaction ...... - 17 -

1.2.6. Blastocyst formation ...... - 22 -

1.3. The Anaphase Promoting Complex ...... - 23 -

1.3.1. Co-activators of the anaphase-promoting complex ...... - 24 -

1.4. Role of APC in mitosis ...... - 25 -

1.4.1. Role of APC in mitotic entry ...... - 25 -

1.4.2. Involvement of APC at anaphase ...... - 25 -

Page | v

1.4.3. APC in regulating mitotic exit ...... - 27 -

1.4.4. G1/S maintenance by APC activity...... - 29 -

1.5. Roles of APCFzr1 outside of the cell cycle ...... - 29 -

1.5.1. Cell cycle exit and G0 maintenance ...... - 30 -

1.5.2. Role of Fzr1 as a tumour suppressor and in genomic integrity maintenance .. - 30 -

1.5.3. Role in endoreduplication ...... - 32 -

1.5.4. Role of Fzr1 in cellular differentiation ...... - 32 -

1.6. Role of APC in meiosis ...... - 34 -

1.6.1. APC mediating homolog and sister chromatid separation ...... - 34 -

1.6.2. Importance of APC in maintaining GV arrest ...... - 35 -

1.6.3. Importance of APC in Prometaphase I progression ...... - 37 -

1.6.4. APC activity during meiosis II ...... - 38 -

1.7. Aims ...... - 39 -

2. Materials and Methods ...... - 40 -

2.1. Animals ...... - 40 -

2.1.1. Animal ethics ...... - 40 -

2.1.2. Inbred and hybrid mouse strains ...... - 40 -

2.1.3. Fzr1 knockout mice ...... - 40 -

2.1.4. Genotyping of Fzr1 knockout mice ...... - 41 -

2.1.5. Fertility trial of Fzr1 knockout mice ...... - 41 -

2.1.6. Hormonal Stimulation and Mating ...... - 41 -

2.2. Media ...... - 44 -

2.2.1. Cell passaging and maintenance ...... - 44 -

Page | vi

2.2.2. M2 medium ...... - 44 -

2.2.3. FHM medium ...... - 45 -

2.2.4. KSOM and KSOM/AA medium ...... - 45 -

2.2.5. Handling pipette fabrication ...... - 45 -

2.3. Tissue collection ...... - 46 -

2.3.1. Oocyte collection ...... - 46 -

2.3.2. MII eggs/embryo collection ...... - 46 -

2.3.3. Parthenogenetic activation ...... - 46 -

2.3.4. Embryo culture and development ...... - 47 -

2.4. Molecular techniques ...... - 48 -

2.4.1. Plasmid preparation for transfection ...... - 48 -

2.4.2. Transfection of F9 cells with Lipofectamine LTX/Plus reagents ...... - 48 -

2.4.3. cRNA preparation for egg/embryo microinjection ...... - 50 -

2.5. Principles of miRNA design and generation of miRNA construct using Block-iT kit .. - 53 -

2.5.1. Design of Fzr1 knockdown miRNA construct ...... - 53 -

2.5.2. General principles for the generation of an miRNA construct using Block-iT kit - 54 -

2.5.3. Ligation of double stranded oligos into pcDNA6.2-GW/EmGFP-miR ...... - 58 -

2.5.4. Transformation using OneShot TOP10 competent E. coli ...... - 59 -

2.5.5. Plasmid digestion ...... - 59 -

2.6. Western blot analysis ...... - 60 -

2.6.1. Sample preparation for oocytes/eggs/embryos ...... - 60 -

2.6.2. Sample preparation for F9 cell line ...... - 60 - Page | vii

2.6.3. Protein quantification using Bradford assay ...... - 60 -

2.6.4. SDS gel electrophoresis and Western blot ...... - 61 -

2.6.5. Protein transfer and chemiluminescence ...... - 61 -

2.7. Immunohistochemical analysis ...... - 63 -

2.7.1. Sample preparation for kinetochore counting ...... - 63 -

2.7.2. Sample fixing and permeabilizing ...... - 63 -

2.7.3. Immunofluorescence ...... - 63 -

2.7.4. Sample mounting ...... - 64 -

2.8. Microinjection ...... - 65 -

2.8.1. Inverted microscope for microjection ...... - 65 -

2.8.2. Microinjection pipette fabrication ...... - 67 -

2.8.3. Microinjection procedure ...... - 69 -

2.9. Epifluorescence microscopy ...... - 72 -

2.9.1. General principles of fluorescent microscopy and imaging ...... - 72 -

2.9.2. Fluorescence imaging ...... - 72 -

2.9.3. Imaging parameters ...... - 76 -

2.9.4. Epifluoresence imaging for pronuclei formation ...... - 76 -

2.9.5. Live cell imaging of the first mitotic division in embryos using confocal microscopy ...... - 76 -

2.10. Data analysis and image processing ...... - 77 -

2.10.1. Densitometric analysis ...... - 77 -

2.10.2. Live cell imaging ...... - 77 -

2.10.3. Statistical analysis ...... - 77 -

Page | viii

3. Fzr1 Knockdown Study in F9 cells and Embryos ...... - 78 -

3.1. Introduction ...... - 78 -

3.2. Results ...... - 81 -

3.2.1. Assessment of Fzr1 expression during preimplantation embryogenesis...... - 81 -

3.2.2. Development of RNAi-mediated knockdown of Fzr1 ...... - 81 -

3.2.3. Design and generation of Fzr1 specific miRNAs ...... - 84 -

3.2.4. Optimization of transfection protocol for F9 cells ...... - 86 -

3.2.5. Efficacy of constitutive miRNA knockdown in F9 cells ...... - 89 -

3.2.6. Efficacy of Fzr1 knockdown in embryos ...... - 91 -

3.3. Discussion ...... - 96 -

3.3.1. Fzr1 expression in preimplantation embryogenesis ...... - 96 -

3.3.2. Optimizing transfection and efficacy testing of miRNA in F9 cells ...... - 97 -

3.3.3. Reduced Fzr1 expression resulted in 2-cell arrest in embryos ...... - 98 -

3.3.4. Incomplete Fzr1 knockdown in embryos ...... - 99 -

4. Fzr1 in Meiosis ...... - 101 -

4.1. Introduction ...... - 101 -

4.2. Results ...... - 104 -

4.2.1. Creation of an oocyte specific knock-out of Fzr1 ...... - 104 -

4.2.2. Isolation and examination of MII eggs from Fzr1-/- mice ...... - 104 -

4.2.3. Low aneuploid rates and smaller spindle formation from MII eggs isolated from Fzr1-/- female mice ...... - 109 -

4.2.4. Viable offspring are produced in the absence of maternal Fzr1 stores ...... - 112 -

4.3. Discussion ...... - 115 -

Page | ix

4.3.1. Fzr1 is important for maintaining GV arrest ...... - 115 -

4.3.2. Loss of Fzr1 does not affect in vivo matured Fzr1-/- egg ...... - 115 -

4.3.3. Loss of Fzr1 has small but significant effect on spindle formation but not aneuploidy rates in MII eggs in vivo ...... - 116 -

4.3.4. Maternal Fzr1 in fully grown oocytes is not essential for meiotic completion and embryo development ...... - 118 -

5. Embryo Culture and Media ...... - 120 -

5.1. Introduction ...... - 120 -

5.2. Results ...... - 124 -

5.2.1. Quality of zygotes collected from different strains of mouse ...... - 124 -

5.2.2. Rates of blastocyst formation in embryos between strains of mice in KSOM and KSOM/AA media ...... - 126 -

5.2.3. Rate of blastocyst formation from parthenogenetically activated eggs cultured in KSOM or KSOM-AA ...... - 126 -

5.2.4. Assessment of blastocyst formation rate in Fzr1fl/fl embryos in comparison to B6CBF1 hybrids and C57Bl6 ...... - 130 -

5.3. Discussion ...... - 132 -

5.3.1. Comparable embryo quality of fertilized zygotes from F1 hybrid, C57Bl6 and Fzr1fl/fl - 132 -

5.3.2. KSOM/AA is an optimal culture medium for F1 hybrids and C57Bl6 embryos ... - 132 -

5.3.3. Parthenogenetic activation in F1 hybrids and C57Bl6 ...... - 134 -

5.3.4. Insertion of a flox cassette into the Fzr1 gene does not affect embryo development ...... - 134 -

6. Fzr1 in Embryo Development ...... - 136 -

6.1. Introduction ...... - 136 - Page | x

6.2. Results ...... - 138 -

6.2.1. Successful egg activation in MII eggs from Fzr1-/- mice ...... - 138 -

6.2.2. Loss of Fzr1 impacts preimplantation embryo development ...... - 146 -

6.2.3. Loss of Fzr1 results in early development arrest ...... - 153 -

6.2.4. First mitotic division in Fzr1 knockout embryos ...... - 156 -

6.2.5. Aneuploidy rates in Fzr1 knockout mice ...... - 162 -

6.2.6. Increased -H2AX foci in Fzr1-/- arrested embryos...... - 166 -

6.2.7. Delayed embryonic development results in early compaction in 4-cell Fzr1-/- embryos - 171 -

6.3. Discussion ...... - 177 -

6.3.1. Fzr1 knockout mice ...... - 177 -

6.3.2. Loss of Fzr1 does not affect pronuclear formation in parthenotes ...... - 177 -

6.3.3. Formation of binucleated Fzr1-/- embryos as a result of failure of pronuclear fusion - 178 -

6.3.4. Increased genomic stress in Fzr1-/- embryos ...... - 179 -

6.3.5. Loss of Fzr1 delays embryo development ...... - 180 -

6.3.6. Loss of Fzr1 results in 2-cell arrest ...... - 182 -

6.3.7. Aneuploidy rates in the absence of Fzr1 ...... - 183 -

6.3.8. Loss of Fzr1 results in initiation of compaction in 4-cell embryos ...... - 184 -

6.3.9. Concluding remarks ...... - 186 -

7. General Discussion ...... - 187 -

8. References ...... - 193 -

9. Appendices ...... - 234 -

9.1. Publication article in Journal of Cell Science ...... - 234 - Page | xi

9.2. Vector maps ...... - 259 -

9.2.1. pcDNA6.2-GW/EmGFP-miR plasmid map for constitutive expression of Fzr1 knockdown ...... - 259 -

9.2.2. pcDNA6.2-GW/EmGFP-miR-neg control plasmid vector map ...... - 260 -

9.3. Culture media ...... - 261 -

9.3.1. M2 media ...... - 261 -

9.3.2. KSOM ...... - 262 -

9.3.3. KSOM-AA ...... - 263 -

9.3.4. FHM ...... - 264 -

9.4. Hormone preparations ...... - 265 -

9.4.1. PMSG (Folligon, Intervet International, Boxmeer, The Netherlands) ...... - 265 -

9.4.2. hCG (Chorulon, Intervet International, Boxmeer, The Netherlands)...... - 265 -

9.5. Buffers and solutions ...... - 265 -

9.5.1. Hyaluronidase (H4272, Sigma-Aldrich, Australia) ...... - 265 -

9.5.2. 10X PBS ...... - 265 -

9.5.3. 25X PVP ...... - 266 -

9.5.4. 2X PHEM buffer ...... - 266 -

9.5.5. 4% Paraformaldehyde/PHEM ...... - 266 -

9.5.6. 2X Embryo lysis buffer ...... - 266 -

9.5.7. Cell lysis buffer ...... - 267 -

9.6. Immunofluorescence ...... - 267 -

9.6.1. PBS/PVP ...... - 267 -

9.6.2. PBST and PBST/BSA (1X PBS, 0.2% Tween-20, 1% BSA) ...... - 267 -

Page | xii

9.6.3. Fixing solution (4% PFA, 1X PHEM, 1X PVP, 0.5% Triton-X) ...... - 267 -

9.6.4. Blocking solution (1X PBS, 0.2% Tween-20, 1% BSA, 7% goat serum) .... - 268 -

9.7. Bacterial culture and growth ...... - 268 -

9.7.1. LB broth ...... - 268 -

9.7.2. LB plate ...... - 268 -

Page | xiii

List of Tables

Table 2-1 Optimization of transfection protocol for F9 cell line ...... - 50 -

Table 2-2 miRNA design using BLOCK-iT RNAi designer………………………………..- 53 -

Table 2-3 Preparation of annealing reaction ...... - 54 -

Table 2-4 Setting up ligation reaction to clone double stranded oligo into pcDNA6.2- GW/EmGFP-miR ...... - 58 -

Table 2-5 Western blot sample preparation ...... - 61 -

Table 2-6 List of primary and secondary antibodies used for immunofluorescence ...... - 64 -

Table 2-7 Table of Excitation and Emission wavelengths of fluorochromes………………..- 74 -

Table 2-8 Table of laser wavelengths and their respective fluorochromes ...... - 74 -

Page | xiv

List of Figures

Figure 1.1 Overview of oogenesis and female meiosis ...... - 3 -

Figure 1.2 Overview of meiosis progression from prophase I arrest to pronuclei formation after fertilization…………………………………………………………………………………….- 5 -

Figure 1.3 Different pathways of syngamy to mononucleated zygote formation ...... - 8 -

Figure 1.4 Microtubule assembly in a mouse zygote following fertilization ...... - 9 -

Figure 1.5 Overview of preimplantation embryo development and relative timing of embryo genome activation in the mouse……………………………………………………………...- 15 -

Figure 1.6 Cell polarization and specification of cell lineage ...... - 21 -

Figure 1.7 Role of APC in mitosis ...... - 26 -

Figure 1.8 Overview of Fzr1 during oocyte maturation and embryo development processes - 33 -

Figure 1.9 APC activity during mitosis, meiosis and embryo development ...... - 36 -

Figure 2.1 Creating Fzr1 knockout mice ...... - 43 -

Figure 2.2 pEGFP-N3 used for optimizing transfection in F9 cell ...... - 49 -

Figure 2.3 Vector map of pMDL ...... - 52 -

Figure 2.4 Design and protocol of constitutive miRNA knockdown technique ...... - 56 -

Figure 2.5 Endogeneous mechanism to generate mature miRNA in cells ...... - 57 -

Figure 2.6 Inverted microscope set up for microinjection procedure ...... - 66 -

Figure 2.7 P-97 Flaming/Brown pipette puller for micropipette manufacture ...... - 68 -

Figure 2.8 Representative image of microinjection of an embryo ...... - 71 -

Figure 2.9 Excitation light path passing through dichroic mirror to produce signal for imaging .. - 75 -

Figure 3.1 Immunoblot of Fzr1 expression profile during preimplantation embryogenesis ... - 82 -

Figure 3.2 Fzr1 expression in F9 mouse embryonal teratocarcinoma cells ...... - 83 -

Page | xv

Figure 3.3 Generation of double stranded miRNA duplexes ...... - 85 -

Figure 3.4 Optimization of F9 cells with pEGFP-N3 using Lipofectamine LTX/Plus ...... - 87 -

Figure 3.5 F9 transfection efficiency under conditions of different plasmid and Lipofectamine concentrations ...... - 88 -

Figure 3.6 Immunoblot of Fzr1 expression in transfected F9 cells with knockdown plasmids- 90 -

Figure 3.7 Percentage of embryos developing to the 2-cell stage by Day 2 of culture after miRNA microinjection ...... - 93 -

Figure 3.8 Fzr1 constitutive knockdown in embryos ...... - 94 -

Figure 3.9 Embryo developmental progression after four days in culture...... - 95 -

Figure 4.1 Western blot of Fzr1 expression in GV oocytes of Fzr1fl/fl and Fzr1-/- mice ...... - 106 -

Figure 4.2 Number of MII eggs isolated from Fzr1-/- females...... - 107 -

Figure 4.3 Immunoblot of Fzr1 expression in MII eggs isolated from Fzr1-/- mice ...... - 108 -

Figure 4.4 Chromosomal alignment and MII spindle measurements in Fzr1-/- mice ...... - 110 -

Figure 4.5 Assessment of aneuploidy rates in MII eggs of Fzr1-/- mice by monastrol chromosome spread ...... - 111 -

Figure 4.6 Pup numbers and days between litters in Fzr1fl/fl and Fzr1-/- mice ...... - 113 -

Figure 4.7 Litter size of Fzr1fl/fl and Fzr1-/- mice ...... - 114 -

Figure 5.1 Percentage of intact embryos collected from different strains of mice ...... - 125 -

Figure 5.2 Rate of blastocyst formation from zygotes of mated females cultured in KSOM and KSOM/AA...... - 128 -

Figure 5.3 Blastocyst formation rates of parthenotes cultured in KSOM or KSOM/AA. .... - 129 -

Figure 5.4 Blastocyst formation in Fzr1fl/fl embryos in comparison to F1 hybrids and C57Bl6, cultured in KSOM/AA medium ...... - 131 -

Figure 6.1 Schematic diagram of MII egg activation protocol using Sr2+ and CCD ...... - 140 -

Page | xvi

Figure 6.2 Immunoblot of Fzr1 expression in mated and activated Fzr1fl/fl embryos ...... - 141 -

Figure 6.3 Fzr1-/- MII eggs can be activated normally by Sr2+ containing medium...... - 142 -

Figure 6.4 Fzr1-/- MII eggs form 2 pronuclei when activated in the presence of Sr2+ and cytochalasin D...... - 143 -

Figure 6.5 Time lapse imaging of activated parthenotes for assessment of pronuclei formation .. - 144 -

Figure 6.6 Number of hours post-activation for pronuclei formation in Fzr1-/- mice ...... - 145 -

Figure 6.7 Delay in early embryogenesis at Day 2 for Fzr1-/- embryos ...... - 148 -

Figure 6.8 Delay in early embryogenesis at Day 3 for Fzr1-/- embryos ...... - 149 -

Figure 6.9 Delay in early embryogenesis at Day 3.5 for Fzr1-/- embryos ...... - 150 -

Figure 6.10 Delay in early embryogenesis at Day 4 for Fzr1-/- embryos ...... - 151 -

Figure 6.11 Asynchrony in early cleavage divisions of Fzr1-/- embryos ...... - 152 -

Figure 6.12 Examination of cell cycle phases in 2-cell arrested parthenotes after 4 days in culture ...... - 154 -

Figure 6.13 Percentage of 2-cell arrested Fzr1fl/fl and Fzr1-/- embryos at interphase or undergoing mitosis after day 4 in culture ...... - 155 -

Figure 6.14 First mitotic division in an Fzr1fl/fl embryo ...... - 157 -

Figure 6.15 First mitotic division in an Fzr1-/- embryo ...... - 158 -

Figure 6.16 Percentage of Fzr1fl/fl and Fzr1-/- embryos that underwent syngamy ...... - 159 -

Figure 6.17 Errors during the first mitotic division in Fzr1-/- parthenotes ...... - 160 -

Figure 6.18 Percentage of 1-cell parthenotes that experienced mitotic difficulties during live cell imaging of first mitosis ...... - 161 -

Figure 6.19 Chromosomal counts in an Fzr1fl/fl embryo ...... - 163 -

Figure 6.20 Aneuploidy rate in Fzr1fl/fl 2-cell embryos 48 hours post-hCG ...... - 164 -

Figure 6.21 Monastrol induced chromosome spreads in Fzr1-/- embryos...... - 165 - Page | xvii

Figure 6.22 -H2AX foci in GV oocytes treated with mitomycin C ...... - 167 -

Figure 6.23 -H2AX immunostaining in an Fzr1-/- embryo after 4 days in culture ...... - 168 -

Figure 6.24 -H2AX immunostaining in an Fzr1fl/fl embryo ...... - 169 -

Figure 6.25 -H2AX counts in Fzr1fl/fl and Fzr1-/- embryos ...... - 170 -

Figure 6.26 Timing of compaction in Fzr1fl/fl and Fzr1-/- embryos...... - 173 -

Figure 6.27 Slow division of Fzr1-/- embryos results in compaction at the 4-cell stage...... - 174 -

Figure 6.28 Quantitative analysis of E-cadherin immunofluorescence in Fzr1-/- and Fzr1fl/fl embryos ...... - 175 -

Figure 6.29 Death rate of embryos after 120 hours post hCG ...... - 176 -

Figure 7.1 Overview of Fzr1 in meiosis and embryogenesis ...... - 192 -

Page | xviii

List of Abbreviations

6-Dimethylaminopurine 6-DMAP Anaphase A Anaphase promoting complex/cyclosome APC Ataxia-telangiectasia mutated ATM Ataxia-telangiectasia and Rad3-related ATR Brinster’s Medium for Ovum Culture BMOC Bone morphogenetic protein 15 Bmp15 5-bromo-2-deoxyuridine BrdU Bovine serum albumin BSA Budding uninhibited by benzimidazole Bub Cyclic adenosine monophosphate cAMP Cytochalasin D CCD Fizzy/ cell division cycle 20 Cdc20 Cyclin dependent kinases Cdk Cytoskeleton-associated protein 2 CKAP2 Cytomegalo-virus CMV Cumulus-oocyte-complexes COCs Chromosome passenger complex CPC Cytostatic Factor CSF Chatot-, Ziomek- and Bavister-medium CZB Destruction box D-box Dulbecco’s Modified Eagle’s medium DMEM Dimethyl sulphoxide DMSO DNA methyltransferase DNMT1 Days postcoitum DPC double stranded RNA dsRNA Embryonic day E Ubiquitin activating enzyme E1 Ubiquitin conjugating enzyme E2 Ubiquitin ligase E3 Essential amino acids EAA Early blastocyst EB Ethylenediaminetetraacetic acid EDTA Embryonic genome activation EGA Early mitotic inhibitor Emi1 Epiblast EPI Embryonic stem cells ES cells Fluorescence activated cell sorting FACS Fully expanded blastocyst FB Fetal bovine serum FBS Page | xix

Factor in the germline Figla Fluorescein isothiocyanate FITC Follicle stimulating hormone FSH Futile cycle fue Fizzy/cell division cycle 20-related protein 1 Fzr1 Fzr1 oocyte-specific knockout mutant Fzr1-/- Floxed Fzr1 knockout control Fzr1fl/fl Glyceraldehyde 3-phosphate dehydrogenase Gapdh Growth differentiation factor 9 Gdf9 Gamma- histone 2AX g-H2AX Gap phase G-phase Glycosylphosphastidylinositol GPI Germinal vesicle GV Germinal vesicle breakdown GVBD Histone-2B H2B human Chorionic Gonadotropin hCG 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HEPES Horseradish peroxidase HPR Inner cell mass ICM Inter-peritoneal IP International units IU K+ modified simplex optimized medium KSOM KSOM supplemented with amino acid KSOM/AA Luria broth LB Luteinizing hormone LH Lymphoid-restricted membrane protein lrmp Morulae M Mitotic arrest deficient Mad Maternal antigen that embryos require Mater Midblastula transition MBT Mitotic checkpoint complex MCC Mini-chromosome maintenance complex MCM Mouse embryonic fibroblasts MEFs Mitotic exit network MEN Meiosis I MI Meiosis II MII Metaphase II eggs MII eggs miRNA-containing RNA-induced Silencing Complex miRISC microRNA miRNA Myosin light-chain kinase MLCK Mitomycin C MMC Page | xx

Modified tubal fluid medium mMTF 3-(N-morpholino)propanesulfonic acid MOPS Maturation promoting factor MPF Mitotic phase M-phase messenger RNA mRNA Microtubule organising centres MTOCs DEAD(Asp-Glu-Ala-Asp) box polypeptide 4 MVH Maternal to zygotic transition MZT Non-essential amino acid NEAA Nuclear envelop breakdown NEBD Sodium/Hydrogen Exchangers NHE Origin recognition complex ORC Polyacrylamide Gel Electrophoresis PAGE Polar body PB Polar Body Extrusion PBE Phosphate Buffered Saline PBS Phosphate Buffered Saline/polyvinylpyrrolidone PBS/PVP Phosphate Buffered Saline/Tween-20 PBST Primitive Endoderm PE Paraformaldehyde PFA Primordial Germ Cells PGCs Propidium Iodide PI Protein Kinase A PKA Protein Kinase C PKC Phospholipase c-zeta PLCz Polo-like kinase 1 Plk1 Pregnant Mare Serum Gonadotrophin PMSG Pronucleus PN RNA Polymerase II Pol II Poly-Adenylated poly-A Protein Phosphatase 2A PP2A precursor miRNA pre-miRNA Pre-replicative complex Pre-RC primary miRNA pri-miRNA Polyvinylidene fluoride PVDF RNA interference RNAi Spindle Assembly Checkpoint SAC Skp1/Cullin/F-box SCF Sodium Dodecyl Sulphate SDS Shugoshin SGO short hairpin RNA shRNA

Page | xxi

short interfering RNA siRNA Spectral Karyotyping SKY Super Optimal Broth SOC Simplex Optimization Medium SOM DNA replicative/ synthesis phase S-phase Trophectoderm TE Trophoblast Giant Cells TGCs Transforming Growth Factor-b TGF-b Thymidine Kinase 1 TK1 Tumor-associated Microtubule-Associated Protein TMAP Thymidylate Kinase TMPK N,N,N’,N’,-Tetrakis-(2-pyridylmethyl) ethylenediamine TPEN Zona Pellucida ZP

Page | xxii

Chapter 1 Introduction

1. Introduction

In this thesis, I am interested in meiotic maturation following metaphase II resumption and early embryo development. In particular, I will be focusing on the protein, Fizzy/cell division cycle 20-related protein 1 (Fzr1), a co-activator of the anaphase promoting complex (APC).

Here in the introduction, I will first discuss the process of female meiosis and how it leads to embryo formation following fertilization. I will then go through the key developmental events in an embryo that will eventually give rise to a blastocyst ready to be implanted into the wall of a receptive uterus. Next, I will provide an overview of Fzr1 and its involvement during mitosis, meiosis.

1.1. Female gametogenesis Gametogenesis in mammals is a specialized and highly regulated cell cycle event known as meiosis. In meiosis, haploid gametes are created from diploid germ cells after undergoing a single DNA replication followed by two consecutive rounds of chromosome segregation without an intervening S phase. During meiosis I (MI), separation of dyad/paired homologs takes place, and in meiosis II (MII), sister chromatid separation occurs to create haploid gametes, giving rise to spermatozoa in males and oocytes in females. The production of haploid gametes allows for the maintenance of proper chromosome numbers in offsprings by avoiding polyploidy as well as giving rise to genetic diversity in subsequent generations.

In female mammals, the processes of oogenesis and meiosis begin during fetal development, and continue after birth. Resumption of meiosis occurs after puberty to produce the female gamete, sometimes called the ovum or mature egg and this process is only completed after fertilization (Austin and Short, 1982). During mammalian fetal development, embryonic precursors of gametes termed primordial germ cells (PGCs) are formed (Ginsburg et al., 1990) and migrate to the gonads where they to continue to divide mitotically until approximately 13.5 days postcoitum (dpc)(Bukovsky et al., 2005; Tam and Snow, 1981). At the gonads, germ cells are termed oogonia and enter meiosis to become oocytes. However, only a subset of oogonia will undergo differentiation to form oocytes that will maturate to form an ovum ready for fertilization.

During the first division, homologous chromosomes are paired and chiasmata are formed for chromosomal recombination to take place. Oocytes enter prophase of the first meiotic division; where they arrest for a protracted period of time, ranging from a few months in mice to several years or even decades in humans (Bachvarova, 1985). In mammals, meiotic Page | ‐ 1 ‐

Chapter 1 Introduction

arrest is dependent on a cyclic nucleotide known as cyclic adenosine monophosphate (cAMP) and is generated by the oocyte itself (Aberdam et al., 1987; Meijer et al., 1989b; Richards et al., 1998; Schultz et al., 1983). The mid-cycle luteinizing hormone (LH) surge results in intracellular cAMP levels to decrease, triggering meiotic resumption of immature oocytes (Conti, 2002; Richards et al., 1995; Richards, 2001; Törnell et al., 1990). This drop in oocyte cAMP level reduces Protein Kinase A (PKA) activity which in turn activates Maturation Promoting Factor (MPF)(Bornslaeger et al., 1986; Matten et al., 1994), which releases oocytes from germinal vesicle (GV) arrest. Following meiotic resumption, the oocyte undergoes two successive rounds of meiotic divisions in the absence of a replicative S-phase arresting at metaphase II, and meiosis is only completed at the time of fertilization (Figure 1.1)

1.1.1. Overview of female meiosis In the mouse, oocytes exiting mitosis contain 20 pairs of chromosomes and are in pre- meiotic arrest at prophase I. Prophase I is made up of five stages, leptotene, zygotene, pachytene, diplotene and diakinesis. In the leptotene stage, individual chromosomes, each consisting of two sister chromatids, undergo condensation to form visible strands within the nucleus. In the zygotene stage, synapsis of chromosomes takes place whereby chromosomes line up with one another into homologous chromosome pairs known as bivalents. At the pachytene stage, chromosomal crossover occurs whereby chiasmata forms and homologous recombination of nonsister chromatids is initiated. At the diplotene stage, chromosome decondensation occurs and oocytes are now known as GV stage, remain at the prophase I arrest at birth. During this arrest, primordial follicle structures enclose the GV oocyte, being surrounded by one layer of pre-granulosa cells (Brunet and Maro, 2005). During each estrous cycle, under the influence of gonadotrophic hormones, follicle stimulating hormone (FSH) and LH released by the pituitary (Richards and Hedin, 1988; Richards, 1980), a group of GV oocytes are recruited to make up the growing pool of follicles prior to ovulation (Yanagimachi, 1994). Following these hormonal cues, diakinesis or prometaphase resumes, resulting in chromosome condensation, nuclear envelope breakdown (NEBD or GVBD) and assembly of the meiotic spindle.

During metaphase I, homologous pairs align along the same equatorial line of the metaphase plate. Microtubules attach to chromosomes at the two kinetochores of each bivalent (Zhai et al., 1995). When chromosomal alignment has been achieved, anaphase

Page | ‐ 2 ‐

Chapter 1 Introduction

Fetal life Human - 46 chr oogonium pool Mouse - 40 chr oogonia (mitosis)

recruit for meiosis

oogonium Birth ~13 years in humans meiosis I ~6 weeks in mouse Puberty / sexual maturity Primary oocyte/ GV oocyte

GVBD

PBE 1

meiosis II

Reproductive X age X Humans - 23 chr Secondary Mouse - 20 chr oocyte/ MII egg

Figure 1.1 Overview of oogenesis and female meiosis In the embryonic ovary, primordial germ cells are recruited to undergo mitosis to give rise to a pool of oogonia and GV arrest commences shortly after birth. An oocyte completes meiosis in two stages: homologous chromosome separation and sister chromatid separation. A small group of quiescent follicles are recruited periodically into the growing pool after birth that leads to follicular growth and ovulation, both of which are under hormonal influence after puberty.

Page | ‐ 3 ‐

Chapter 1 Introduction

onset ensues and homologs are segregated, leaving one half of the chromosomes in the oocyte while the other half gets extruded into the polar body (Maro and Verlhac, 2002). Here, each chromosome is made up of two sister chromatids and cytokinesis marks the completion of MI.

Following MI completion, MII is initiated and sister chromatid alignment begins along the meiotic spindle before arresting at metaphase II until fertilization or parthenogenetic activation (Maro and Verlhac, 2002). In MII eggs, this arrest is maintained by MPF, which is stabilized by the presence of Cytostatic Factor (CSF)(Kubiak et al., 1993; Sagata, 1996). The initiation of MII resumption is marked by the 90 degrees rotation of the meiotic spindle to facilitate second polar body extrusion (Edwards, 1965). During Anaphase II, sister chromatids are segregated and the completion of MII is evident by the extrusion of the second polar body and pronuclear formation of parental DNA (Runft et al., 2002)(Figure 1.2).

Female meiotic maturation is characterized by two successive asymmetric divisions, each producing a large oocyte and a small (~1% of oocyte size) polar body. In the mouse oocyte, spindles do not have asters at the poles (anastral)(Szollosi et al., 1972) and thus this process is regulated by cortical migration and asymmetrical position of the central meiotic spindle (Verlhac et al., 2000; Wang et al., 2008). In doing so, the oocyte retains most of its cytoplasm instead of losing half of the material to the polar body that would eventually be degraded (Maro and Verlhac, 2002). This is an important process because preservation of maternal resources in the oocyte is necessary for supporting embryonic development which will be discussed later.

1.1.2. Fertilization and egg activation Mammalian eggs are ovulated in a quiescent MII arrested stage and surrounded by the cumulus cell mass, awaiting for fertilization to take place by a sperm (Runft et al., 2002). Fertilization is a complex process involving a series of events that culminates to form a zygote ready for development. For the sperm to fuse with the egg, it will first have to pass through the cumulus mass and the zona pellucida (ZP) that surrounds the egg (Edwards and Gates, 1959; Gaddum‐Rosse et al., 1982; Krishna and Generoso, 1977). The sperm will undergo two processes, capacitation and acrosomal reaction to pass through the cumulus mass and ZP for successful egg penetration (Fleming and Yanagimachi, 1982; Ickowicz et al., 2012; Reid et al., 2012; Wassarman and Place, 1999; Yanagimachi, 1989), and the process of fertilization ends following fusion of gametes with the creation of an embryo. Page | ‐ 4 ‐

Chapter 1 Introduction

Fertilization

X X < < X X XX X GV X >

Prophase I GVBD Prometaphase I Metaphase I Anaphase I PBE 1 Metaphase II PBE 2 PN

Meiosis I Meiosis II

Figure 1.2 Overview of meiosis progression from prophase I arrest to pronuclei formation after fertilization Oocytes arrest for a protracted period of GV arrest. Resumption of meiosis is marked by the observation of nuclear envelope/germinal vesicle breakdown, GVBD. Bipolar anastral (lack of asters at spindle poles) barrel-shaped spindles are assembled and homologous chromosomes are separated. Meiosis I ends with unequal cytokinesis, resulting in extrusion of a smaller polar body. Oocytes then assemble another spindle and arrest at MII waiting for the arrival of a sperm. Fertilization triggers egg activation and meiosis II resumes ending with separation of sister chromatids and extrusion of a second polar body. Both parental genomes will form pronuclei and undergo independent DNA replication prior to chromosome mixing in the embryo.

Page | ‐ 5 ‐

Chapter 1 Introduction

During fertilization, the sperm has two important functions; (1) to deliver the paternal genome into the egg and (2) to activate the egg to resume meiotic completion and so initiate subsequent entry into the embryonic cell cycle. At fertilization when membranes of the gametes fuse, the sperm introduces a soluble protein into the egg that triggers the release of cytosolic calcium and consequently inducing a series of calcium oscillations (Dumollard et al., 2002; Homa and Swann, 1994; Stricker, 1999; Swann, 1996). In mice, this series of calcium waves last for about four hours, stopping at pronuclei formation (Cuthbertson and Cobbold, 1985; Marangos et al., 2003; Taylor et al., 1993). It was later discovered that this protein is located in the head of the sperm (Kimura et al., 1998) and is phospholipase c-zeta (PLC(Cox et al., 2002; Jones, 1998; Kouchi et al., 2004; Miyazaki et al., 1993; Saunders et al., 2002; Stricker, 1999; Swann, 1990). This increase in cytosolic calcium mediates egg activation, which consists of several processes, including cortical granule exocytosis, meiotic resumption and the recruitment of maternal mRNAs (Ducibella et al., 2002; Kline and Kline, 1992; Swann and Ozil, 1994).

Egg activation can also be achieved by other means in the absence of the sperm in a process known as parthenogenetic activation. Since egg activation is dependent on the initial rise in intracellular calcium level, chemical or physical treatment that results in increased calcium signal in the egg will also achieve the same outcome (Mittwoch, 1978; Swann and Ozil, 1994). There are various methods of parthenogenetic activation that do not result in waves of calcium signalling, and instead creates only a single and sustained calcium rise (Colonna et al., 1989; Cuthbertson et al., 1981; Liu et al., 2002; Ozil, 1990; Swann and Ozil, 1994). An electro- physiological method of parthenogenetic activation is to generate an electrical pulse through the egg, which can trigger a single sustained spike of calcium (Ozil, 1990). Chemically, eggs can be treated with agents such as ethanol or strontium but only activation using strontium has been shown to best mimic the calcium oscillations as seen when triggered by the sperm (Bos-Mikich et al., 1995; O'neill et al., 1991; Swann, 1990; Swann and Ozil, 1994). Additionally, there are also chemicals such as cycloheximide (Moses and Kline, 1995), 6-dimethylaminopurine (6-DMAP)(Moses and Masui, 1994) and N,N,N’,N’,-tetrakis-(2-pyridylmethyl) ethylenediamine (TPEN)(Arslan et al., 1985) that can activate eggs in the absence of Ca2+ increase.

1.1.3. Syngamy

Concluding the event of fertilization is the coalescence of male and female pronuclei in a process termed syngamy. In most species, syngamy of parental pronuclei generally follows

Page | ‐ 6 ‐

Chapter 1 Introduction

one of two patterns. In the first instance, maternal and paternal pronuclei migrate into close association, but no actual chromosomal fusion occurs before nuclear membrane breakdown. Congression of parental genetic material will only take place after mitotic entry and fuse during metaphase of the first embryonic cell cycle. This form of syngamy is characteristic in eggs that are fertilized prior to meiotic completion such as that observed in Drosophila, mouse and humans (Callaini and Riparbelli, 1996; Schatten et al., 1985; Simerly et al., 1995). In the second instance, fusion of parental genome occurs immediately after pronuclei association without the formation of parental pronuclei envelope, producing a mononucleated zygote. This form of syngamy is representative of eggs that have completed meiosis at the time of fertilization and is observed in sea urchins and C. elegans (Figure 1.3)(Longo and Anderson, 1968; Strome and Wood, 1983; Ubbels et al., 1983).

In unfertilized mouse eggs, meiotic spindles are anastral barrel-shaped and attached to the cortex (FitzHarris et al., 2007; Wassarman and Fujiwara, 1978). At the time of sperm incorporation, numerous small cytoplasmic asters assemble in association with the oocyte cortex (Schatten et al., 1985) and are involved in the process of second polar body extrusion. As the pronuclei develop in the early zygote, a fine lattice of microtubules fill the cytoplasm and are organized by several foci with some being associated to the pronuclei (Schatten et al., 1985). At the time of mammalian fertilization, microtubules present are thought to interact with the perinuclear actin of the pronuclei given that treatment with cytochalasin and latrunculin inhibits pronuclear apposition in the mouse (Figure 1.4A-F)(Maro et al., 1984).

In order for parental genomes to fuse, microtubules have been found to facilitate the migration of both pronuclei to come into close association (Brawley and Quatrano, 1979; Reinsch and Karsenti, 1997; Schatten et al., 1985). In the egg, microtubules are predominantly found in the meiotic spindles of the arrested MII egg. However at the time of fertilization, centrioles contributed by the sperm mediate the assembly of numerous cytoplasmic asters, associating closely to and facilitate pronuclei migration, bringing them into close proximity (Albertson, 1984; Klotz et al., 1990; Lessman and Huver, 1981; Schatten, 1982; Schatten, 1994; Schatten et al., 1986). In the early mouse and human zygote, parental genomes are contained within separate nuclear envelopes, each undergoing independent chromosome replication and will only fuse on the metaphase plate (Figure 1.4G-K)(Callaini and Riparbelli, 1996; Schatten et al., 1985; Simerly et al., 1995). A study examining mouse zygotes following fertilization has demonstrated the importance of microtubules during syngamy using drug treatment that inhibited microtubule formation Page | ‐ 7 ‐

Chapter 1 Introduction

I : Fertilization prior to II : Fertilization after meiotic completion in meiotic completion in egg egg

parental genome

polar bodies

nuclear envelope

embryonic genome

Figure 1.3 Different pathways of syngamy to mononucleated zygote formation

Following fertilization, depending on whether the oocyte has completed meiosis, the process of syngamy will follow one of two paths. (I) In eggs fertilized prior to meiotic completion, parental pronuclei form separate nuclear envelopes and come into close association without chromosomal fusion until metaphase of the first mitotic cell cycle. (II) In eggs that are fertilized after meiotic completion, chromosomal fusion occurs immediately when parental genomes are in close proximity to form a mononucleated diploid zygote.

Page | ‐ 8 ‐

Chapter 1 Introduction

A BC DE F

GHI J K

Figure 1.4 Microtubule assembly in a mouse zygote following fertilization (A) MII spindle present in the unfertilized mouse egg. Anastral barrel-shaped spindle attached to the cortex of the egg surface; (B) Meiotic completion is achieved by the extrusion of the second polar body; (C) During sperm incorporation, maternal cytoplasmic asters assemble During pronuclear formation, microtubules of the sperm axoneme becomes apparent; and cytoplasmic spindles enlarge; (D) Pronuclear migration towards egg centre and dense array of microtubules were assembled; (E) At the end of interphase, disassembly of dense microtubule array, adjacent but still separated pronuclei are enclosed in individual sheaths of microtubules; (F) At prophase, spindle emerges from perinuclear microtubules; (G) Formation of anastral barrel shaped independent of sperm axoneme; (H) At anaphase, asters form in the cytoplasm and spindle elongates; (I) At telophase, central spindle formation; (J) During cytokinesis, central spindle aggregate to the midbody and new cytoplasmic aster formation; (K) At interphase, monoasters form from cytoplasmic arrays and position each nucleus at the cell centre of the blastomere.

Page | ‐ 9 ‐

Chapter 1 Introduction

(Schatten et al., 1985). This resulted in a failure of pronuclear fusion and maternal chromosomes were observed to be dispersed all over the oocyte cortex (Schatten et al., 1985). In addition, PolyADP-ribosylation in mouse zygotes has also been found to be crucial for pronuclei fusion by mediating pronuclear envelope breakdown (Osada et al., 2010). However, to date, little is known about the mechanisms underlying the process of syngamy in the mouse.

Much of what is currently known about syngamy is based on previous studies carried out in a variety of organisms such as fish, nematodes, Xenopus and sea urchins. Several genes such as futile cycle (fue)(Dekens et al., 2003), lymphoid-restricted membrane protein (lrmp)(Lindeman and Pelegri, 2012; Nguyen et al., 2012) and Cdk1-cyclin B activity (Tachibana et al., 2008) have now been identified to be involved in microtubule assembly in the zygote, necessary for pronuclear union during syngamy.

1.2. Overview of Embryogenesis Mammalian preimplantation embryo development extends from the time of egg fertilization until the time of blastocyst implantation in the uterus wall at about embryonic day (E)4.5 in mouse and E6-7 in humans (Cockburn and Rossant, 2010). During this period, blastocyst formation sets aside three distinct cell lineages that will make up the embryo and its extraembryonic membranes. Only the epiblast (EPI) will contribute to the embryo proper, the trophectoderm (TE) and primitive endoderm (PE) will form parts of the extraembryonic tissues. The TE will contribute to majority of the fetal placenta while the PE will form the parietal and visceral endoderm, which will later become the yolk sac (Monk et al., 1987; Nishioka et al., 2008).

During preimplantation embryogenesis, there are several significant developmental milestones that lead up to blastocyst formation. Following egg fertilization, fusion of parental DNA marks the beginnings of early embryo cleavage divisions. There is also the maternal to zygotic transition (MZT) early in the embryo. Cleavage divisions will give rise to the 8-cell embryo that will be polarized and undergo compaction, an important process necessary for proper segregation of the three embryonic lineages. Blastulation begins at the 32-cell stage whereby outer cells commit to the TE lineage and blastocoel formation is initiated, essential for proper inner cell mass (ICM) development. These processes in the embryo will be described in detail in the following sections.

Page | ‐ 10 ‐

Chapter 1 Introduction

1.2.1. Timing of cell cycle in early embryogenesis The event of fertilization marks a switch from meiotic to mitotic cell division. However, it has been reported recently that this process is a gradual transition occurring during the period of preimplantation embryo development (Courtois et al., 2012). One of the features of this gradual transition is the change over from acentrosomal to centrosomal spindle formation. Several studies have demonstrated that this transition takes about 3 days before proper mitosis is established in the early mouse embryo (Courtois et al., 2012; FitzHarris, 2009; Kubiak et al., 2008; Schatten et al., 1985; Schuh and Ellenberg, 2007). During this period of transition, the early embryo does not contain centrioles and instead depends on microtubule organising centres (MTOCs) for spindle assembly (Courtois et al., 2012; Schatten et al., 1985; Wassarman and Fujiwara, 1978).

In the oocytes of many species such as mouse and human, acentrosomal spindle assembly is important for meiotic cell cycle progression. During GV stage, cytoplasmic MTOCs are recruited to the surface of the nucleus that will lead to stochastic self-organization, giving rise to a barrel shaped spindle (Schuh and Ellenberg, 2007). Since there is an apparent absence of centrioles in the early embryo, multiple MTOCs establish multipolar spindles within the zygote or each blastomere that would eventually reorganize to form the barrel- shaped spindle during the first three embryonic mitotic divisions resembling that of oocytes during meiosis (Courtois et al., 2012; Kubiak, 1991). Therefore during the early mitotic divisions of the embryo, some meiotic traits and pathways are still shared and active.

Events that follow fertilization and the first few embryonic cell divisions are usually synchronous and tightly regulated (Ciemerych and Sicinski, 2005). Following meiotic completion in the egg, both parental pronuclei will form approximately 4.5 to 6.5 hours post-insemination. The maternal pronucleus is closer to the second polar body and is comparatively smaller than the paternal pronucleus (Howlett and Bolton, 1985; Luthardt and Donahuc, 1973). Each pronucleus will undergo independent DNA replication (S-phase) approximately 8 to 10 hours after fertilization and this generally lasts for 4 to 8 hours, depending on the strain of mouse (Howlett and Bolton, 1985; Molls et al., 1983; Schabronath and Gärtner, 1988).

After egg activation, the embryo undergoes several rounds of cleavage divisions, comprising of alternating S and mitotic (M)- phases with short Gap (G)-phases (Ciemerych and Sicinski, 2005; Smith and Johnson, 1986). These cleavage divisions result in the formation of increasing numbers of smaller blastomeres, so exponentially increasing the Page | ‐ 11 ‐

Chapter 1 Introduction

number of nuclei and DNA content without any change to the actual size of the embryo. These rapid rounds of cell cycle are tightly regulated and usually take place within a narrow range of time with variations observed between the different strains of mice used. During the first cell cycle, the average cleavage time is approximately 22 to 26 hours (Ciemerych and Sicinski, 2005; Shire and Whitten, 1980). However, this process can be as short as only 13 hours (Molls et al., 1983), with combined M and G2 phases lasting between 3 to 8 hours and variable lengths of S phases between strains of mice. S-phase of the second mitotic cycle commences almost immediately after the completion of the first cell division with G1-phase lasting only for 1 hour (Bolton et al., 1984; Ciemerych et al., 1999). The second cleavage cycle is between 18 to 22 hours and such a range is due to the variable S phases, which are between 4 to 7 hours and M+G2 phases lasting between 12 to 15 hours (Luthardt and Donahuc, 1973; Molls et al., 1983). The third cleavage cycle takes approximately 12 hours to complete, with S-phase lasting approximately 7 hours, and a combined M- and G2-phase lasting 2 to 5 hours (Smith and Johnson, 1986). In later stage embryos, the average length of each cell cycle is approximately 10 hours (Streffer et al., 1980). Generally, a 2 hour delay is observed in embryos cultured in vitro in comparison to the times observed above (Streffer et al., 1980).

1.2.2. Embryonic genome activation During intraovarian growth, an oocyte increases in size and volume, synthesising and accumulating a store of maternal proteins, mRNAs and various factors necessary for its own growth, maturation and most importantly, for sustaining early embryonic development in its cytoplasm (Bachvarova, 1985; De Leon et al., 1983; Eppig, 1996; Moore and Lintern- Moore, 1978; Sorensen and Wassarman, 1976). Oocyte growth is dependent on the presence and communication with the surrounding granulosa cells (Buccione et al., 1990; Eppig, 1991; Su et al., 2009). In mouse, granulosa cells-to-oocyte communication is mediated through Gap junctions such as connexin (Carabatsos et al., 2000; Gittens et al., 2003; Juneja et al., 1999; Kidder and Mhawi, 2002; Simon et al., 1997). The highest activity of transcript synthesis occurs during the early phase of oocyte development, coinciding with the period of rapid proliferation of granulosa cells resulting in follicle expansion (Bachvarova et al., 1985; Clegg and Pikó, 1983; Su et al., 2007). However, at the time of oocyte maturation, the oocyte becomes transcriptionally quiescent and majority of its polyadenylated RNA gets degraded (Bachvarova et al., 1985; Clegg and Pikó, 1983; Su et al., 2007). By the time an oocyte is fully grown and meiotically competent, it would

Page | ‐ 12 ‐

Chapter 1 Introduction

contain approximately 200 times the amount of RNA found in a typical somatic cell, which is essential for the development of a viable embryo (Wassarman and Kinloch, 1992).

Upon fertilization, one of the first roles of maternal factors is to process the male genome and chromosomes undergo remodelling to restore totipotency and establish transcriptional activation of zygotic genes (Latham and Schultz, 2001). It has been found that maternal genetic differences plays an influential role in how the oocyte modifies maternal chromosomes during oogenesis (Reik et al., 1993; Roemer et al., 1997), which in turn affects paternal genome modifications following fertilization (Latham, 1994; Latham and Sapienza, 1998; Latham and Solter, 1991), and therefore impact the methylation patterns and embryonic gene expressions (Sapienza et al., 1989; Surani et al., 1990).

MZT is the first developmental transition that occurs in the embryo. This transition involves two interrelated processes; (1) degradation of a subset of maternal mRNAs and proteins (Yu et al., 2001), and (2) initiation of zygotic transcription to firstly replace transcripts common to both oocyte and embryo, and to secondly promote reprogramming of gene expression to generate transcripts that are not expressed in the oocyte (Latham et al., 1991). Early events of embryogenesis following fertilization until MZT are governed by mRNA and proteins accumulated and stored during oocyte maturation until MZT (Clegg and Pikó, 1977; Clegg and Pikó, 1982; Moore, 1975; Young et al., 1978). In the mouse, zygotes remain transcriptionally inactive for at least 20 hours post-fertilization before an initial weak burst of zygotic transcription occurs at the late 1-cell embryo (Braude et al., 1979; Clegg and Pikó, 1982; Cullen et al., 1980; Latham et al., 1991; Latham et al., 1992; Petzoldt et al., 1980). In mammals, this transition occurs as early as the 2-cell stage such as the mouse (Schultz, 2005), by the 4- to 8-cell stage in bovine and humans (Bachvarova, 1985; Braude et al., 1988; Telford et al., 1990) or later at >12th cell cycle in Drosophila and Xenopus (Newport and Kirschner, 1982b; Tadros et al., 2007).

Following the minor wave of gene activation, 2 major waves of embryonic activation occur; first at the 2-cell stage and later at the 4- to 8-cell transition in the mouse (Figure 1.5)(Carter et al., 2003; Hamatani et al., 2004; Wang et al., 2004). Initiation of zygotic transcription at the two-cell stage signifies the transition from maternal to zygotic genome control in a process known as embryonic genome activation (EGA). This process results in the rapid degradation of total RNA content (Olds et al., 1973), reduction in polyadenylated (poly-A) RNA amounts and average chain lengths (Bachvarova and De Leon, 1980; Clegg and Piko, 1978; Levey et al., 1978) as well as maternal transcripts in the

Page | ‐ 13 ‐

Chapter 1 Introduction

embryos (Figure 1.5)(Aoki et al., 1997; Flach et al., 1982; Hamatani et al., 2004; Petzoldt et al., 1980). As such, EGA may not necessarily behave as a switch-like process but rather a step-wise event. It has been shown that specific genes are transcribed at the late 1-cell embryo that supports the transcription of some 2-cell stage-specific genes (Christova and Oelgeschläger, 2001; Latham et al., 1992; Martínez-Balbás et al., 1995). In addition, many house-keeping genes have been reported to be transcribed at the 2- and 4-cell stage, and are dramatically upregulated at the 8-cell stage (Latham et al., 1991; Latham and Rambhatla, 1995). The initiation of EGA in embryos is of paramount importance because failure to express the correct genes or errors in timing of activation has been shown to result in embryonic arrest (Bultman et al., 2006).

1.2.3. 2-cell block As discussed in Section 1.2.2, during early embryogenesis, there is limited activity of the embryonic genome and instead the zygote is under the control of oocyte components accumulated during meiosis. In the mouse, this post-transcriptional maternal control has been found to extend from the time of fertilization until the mid/late 2-cell stage when MZT occurs. During this transition, the metabolic requirements of the embryos are changed and even though they do possess some level of tolerance to media deficiencies, the availability of essential components are vital for culturing embryos in vitro. In some strains of mice, the metabolic requirements of the embryos appear to be harder to satisfy, and even though cleavage of 1-cell to 2-cell stage can still happen under unfavourable or sub-optimal conditions, further development to blastocyst is compromised.

Zygotes derived from outbred/random bred (close population of genetically different mice bred for maximum heterozygosity)(Chia et al., 2005) strains of mice have been observed to arrest at the 2-cell stage even though they had been be grown in chemically defined media containing pyruvate, lactate and bovine serum albumin (Biggers and Blandau, 1971; Cross and Brinster, 1973; Whitten, 1957; Whittingham, 1975). This phenomenon is now commonly known as the ‘2-cell block’ and embryos are found to usually arrest at the G2- phase of the second cell cycle (Goddard and Pratt, 1983). However, using the same media, embryos from inbred strains (genetically defined; bred among siblings for at least 20 generations)(Beck et al., 2000), or hybrids derived between different inbred strains of mice were able to successfully develop into normal blastocysts (Biggers and Blandau, 1971; Whitten and Biggers, 1968; Whittingham, 1975). A characteristic of the 2-cell block is that

Page | ‐ 14 ‐

Chapter 1 Introduction

Compaction Blastocoelic cavity < X X X ICM ICM

Blastocoel TE

Syngamy 2-cell stage 4-cell stage 8-cell stage Morula Early Fully expanded blastocyst blastocyst Fertilization Cleavage stage Cavitation Blastulation

Maternal

No Minor Major Transcription ZGA EGA (arbitary units) Transcription activity

Embryonic

12 32 52 66 80 120 Post-hCG (hours)

Figure 1.5 Overview of preimplantation embryo development and relative timing of embryo genome activation in the mouse Following fertilization, the egg completes meiosis and extrudes the second polar body. Parental genomes congress and fuse during syngamy before undergoing the first mitotic division. Up until the late 1-cell stage, all events happening in the zygote are under the control of maternal mRNA and proteins accumulated during oogenesis because no embryonic transcription is observed. At the late 1-cell stage, a small burst of zygotic genome activation is observed and only a selected pool of embryonic genes necessary for 2-cell stage development get transcribed. At the mid 2-cell stage, a major wave of embryonic genome activation is initiated, marking the transition from maternal to embryonic control of processes. During this period, rapid degradation of maternal transcripts and proteins are observed

Page | ‐ 15 ‐

Chapter 1 Introduction

it is dependent on the strain of mouse the oocytes were derived from (Goddard and Pratt, 1983; Scott and Whittingham, 1998). Based on whether embryos from these females had experienced the 2-cell block in traditional media, mouse strains are now classified as blocking or non-blocking. Generally, in- and outbred strains experience block or partial block, while hybrids are non-blocking strains (Biggers, 1998; Whitten and Biggers, 1968). Injection of embryonic cytoplasm from a non-blocking strain has abolished the 2-cell block in blocking strains of embryos and this affirms the cytoplasmic importance leading to this defect (Muggleton-Harris et al., 1982). Since 1-cell embryos are highly sensitive to the type and concentration of energy sources, their requirement for lactate:pyruvate ratios needed for maintaining homeostatic oxidation-reduction potentials could possibly account for the difference between blocking and non-blocking strains of mice (Biggers and Blandau, 1971; Cross and Brinster, 1973; Whittingham, 1975).

Since the development of the first chemically defined embryo culture medium, several modifications have been made because this first medium supported the development of 2- cell embryos but not zygotes (Whitten, 1957). To date, several key components have been identified to relieve the 2-cell block, including decreased sodium chloride, glucose and phosphate, lowered osmolarity, pyruvate:lactate ratio, addition of ethylenediaminetetraacetic acid (EDTA) and glutamine (Baltz, 2001; Biggers, 1998; Biggers et al., 1993; Chatot et al., 1989; Erbach et al., 1994; Lawitts and Biggers, 1992; Scott and Whittingham, 1998). Of the many modifications, Chatot-, Ziomek- and Bavister- medium (CZB)(Chatot et al., 1989), simplex optimization medium (SOM)(Lawitts and Biggers, 1991) and increased potassium version of SOM, KSOM medium (Lawitts and Biggers, 1993) have shown the most success in culturing fertilized zygotes to blastocysts. In addition to changing components in the media, media osmolarity has also been shown to be critical because mammalian cells regulate cell volume by adjusting intracellular osmotic pressure (Hallows and Knauf, 1994).

One of the key features of CZB and KSOM other than the additions of glutamine and EDTA (Abramczuk et al., 1977), was the substantially lower osmolarities as compared to previous culture media. In contrast to M16, whose osmolarity is ~290mOsm, osmolarity of CZB and KSOM were ~275 mOsm and ~250 mOsm respectively. To prevent against shrinkage, embryos regulate their cell volume and control their internal osmolarity by a swelling-activated anion channel that is highly permeable to organic osmolytes. Several compounds have been identified as organic osmolytes in the embryo, offering protection against increased osmolarity (Biggers et al., 1993; Dawson and Baltz, 1997; Lawitts and Page | ‐ 16 ‐

Chapter 1 Introduction

Biggers, 1992; Van Winkle et al., 2005), and glycine has been found to be the most effective in this process through the GLYT1 glycine transporter during cleavage stage embryos (Baltz, 2001; Steeves and Baltz, 2005; Steeves et al., 2003), and overcoming the 2-cell block.

In preimplantation embryo development, intracellular pH regulation is vital and is regulated by active bicarbonate/chloride exchange that mitigates alkalosis (Baltz et al., 1991; Zhao and Baltz, 1996; Zhao et al., 1995) and sodium/hydrogen exchangers (NHE) that mitigates against acidosis (Gibb et al., 1997; Harding et al., 2002; Lane et al., 1998). High levels of certain amino acids including alanine, aspartate, glycine, glutamate, glutamine and taurine have been measured within the oocyte, early embryo and surrounding oviduct, suggesting their possible involvement in early preimplantation embryo development. With the exception of taurine, this group of amino acids are classified as non-essential amino acid (NEAA)(Gardner and Leese, 1988; Gardner and Leese, 1990; Miller and Schultz, 1987; Schultz et al., 1981), and has been found to promote early embryonic growth by buffering the intracellular pH thereby overcoming the 2-cell block in vitro (Edwards et al., 1998). Since this discovery, the addition of both NEAA and essential amino acids (EAA) to KSOM has resulted in significant improvement in the rates of blastocyst formation, hatching (process when blastocyst hatches out of the protective zona pellucida layer for implantation) and increased the number of cells in the blastocyst (Ho et al., 1995).

1.2.4. Compaction During the first 48 hours following fertilization, the embryo undergoes cleavage divisions to produce the early 8-cell stage. Here, blastomeres are spherical and are symmetrically organized, showing no polarity with an even distribution of microvilli over the entire cortex of each individual cell. However, approximately 10 hours later, by the late 8-cell stage, the embryo undergoes an important transformation known as compaction that leads to blastocyst formation through restructuring of cell organization and intracellular interactions. This process is essential for later morphogenetic events as well as the proper segregation of the three embryonic lineages (epiblast, trophectoderm and primitive endoderm) during blastocyst formation. This process involves not only physical modifications between blastomeres but also changes at both the intra- and inter-cellular level whereby individual cells undergo polarization.

Page | ‐ 17 ‐

Chapter 1 Introduction

During compaction, each blastomere becomes highly polarized. Polarity is organized axially from the centre of the embryo (baso-lateral) to the external surface (apical) (Fleming and Johnson, 1988; Fleming et al., 2000). When polarization of blastomeres has been achieved, the embryo is known as a morula and a variety of intracellular changes occurs at this time. These modifications include (1) restriction of microvilli to mainly the apical pole of the blastomeres occurs, and the almost complete loss of microvilli baso- laterally (Ducibella et al., 1977; Fleming et al., 1986; Handyside, 1980; Reeve and Ziomek, 1981; Ziomek and Johnson, 1980), (2) localization of microfilaments beneath the apical surface (Lehtonen and Badley, 1980), (3) microtubules align parallel to the basolateral membranes (Ducibella and Anderson, 1975), (4) endocytotic vesicles are laid between the apical pole (Johnson et al., 1986) and (5) the nucleus becomes located basally (Reeve, 1981; Reeve and Ziomek, 1981). This complex cellular reorganization of the blastomeres marks the initial stages for TE epithelial differentiation and for the subsequent segregation of outer (TE) and inner (ICM) cell populations mediated by E-cadherin (Fleming, 1987; Johnson et al., 1986; Johnson and Ziomek, 1981).

Intercellular changes of compaction involve the interactions that blastomeres have with one another. During compaction, cell surface flattening is observed and this enables maximum apposition between adjacent blastomeres, which eventuates less distinctive intercellular boundaries (Lewis and Wright, 1935). The apposition of cell membranes between adjacent blastomeres is mediated by a calcium dependent adhesion system involving E-cadherin (also called: uvomorulin, L-CAM, cell CAM 120/80 and gp123) (Hyafil et al., 1981; Johnson and Maro, 1986; Ogou et al., 1982; Shirayoshi et al., 1983). E-cadherin belongs to a group of cell adhesion molecules and functions through homophilic associations of molecules in a calcium dependent manner between adjacent blastomeres (Gallin et al., 1983; Peyriéras et al., 1983). During compaction, E-cadherin proteins are redistributed from a uniform membrane localization to sites of cell-to-cell contact (Figure 1.6A)(Vestweber et al., 1987; Winkel et al., 1990) and form nascent apicolateral junctional complexes (Ducibella et al., 1975). The transcriptional and translational processes necessary for compaction are completed by the late 4-cell stage (Kidder and McLachlin, 1985; Levy et al., 1986) and activity of E-cadherin is regulated post-translationally by protein kinase C (PKC) and various other signalling molecules (Goval et al., 2000; Pey et al., 1998). The close proximity of neighbouring blastomeres enables the establishment of gap junctions between baso-lateral membranes and focal tight junctions that will later become zonular and develop into zonula occludens around the periphery of the embryo to

Page | ‐ 18 ‐

Chapter 1 Introduction

serve as a permeability seal for the blastocyst (Ducibella and Anderson, 1975; Lo and Gilula, 1979; Magnuson et al., 1977). These junctions are essential for cell-to-cell communication and allow for the restructuring of components in each cell to form from non-polar radially symmetrical into a polarized array. Several proteins have been identified to be involved in the process of cell polarization, such as ASIP/PAR-3 (Izumi et al., 1998), ZO-1(Fleming et al., 1989; Sheth et al., 1997), PAR-6 (Vinot et al., 2005; Yamanaka et al., 2001), aPKC (Joberty et al., 2000; Suzuki et al., 2001), junctional adhesion molecule; JAM-1 (Ebnet et al., 2001; Itoh et al., 2001) and Cdc42 (Kim et al., 2000). In addition, other proteins have also been suggested to be involved during compaction, such as myosin light-chain kinase (MLCK)(Kabir et al., 1996) in influencing tight junction formation and epithin, a mouse type II transmembrane serine protease, to interact with E-cadherin to mediate cell-to-cell adhesion (Khang et al., 2005).

When stable polarization of blastomeres had been achieved, this creates the opportunity for generating cell diversity in subsequent divisions. During the fourth cleavage division (8- to 16-cell transition), the orientation of the mitotic spindle is random with respect to the apical-basal axis, resulting in asymmetrical division (Johnson et al., 1986; Johnson and McConnell, 2004). This asymmetrical division produces two populations of daughter cells that have distinct cell fate; (1) internal, non-polarized cells will give rise to cells of the ICM, while (2) external, polarized cells will contribute to cells that make up the TE (Fleming, 1987; Johnson and Ziomek, 1981). As such, the process of compaction is thought to play an influential role in the processes leading up to blastocyst formation. Firstly, it confers cellular polarity, influencing the orientation of the cleavage plane. This in turn restricts blastomeres within a location to be committed to a specific cell lineage resulting in the loss of totipotency. Secondly, because of cell polarity, it results in TE differentiation and initiation of ICM formation (see Section 1.2.5). Compaction also affects the morphogenesis of blastocyst formation, whereby the outer cells will form the TE surrounding the blastocoel and ICM (Figure 1.6B).

In addition to the ‘inside-outside’ model to determine cell fate of blastomeres (Tarkowski and Wróblewska, 1967), recent studies have suggested other than positional influence, molecular determinants like the differential Hippo signaling could also regulate expression of various transcription factors responsible for lineage-specification. It has been observed that Hippo signaling is inactive in outer cells which results in the translocation of transcriptional cofactor Yap/Tax into the nucleus, that binds to TEAD4 which in turn mediates Cdx2 and Gata3 (Ralston et al., 2010) expression, both of which are TE-specific Page | ‐ 19 ‐

Chapter 1 Introduction

transcription factors. In contrast, active Hippo signalling in the inner cells represses Cdx2 expression by promoting phosphorylation and exclusion of Yap/Taz from the nucleus (Nishioka et al., 2009; Nishioka et al., 2008; Ralston and Rossant, 2008; Strumpf et al., 2005; Yagi et al., 2007). It has also been shown that expression of Oct4, a pluripotency linked transcription factor represses the activity of Cdx2, segregating TE from ICM cells (Chambers and Smith, 2004; Niwa et al., 2005). A recent study of the seemingly similar blastomeres of the 8-cell embryo had in fact displayed differential Oct4 kinetics. Blastomeres of slower Oct4 kinetics were found to preferentially undergo asymmetric divisions, contributing mainly to the ICM and the reverse applies to blastomeres that make up the outer TE cells (Plachta et al., 2011). Further examples of transcription factors that have been found to be involved in influencing cell allocation in the blastocyst also includes, Gata4 and Gata6 that regulates Nanog expression (Koutsourakis et al., 1999; Kuo et al., 1997; Morrisey et al., 1998), Sox2 (Avilion et al., 2003) and differential FGF signalling (Yuan et al., 1995) which will not be discussed in detail for the purposes of this thesis.

Page | ‐ 20 ‐

Chapter 1 Introduction

JAM-1 Ezrin Apical PKC domain Par3 Par6

E-cadherin Basolateral -cdtenin domain -catenin Epithin

8-cell stage 8-cell Pre-compact Compact

Parallel

8-cell 16-cell TE Compact Morula ICM

Perpendicular

32-cell Early blast

Figure 1.6 Cell polarization and specification of cell lineage (A) At the pre-compact 8-cell stage, all blastomeres are non-polar and when compaction commences, all cells polarize along the axis of cell contact forming apical domains on the external surface (red) and inward-facing basolateral domains (blue). Protein expressions are listed according to their site of expression. (B) As the embryo transitions from 8- to 16-cell, blastomeres that divide parallel to the apical-basal/radial axis produces 2 polar outside cells, while blastomeres that divide orthogonal to the axis give rise to 1 outside and 1 non-polar inside cell. Pink dotted line represents plane of cell division. This asymmetrical division thus creates two distinct populations of cells that will at the 32-cell stage give rise to the outer trophectoderm (TE) cells and the inside inner cell mass (ICM) lineages of the blastocyst.

Page | ‐ 21 ‐

Chapter 1 Introduction

1.2.6. Blastocyst formation The blastocyst is made up of an outer TE layer, comprised of epithelial cells, and the non- epithelial ICM located to one side of the cavity in contact with the polar TE and the blastocoel, generated by sodium-potassium-ATPase dependent transport system (Eckert et al., 2004; Rossant et al., 2003). In the last stages of preimplantation development, blastocoelic fluid accumulation begins inside the trophectoderm forming the blastocoel in a process known as cavitation or blastulation. Blastulation enables cell migration during gastrulation and prevents cells destined to become the ectoderm from premature induction to form mesoderm by the underlying vegetal cells (Adamson and Gardner, 1979; van Blerkom et al., 1976). By the end of preimplantation embryogenesis, there are two distinct cell lineages; the ICM, which contributes to the embryo proper and the TE, which contributes to fetal placental development.

In the mouse, TE differentiation begins at the 8-cell stage and is completed by the 32-cell stage when vectorial transport is initiated and consequently forming the blastocoel. In culture, blastomeres isolated from 4- and 8-cell mouse embryos usually produced trophectodermal vesicles in the absence of ICM (Tarkowski and Wróblewska, 1967). The low occurrence of ICM-like forms suggest that these cells have to be enclosed within the morula whereas TE cells originated from cells on the periphery. These different environmental factors/location of cells would determine the differentiative fate of the blastomere, influencing whether it becomes ICM or TE (Tarkowski and Wróblewska, 1967). However, even up until late morula stage (~ 32 cells), it has been shown in a couple of studies that despite being allocated to the polar outside or apolar inner cells of the morula, isolated blastomeres retained some level of totipotency, upon disaggregation and recombination with other embryos were able to form normal blastocysts (Kelly, 2005; Rossant and Vijh, 1980; Ziomek et al., 2005). Recently, it was discovered that blastomeres in the mouse embryos only lose their totipotency after the fifth cleavage division after blastocoel formation is initiated (Suwińska et al., 2008). During this period of time, blastomeres express specific proteins that play influential roles in polar outer and apolar inner cells that determine and maintain their developmental potential to either become part of the ICM or TE (Handyside, 1978; Hogan and Tilly, 1978; Johnson and Ziomek, 1983; Spindle, 1978; Suwińska et al., 2008).

Page | ‐ 22 ‐

Chapter 1 Introduction

1.3. The Anaphase Promoting Complex In most cell types, the tight regulation to maintain faithful chromosomal segregation is governed by the Anaphase Promoting Complex (APC) It plays a central role in targeting key substrates of mitosis and meiosis for their timely ubiquitin-dependent degradation to ensure successful progression through the cell cycle (Jones, 2011; Pesin and Orr-Weaver, 2008; Peters, 2006). Of particular interest, Fizzy/cell division cycle 20-related 1 (Fzr1, aka Cdh1 or Hct1), one of two co-activators of the APC has been identified for its importance during meiosis I such as maintaining GV arrest, mediating prometaphase progression and various other functions outside of the cell cycle. However, little is known about its role in regulating the cell cycle during embryogenesis. Additionally, Fzr1 is also involved in numerous processes outside of the cell cycle and has recently been identified to play a role during post-implantation embryogenesis. As such, the focus for the rest of the introduction will be discussing the involvement of APC in the mitotic and meiotic cell cycle, paying particular attention to Fzr1.

To ensure smooth unidirectional progression of the cell cycle, temporal degradation of mitotic regulators have to be stringent and this is governed by the ubiquitin-proteasome system (King et al., 1996).This works by degrading proteins necessary for the previous step at a faster rate than they can be accumulated, thereby preventing the cell cycle from regressing. Ubiquitination involves the transfer of the 76-amino acid protein, ubiquitin, onto the protein to be degraded. Targeted substrates are firstly tagged by a chain comprising of at least four lysine linked ubiquitin molecules. This in turn activates a cascade of enzymatic reactions involving three enzymes; a ubiquitin activating enzyme (known as E1) (Ciechanover et al., 1981), a ubiquitin conjugating enzyme (known as E2) (Hershko et al., 1983) and a ubiquitin ligase (known as E3) (Hershko and Ciechanover, 1998; Hershko et al., 1983).

The E3 ubiquitin ligase is essential for conferring substrate recognition and is involved in the final transfer of ubiquitin to the lysine residue that will ultimately bring the E2 enzyme into contact with the protein to be degraded by the 26S proteasome (Hershko and Ciechanover, 1998; Hochstrasser, 1996; Varshavsky, 1997). There are two multimeric E3 protein ligases; the APC and Skp1/Cullin/F-box (SCF), both involved in driving cell cycle progression. SCF controls the transition from G1/S and G2/M phases of the cell cycle (Deshaies, 1999), while the primary role of APC is to mediate mitotic progression and exit

Page | ‐ 23 ‐

Chapter 1 Introduction

(Castro et al., 2005; Morgan, 1999; Peters, 2002; Rape and Kirschner, 2004; Wäsch and Engelbert, 2005).

1.3.1. Co-activators of the anaphase-promoting complex The APC is made up of a 13 subunit core complex and is only active in the presence of one of its two co-activator proteins; Cdc20 (Fizzy) and Fzr1. Binding of Cdc20 to APC results in the degradation of securin/Pds1p; an anaphase inhibitor, enabling for sister chromatid separation, as well as cyclin B1, the regulatory subunit of MPF (Meijer et al., 1989a; Minshull et al., 1989). On the other hand, APCFzr1 is active in late mitosis and during G1 phase, promoting mitotic exit by targeting further cyclin B1 degradation and loss of other mitotic proteins (Harper et al., 2002; Peters, 2002), as well as allowing for the assembly of the pre-replicative complex (pre-RC) in preparation for S-phase of the next division (Mimms, 2005; Tanaka and Diffley, 2002). As such, the activities of Cdc20 and Fzr1 are complementary during the cell cycle, with Cdc20 being highly expressed during mitosis and Fzr1 during late-M and G1-phase, when there is low Cdk1 activity. Hence, activation of APC by binding to its respective co-activator would confer substrate specificity on the ubiquitin ligase.

Association of Cdc20 and Fzr1 to APC is only transient and substrate recognition is dependent on degradation motifs. Both Cdc20 and Fzr1 contain a C-terminal WD40 repeat domain that mediates their ability to recognize APC substrates, such as the destruction box (D-box) or KEN-box contained within the targeted protein (Glotzer et al., 1991; Pfleger and Kirschner, 2000). The D-box contains a recognition element, consisting of the consensus amino acid sequence RXXLXXXN and is found in several families of proteins including mitotic cyclins (Glotzer et al., 1991). While APCCdc20 has been shown to preferentially bind to substrates containing the D-box, APCFzr1 is also able to bind to proteins containing either the D-box or the KEN-box (KENXXXN)(Jaspersen et al., 1999; Pines, 2011), giving it potentially a wider range of substrates.

Cdc20 and Fzr1 are themselves subjected to regulation by APC-dependent ubiquitination and proteolysis (Pesin and Orr-Weaver, 2008). Since Cdc20 contains a KEN-box, it is therefore targeted by APCFzr1 for degradation, mediating its activity (Pfleger and Kirschner, 2000) and possibly enabling the quick transition from APCCdc20 to APCFzr1. In contrast, APCFzr1 is able to autoregulate its own activity by mediating its auto-ubiquitination as well as the proteasomal degradation of an APC-specific E2 enzyme, UbcH10 (Rape and Kirschner, 2004). This negative feedback mechanism is functional during late G1-phase to Page | ‐ 24 ‐

Chapter 1 Introduction

downregulate APCFzr1 level and is mediated by stabilization of Cdk2-cyclin A activity (Listovsky et al., 2004; Rape and Kirschner, 2004).

1.4. Role of APC in mitosis

1.4.1. Role of APC in mitotic entry In order to progress through the cell cycle, timely degradation of cyclins, the activator subunits of cyclin dependent kinases (Cdk) is required to proceed through the different phases. The MPF is a kinase complex made up of cyclin B1 (also known as Clb2p) and Cdk1 (also called Cdc2 or Cdc28p)(Meijer et al., 1989a; Minshull et al., 1989). High MPF activity functions to phosphorylate substrates for mitotic entry, mediating chromatin condensation, NEBD and spindle formation. On the other hand, loss of MPF activity is needed for mitotic exit and results from APC mediated cyclin B1 degradation (Zachariae and Nasmyth, 1999). Before entry into mitosis, MPF activity is suppressed by phosphorylation of Cdk1 by Wee1 and Myt1 (Morgan, 1997). At the end of G2, MPF is activated by Cdc25 dephosphorylation, which in turns promotes APCCdc20 activity (Kotani et al., 1999) while inhibiting the binding of Fzr1 to APC (Bembenek and Yu, 2001; Jaspersen et al., 1999; Kotani et al., 1999; Zachariae et al., 1998). Figure 1.7 provides an overview of APC involvement during mitosis.

1.4.2. Involvement of APC at anaphase In the mitotic cell cycle, the primary purpose of the APC is as suggested by its name, to mediate the onset of anaphase by inducing destruction of the cohesive molecules holding sister chromatids together. During early mitosis, the spindle assembly checkpoint (SAC) prevents untimely premature chromosome segregation (Amon, 1999; Bharadwaj and Yu, 2004; Musacchio and Salmon, 2007). In the presence of incorrect kinetochore-microtubule attachments, APCCdc20 activity is inhibited by SAC so preventing anaphase onset until correct chromosomal attachments and bi-orientation alignment are achieved along the metaphase plate (Musacchio and Salmon, 2007). The SAC recruits various checkpoint proteins from the Mitotic Arrest Deficient (Mad) and Budding Uninhibited by Benzimidazole (Bub) families to unattached kinetochores. Some of the recruited proteins include Mad2, BubR1 and Bub3, which bind to and suppress APCCdc20 activity by forming the mitotic checkpoint complex (MCC)(Herzog et al., 2009; Kulukian et al., 2009; Nilsson et al., 2008). When all chromosomes have been correctly attached to the mitotic spindle and aligned at the metaphase plate, SAC satisfaction is achieved and the checkpoint

Page | ‐ 25 ‐

Chapter 1 Introduction

APCCdc20

Chromosome separation M Anaphase spindle organization APCFzr1 Cytokinesis

G1 G2 APCFzr1 Differentiation

S DNA Fzr1 replication APC

Figure 1.7 Role of APC in mitosis APC is activated by Fzr1 during late mitosis until G1/S transition. During G1-phase, activity of APCFzr1 either allows for differentiation to occur or for the preparation of S-phase. In G2-phase, APCFzr1 is activated in response to damaged DNA resulting in M-phase inhibition and allowing for repair to take place. During early M-phase, APCCdc20 is involved in mediating chromosomal separation and initiating mitotic exit. At late M-phase, a switch occurs and APCFzr1 targets Cdc20 for degradation. Subsequently, APCFzr1 is involved in mediating anaphase spindle dynamics and cytokinesis. Loss of Fzr1 function can result in dysregulation of these cell-cycle transitions leading to tumour formation.

Page | ‐ 26 ‐

Chapter 1 Introduction

signalling ceases. This promotes the release of Cdc20 from the Mad2-BubR1 complex (Reddy et al., 2007; Stegmeier et al., 2007) and allows APCCdc20 activation, driving the cell into anaphase, by targeting securin and cyclin B1 degradation (Lim et al., 1998; Shirayama et al., 1999).

Cdk functions to drive cells into mitosis but its activity needs to be quenched during anaphase and telophase to allow chromosome decondensation and reassembly of nuclear envelope (Peters, 2002). During anaphase, partial inactivation of Cdk is necessary for sister chromatid separation (Stemmann et al., 2001). In S-phase, newly replicated sister chromatids are held together by a protein complex called cohesin until they are ready for separation at anaphase. The cohesive forces of cohesin help to prevent precocious sister separation (Darwiche et al., 1999; Uhlmann et al., 1999; Uhlmann et al., 2000). At anaphase onset, following chromosomal congression, APCCdc20 promotes degradation of securin (Ciosk et al., 1998), an inhibitory chaperone of separase (also known as Esp1p), a thiol protease (Uhlmann et al., 1999)). Until the metaphase-to-anaphase transition, the enzymatic activity of separase is inhibited by binding of securin and cyclin B1-Cdk1 mediated phosphorylation (Stemmann et al., 2005; Zou et al., 1999). Activation of separase cleaves the kleisin subunit, Scc1/Rad21 of the cohesion complex allowing for chromosomal separation to take place (Gruber et al., 2003). It has been reported that persistent Cdk1 activity has been shown to inhibit both anaphase onset and separase activation (Gorr et al., 2005; Hauf et al., 2001; Stemmann et al., 2001; Waizenegger et al., 2000). Additionally, separase inhibition can also be achieved by high Cdk1 activity, independent of securin levels (Stemmann et al., 2001). These results suggest that APC can control separase activity by two mechanisms; firstly through securin degradation and secondly through cyclin B proteolysis to decrease Cdk1 activity allowing chromatids to be pulled to either poles of the cell in preparation for cytokinesis.

1.4.3. APC in regulating mitotic exit

In most eukaryotic cell types, APCCdc20 is activated during the metaphase-to-anaphase transition; while during the majority of mitosis, Fzr1 is phosphorylated by Cdk1 (Lukas et al., 1999; Zachariae et al., 1998) and is only active during late mitosis and G1/S transition (Kramer et al., 2000), requiring low cyclin B1-Cdk activity (King et al., 1996; Morgan, 1999; Murray, 1995). Due to cyclin B1 degradation during anaphase, Cdk1 function is inactivated, allowing for Fzr1 dephosphorylation which triggers mitotic exit (Peters, 2006). In budding yeast, Cdc14 phosphatase, part of the mitotic exit network (MEN), mediates

Page | ‐ 27 ‐

Chapter 1 Introduction

Fzr1 dephosphorylation enabling it to bind to APC (Cerutti and Simanis, 2000; Hoyt, 2000). The binding of Fzr1 to APC triggers the ubiquitination of Cdc20 and thereby inactivating APCcdc20 (Pfleger and Kirschner, 2000; Prinz et al., 1998; Shirayama et al., 1998). As a consequence of APCCdc20 inactivation, the SAC can no longer suppress APC activity (Pfleger and Kirschner, 2000).

During mitotic exit, functional components of the cell cycle such as mitotic spindle, cytokinetic furrow and kinetochores have to be disassembled to allow the cell to return to interphase. In budding yeast, Fzr1 has been found to be active from late mitosis through to cytokinesis and during centrosome replication by targeting regulators such as Aurora A, Aurora B, polo-like kinase 1 (Plk1), Anillin and Tpx2 for degradation (Bardin and Amon, 2001; Shou et al., 1999; Stewart and Fang, 2005; Taylor and Peters, 2008; Zhao and Fang, 2005). Silencing of Fzr1 expression using siRNA knockdown in human cells has demonstrated the importance of Aurora kinase stabilization through APCFzr1 activity (Floyd et al., 2008). During mitosis, Aurora A and its activating partner, Tpx2 associate to the spindle poles (Cao et al., 2003; Castro et al., 2002; Littlepage and Ruderman, 2002), while Aurora B is the enzymatic component of the chromosome passenger complex (CPC)(Ruchaud et al., 2007). During anaphase, Plk1and CPC are recruited to the spindle midzone where they play an influential role in mediating cytokinesis by co-ordinating cleavage furrow position and mitotic spindle assembly (D'Avino et al., 2005; Eggert et al., 2006; Lindon and Pines, 2004). As such, APCFzr1 activity is crucial for proper assembly of a robust spindle midzone during anaphase, normal timing of spindle elongation and proper cytokinesis, in particular to stabilize Aurora A expression. However, studies in frogs and Drosophila embryos have suggested that orthologous Fzr1 is dispensable for mitotic exit (Jacobs et al., 2002; Lorca et al., 1998; Sigrist and Lehner, 1997).

In separate studies, tumour-associated microtubule-associated protein (TMAP)/ cytoskeleton-associated protein 2 (CKAP2) has been identified as a substrate of APCFzr1 and is associated with spindle poles and microtubules during prophase through anaphase before disappearing at cytokinesis. Ectopic expression of the protein resulted in monospindle formation with highly bundled microtubules (Hong et al., 2007; Seki and Fang, 2007) and as such proper regulation of TMAP/CKAP2 by APCFzr1 is essential for maintenance and proper spindle assembly and mitotic progression.

Page | ‐ 28 ‐

Chapter 1 Introduction

1.4.4. G1/S maintenance by APC activity Recent knockout studies have also found that Fzr1 is involved in the regulation of G1-to-S phase transition in somatic cells implicating it in DNA replication and genomic instability (García-Higuera et al., 2008; Sigl et al., 2009). Before S phase entry, assembly of the pre- replicative complex (pre-RC) is essential and dependent on Cdt1 and Geminin to ensure only one round of DNA replication occurs during each round of cell cycle (Diffley, 2004). Geminin is a substrate of APCFzr1 during late mitosis and its degradation releases Cdt1 inhibition allowing pre-RC assembly in preparation for the next division (McGarry and Kirschner, 1998). In addition, Cdc6 another protein required for DNA replication is also a target of APCFzr1 (Petersen et al., 2000). Since inactivation of APCFzr1 plays an influential role in cyclin-Cdk accumulation and pre-RC assembly, the overexpression of Fzr1 results in delays in S-phase onset and decreases the rate of DNA replication (Sorensen et al., 2000), whereas loss of Fzr1 shortens G1-phase leading to premature entry into S-phase (Sigl et al., 2009). In addition, to prevent premature S-phase entry, Fzr1 also regulates degradation of F-box proteins such as Skp2 and Tome-1, allowing p27, a Cdk2 inhibitor, (Wei et al., 2004) and Wee1 accumulation (Ayad et al., 2003).

Therefore to co-ordinate timely APC activity, Fzr1 has to be tightly regulated. One of the key players in APCFzr1 regulation during early S-phase has been found to be Early mitotic inhibitor (Emi1), when it is highly expressed (Hsu et al., 2002; Reimann et al., 2001a). In addition, MAD2B (Chen and Fang, 2001; Pfleger et al., 2001) and several other proteins (Verma et al., 2004) have also been found to have an inhibitory effect on APCFzr1 proving its tightly controlled regulation.

1.5. Roles of APCFzr1 outside of the cell cycle APC is commonly known for its involvement in regulating cell cycle progression by targeting mitotic cyclins for degradation and the metaphase-to-anaphase transition. In mammals, Cdc20 is essential for mediating degradation of mitotic cyclins, inactivation of Cdk1 and the activation of mitotic phosphatases (Li et al., 2007a; Manchado et al., 2010). In contrast, Fzr1 is dispensable for cell cycle progression (García-Higuera et al., 2008; Li et al., 2008; Sigl et al., 2009). However, due to its ability to recognize a wider variety of substrates, Fzr1 seem to play numerous roles outside of the mitotic cell cycle, such as maintaining quiescence and genomic stability, regulating endoreduplication and mediating differentiation of specific cell types. Therefore in the following sections, the non-mitotic functions of Fzr1 will be discussed.

Page | ‐ 29 ‐

Chapter 1 Introduction

1.5.1. Cell cycle exit and G0 maintenance When cells are not dividing, they enter a state of quiescence (G0-phase), and re-entry into the cell cycle is dependent on Cdk activation and retinoblastoma protein inactivation, a transcription repressor of cell cycle transcriptional genes (Malumbres and Barbacid, 2001). To exit the cell cycle and enter quiescence, cells need to eliminate cell cycle proteins synthesized during G1/S/G2. As discussed in section 1.4.3, APCFzr1 has been found to target mitotic cyclins and cell cycle regulators for degradation (Carmena and Earnshaw, 2003; Carter et al., 2006; Lindon and Pines, 2004; Malumbres and Barbacid, 2009; Wäsch and Engelbert, 2005), allowing for mitotic exit and entry into G0.

In brain progenitor cells, mouse embryonic fibroblasts (MEFs) and resting hepatocytes, it was observed that loss of Fzr1 resulted in accumulation of mitotic substrates and unscheduled re-entry into a new cell cycle (García-Higuera et al., 2008; Li et al., 2008; Wirth et al., 2004). Additionally, loss of Fzr1 in mouse embryos resulted in extra embryonic epidermal cell proliferation possibly due to mitotic cyclin accumulation during the G1-phase (Grosskortenhaus and Sprenger, 2002; Skaar and Pagano, 2008). Together, these results highlight the importance of Fzr1 in maintaining quiescence in cells by inhibiting accumulation of mitotic substrates allowing for their re-entry into the cell cycle.

1.5.2. Role of Fzr1 as a tumour suppressor and in genomic integrity maintenance Recent studies have implicated Fzr1 to be a tumour suppressor necessary for maintaining genomic stability (Engelbert et al., 2007; García-Higuera et al., 2008). Normally, Fzr1 activity is inhibited by Cdk1 and Plk1 phosphorylation, however in the presence of damaged DNA, ataxia telangiectasia mutated and Rad3-related (ATR) inhibits Cdk1 and Plk1, so activating Fzr1 (Zhang et al., 2010). In support of Fzr1 involvement in the DNA damage response, it has been shown that when Fzr1 is downregulated or phosphorylated by different DNA damaging agents, cyclin B1 degradation was abolished resulting in increased Cdk1 activity which consequently promoted apoptosis in response to genomic stress (Liu et al., 2008).

In recent years, another novel DNA damage checkpoint protein Rad17 in fission yeast has been identified as a Fzr1 substrate (Zhang et al., 2010) and proper proteolysis of this protein regulates the activation of the DNA damage checkpoint. Stabilization of Rad17 in the presence of damaged DNA would result in checkpoint activation and Rad17 destruction mediated by APCFzr1 would terminate checkpoint signalling when the damage response is complete (Zhang et al., 2010). Page | ‐ 30 ‐

Chapter 1 Introduction

Genotoxic stress has been observed to result in G1 or G2 arrest of the cell cycle, which is thought to allow time for damaged DNA to be repaired, and it is Fzr1 that is involved in coordinating the DNA damage response by targeting its substrates (Bassermann et al., 2008; Wiebusch and Hagemeier, 2010). The loss of Fzr1 results in substrate accumulation such as Aurora A, Plk1, Cdc20, Cyclin A and B resulting in chromosomal instability both in human and mouse tumour cell lines (Engelbert et al., 2007; García-Higuera et al., 2008; Marumoto et al., 2005). This genomic instability is apparent by the presence of multipolar mitotic spindles, formation of anaphase bridges, detectable micronuclei and centrosome aberrations (Engelbert et al., 2007; García-Higuera et al., 2008).

In order to regulate DNA synthesis, cells need to maintain low Cdk1 and Geminin levels to allow for pre-RC assembly in a process termed licensing during G1 (McGarry and Kirschner, 1998). Cdk1 is inhibited through targeted cyclin A and B1 degradation by APCFzr1 (Brandeis and Hunt, 1996; Irniger and Nasmyth, 1997; Wäsch and Cross, 2002) to allow for the loading of the mini-chromosome maintenance complex (MCM) onto the chromatin by origin recognition complex (ORC), Cdc6 and Cdt1, which is inhibited by Geminin (Blow and Dutta, 2005; Diffley, 2004). During the period of origin firing (firing of DNA replication origins) and DNA replication, high Cdk1 and Geminin levels have to be maintained and APCFzr1 activity is inhibited by Emi1 (Miller et al., 2006; Reimann et al., 2001b; Zachariae et al., 1998). As such, the switch between these two states of high and low Cdk1/Geminin are regulated by APCFzr1 activity and timely oscillation of Geminin is essential for regulating MCM loading to prevent re-replication (McGarry and Kirschner, 1998; Wohlschlegel et al., 2000). Dysregulation of Fzr1 has resulted in shortened G1 and early entry into S-phase due to premature cyclin accumulation leading to Cdk activation (Engelbert et al., 2007; García-Higuera et al., 2008; Li et al., 2008; Sigl et al., 2009). Since the loss of Fzr1 function would result in increased Geminin levels and untimely Cdk1 activation, affecting pre-RC assembly and impairing MCM loading onto the chromatin, this would consequently lead to precocious induction of DNA replication resulting in genomic instability, promoting tumorigenesis (Diffley, 2004; García-Higuera et al., 2008; Karakaidos et al., 2004; Zhu and Dutta, 2006).

In addition, APCFzr1 also target two enzymes, thymidine kinase 1 (TK1) and thymidylate kinase (TMPK) which are essential for dTTP formation during G1 phase. Inactivation of Fzr1 during G1/S transition allows for the expansion of dTTP pool required for DNA replication. As such, impaired degradation of these two enzymes would result in

Page | ‐ 31 ‐

Chapter 1 Introduction

imbalances to the dNTP pool, increasing the chances of genetic mutations and compromising the fidelity of DNA replication (Ke et al., 2005).

1.5.3. Role in endoreduplication Re-replication, is when cells undergo repeated rounds of DNA synthesis in the absence of intervening M-phases and is usually inhibited in the normal mitotic cycle in various organisms such as yeast, C. elegans, Drosophila and mammals (Fay et al., 2002; García- Higuera et al., 2008; Kitamura et al., 1998; Li et al., 2008; Schwab et al., 1997; Sigl et al., 2009; Visintin et al., 1997; Yamaguchi et al., 1997). However, this tight regulation of DNA replication is sometimes selectively inactivated and is necessary for a developmental process known as endoreduplication (also known as endoreplication or endocycle).

In Drosophila, endoreduplication is necessary for oogenesis (Gutierrez et al., 2010; Schaeffer et al., 2004) and in postmitotic salivary gland cells (Edgar and Orr-Weaver, 2001; Schaeffer et al., 2004; Sigrist and Lehner, 1997). The transition from mitosis to the endocycle is controlled by the activation of Notch-dependent activation of APCFzr1 during G2-phase (Schaeffer et al., 2004), promoting Geminin, cyclin A and B1 degradation. This in turn inactives Cdk1 and allow for pre-RC assembly and entry into a new S-phase (Narbonne-Reveau et al., 2008).

In humans, this process is observed in cells of the pancreas, liver, trophoblast giant cells (TGCs) in the placenta and megakaryocytes in the bone marrow (Cortés et al., 2004; Szalai et al., 2006). Recently, a couple of Fzr1 knockout studies have shown that deficiency in Fzr1 is embryonic lethal at approximately E9.5 and it was revealed in these embryos there were defects in TGC formation (Figure 1.8)(García-Higuera et al., 2008; Li et al., 2008). Examination of the placenta revealed that they were smaller and paler in knockouts compared to wild-types and there was a much smaller region of TGCs observed in the sections, suggesting difficulty in endoreduplication in these cells (García-Higuera et al., 2008; Li et al., 2008).

1.5.4. Role of Fzr1 in cellular differentiation

APCFzr1 is also involved in cellular differentiation of various cell lines such as neurons, hepatocytes and muscle cell differentiation (Figure 1.8)(Qiao et al., 2010; Wäsch et al., 2009). Transforming growth factor- (TGF- is involved in both cellular cytostatic (inhibition of cell growth and multiplication) and tumour enhancing roles. It was found that binding of Smad2 to Fzr1 promotes APC-dependent ubiquitination of SnoN, an inhibitor of

Page | ‐ 32 ‐

Chapter 1 Introduction

Emi1 E2F7? Securin Fzr1 Cdc14B? Fzr1 Cyclin B1 Cyclin B1 others? Cdc14B APC Emi1? APC BubR1

GV arrest zygote X V V Placenta TGCs X X X V V X X X X Endoreduplication

V prometaphase I fertilization

mitosis meiosis I meiosis II oogenesis

embryo

Hematopoiesis Neurogenesis Lens development Myogenesis HSCs NSC differentiation? cell cycle cell cycle glycolysis? axon growth & withdraw withdraw HSCs patterning myogenic differentiation? synapse differentiation fusion nerve system assembly TGF- TGF- others Cdk

Fzr1 Fzr1 Fzr1 Fzr1 APC APC APC APC

PFKB3 SnoN, Id2, Lirpin-, SnoN Skp2 others? glutamate receptor Myf5 others?

Figure 1.8 Overview of Fzr1 during oocyte maturation and embryo development processes Summary of various roles for APCFzr1 in regulating several processes during development. During meiosis, APCFzr1 is essential for maintaining prophase I arrest and prometaphase progression during MI. During embryo development, Fzr1 is crucial for endoreduplication of TGCs in the placenta. Outside of the cell cycle, Fzr1 is important for regulating differentiation in specific cell types.

Page | ‐ 33 ‐

Chapter 1 Introduction

TGF- signalling, suggesting the involvement of APCFzr1 in the antiproliferative effects of TGF- (Stroschein et al., 2001; Wan et al., 2001). During vertebrate development, epithelial cells differentiate to fibre cells to form a multilayered lens fibre core. In zebrafish, defects in the ubiquitin-proteasome pathway has resulted in loss of cell proliferation in lens epithelial cells (Guo et al., 2006; Liu et al., 2006) . Similarly in the mouse lens, TGF- dependent degradation of Sno mediated by APCFzr1 activity blocks Cdk inhibitor transcription (p15INK4a and p21Cip1) necessary for initiation of lens differentiation (Stroschein et al., 2001; Wan et al., 2001; Wu et al., 2007).

Targeted destruction of Skp2 and Myf5 by APCFzr1 has also been observed to be involved in myoblast differentiation. Targeted degradation of Skp2 resulted in increased p21 and p27 expressions, which are essential for coordinating cellular division and differentiation, whereas destruction of Myf5 by APCFzr1 has been shown to be important for myogenic fusion (Li et al., 2007b).

Several studies have demonstrated that APC is important in postmitotic neurons at different levels and APCFzr1 expression has been ubiquitously observed in the nuclei of terminally differentiated post-mitotic neuronal cells of cultured rat hippocampus and sections of both mouse and human brains (Gieffers et al., 1999). For example, APCFzr1 activity in neuronal differentiation includes, regulating patterning and axonal growth of postmitotic neurons in the developing brain (Konishi et al., 2004). In addition, studies in Drosophila and C. elegans have suggested possible role of APCFzr1 in synaptic development and transmission (DiAntonio et al., 2001; Speese et al., 2003; Zhao et al., 2003).

1.6. Role of APC in meiosis There is a reversal in the timings of APC activation by Cdc20 or Fzr1 during meiosis as compared to somatic mitosis. In oocytes, APCFzr1 is activated first, during prophase I (the equivalent of G2 arrest in somatic cells) and early prometaphase I, while APCCdc20 is activated only during anaphase due to Cdk1-mediated switch to target securin and cyclin B1 for degradation leading to meiotic exit (Figure 1.8 and Figure 1.9)(Reis et al., 2007).

1.6.1. APC mediating homolog and sister chromatid separation As previously discussed in section 1.1, alignment of chromosomal homologs (also termed as bivalents) during fetal life allows for recombination of genetic material and separation is only completed in MI (Herbert et al., 2003; Terret et al., 2003). Sister chromatids (also known as dyads) remain attached and will only separate during MII (Madgwick et al., 2004; Page | ‐ 34 ‐

Chapter 1 Introduction

Zou et al., 1999). Separation in both MI and MII depends on the timely dissolution of the cohesin complex which is responsible for maintaining sister chromatid cohesion (Peters et al., 2008; Revenkova and Jessberger, 2005). In meiosis, the cohesion complex comprises of Rec8, SMC1 and Stag3 (Prieto et al., 2004; Revenkova and Jessberger, 2005). In mitosis, cohesion complex form ring-like structures around sister chromatids and its dissociation is mediated by PLK1 and Aurora B phosphorylation during prometaphase (Hauf et al., 2005; Juan et al., 2004; Nasmyth, 2005). In contrast, loss of Rec8 is only observed in meiotic sister chromatids at anaphase I, mediated through the action of separase (Kudo et al., 2006; Terret et al., 2003). Here, sister centromere cohesin remains intact so that sister chromatids can move to the same pole during cytokinesis, and centromeric Rec8 is only cleaved during anaphase II during separation of dyads to produce the haploid gamete (Kudo et al., 2006; Terret et al., 2003). During MI, degradation of Rec8 is mediated by APCCdc20-dependent separase activity. Shugoshin (SGO) family proteins localize to the centromeres and recruits protein phosphatase 2A (PP2A) to protect centromeric Rec8 from degradation, resulting in only homolog separation during MI (Kitajima et al., 2006; Lee et al., 2007; Llano et al., 2008; Riedel et al., 2006). During MII, kinetochore-microtubules attachments hold sister chromatids to spindle poles. The pulling tension generated from the microtubules induces movement of SGO/PP2A complex away from the centromere allowing for Rec8 cleavage by APCCdc20-dependent separase activity, resulting in sister chromatid separation (Figure 1.9)(Gómez et al., 2007; Lee et al., 2007; Llano et al., 2008; Prieto et al., 2002). While APCCdc20 is responsible for homolog and sister chromatid separation during MI and MII, APCFzr1 activity has been found to be important for other processes during other phases of meiosis.

1.6.2. Importance of APC in maintaining GV arrest GV/ Prophase I arrest is important for maintaining the oocyte pool in the ovary and is regulated by protein kinase A (PKA), a cyclic AMP (cAMP)-dependent kinase (Dennis Smith, 1989; Eppig, 1989; Lu et al., 2001; Rose‐Hellekant and Bavister, 1996). During MI resumption, MPF activation is necessary for GVBD. PKA inhibits MPF during GV arrest through the activation of Cdk1-inhibitor Wee1 and suppression of Cdk1-activating phosphatase Cdc25 (Han and Conti, 2006; Mitra and Schultz, 1996; Pirino et al., 2009). Previous studies had reported measurable levels of APCFzr1 activity during early meiosis in Prophase I, and has been found to be essential for maintaining GV arrest by targeting cyclin B1 degradation to keep low MPF activity (Figure 1.9)(Holt et al., 2011; Marangos et al., 2007; Reis et al., 2006; Yamamuro et al., 2008). The SAC has been found to be active Page | ‐ 35 ‐

Chapter 1 Introduction

APCCdc20 APCFzr1

Activity mitosis

G2 P PM M A T G1 S

APCFzr1 APCCdc20 (endoreduplication)

Activity meiosis

GV GVBD MI MI-MII MII fertilization PBE2 Early emb. implantation E9.5

Figure 1.9 APC activity during mitosis, meiosis and embryo development During mitosis, APCCdc20 is active during metaphase (M) and at anaphase (A). There is then a rapid switch to APCFzr1 that remains high up until the G1/S transition. However, during meiosis, low levels of Fzr1 activity is necessary for maintaining prophase I arrest and prometaphase progression. During MI to MII transition, APCFzr1 targets cyclin B1 and securin for degradation allowing for spindle assembly during MII. APCCdc20 activity is required during both anaphase I and II to target securing and cyclin B1 to allow for chromosomal segregation. Shortly after sperm fertilization, APCCdc20 activity has been noted and during the period between second polar body extrusion and pronuclear formation, APCFzr1 activity has been detected. Therefore it seems as though APCCdc20 and APCFzr1 are both active after MII resumption until the period of pronuclear formation in mouse oocytes. APCFzr1 activity has also been identified in the endoreduplication of TGCs, However its activity between fertilization and endoreduplication has not been examined.

Page | ‐ 36 ‐

Chapter 1 Introduction

during meiosis, modulating metaphase I to anaphase transition (McGuinness et al., 2009; Wei et al., 2010). In contrast to mitosis, where the primary function of BubR1 is in the SAC, in oocytes, BubR1 has been found to be necessary for stabilizing Fzr1, required for maintaining GV arrest of oocytes and prometaphase I progression. The importance of BubR1 was demonstrated through its morpholino depletion in mouse oocytes. Loss of BubR1 resulted in escape of prophase I arrest and re-entry into MI where there was an eventual arrest at prometaphase I (Homer et al., 2009). Loss of BubR1 was found to result in reduced Fzr1 expression and since APCFzr1 is essential for maintaining GV arrest, its downregulation resulted in unscheduled MI resumption (Homer et al., 2009). As such BubR1 is essential for regulating APCFzr1 activity early in meiosis to maintain arrest of GV oocytes, consistent with the prophase I role BubR1 has in yeast and flies (Cheslock et al., 2005; Malmanche et al., 2007).

1.6.3. Importance of APC in Prometaphase I progression APCFzr1 activity was observed to remain active during prometaphase I and was found to target Cdc20 for degradation (Figure 1.9)(Reis et al., 2007). The control of Cdc20 activity is essential because Fzr1 antisense-knockdown expedited APCCdc20-dependent degradation of cyclin B1 and securin that consequently led to premature homolog segregation and non- disjunction (failure of homologous chromosomes to separate properly)(Reis et al., 2007). In addition to its role in prophase I, BubR1 has also been identified to stabilize Fzr1 during prometaphase I (Homer et al., 2009). BubR1 depletion led to prometaphase I arrest due to decreased Fzr1 activity which led to securin accumulation (Homer et al., 2009). When Fzr1 expression was reduced, securin activity was stabilized and its accumulation prevented anaphase I onset (Herbert et al., 2003; Reis et al., 2007).

A recent study performed in mouse oocytes demonstrated the importance of Fzr1 in mediating spindle assembly and MI progression (Holt et al., 2012). Using an oocyte- specific knockout, the loss of Fzr1 resulted in earlier SAC satisfaction because the bipolar meiotic spindle was assembled faster. Due to premature bivalent attachment and earlier loss of bound MAD2 to kinetochore, consequently MI progression in GV oocytes was accelerated. In addition, spindle elongation was initiated earlier and poor bivalent congression was observed in the absence of Fzr1, resulting in high rates of non-disjunction (Holt et al., 2012). As such, APCFzr1 activity is important for proper spindle assembly during MI to ensure proper chromosomal segregation.

Page | ‐ 37 ‐

Chapter 1 Introduction

1.6.4. APC activity during meiosis II Meiotic exit in the eggs of most species is usually governed by the activity of APCCdc20 and inhibition of Cdc20 prevents egg activation in Xenopus eggs (Lorca et al., 1998) and embryo development in C. elegans (Kitagawa et al., 2002). In contrast, Fzr1 was found to be absent in the eggs and early embryos of Xenopus (Lorca et al., 1998), Drosophila (Raff et al., 2002; Sigrist and Lehner, 1997) and C. elegans (Fay et al., 2002). Interestingly, measureable levels of both APCCdc20 and APCFzr1 activity were observed in the mouse oocyte mediating MII resumption (Figure 1.9)(Chang et al., 2004). Due to the calcium spikes induced by the sperm, APCCdc20 was activated and its substrates were degraded quickly prior to polar body extrusion. In contrast, APCFzr1 activity was found to be present during the period between polar body extrusion and nuclear formation, targeting substrate degradation during low Cdk1 activity, mediating meiotic exit (Chang et al., 2004).

Page | ‐ 38 ‐

Chapter 1 Introduction

1.7. Aims The exact of role Fzr1 in meiosis II and preimplantation embryo development is currently still unaddressed. It is therefore the aim of this thesis to investigate if Fzr1 plays an essential role in egg maturation following MII resumption as well as to examine if Fzr1 is necessary for early embryogenesis.

In the first experimental chapter (Chapter 3), the role of Fzr1 in embryogenesis is investigated. Fzr1 has been found to play important roles in mediating progression of both meiotic and mitotic progression, as discussed in Sections 1.4 and 1.6. However, little is known about the role of APCFzr1 during embryogenesis other than its involvement in TGC formation, as mentioned in Section 1.5.3. Previous studies examining the role of Fzr1 used embryos that contained maternal transcripts which could help promote early embryo development, as detailed in 1.2.2, therefore I microinjected Fzr1 miRNA plasmid into zygotes to achieve knockdown and the resulting phenotype was examined. Initial stages of plasmid construction and optimization were performed in an F9 mouse embryonal teratocarcinoma cell line.

In the second experimental chapter (Chapter 4), following the availability in Newcastle of an oocyte-specific knockout, importance of Fzr1 during meiotic completion was addressed. Previous work had identified the importance of Fzr1 during MI progression, as examined in Sections 1.6.2 and 1.6.3. Even though Fzr1 activity has been detected during MII, as mentioned in Section 1.4.3, it has not yet been confirmed whether Fzr1 was essential for this process. Therefore using the Fzr1 knockout mouse, the functional importance of the protein could be examined during MII progression.

In the third experimental chapter (Chapter 5), the choice of embryo culture medium was examined. I wanted to determine a suitable embryo culture medium for sustaining preimplantation development of parthenotes derived from MII eggs collected from the oocyte-specific Fzr1 knockout mouse.

In the fourth and last experimental chapter (Chapter 6), embryo development of Fzr1 knockout parthenotes was studied. Such Fzr1 knockout embryos have been found to die due to defects in endoreduplication of TGCs, necessary for placentation, as discussed in Section 1.5.3. However the persistence of maternal Fzr1, meant that the examination of its role in preimplantation embryo was hindered.

Page | ‐ 39 ‐

Chapter 2 Materials and Methods

2. Materials and Methods

Detailed protocols for constituents of media and buffers will be listed in appendix. All reagents are from Sigma-Aldrich, Australia unless otherwise stated.

2.1. Animals

2.1.1. Animal ethics All animal procedures were carried out in compliance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes and approved by the University of Newcastle Animal Care and Ethics Committee.

2.1.2. Inbred and hybrid mouse strains All experimental female mice were between 4 to 8 weeks old. Stud males were between 8 weeks to 10 months of age. B6CBF1 hybrid females were derived from mating of C57Bl6 females to CBA males. C57Bl6 females were obtained from Australian Bio Resources, Mossvale, Sydney, Australia; CBA males were from Australian Research Services, Perth, Australia. F1 breeding was performed at the University of Newcastle’s Animal Services Unit.

2.1.3. Fzr1 knockout mice Mice homozygous for the Fzr1 floxed alleles (Fzr1fl/fl) were developed at Salamanca University, Spain (García-Higuera et al., 2008) and bred onto a C57Bl6 background at Australian Bio Resources to 7th generation. As described by Garcia et al. (2008), the second and third exons of the single copy, 12kbp Fzr1 gene were targeted for removal by insertion of loxP sites between exons 1 and 2, and exons 3 and 4. A neomycin cassette flanked by frt sites was also inserted between exons 3 and 4 to allow selection of recombinant clones, and later removed by treatment with flox-recombinase (Figure 2.1). Homologous recombinant embryonic stem (ES) cells were injected into blastocyst to be transferred into a surrogate female, and offspring with germline transmission of the floxed Fzr1 allele was selected by Southern blot analysis using a specific probe (refer to García-Higuera et al., 2008). The Fzr1fl/fl colony was maintained in a mixed background of 25% 129/Sv x 25% CD1 x 50% C57Bl6/6J.

ZP3Cre [C57BL/6-Tg(Zp3-cre)93Knw] mice expressing Cre–recombinase under the control of the ZP3 promoter, were obtained from The Jackson Laboratory (#003651,

Page | ‐ 40 ‐

Chapter 2 Materials and Methods

USA)(de Vries et al., 2000). ZP3Cre [C57BL/6-Tg(Zp3-cre)93Knw] males were mated with Fzr1fl/fl females to obtain males offspring with the genotype Fzr+/fl /ZP3Cre (contains loxP sites and the ZP3 promoter). These males were mated with Fzr1fl/fl females to create offsprings with the following genotypes: Fzr1fl/+, Fzr1fl/fl, Zp3Cre+Fzr1fl/+ and Zp3Cre+Fzr1fl/fl (knockouts). Female pups with the genotype Fzr1fl/fl were used as controls in all experiments, and have been shown to express normal levels of Fzr1 (Holt et al., 2011)(Figure 2.1).

2.1.4. Genotyping of Fzr1 knockout mice Primers used for genotyping were Cre (5’-GCGGTCTGGCAGTAAAAACTAT-3’ and 5’- GTGAAACAGCATTGCTGTCACTT-3’), and Fzr1 (5’- AGCATGGTGACCGCTTCATCC-3’, 5’-CCTGGTCCACAGAGGAAATTTC-3’, and 5’- TGGCTGGGGGACTTCTCATTTTCC-3’)(García-Higuera et al., 2008; Holt et al., 2011). Tail DNA or ear clippings from 3-4 weeks old mice were collected and amplified using these oligos with 30 seconds annealing phase at 58°C and an extension phase of 1 minute at 72°C for 35 cycles. Products were analysed on agarose gels, Fzr1fl/fl would produce a band at 300bp and Fzr1-/- would produce a band at 177bp.

2.1.5. Fertility trial of Fzr1 knockout mice Females 4 weeks of aged were used for fertility trials. Six controls (Fzr1fl/fl) and Fzr1-/- females were paired individually with proven, 3-month old C57Bl6 stud males over a period of six months. Litters were removed within three days after birth and were culled.

2.1.6. Hormonal Stimulation and Mating In this thesis, ovulation was induced 10-14 hours in female mice to maximize egg and embryo yields (Edwards and Gates, 1959) following human chorionic gonadotropin (hCG) administration after being primed with pregnant mare seum gonadotrophin (PMSG).

An inter-peritoneal (IP) injection of 5-10 International Units (IU, 0.1-0.2ml) PMSG (Folligon, Intervet International, Boxmeer, The Netherlands; Section 9.4.1) was administered 46-52 hours before collection of GV oocytes. For collection of MII eggs, a second injection of 5-10 IU of hCG (Chorulon, Intervet International, Boxmeer, The Netherlands; Section9.4.2) was administered 12-14 hours prior to euthanasia. For collection of embryos, females were paired individually with B6CBF1 males at the time of hCG injection and females were removed the following morning after detection of a vaginal plug as evidence of copulation. 1-cell embryos were collected approximately 21 hours post-hCG Page | ‐ 41 ‐

Chapter 2 Materials and Methods

(E0.5). Mice were restrained by the skin of their backs and hormones were administered using a 25G hypodermic needle and 1ml syringe. The welfare of females were checked immediately and daily up until their usage.

Page | ‐ 42 ‐

Chapter 2 Materials and Methods

FZR1 +/+

14 13 12 11 10 9 8 7 6 5 4 3 2 1

flox FZR1 loxP/frt

14 13 12 11 10 9 8 7 6 5 4 3 2 1 NeoR

Flp FZR1 fl/fl

14 13 12 11 10 9 8 7 6 5 4 3 2 1

Cre FZR1 -/-

14 13 12 11 10 9 8 7 6 5 4 1

Figure 2.1 Creating Fzr1 knockout mice

Schematic diagram of Fzr1 alleles in the mouse. The Fzr1 gene has 14 exons (grey boxes) and spans 12kbp. LoxP (open triangles) and frt (grey triangle) recombinase sites were introduced. A neomycin (NeoR) cassette was inserted to select for homologous recombinant ES clones (black arrow). Wild-type, resultant Fzr1fl/fl (contains all 14 exons) and Fzr1-/- mutants (lost exons 2 and 3) used for experiments were shown.

Page | ‐ 43 ‐

Chapter 2 Materials and Methods

2.2. Media

2.2.1. Cell passaging and maintenance F9 mouse embryonic teratocarcinoma cell line was obtained from HPA Culture Collections (Sigma-Aldrich). Canted neck cell culture flask (Corning, Sigma-Aldrich, Australia) were pre-treated with 0.1% gelatin overnight at 4ºC and rinsed with sterile water before use. Cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM, 4.5g/L of glucose; Gibco, Invitrogen, Australia) supplemented with 10% fetal bovine serum (FBS, Gibco,

Invitrogen, Australia) and were cultured in a humidified incubator at 37ºC with 5% CO2. Cells were plated for maintenance at a density of 3x103 cells/cm2, and subcultured twice a week by rinsing with phosphate buffered saline (PBS) and treating using 0.25% Trypsin- EDTA in phenol red (Gibco, Invitrogen, Australia).

To maintain a supply of cells with low passage number, cells were split into multiple flasks and frozen down when ~90% confluency was reached. Cells were rinsed with PBS several times and incubated with a small volume of 0.25% Trypsin/EDTA at 37°C for about 2 minutes to dissociate adhered cells. Trypsin/EDTA was then inactivated using an equal volume of FBS-containing medium. The resulting cell suspension was transferred into 14ml tubes and centrifuged at 1000rpm for 10 minutes. After which, the supernatant was aspirated. The remaining cell pellet was resuspended in 1ml of FBS containing 10% dimethyl sulphoxide (DMSO) and transferred into a cryovial (Nunc, Denmark) and placed into an isopropanol freezing container (Biolab Direct) at -80°C to achieve slow freezing of ~1°C per minute to reduce ice crystal formation before long term storage in liquid nitrogen.

2.2.2. M2 medium M2 medium (Section 9.3.1) was prepared from individual components fortnightly, and GV oocyte maturation was tested prior to use in experiments. This medium was used primarily as a handling medium because it is buffered by 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid (HEPES) and therefore did not require 5% CO2 environment to maintain its pH. Besides use for oocyte collection and microinjection, oocyte maturation can be carried out using M2 medium, and careful handling usually produces oocyte maturation rates greater than 90%. Mineral oil was used to cover medium in all experiments to prevent evaporation. All media and oil were pre-warmed to 37ºC prior to use, so that they are at physiological temperature. Milrinone supplementation (1-10M) was used to maintain arrest of GV oocyte where necessary.

Page | ‐ 44 ‐

Chapter 2 Materials and Methods

2.2.3. FHM medium FHM medium (Section 9.3.4) was prepared weekly from individual components. This medium is used primarily as a handling medium for embryo collection, microinjection and

live cell imaging experiments when 5% CO2 atmosphere condition cannot be provided, like when using an inverted microscope or the inverted confocal microscope. FHM is buffered

by HEPES and therefore did not require 5% CO2 to maintain optimal pH. Careful embryo handling usually results in >80% of zygotes to form 2-cell embryos by day 2 of culture after microinjection and imaging procedures. Mineral oil was used to cover medium in all experiments to reduce evaporation. All media and oil were pre-warmed to 37ºC prior to use, which is physiological temperature.

2.2.4. KSOM and KSOM/AA medium KSOM medium (Section 9.3.2) was freshly prepared weekly from individual components. This medium does not contain HEPES and needs to be equilibrated in a humidified

incubator at 37ºC with 5% CO2 atmosphere overnight prior and during use. All media used were covered with pre-warmed and equilibrated mineral oil and used for long term culture of embryos.

KSOM supplemented with amino acid (KSOM/AA) medium (Section 9.3.3) was prepared fresh weekly from individual components. Both essential (EAA) and non-essential (NEAA) amino acids were incorporated into KSOM because it has been shown to better support embryo development in vitro (Biggers and Summers, 2008; Ho et al., 1995). Similar to

KSOM, KSOM/AA needs to be equilibrated in a humidified chamber at 37ºC with 5% CO2 atmosphere prior and during use, and was covered in pre-warm and equilibrated mineral oil for use of long term embryo culture.

2.2.5. Handling pipette fabrication Glass pipettes were made in the laboratory for handling of eggs/embryos. 150mm glass pasteur pipettes (Kimble-Chase/Lomb Direct, Australia) were heated over a Bunsen burner pilot flame and pulled to produce a fine taper. The taper was broken cleanly prior to use to obtain a tip diameter of approximately 80m in order to strip cumulus cells from GV oocytes effectively, without squeezing the oocyte. A slightly larger tip of approximately 90m was used to handle MII eggs and embryos.

Page | ‐ 45 ‐

Chapter 2 Materials and Methods

2.3. Tissue collection Mice were killed by cervical dislocation resulting in the severing of the spine between the neck and head. The abdomen was briefly sterilized with 75% ethanol and cut open towards the thorax using scissors and forceps. Ovaries and oviducts were carefully removed, and cut free from surrounding connective tissues and fat. The ovaries and/or oviducts were then transferred into either pre-warmed M2 medium (Section 9.3.1) supplemented with 1M of milrinone (M4659) for GV collection or oviducts into pre-warmed M2 or FHM (Section 9.3.4) media for MII and zygote collection.

2.3.1. Oocyte collection Collection was performed on a stereomicroscope with variable zoom function (SZ51, Olympus, Japan) and a transmitted illumination attachment (SZ2-ILA, Olympus, Japan). In addition, a heated stage (MATS-U4020WF, Tokai Hit, Japan) was used to maintain 37ºC during handling. Ovaries were punctured repeatedly using a ½ inch, 30-gauge needle to release the cumulus-oocyte-complexes (COCs) into the medium. This procedure was carried out within 2-3 minutes of ovary collection to maximise oocyte health. Glass pipettes made in-house were used for handling oocytes, MII eggs and embryos (Section 2.2.5). Gentle bulb suction pressure was applied to the pipette to draw the COCs in and out of the pipette causing the cumulus cells to be dislodged, exposing the denuded GV oocytes. These denuded oocytes were then transferred into a separate dish and washed through 6 100l droplets of fresh medium to remove all somatic cells.

2.3.2. MII eggs/embryo collection Using a similar microscope set up as previously described in Section 2.3.1, oviducts were transferred to M2 medium (Section 2.2.2) or FHM (Section 2.2.3) and ampullae torn to release the cumulus mass containing the MII arrested eggs or zygotes. Brief treatment with hyaluronidase (300g/ml, Section 9.5.1) was used to remove the surrounding cumulus cells. Eggs/zygotes were then collected and transferred into a separate dish and washed through at least 6 100l droplets of fresh FHM and KSOM (Section 9.3.2) or KSOM-AA (Section

9.3.3) media before culturing in a humidified incubator at 37ºC with 5% CO2 atmosphere.

2.3.3. Parthenogenetic activation

Activation media was calcium-free KSOM or KSOM-AA media supplemented with 10mM of strontium chloride and 1µg/ml cytochalasin D (CCD); prepared freshly prior use and

equilibrated at 37˚C in 5% CO2 in air overnight. Denuded MII eggs were washed through 6 Page | ‐ 46 ‐

Chapter 2 Materials and Methods

times 100l droplets of FHM, followed by 6 times 200l droplets of calcium-free KSOM

media, before eggs were exposed to activating medium for 4-5 hours at 37˚C in 5% CO2 atmosphere. Eggs were then washed in 6 times 100l droplets of KSOM media and parthenotes were cultured in groups of 10 in 10l droplets of KSOM or KSOM/AA under

mineral oil in a humidified atmosphere of 5% CO2 at 37˚C. Egg activation using strontium has been shown to mimic calcium oscillation observed during fertilization, which results in egg activation (Bos-Mikich et al., 1995; O'neill et al., 1991; Swann, 1990; Swann and Ozil, 1994), while addition of CCD, an actin inhibitor, prevents polar body extrusion producing diploid parthenotes (Balakier and Tarkowski, 1976; Navarro et al., 2005; Zhu et al., 2003).

2.3.4. Embryo culture and development Typically, parthenotes were scored ~9 hours post-activation for pronuclei formation. Embryos and parthenotes were cultured in KSOM or KSOM/AA for up to ~144 hours (6 days) or less depending upon the experiment being performed and were usually scored for developmental stage at regular intervals (~24 hours).

Page | ‐ 47 ‐

Chapter 2 Materials and Methods

2.4. Molecular techniques

2.4.1. Plasmid preparation for transfection

pEGFP-N3 glycerol stock were cultured in LB broth containing kanamycin (50g/ml) in an overnight culture at 37°C in a shaker. DNA plasmid was purified using PureLink HiPure plasmid midiprep kit (Life technologies, Invitrogen, Australia) according to manufacturer’s instructions. The concentration of the plasmid isolated was analysed using a spectrophotometer. Plasmids were linearized prior to transfection using NotI restriction enzyme digestion in Buffer D, performed at 37°C for 1 hour. An aliquot of the restriction digest was then analysed using agarose gel to ensure successful plasmid linearization (Figure 2.2).

2.4.2. Transfection of F9 cells with Lipofectamine LTX/Plus reagents F9 cells were seeded one day before transfection at 30x104 cells per 60mm tissue culture plate, such that cells were between 50-80% confluent on the day of transfection. Lipofectamine LTX and Plus reagents (Invitrogen) were used according to manufacturer’s instruction. Briefly, 1.8-3.6g of plasmid was complexed for 15 minutes with the Plus reagent, followed by the addition of Lipofectamine LTX to the mixture for a further 15 minutes, at room temperature. F9 cells were then transfected with the Lipofectamine LTX/Plus/plasmid mixture in the presence of 2ml of Opti-MEM medium (Gibco) without antibiotics for 3 to 4 hours at 37°C before being washed into fresh medium post- transfection. F9 cells were observed for positive EGFP fluorescence 24- and 48-hours after transfection.

To optimize conditions for transfecting F9 cells using Lipofectamine LTX/Plus reagents, cells were transfected with linearized pEGFP-N3 (Figure 2.2). For detailed parameters for optimizing F9 cell transfection, refer to Table 2-1.

Page | ‐ 48 ‐

Chapter 2 Materials and Methods

B ladder NotI uncut 4.7kb

10K 8K 6K 5K 4K 3.5K 3K 2.5K 2K 1.5K

Figure 2.2 pEGFP-N3 used for optimizing transfection in F9 cell

(A) Plasmid map of pEGFP-N3 used for optimizing transfection protocol of F9 cell line. (B) Gel of pEGFP-N3 plasmid after linerizing using NotI restriction enzyme in preparation for transfection. Linerized plasmid was approximately 4.7kb in size in lane 2, whereas the uncut supercoiled plasmid ran at approximately 3.5kbp lower on the gel in lane 3.

Page | ‐ 49 ‐

Chapter 2 Materials and Methods

Parameters Plasmid Fold change Vol. of Fold change Transfected to plasmid LTX/PLUS to LTX/Plus (ng) transfected reagent (l) reagent used

Pre-optimization 2500 1 fold 5/1.67 1 fold

High Plasmid 3750 1.5 fold 5/1.67 1 fold

Low Plasmid 1250 0.5 fold 5/1.67 1 fold

High Reagent 2500 1 fold 6.25/2.083 1.25 fold

Table 2-1 Optimization of transfection protocol for F9 cell line

Pre-optimization conditions were as per manufacturer’s recommendations; all alterations were measured in terms of folds as compared to pre-optimization conditions. ‘High plasmid’ referred to using 1.5-fold increase in plasmid amount, ‘low plasmid’ referred to using a 0.5-fold amount as compared with that used pre-optimization. ‘High reagent’ referred to using a 1.25-fold increase in both Lipofectamine LTX and Plus reagents as compared to pre-optimization parameters. The number of cells seeded per 60mm tissue cuclture dish was the same for all parameters at 30x104 cells

2.4.3. cRNA preparation for egg/embryo microinjection cRNA for microinjection was prepared from a modified pRN3 (Lemaire et al., 1995; Roure et al., 2007) vector known as pMDL (a gift from Dr. Mark Levassuer, Newcastle, UK) that is compatible to use with the T3 mMESSAGE mMACHINE RNA polymerase kit (T3 message machine high yield transcription kit, Life Technology, USA). This vector possesses a T3 promoter for in vitro RNA expression, multiple cloning sites for insertion of gene of interest, -globin gene 5’ and 3’ UTRs for improved mRNA stability and translation in vivo, as well as rare cutters of restriction sites for plasmid linearization (PstI, SfiI and KpnI). In addition, there is an Ampicillin resistance gene that permits selection of positively cloned plasmid. Here, an open-reading frame of histone-2B (H2B) lacking the stop codon was cloned into pMDL using the restriction sites BglII and SalI. mCherry fluorescent probe was cloned downstream of H2B, using restriction sites SalI and NotI (Figure 2.3). mRNA was produced using the T3 mMESSAGE mMACHINE RNA

Page | ‐ 50 ‐

Chapter 2 Materials and Methods

polymerase kit according to the manufacturer’s instructions and the resultant capped RNA was dissolved in nuclease-free water and microinjected at a concentration of 1g/l.

Page | ‐ 51 ‐

Chapter 2 Materials and Methods

Bgl II Histone 2B 5’ UTR Sal I T3 Promoter mCherry

Not I pMDL 3’ UTR Ampicillin Resistance PolyA

Pst I

Kpn I Sfi I

Figure 2.3 Vector map of pMDL

The modified pRN3 vector possesses a T3 promoter, ampicillin resistance selection marker, and various restriction sites. Here, BglI and SalI were used to insert histone-2B open-reading frame without the stop codon, and SalI and NotI for insertion of mCherry fluorescent probe. SfiI was usually used to linearize plasmid.

Page | ‐ 52 ‐

Chapter 2 Materials and Methods

2.5. Principles of miRNA design and generation of miRNA construct using Block-iT kit

2.5.1. Design of Fzr1 knockdown miRNA construct Using the online software designed by the manufacturer, Invitrogen RNAi Designer, three miR-RNAi target regions with the highest probable knockdown score out of the ten generated were targeted for Fzr1 knockdown (Table 2-2). Each of these consist of 21- nucleotide target sequences, namely beginning from nucleotides 178, 307 and 693 which coincides with exons 2, 3 and 7 respectively (Figure 2.4A). Each of these will be herein known as miR-Fzr1178-199, miR-Fzr1307-328 and miR-Fzr1693-714.

No. Start of oligo Sequence (DNA) GC% Rank (total (Nucleotide of 5 stars) no.)

1 178 GATCATCATCCAGAATGAGAA 38.1 5

2 210 GTGTTTCAGAGATGCGGAGAA 47.62 4.5

3 307 CAACTGGAGCGTGAACTTCCA 52.39 5

4 452 ATCGAGAAGGTTCAGGACCCA 52.39 3.5

5 522 TCTTTACGTATTCCCTCAGCA 42.86 4.5

6 555 GTCCAGATGATGGCAATGACG 52.39 4

7 687 CAGAGCTTCAGGACGACTTCT 52.39 4.5

8 688 AGAGCTTCAGGACGACTTCTA 47.62 4.5

9 690 AGCTTCAGGACGACTTCTACC 52.39 4

10 693 TTCAGGACGACTTCTACCTCA 47.62 5

Table 2-2 miRNA design using BLOCK-iT RNAi designer

Ten possible target sequences were generated for Fzr1 using the BLOCK-iT RNAi designer program. These results were obtained by calculation of GC content and target location within the gene that could result in the most probable targets to achieve Fzr1 knockdown and were ranked accordingly. The target with the highest probability of Page | ‐ 53 ‐

Chapter 2 Materials and Methods

achieving knockdown was awarded the most number of stars. The three miRNA targets selected for this thesis were those that were ranked with 5 stars, starting from base pair number 178, 307 and 693.

2.5.2. General principles for the generation of an miRNA construct using Block-iT kit Firstly, the desired miRNA was cloned into a pcDNA6.2-GW/EmGFP-miR vector, which could be used as a constitutive expression vector (Figure 2.4). This expression cassette could later be transferred into pT-Rex-DEST30 to be used as an inducible construct. Expression of the inserted sequence was driven by a Pol II human CMV promoter and the presence of the coding sequence of EmGFP upstream of the incorporated pre-miRNA allows tracking of the miRNA expression based on fluorescent expression.

The RNAi sequences targeted for Fzr1 knockdown were in the pre-miRNA form with each encoding the pre-miRNA containing a 5’ overhang of 4 base pairs. These 4 base pair overhangs were compatible to a 4 nucleotide overhang on the pcDNA6.2-GW/EmGFP- miR murine vector allowing the segment to be cloned in by annealing the double-stranded oligo made from the pre-miRNA (Figure 2.4B and C). The pre-miRNA was then introduced into a cell to form an intramolecular stem loop structure similar to endogenous pri-miRNA which can then be processed by the Dicer enzyme to generate a mature miRNA to induce gene silencing (Figure 2.4C and Figure 2.5)

The protocol for preparation of the annealing reaction was as shown in Table 2-3:

Reagent Volume (l)

Top strand DNA oligo (200M) 5

Bottom strand DNA oligo (200 5

10X Oligo annealing buffer 2

DNase/RNase-free water 8

Total volume 10

Table 2-3 Preparation of annealing reaction

Page | ‐ 54 ‐

Chapter 2 Materials and Methods

Samples were incubated at 95°C for 4 minutes and allowed to cool to room temperature for 5 to 10 minutes. The reaction mixture was then briefly centrifuged and mixed gently. The final concentration of the oligo mixture stock was 50M which was appropriate for long term storage.

1l of the 50M oligo stock was then diluted 100-folds (500nM). 5l of this stock was used for checking the integrity of the double stranded oligos generated by agarose gel electrophoresis (Figure 3.3). The 500nM oligo solution was then diluted by another 50-fold to give a final concentration of 10nM to be used in the subsequent ligation

Page | ‐ 55 ‐

Chapter 2 Materials and Methods

#178#307 #693 FZR1 1234567891011121314

TGCT CAGG overhang 5’ antisense target sequence Sense -2 nt target sequence overhang Linker Mature miR RNAi Sequence Loop Sequence 1-8, 11-21 of 21mer Target Linker

Annealing TGCT ds Oligos

CAGG pcDNA6.2- GW/EmGFPmiR

Ligation

pcDNA6.2- GW/EmGFPmiR with expression clone

Figure 2.4 Design and protocol of constitutive miRNA knockdown technique (A) Wildtype mouse Fzr1 locus containing 14 exons (grey boxes). Location of the 21 nucleotides for creating pre-miRNA oligo (red boxes; exon 2 – target #178, exon 3 – target #307 and exon 7 – target #693). (B) Structural features of RNAi design for cloning into vector. (C) Flow chart of assembling pre-miRNA into pcDNA6.2-GW/EmGFP-miR vector to be used for constitutive expression of knockdown target sequence or to be used for constructing inducible knockdown plasmid.

Page | ‐ 56 ‐

Chapter 2 Materials and Methods

Nucleus

Pre-miRNA Cytoplasm

3’ Transcription 5’ Exportin 5-induced nucelar export Drosha processing Pri-miRNA

3’ 5’ Dicer 5’ 3’ processing RNA Mature miRNA RISC within RISC 5’ 3’

Gene silencing through miRNA translation

5’ AAAAAAAAA 3’ 3’ 5’

RISC

Figure 2.5 Endogeneous mechanism to generate mature miRNA in cells

Processing of miRNA from primary miRNA (pri-miRNA) to form precursor miRNA (pre- miRNA) and into mature miRNA are mediated by Drosha and Dicer in the nucleus and cytoplasm respectively. Mature miRNA associate with RNA induced silencing complex (RISC) to gene expression through miRNA translation.

Page | ‐ 57 ‐

Chapter 2 Materials and Methods

2.5.3. Ligation of double stranded oligos into pcDNA6.2-GW/EmGFP-miR The mature miRNAs generated from Section 2.5.2 were ligated with linearized pcDNA6.2- GW/EmGFP-miR vector in separate reactions. Reactions also included a positive control (miR-Lac Z oligo) and a negative control (vector only), which were performed simultaneously with the samples.

The procedure was set up as shown in Table 2-4:

Reagent miRNA (l) Positive control Negative (l) control (l)

5X ligation buffer 4 4 4

pcDNA6.2-GW/EmGFP-miR, 2 2 2 linearized (5ng/l)

miR-double stranded oligo 4 - - (10nM)

miR-LacZ positive double - 4 - stranded control oligo (10nM)

DNase/RNase-free water 9 9 13

T4 DNA ligase (1U/l) 1 1 1

Total (l) 20 20 20

Table 2-4 Setting up ligation reaction to clone double stranded oligo into pcDNA6.2- GW/EmGFP-miR

The reaction mixture was mixed gently and pipetted up and down several times before incubation at room temperature for approximately 1 hour.

Page | ‐ 58 ‐

Chapter 2 Materials and Methods

2.5.4. Transformation using OneShot TOP10 competent E. coli

One vial of OneShot TOP10 competent E. coli was used per reaction with either 2l of miRNA or 1l of pUC19 positive control from Section 2.5.3. The transformation reaction mixture was incubated on ice for 5 to 30 minutes prior to heat-shock treatment at 42°C for 30 seconds. The tubes were then transferred immediately onto ice for 2 minutes. 250l super optimal broth (SOC) medium at room temperature was then added into each transformation tube. The tubes were shaken horizontally (200 rpm) at 37°C for 1 hour. Next, 50-100 l of each transformation was spread onto a pre-warmed Luria broth (LB) agar plate containing the appropriate antibiotics for selection, and incubated at 37°C overnight. Positive plasmid clones were selected for using 200g/ml spectinomycin. Positive pUC19 control clones were selected for using LB plates containing 100g/ml ampicillin.

5 spectinomycin-resistant colonies were picked for each miRNA target and cultured in 5ml of LB broth at 37°C overnight containing 10mg/ml of spectinomycin. The plasmids were then isolated using Qiagen QIAprep Spin MiniPrep kit according to manufacturer’s instruction.

2.5.5. Plasmid digestion An aliquot of the purified plasmid was then digested using 2 restriction enzymes SalI and BglII. These 2 restriction sites flank the 5’ and 3’ ends of the target sequence respectively (Appendix 9.2.1). Reaction mixtures were analysed on a 4% agarose gel, a 5.7kbp vector backbone and a ~100bp inserted double stranded duplex bands should be detected. Samples with inserts confirmed were sequenced (Australian Genome Research Facility; AGRF). When sequencing confirmed the correct insertion (orientation and sequence) of the miRNA into the pcDNA6.2-GW/EmGFP-miR vector, this plasmid would be ready for transfection or microinjection for constitutive Fzr1 knockdown.

Page | ‐ 59 ‐

Chapter 2 Materials and Methods

2.6. Western blot analysis

2.6.1. Sample preparation for oocytes/eggs/embryos Oocytes, eggs or embryos were rinsed through 3-6 drops of phosphate buffered saline/polyvinylpyrrolidone (PBS/PVP; Section 9.6.1) and transferred to a 0.5ml lo-bind eppendorf tube using a glass handling pipette. Excess PBS/PVP buffer was carefully withdrawn from around the sample, and 2-5l of embryo lysis buffer (Section 9.5.6) was added to the tube. The sample was briefly centrifugated and being stored at -80ºC until use.

Proteins were extracted from GV oocytes ~48 hours post-PMSG injection. Proteins were extracted at the following times post-hCG injection: MII eggs, ~12 hours; zygotes, ~21 hours; 2-cell embryos, ~45 hours; 4-cell embryos, ~69 hours; 8-cell embryos, ~77 hours; morulae, ~93 hours; early blastocyst; ~115 hours and fully expanded blastocyst, ~125 hours.

2.6.2. Sample preparation for F9 cell line F9 cells were plated on 100mm petri dishes to aid the collection process. Cells were washed three times with PBS and 500l of cell lysis buffer (Section 9.5.7) was added directly onto the plate. The rubber plunger of a 1ml syringe was then used to mechanically aid cell lysis prior to transfer of the sample into a 1.5ml eppendorf tube. Samples were briefly centrifugated and stored at -80ºC freezer until use.

2.6.3. Protein quantification using Bradford assay Quantification of protein concentration was performed using the Bradford assay, a dye- binding assay which results in differential colour changes of the dye Coomassie Brilliant Blue G-259. In response to varying concentrations of solubilised protein, a resultant dye shift occurs from 465nm to 595nm which can be quantitated. Protein standards with concentrations of 0, 10, 20, 30, 40 and 50g/ml were made from a stock standard of 10mg/ml bovine serum albumin (BSA) prepared in the same cell lysis buffer as the samples to be assayed. During each round of quantification, 5l of protein standard or sample was added to a 96-well microtitre plate in triplicate and the assay carried out using the Biorad Protein assay kit (Biorad Laboratories P/L, Australia) according to the manufacturer’s directions. Briefly, this process involved premixing 1:50 ratio of Reagent S to Reagent A. 25l of Reagent A/S and 200l of Reagent B were added into the microtitre plate containing either the protein standards or samples. The plate was then incubated in the dark for 15 minutes and the colourometric readout was obtained using an automated Synergy2

Page | ‐ 60 ‐

Chapter 2 Materials and Methods

spectrophotometer (Biotek Instruments, Inc., USA). The program, Gen5 (Biotek Instruments, Inc., USA) was used to plot the standard curve and the concentration of each sample was generated automatically. The following components were prepared in a new tube for gel loading (Table 2-5).

Component Volume

Protein X l (2.5g)

4X Sample Buffer 5l

10X Reducing Agent 2l

Cell Lysis Buffer Made up to 20l

Table 2-5 Western blot sample preparation

2.6.4. SDS gel electrophoresis and Western blot Protein samples were heated to 70ºC for 10 minutes, spun briefly and cooled to room temperature before use. The XCell SureLock Mini-Cell tank (Invitrogen, Australia) was set up according to manufacturer’s instructions. A 10% Bis-Tris sodium dodecyl sulphate (SDS)-polyacrylamide gel electrophoresis (PAGE) gel (NuPage Novex, Invitrogen, Australia) was rinsed twice with 3-(N-morpholino)propanesulfonic acid (MOPS) running buffer (NuPage, Invitrogen, Australia) and locked into place in the tank. The lower chamber was filled with MOPS running buffer, while the upper chamber was filled with MOPS running buffer supplemented with antioxidant. 15-20l of each sample was loaded into the wells and standard protein ladders were also added during each round of protein separation. These ladders included a BenchMark protein (#10747-012, Invitrogen, Australia), which provide markers for sizes ranging from 10 to 220kDa, and a pre-stained SeeBlue® protein standard (LC5925, 4-250kDa, Invitrogen, Australia) to allow easy visualization of gel progress and later, for the effectiveness of the blot transfer. Samples were electrophoresed at 200V for approximately 60 minutes.

2.6.5. Protein transfer and chemiluminescence

Protein was transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, USA) using a XCell II Blot Module (Invitrogen, Australia) with NuPage Transfer buffer (Invitrogen, Australia) containing 10% methanol. The inner tank was filled with transfer buffer, outer tank filled with Milli-Q and the transfer performed at 30V for 90 minutes. Page | ‐ 61 ‐

Chapter 2 Materials and Methods

Ponceau S (0.1% w/v in 5% acetic acid) was used to confirm location of BenchMark protein ladder standards and removed with repeated washes in Milli-Q water.

The PVDF membrane was blocked overnight at 4ºC in PBST with 5% skimmed milk (Section 9.6.2). The primary antibody was diluted in PBST/1%BSA (Section 9.6.2) and incubated with the membrane at room temperature for 2 hours on a roller or at 4ºC, overnight on a shaker. Following incubation, 4 x 15 minutes PBST washes were performed, followed by incubation with horseradish peroxidase (HPR)-conjugated secondary antibodies (DAKO, Denmark) for 1 hour at room temperature. PBST washes were repeated, and a chemiluminescence assay carried out using ECL or ECL Plus detection solution (GE Healthcare, UK). The plastic wrapped membrane was exposed to ECL film (GE Healthcare, UK) for 1-10 minutes in a Biomax Cassetter with intensifying screen (Kodak). Alternatively, the chemiluminescence assay was carried out using Illumina Forte or Illumina Crescendo (Millipore, USA) and signal detected with a Luminescent Image Analyser LAS-4000 Imaging System (Fujifilm Life Science, Japan).

Primary antibodies used were mouse anti-Fzr1 (1:100 dilution; Ab3242, Abcam, UK) and rabbit anti-Gapdh (1:10,000 dilution; G9545), probed at room temperature for 2 hours, and HRP conjugated secondary antibodies used were goat anti-mouse and goat anti-rabbit respectively. For each primary antibody, this immunoblot protocol was repeated independently 2-3 times.

Page | ‐ 62 ‐

Chapter 2 Materials and Methods

2.7. Immunohistochemical analysis

2.7.1. Sample preparation for kinetochore counting Eggs or embryos at metaphase were incubated in M2 or KSOM media respectively containing 500M monastrol, a Kinesin 5 inhibitor, for 2 hours at 37ºC. This treatment results in the collapse of the spindle onto a single pole which spreads the chromosomes around the structure and so aids kinetochore visualisation following immunostaining (Khodjakov et al., 2003).

2.7.2. Sample fixing and permeabilizing Embryos were washed briefly through several drops of PBS/PVP (Section 9.6.1) and transferred into fixing solution (4% paraformaldehyde (PFA)/PHEM; Section 9.6.3) for 20 minutes at room temperature. Embryos were then permeabilized in 4% PFA/PHEM containing 0.5% TritonX-100 for another 20 minutes at room temperature followed by three washes in PBS/PVP for 10 minutes before storing in PBS/PVP at 4ºC for up to 2 weeks.

2.7.3. Immunofluorescence Ten-well glass dishes were used for all washes and incubation, placed in a humidified, darkened chamber during incubation. Eggs or embryos were typically transferred through 100l droplets of different solutions using a glass pipette. Eggs or embryos were blocked in 7% goat serum in PBST/BSA (wash buffer, Section 9.6.2) at room temperature for 1 hour or at 4ºC, overnight to prevent non-specific binding and background signal. Samples were then washed through five 100l droplets of PBST/BSA before they were incubated in primary antibody diluted in PBST/BSA to the correct working concentration for the appropriate time (refer to Table 2-6 for details). The samples were washed through five 100l droplets of PBST/BSA for 20 minutes each to remove any unbound primary antibody. Samples were then incubated with secondary antibody diluted in PBST/BSA for 1 hour at room temperature. All secondary antibodies were used at 1:1000 dilution (Invitrogen, Australia), except for Anti-Rat Fluorescein isothiocyanate (FITC) 1:150 (F- 6258, Sigma-Aldrich, Australia). The 20 minutes washes were repeated five times to remove any unbound secondary antibody. Eggs or embryos were briefly counter stained by either Hoechst (20µg/ml) or propidium iodide (10µg/ml) diluted to the correct concentration using wash buffer for 10 minutes prior to mounting on glass slides.

Page | ‐ 63 ‐

Chapter 2 Materials and Methods

2.7.4. Sample mounting Egg or embryos were mounted on 12-well glass slides in a small volume of Citifluor (~0.4l, Citifluor Ltd., UK). Samples were transferred onto the glass well and most of the wash buffer was removed leaving just enough to cover the embryos, before the droplet of Citifluor added on top. A thin cover slip was then placed on the glass slide and sealed using clear nail polish and left to set for several minutes prior to storing in the fridge or to be imaged immediately.

Primary Company Dilution Incubation Secondary Antibody Factor Condition Antibody

CREST 90C-CS1058, Cortex 1:400 1 hour, room Human IgG Alexa- Biochem, USA temperature 555 conjugated

-Tubulin A11126, Molecular 1:200 2 hours, Bovine IgG Alexa- Probes, Invitrogen, room 633 conjugated Australia temperature

-H2AX Ab11174, Abcam, UK 1:100 Overnight; Rabbit IgG Alexa- 4ºC 488 conjugated

E-cadherin M108, Takara Bio Inc., 1:200 Overnight, Rat IgG FITC Japan 4ºC conjugated

Table 2-6 List of primary and secondary antibodies used for immunofluorescence

Page | ‐ 64 ‐

Chapter 2 Materials and Methods

2.8. Microinjection

2.8.1. Inverted microscope for microjection A Nikon TE300 inverted microscope (Nikon, Japan) was fitted with 4X, 10X and 20X objectives. The microscope also included a heated stage that was set to 37°C, controlled by a manual stage controller located on the right of the microscope (ASI MS2000, ASI, USA), as well as left and right 3-ways joystick (X-,Y- and Z-axis) micromanipulators (MO-202U or MHW-3, Narishige, Tokyo, Japan). The left-hand micromanipulator controlled a holding pipette that held the egg/embryo in place during the procedure, while the right-side controlled the microinjection micropipette that delivered the desired cRNA or plasmid into the egg/embryo. Both left- and right-hand micromanipulators were controlled hydraulically (X-, Y- and Z-axis) by coarse manipulators (MMN-1 Coarse manipulators, Narishige, Tokyo, Japan) located on the sides of the microscope using mounting adaptors (Microscope/Adaptor combinations for injection systems, Narishige, Tokyo, Japan) and fine micromanipulators (mentioned above), placed on either sides of the microscope. A hydraulic syringe and tubing pre-filled with mineral oil, were connected to the left-side micromanipulator by an injection holder set and a pre- fabricated holding pipette (G32801 Cook Medical, Bloomington, IN, USA) was attached to the end of the holder. The right micromanipulator was attached to a PV820 pneumatic picopump, capable of delivering compressed air of ~50 psi (World Precision Instruments, Australia) that controlled injection pressure and duration. The picopump was connected to a microelectrode holder (MEF2SF, World Precision Instruments, Australia) which held the micropipette containing cRNA/plasmid to be microinjected. The holder was also connected to an Electro 705 head stage (World Precision Instruments, Australia) which acted as a source of negative capacitance to facilitate permeability of the cell membrane (Figure 2.6).

Page | ‐ 65 ‐

Chapter 2 Materials and Methods

Mounting adaptor

Coarse manipulators

Picopump

Electro 705 electrometer 3-way joystick 3-way (injection Hydraulic joystick pipette syringe (holding manipulators) pipette manipulators)

Electro head stage

Earth Connection Microelectrode holder

Holding pipette Injection micropipette

Heated stage Air Fluoro- hose dish

Figure 2.6 Inverted microscope set up for microinjection procedure

(A) A Nikon TE-300 inverted microscope showing the front view of the set up for microinjection with its associated components. (B) View of heated stage set up with fluoro-dish containing media overlaid with mineral oil and its associated components for microinjection procedure.

Page | ‐ 66 ‐

Chapter 2 Materials and Methods

2.8.2. Microinjection pipette fabrication Microinjection pipettes were fabricated from borosilicate glass pipettes with internal filament, 0.84mm inner diameter and 1.5mm outer diameter (World Precision Instruments, Australia). The pipettes were pulled using P-97 Flaming/Brown pipette puller with a 3mm box filament (Sutter Instruments, Novato, CA, USA; Figure 2.7). The parameters were set to Pressure = 500, Heat = Ramp + 10, Pull = 60, Velocity = 80, Time = 250. This pulled the glass capillaries horizontally producing a fine tip with a shoulder of about ~1cm in length. The micropipette tip was then brushed gently over loose cotton balls at a 90° angle to break the end to produce a visibly open, straight-edged tip that was inspected by a compound microscope before storage in a dust-free glass jar (World Precision Instruments, Australia).

Microinjection pipettes were filled with loading pipettes that were made from 1 cc/ml sterile tuberculin syringes (Terumo, USA), made in-house. The plunger was removed and melted near the mid-point over pilot light of a Bunsen burner while constantly being rotated. When the plastic had softened, it was moved away from the flame and drawn out to produce a tapered end, used to back-fill liquid into the tip of the glass microinjection pipette. Loading of cRNA/plasmid to the tip of the pipette was induced by gentle flicking of the glass pipette.

Page | ‐ 67 ‐

Chapter 2 Materials and Methods

Figure 2.7 P-97 Flaming/Brown pipette puller for micropipette manufacture

Green arrow indicates the filamentt housing for heating the glass capillary. Red arrows indicate the 2 micropipettes produced from pulling a borosilicate glass pipette.

Page | ‐ 68 ‐

Chapter 2 Materials and Methods

2.8.3. Microinjection procedure A 30mm Fluoro Glass Dish (FD35-100, World Precision Instruments, Australia) was filled with 1ml of pre-warmed FHM medium and covered with mineral oil. The centre of the base of the dish was then brought into focus on the 4X objective and an earth connection was placed into the media to complete the circuit. The holding pipette was lowered into the dish with the tip gently touching the base of the dish and positioned slightly off-centre to the left of the field of view using the 20X objective. A small number of embryos (no more than could be injected within 10 minutes) were then transferred onto the dish slightly off-centre to the top of the field. This would prevent excessive illumination on the embryos to maintain embryo health.

The microelectrode holder was then filled with HEPES-buffered KCl solution with a loading pipette. A prepared microinjection pipette was backfilled with cRNA/plasmid as described previously (Section 2.8.2) and attached to the electrode holder before connecting to the electro 705 head stage. The microinjection pipette was then introduced into the medium at a 15° angle from perpendicular, positioned opposite to the holding pipette with a space in between slightly wider than the diameter of an embryo.

Air bubbles in the microinjection pipette were then forced out by adjusting the pressure of the picopump starting from a low pressure for an extended interval of several seconds. When the pipette was unblocked, the stage was adjusted so that the nearest embryo would be in the path of the current and move from the ejected cRNA/plasmid. When this was achieved, the micropipette tip was raised just out of focus and the picopump adjusted to ~10-20 psi ready for microinjection at 20X objective.

The stage was moved so that an embryo was in close proximity to the holding pipette before gentle suction was applied on the holding pipette to hold the egg/embryo in place and moved slightly away from the rest of the embryos. The micropipette was then positioned above the embryo prior to being lowered using the fine micromanipulator so that the tip pierced through the zona pellucida without resistance into the cytoplasm (Figure 2.8). This could be visualized by a slight recoil of the zona pellucida. Following this, negative capacitance was achieved by activating the ‘tickle’ function of the Electro 705 for ~1 second. This process transiently disrupts the plasma membrane and ensure that the solution would be injected into the cytoplasm and not into the perivitelline space. A timed pressure injection of ~100 millisecond on the picopump was then used to deliver a small volume of cRNA/plasmid into the embryo (approximately the size of the nucleolus, Page | ‐ 69 ‐

Chapter 2 Materials and Methods

Figure 2.8). When the embryo had been injected, the micropipette was gently but quickly withdrawn vertically, and the embryo was deposited a short distance away in another region of the dish, usually below to prevent mix-up from uninjected embryos by mechanically moving the stage. When all eggs/embryos were microinjected, they were transferred from the inverted microscope to media and kept in the dark on the heat block to recover for about 10-15 minutes before further manipulation.

Page | ‐ 70 ‐

Chapter 2 Materials and Methods

A holding pipette

micropipette

Injection size

Figure 2.8 Representative image of microinjection of an embryo

(A) Brightfield image of an embryo being held in place by the holding pipette (left) and in the process of being injected by a micropipette (right). Even though the pipette may look out of focus due to its steep angle, the tip of the pipette was in the cytoplasm at the same level as the holding pipette. Image was taken at 20X magnification. (B) White circles show the best positions and size to inject the embryo, while avoiding the pronuclei of the embryo.

Page | ‐ 71 ‐

Chapter 2 Materials and Methods

2.9. Epifluorescence microscopy

2.9.1. General principles of fluorescent microscopy and imaging Electrons in an atom are promoted to a higher energy orbit when it absorbs light photons. When these electrons fall back to a lower energy orbit, it will usually emit another photon of a higher wavelength than the one absorbed. In imaging systems, the ability to distinguish and separate the excitation and emission lights allowed for the capturing of detailed images using a dichroic mirror. The use of a dichroic mirror reflects light of a certain electromagnetic spectrum while allowing others to pass through as described below.

For my studies, dichroic mirrors were selected according to the properties of the fluorochromes to be imaged (Table 2-7). For epi-fluorescence, a mercury burner ((i) mercury vapour lamp: Olympus FV1000 confocal microscope – Olympus U-RFL-T, and Nikon Biostation IM – Nikon Intensilight or (ii) mercury halide lamp: TE2000-U inverted microscope – Prior Lumen 200) supplied a spectrum of wavelengths ranging from the ultra violet through to far red. A filter wheel (Chroma Technology Corp., USA) that was fitted to the inverted microscope was used to hold different filters into the path of this light, thus narrowing the range to an appropriate wavelength (Table 2-8) for exciting the fluorochrome of interest (Chroma Technology Corp., USA). This light was reflected off the long-pass dichroic mirror into the objective lens and focused onto the specimen. The fluorochrome then absorbed the excitation wavelength and consequently emitted a photon of a higher wavelength. This higher wavelength was captured by the objective lens and channelled back to the dichroic mirror and because it was a higher wavelength, it was able to pass through the mirror and be captured by the camera through a series of mirrors. Any other light reflecting off the specimen being of a lower wavelength was not able to pass through the mirror and so was therefore not part of the output generated by the camera (Figure 2.9).

2.9.2. Fluorescence imaging In this thesis, three imaging systems were used perform imaging experiments. 1) A TE2000-U inverted microscope attached to a PC-controlled Charge Coupled Device (CCD) camera (Orca-R2, Hamamatsu Photonics K.K., Japan) that was capable of acquiring epi fluorescence images, 2) an IM Biostation (Nikon, Japan) that works on a similar principle

as the TE2000-U but had a humidified heated 5% CO2 chamber that allowed for live cell imaging using KSOM medium and 3) an Olympus Fluoview FV1000 confocal microscope

Page | ‐ 72 ‐

Chapter 2 Materials and Methods

with 4 laser lines (405nm, 473nm, 559nm and 635nm), 3 photomultiplier detectors and 6 barrier filters (Olympus, Japan) attached to a heated chamber (Solent Scientific) was used

for live cell imaging without CO2 supply such as with FHM medium.

Page | ‐ 73 ‐

Chapter 2 Materials and Methods

Fluorochrome Excitation Max (nm) Emission Max (nm)

Hoechst 346 461

EGFP 488 507

Fluorescein 490 525 isothiocyanate (FITC)

Propidium iodide 536 617 (PI)

mCherry 587 610

Table 2-7 Table of Excitation and Emission wavelengths of fluorochromes

Epi-fluorescence / IM Biostation Confocal

Fluorochrome Excitation Dichroic Emission Fluorochrome Laser filter (nm) mirror filter wavelength (beamsplitter) (nm) (nm)

Hoechst 380 400 420-460 Hoechst 405

EGFP 480±15 505 510-550 FITC, Alexa 488 488

mCherry 580±10 490-550 + 522/20 + Alexa 555; 532 590-680 (dual 632/30 mCherry pass)

Alexa 633, 633 Propidium iodide

Table 2-8 Table of laser wavelengths and their respective fluorochromes

Page | ‐ 74 ‐

Chapter 2 Materials and Methods

Fluorochrome

Objective lens

Excitation filter

Lo ng- pa ss Reflected light D i ch ro Excitation wavelengths Mercury burner ic M irr or

Emission wavelenth to camera

Figure 2.9 Excitation light path passing through dichroic mirror to produce signal for imaging

Broad spectrum of light produced from mercury burner passes through filter wheel that narrows the range of excitation wavelength is reflected by a long-pass dichroic mirror into the objective lens and projected onto fluorochrome. The fluorochrome absorbs the excitation wavelength and emits a photon of a higher wavelength that passs through the mirror to be captured by the camera whilst the unabsorbed lower wavelengths are reflected.

Page | ‐ 75 ‐

Chapter 2 Materials and Methods

2.9.3. Imaging parameters Fixed embryos were imaged using an Olympus FV1000 confocal microscope equipped with a 60X 1.2 NA UPLSAPO oil immersion objective lens. Z-stacks were compiled at 0.5 to 2.5m slice separation intervals in the z-axis. Images were scanned at a minimum resolution of 312 pixels and up to 800 pixels and different laser channels were usually used sequentially to prevent bleed-through. For experiments where intensity of fluorochromes was of importance for quantification, laser settings and other confocal parameters were not adjusted between samples and acquisitions. Images shown in thesis are usually representative of equatorial scans on individual embryos unless otherwise stated. Analyses were performed with FV10-ASW2.0 viewer software (Olympus, Tokyo, Japan) or Image J software (NIH, Bethesda, USA).

2.9.4. Epifluoresence imaging for pronuclei formation Live cell imaging was carried out using an inverted microscope where 2D information was sufficient, such as observing for H2B-mCherry signal during pronuclear formation times and rate of activation in MII eggs. Imaging was performed within 30 minutes after MII egg were exposed to activation medium (Ca2+-free FHM, supplemented with Sr2+ and CCD) following H2B-mCherry microinjection. Images were taken at a 20X NA 0.75 objective magnification with an additional 1.5X optical zoom. This allowed for about 10-20 MII eggs within the frame to be imaged simultaneously. Images were captured at every 5 minutes interval for up to 15 hours.

2.9.5. Live cell imaging of the first mitotic division in embryos using confocal microscopy Live cell imaging was performed using an Olympus FV1000 confocal laser scanning microscopy (CLSM) equipped with a 60X 1.2 NA UPLSAPO oil immersion objective lens when 3D information was required. This experiment was performed to observe chromosome movements during the first mitotic division of parthenotes. MII eggs were microinjected with H2B-mCherry prior to activation for 5 hours. Parthenotes were washed out of activating medium into FHM, plated in microdroplets of no more than 16l of FHM (1l of media per parthenote), overlaid with mineral oil and placed on a heated stage. Depending on the number of parthenotes, different objectives were used; 20X objective for 16 eggs, 40X objective for 9 eggs and 60X objective for 4 eggs within the frame for capture. The base of 1 pronucleus was located and set as zero before the z-positions of both

Page | ‐ 76 ‐

Chapter 2 Materials and Methods

pronuclei were determined for imaging with a 2m step interval. Images were scanned at every 5 minutes interval for up to 30 hours.

2.10. Data analysis and image processing

2.10.1. Densitometric analysis Protein expression levels on immunoblots were determined by densitometric analysis of bands using Image J software (NIH, Bethesda, USA). Western blots that were developed onto film were converted into digital images using a flatbed scanner. Digital images were inverted and a small area, just enough to contain the protein band was used to calculate the total pixel intensity and subtracted against the background intensity, an area directly below protein band, for each lane.

2.10.2. Live cell imaging At the end of the experiment, movie files were created from the IM Biostation in-built program or tiff file images captured using the inverted microscope were compiled into a video clip using MetaMorph software (Molecular Devices, LLC, USA). Data obtained were used for analysis of pronuclear formation times in parthenotes and activation rates as discussed in Chapter 6.

Image files from live cell imaging performed on the CLSM for tracking the first mitotic division in embryos were compiled to restruct the 3D images using the FV10-ASW software (Olympus, Tokyo, Japan), before the movie file could be created using Image J (NIH, Bethesda, USA). Data obtained were used for analysis of timings and rates of syngamy in parthenotes as discussed in Chapter 6.

2.10.3. Statistical analysis All statistical analysis were performed using GraphPad Prism version 5 (Graphpad software, CA, USA). Dichotomous data were compared using Fisher Exact test. Comparison of means were analysed using either Student’s (data following a normal distribution) or Welch’s (samples having unequal variances) t-test.

Page | ‐ 77 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

3. Fzr1 Knockdown Study in F9 cells and Embryos

3.1. Introduction To date, there are two existing Fzr1 mouse knockout models developed using gene-trap (Li et al., 2008) and Cre-lox recombination technology (García-Higuera et al., 2008). Li et al. utilized a gene-trap construct consisting of a splicing acceptor and a -geo promoter (Ullrich and Schuh, 2009), which was inserted into intron 5 of the Fzr1 gene to generate a dysfunctional allele in embryonic stem (ES) cell clones. Similarly, using a gene-targeting construct, Garcia-Higuerea et al. inserted loxP sites into the Fzr1 gene flanking exons 2 and 3 in ES cells to disrupt Fzr1 expression. In both cases, ES cell clones containing the gene- trap construct or floxed allele were subsequently transferred into blastocysts to produce chimeras, and mice carrying the transgenic insert in the germ line were identified. Mice that contained the floxed Fzr1 allele were then further crossed with those ubiquitously expressing Cre–recombinase to disrupt Fzr1 expression. In both cases, Fzr1 knockout mice (Fzr1-/-) were created by matings between heterozygotes (Fzr1+/-). These subsequent Fzr1-/- offsprings were informative in allowing identification of the importance of Fzr1 in the process of endoreduplication during trophoblast giant cell (TGC) formation necessary for placentation and cells lacking in Fzr1 displayed chromosomal aberrations leading to inefficient proliferation and premature cell senescence (García-Higuera et al., 2008; Li et al., 2008). However, since heterozygous matings were used to create these Fzr1-/- mice, the role of preimplantation embryo development could not be effectively investigated due to the presence of maternal Fzr1 messenger RNA (mRNA) and protein stores in the eggs of Fzr1+/- female breeders. Therefore, to circumvent the confounding effects of maternal Fzr1 contribution, I chose to employ a method of Fzr1 transcript knockdown by inducing RNA interference (RNAi) in zygotes, in order to examine the role of Fzr1 during the earliest stages of embryo development.

The use of RNAi has been shown to produce a conserved biological response resulting in post-transcriptional gene silencing through mRNA degradation (Montgomery et al., 1998; Ngô et al., 1998). RNAi is thought to protect against genome instability as a result of transposons (translocation of DNA sequence from one location of the genome to another) and repetitive sequence accumulation (Ketting et al., 1999; Tabara et al., 1999). As such, the use of RNAi has emerged as a powerful tool for determining the function of target genes in animals and plants. The term RNAi was first coined by Fire et al. (1998) to describe the blocking of gene expression through the introduction of double stranded RNA

Page | ‐ 78 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

(dsRNA) in Caenorhabditis elegans. Now, the term RNAi is also used to describe a technique that utilizes short homologous RNA duplexes that are inserted into eukaryotic cells by transfection of either the oligonucleotides (siRNA- short interfering RNA) or plasmids encoding the small interfering RNA (shRNA- short hairpin RNA or miRNA- microRNA) to induce specific and potent inhibition of gene expression through degradation of the complementary mRNA (Valencia-Sanchez et al., 2006; Zeng et al., 2003).

Both endogenous siRNA and miRNAs, usually between 21 to 23 nucleotides long are products derived from a larger dsRNA precursor that has been cleaved by an enzyme, known as Dicer in the cytoplasm and Drosha in the nucleus; a member of the RNase III family of the double stranded RNA specific endonucleases (Bernstein et al., 2001; Billy et al., 2001; Ketting et al., 2001). siRNA is formed when long endogenous dsRNA is introduced into cells by transposons or viruses (Fire et al., 1998; Hamilton and Baulcombe, 1999), whereas miRNA are endogenous, non-coding genes with precursor RNA transcripts that can form small stem loops which are cleaved by Dicer to produce mature miRNAs f(Ambros, 2001; Carrington and Ambros, 2003; Lagos-Quintana et al., 2001).

In the current study, miRNAs were used for initiating gene silencing. Using this vector- based system, RNAs will be made from a DNA template driven by an RNA polymerase II (Pol II) promoter to overcome the transient nature of siRNA knockdown approach to enable for stable loss of function to be achieved (Brummelkamp et al., 2002; Sui et al., 2002). Endogenously, miRNAs are found embedded in clusters known as the primary transcript (pri-miRNA), containing a hairpin loop structure and its expression is driven by RNA Polymerase II (Lee et al., 2004). The pri-miRNA is then be cleaved by Drosha, a nuclear RNase III to produce a small hairpin precursor miRNA (pre-miRNA)(Zeng and Cullen, 2005). Following this, the pre-miRNA is transported from the nucleus into the cytoplasm (Bohnsack et al., 2004; Yi et al., 2003), before being processed by the Dicer to form the mature miRNA for incorporation into an miRNA-containing RNA-induced silencing complex (miRISC)(Bartel, 2004). Since its discovery, RNAi technology has found its way into a wide variety of animal models, including Drosophila (fruit flies) (Kennerdell and Carthew, 1998; Misquitta and Paterson, 1999), Trypanosome (protozoan parasite)(Ngô et al., 1998), Planarian (flatworm)(Sánchez Alvarado and Newmark, 1999), Cnidarian hydrozoan (hydra)(Lohmann et al., 1999), Danio rerio (zebrafish)(Wargelius et al., 1999) and Mus musculus (mice)(Wianny and Zernicka-Goetz, 2000). As such, by microinjecting miRNA into zygotes, maternal stores of Fzr1 will be decreased allowing for Page | ‐ 79 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

the investigation of Fzr1 function during early embryogenesis. However, the lack of miRNA transcription in the early embryo would mean that this vector-based system is only useful after EGA, as opposed to using a direct siRNA approach. In spite of its limitations, this plasmid-based approach was chosen rather than direct siRNA injection because it could be easily adapted to allow for inducible expression of the miRNA. In this inducible system, expression of the miRNA will only occur once the appropriate activator of the promoter is supplied to the cells, in this case, an antibiotic (Yao et al., 1998). As such, this technique provides an opportunity for regulated inhibition of the targeted gene during various time points of embryogenesis or at a particular phase of the cell cycle, allowing for detailed examinations of Fzr1 function during mouse embryo development.

Due to the ease of cell propagation and the abundance of material available for quantitative analysis, preliminary experiments to optimize conditions for miRNA Fzr1 knockdown were performed in an embryonic stem cell line. It has previously been established that mouse embryonal teratocarcinoma cells serve as a good model platform for differentiation and developmental studies (Ozolek and Castro, 2011). One of the best characterized cell lines of this type is the F9 embryonal teratocarcinoma stem cell line, derived from testicular carcinoma, which was chosen for the studies presented here because it is of a mouse origin and further studies will be performed in mouse embryos. Additionally, F9 cells can be easily maintained in the embryonic state unless low concentrations of retinoic acid are added to induce cellular differentiation (Strickland and Mahdavi, 1978). Normal 1- to 7.5- day old inbred mouse embryos when transplanted to an extra-uterine site in a histocompatible host forms tumours known as teratocarcinomas, and it was from such cells that F9 line was originally developed (Solter et al., 1975; Stevens, 1970). Their phenotype closely resembles that of primordial germ cells (Pierce et al., 1967) as well as the embryonic ectoderm, which contains the pluripotent cells of the early embryo (Damjanov and Solter, 1975). Since F9 cells can be easily maintained in vitro as cell lines, they provide an excellent tool for the purpose of optimizing conditions for successful Fzr1 knockdown using miRNA.

Since previous Fzr1 knockout studies have observed normal preimplantation development, it was therefore necessary to characterize Fzr1 expression over the course of preimplantation embryo development to determine its presence during the earliest stages of embryonic development.

Page | ‐ 80 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

3.2. Results

3.2.1. Assessment of Fzr1 expression during preimplantation embryogenesis Previous knockout models of Fzr1 have been unable to directly examine a role for this protein during preimplantation embryogenesis. As an indicator of whether Fzr1 may in fact be important during this period, I first sought to establish the protein expression profile of Fzr1 during early embryo development by Western blotting. Characterizing Fzr1 protein profile in embryos was also important for determining whether Fzr1 knockdown had been achieved after injection of the miRNA plasmid.

Protein was extracted from 100 of each of the following; GV oocytes, MII eggs, 1-, 2-, 4- and 8-cell embryos, morulae (M), early blastocyst (EB) and fully expanded blastocysts (FB), and immunoblotted against a mouse monoclonal antibody specific to Fzr1 (Figure 3.1A). Densitometric analysis of Fzr1 expression was normalized to Gapdh as a control for protein loading, and calculated relative to the stage of maximum expression (GV oocytes; Figure 3.1B). It was observed that there was lower Fzr1 expression in MII eggs (~75% of GV levels) and a further reduction following zygote formation (~45%). At the 2-, 4- and 8- cell stage, Fzr1 expression was minimal ~4%. Fzr1 expression began to increase at the morula stage to ~25% of GV levels and continued to accumulate to ~80% in fully expanded blastocysts.

3.2.2. Development of RNAi-mediated knockdown of Fzr1 Having established evidence for Fzr1 protein expression in preimplantation embryos, I next sought to develop a method for in vitro RNAi-mediated Fzr1 knockdown that could be used on embryos. To achieve this, an appropriate miRNA sequence had to be designed and cloned into a suitable vector before its efficacy was tested. The initial stages of miRNA testing were performed in F9 cells since this allowed for simple transfection of the miRNA containing plasmids and provided abundant material for Western blot analysis.

However, it was essential to first confirm whether Fzr1 protein could be readily detected in these cells by Western blot, so that knockdown efficiency of the transfected miRNAs could be determined. Immunoblot analysis performed on proteins from F9 cells revealed high levels of Fzr1 expression (Figure 3.2). The F9 cell line was therefore deemed suitable for assessment of Fzr1 miRNA efficacy as described in the following sections.

Page | ‐ 81 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

GV MII 1 2 4 8 MEBFB kDa cell cell cell cell 62 Fzr1 49

Gapdh 38

1.0

0.8

0.6

0.4 Fzr1 Expression Fzr1 0.2

0.0 GV MII 1 2 4 8 M EB FB cell cell cell cell

Figure 3.1 Immunoblot of Fzr1 expression profile during preimplantation embryogenesis (A) Immunoblot of Fzr1 expression levels in GV oocytes (germinal vesicle), MII eggs (metaphase II) and embryos (M, morulae; EB, early blastocyst; FB, fully expanded blastocyst) at various time points over the course of preimplantation embryogenesis. 100 oocytes / eggs / embryos were loaded per lane. Gapdh expression was used as a control for protein loading (n = 2 blots). Time listed for protein samples for GV oocytes, ~48 hours post PMSG injection; MII eggs, ~12 hours; 1-cell, ~21 hours; 2-cell, ~45 hours; 4-cell, ~69 hours; 8-cell, ~77 hours; M, ~93 hours; EB, ~115 hours and FB, ~125 hours post-hCG injections. (B) Densitometric analysis of (A), normalized to Gapdh and expressed relative to Fzr1 protein levels in GV oocytes.

Page | ‐ 82 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

#1 #2 #3 kDa

Fzr1 60

Gapdh 38

Figure 3.2 Fzr1 expression in F9 mouse embryonal teratocarcinoma cells Immunoblot for Fzr1 in F9 cells after 48 hours of propagation. Experiment was performed in triplicate. 2.5g of protein loaded per lane. Immunoblot for glyceraldehyde 3-phosphate dehydrogenase (Gapdh) was performed as a control for protein loading.

Page | ‐ 83 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

3.2.3. Design and generation of Fzr1 specific miRNAs In Section 2.5, the principles of designing miRNAs to target Fzr1 were described. The aim was to insert these miRNA sequences into the pcDNA6.2-GW/EmGFP-miR vector consisting of 1) a human cytomegalo-virus (CMV) promoter so that high-level, constitutive expression of the miRNA can be achieved, 2) an EmGFP cassette for co- cistronic expression with the pre-miRNA for positive identification and 3) a blasticidin resistance gene for selection to generate stable clones expressing the miRNA. Three 21 base pair miRNA against regions 178-199, 307-328 and 693-714 of the murine Fzr1 gene transcript were selected, corresponding exons 2, 3 and 7 respectively. Each of these will herein be known as miR-Fzr1_178-199, miR-Fzr1_307-328 and miR-Fzr1_693-714.

Annealing of the complementary single stranded oligos to form double stranded duplexes was confirmed by electrophoretic separation on an agarose gel (Figure 3.3). Whilst each of the complementary single stranded oligos showed bands at about 150 base pairs, the annealed double stranded duplexes produced bands at approximated 300 base pairs (Figure 3.3). Following ligation into the mammalian expression vector pcDNA6.2-GW/EmGFP-miR, correct insert orientation and sequence of miRNA were confirmed by plasmid sequencing. Even though all three Fzr1 knockdown targets successfully formed their respective double stranded duplex, only miR-Fzr1_178-199 and miR-Fzr1_307-328 were found to be inserted into the pcDNA6.2-GW/EmGFP-miR vector correctly. As such, miR-Fzr1_178-199 and miR-Fzr1_307-328 were used for further constitutive studies as described in subsequent sections.

Page | ‐ 84 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

bp LacZ mi-RFzr1 178-199 mi-RFzr1 307-328 mi-RFzr1 693-714

ds t b ds t b ds t b ds 500 400

300

200

100

Figure 3.3 Generation of double stranded miRNA duplexes Complementary single stranded oligos (t = top strand and b = bottom strand) were annealed and assessed using agarose gel electrophoresis. A control reaction using complementary LacZ oligos was performed simultaneously. Double stranded (ds) oligos produced bands corresponding to approximately the 300bp marker of the DNA ladder, about twice the size of each single stranded oligo components.

Page | ‐ 85 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

3.2.4. Optimization of transfection protocol for F9 cells Traditionally, embryonal carcinoma cells, such as F9 cells have been associated with low transfection efficiencies. Recently, the use of liposome-mediated transfection has improved rates from less than 5% to ~20–50% transfection efficiency (Doi et al., 2003; Nowling et al., 2002). To ensure that I was able to achieve maximum transfection rates that would allow for the best assessment of miRNA efficacy, I performed optimization experiments using a standard EGFP-expressing reporter plasmid (pEGFP-N3) and the Lipofectamine LTX/Plus reagent system. To determine the optimal transfection protocol, different quantities of plasmid and transfection reagents were tested as follows (refer to Table 2-1); (1) as per manufacturer’s instructions (‘pre-optimization, Figure 3.4ii), or with (2). a 1.5 fold increase in recommended plasmid concentration (high plasmid; Figure 3.4iii), (3) a 0.5 fold decrease in plasmid concentration (low plasmid; Figure 3.4iv), or lastly (4) a 1.25 fold increase in the recommended transfection reagent concentrations (high reagent, Figure 3.4v).

Transfection efficiency was assessed 48 hours post treatment by observing EGFP expression. Representative fields of view were imaged (Figure 3.4) and quantitative measurements of total fluorescence per field of view were recorded and analysed using Image J software. It was observed that there was no statistical difference in detectable fluorescence of positively transfected cells between pre-optimized (~6%), high plasmid (~5%) and low plasmid (~8%) conditions (Figure 3.5, p>0.05; t-test). The best transfection efficiency was achieved using higher concentrations of transfection reagents (1.25 fold of LTX/Plus reagent volume in comparison to pre-optimization) (~17% and up to 30% transfection efficiency; Figure 3.5, p<0.05; t-test). Despite further optimization attempts, this rate could not be surpassed, however it was deemed sufficient to allow further analysis of Fzr1 knockdown following transfection of miRNA containing plasmids.

Page | ‐ 86 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

Brightfield GFP fluorescence i Control

ii Pre-optimization

iii High plasmid

iv Low plasmid

v High reagent

Figure 3.4 Optimization of F9 cells with pEGFP-N3 using Lipofectamine LTX/Plus

Representative images of F9 cells 48 hours after transfection with pEGFP-N3 and Lipofectamine LTX/Plus reagents. Cells were seeded 24 hours prior at 30x104 cells per 6-well plate. (i) negative control; transfection reagents only; (ii) pre-optimization conditions; transfected with 2500ng of plasmid using 1.67l and 5l of Plus and LTX reagents respectively; (iii) high plasmid; transfected with 1.5 fold greater plasmid than in (ii); (iv).low plasmid; transfected with 0.5 fold less plasmid than in (ii); (v) high transfection reagent; 1.25 fold greater transfection reagents than in (ii). Scale bar, 30m.

Page | ‐ 87 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

25 b (16) 20 a 15 a (7) (10) 10 a (11) 5 Transfected cells (%)

0 pre-op low DNA high DNA high rgt

Figure 3.5 F9 transfection efficiency under conditions of different plasmid and Lipofectamine concentrations Percentage of fluorescent F9 cells for each transfection condition tested. There were no significant differences between pre-optimisation, low plasmid and high plasmid transfections, however, high reagent conditions resulted in significantly better transfection efficiency in comparison to all other conditions. Different letters denotes significant statistical differences (p<0.05, t-test). In parenthesis, the number of frames analysed per condition.

Page | ‐ 88 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

3.2.5. Efficacy of constitutive miRNA knockdown in F9 cells To examine the potency of the Fzr1 constitutive knockdown miRNA sequences (generated in Section 3.2.3), the two targets, miR-Fzr1_178-199 and miR-Fzr1_307-328 were transfected into F9 cells using the protocol optimized in Section 3.2.4 either alone or in combination. A control plasmid pcDNA™6.2-GW/EmGFP-miR-neg control plasmid (Section 9.2.2), containing an insert capable of forming a hairpin structure as would a regular pre-miRNA, with no known vertebrate target gene was inserted in place of the knockdown cassette; was included in each round of transfection as a negative control.

Immunoblotting was used to analyse Fzr1 protein levels 48 hours after transfection. F9 cells transfected with a single plasmid, either miR-Fzr1_178-199 or miR-Fzr1_307-328, had ~40% reduction in Fzr1 protein expression (Figure 3.6). Transfection using miRNAs in combination was no more effective, and in fact resulted in a lower level of Fzr1 knockdown efficiency of only ~20% (Figure 3.6). Even though Fzr1 knockdown was incomplete, however there was a substantial decrease in Fzr1 expression levels and therefore deemed to be sufficient reduction for the miRNA to be tested out in embryos. Since both miR-Fzr1_178-199 and miR-Fzr1_307-328 Fzr1 knockdown plasmids showed similar efficacies, only one was chosen (miR-Fzr1_178-199) at random to be used for subsequent experiments in mouse embryos.

Page | ‐ 89 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

miR- Fzr1_178-199

+ kDa Neg Ctrl miR- miR- miR- plasmid Fzr1_178-199 Fzr1_307-328 Fzr1_307-328 60

Fzr1

Gapdh 38

1.0

0.8

0.6

0.4 Fzr1 ExpressionFzr1 0.2

0.0

9 8 9 2 -1 -3 trl 8 7 7 0 1 3 _ _ r1_307-328 gC r1 r1 e Fz N Fz Fz iR iR miR m 9 9 +m 1 8- 7 r1_1 Fz

miR

Figure 3.6 Immunoblot of Fzr1 expression in transfected F9 cells with knockdown plasmids (A) Fzr1 immunoblot of protein from F9 cells transfected with pcDNA™6.2-GW/EmGFP-miR- neg control plasmid (Neg), miR-Fzr1_178-199, miR-Fzr1_307-328 and a combination of both miR-Fzr1_178- 199 and miR-Fzr1_307-328 respectively. 2.5g of protein was loaded in each lane. Gapdh immunoblot as housekeeping protein loading control (n=2 experimental replicates). (B) Densitometric analysis of (A), normalized to F9 cells transfected with miRNA negative control plasmid.

Page | ‐ 90 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

3.2.6. Efficacy of Fzr1 knockdown in embryos Having identified an miRNA capable of knocking down Fzr1 protein expression in a mouse cell line, I next wanted to investigate Fzr1 knockdown efficacy in embryos. The selected plasmid containing the miRNA was microinjected into fertilized zygotes and developmental stages scored at 24 hour intervals. Since mouse zygotes remain transcriptionally silent until EGA at the 2-cell stage, expression of the miRNA should only occur after this time.

At E0.5, zygotes were isolated from mated females and microinjected with miR-Fzr1_178- 199 plasmid. Controls included were 1) non-injected zygotes (Non), 2) KCl solution; control for microinjection process, and lastly 3) pcDNA™6.2-GW/EmGFP-miR-neg control plasmid; experimental control for the introduction of a foreign plasmid. To verify that successful Fzr1 knockdown had been achieved after miRNA treatment, proteins from 2-cell stage embryos and morulae were immunoblotted for Fzr1 expression (Figure 3.8). Western blot analysis showed embryos injected with negative control plasmid expressed ~65% the level of Fzr1 protein of KCl controls at the 2-cell stage, suggesting that miRNA introduction into zygotes may have some deleterious non-specific effects on the overall rates of translation. This unexpected decrease in Fzr1 may have been a non-specific response due to embryo sensitivity to introduction of foreign plasmid (Page et al., 1995; Winkler et al., 1991).. However as predicted, the 2- cell stage miR-Fzr1178-199 injected embryos contained substantially less Fzr1 protein (~25% of KCl group; Figure 3.8). At the morulae stage, knockdown of Fzr1 appeared less significant in the miRNA treated embryos (~73% level of Fzr1 compared to KCl controls; Figure 3.8), suggesting the effect of miRNA may be short-lived.

Developmental rates of embryos were then further analysed at days 2 and 4 of in vitro culture when controls would have formed 2-cell embryos and morulae respectively. As expected at day 2 of culture, high rates of 2-cell embryo formation were observed in untreated and KCl injected controls (n = 139 and 72; 91% and 86% respectively; p=0.2438, 2-test). There was a slight decrease (n=110, 74%; *, p=0.0293; 2-test) in 2- cell embryo formation of those microinjected with the negative control plasmid, but it was not statistically different to KCl controls. Interestingly, less than 50% of miR- Fzr1_178-199 injected embryos had progressed to the 2-cell stage at the same time point (n = 216; *, p <0.001; 2 test, Figure 3.7).

Page | ‐ 91 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

After 4 days in culture, it was observed that the majority of untreated and KCl microinjected controls had formed morulae (n= 139; untreated embryos, and n= 72; KCl microinjected, 92% in both sample groups; p=1.000; 2-test). As expected from the previous observation at day 2 of culture, a much smaller percentage of miR-Fzr1178-199 injected embryos had formed morulae after 4 days (36%; Figure 3.9, n= 216, p<0.0001, 2-test). Although less miRNA negative control embryos had formed morulae at this time, which was significantly different to both untreated and KCl controls, the rate was still significantly higher than miR-Fzr1178-199 treated embryos (76%, n=110, p<0.0001; 2- test).

Interestingly, it was noted that at day 4 of embryo culture, about 20% of Fzr1 miRNA treated embryos were blocked at the 2-cell stage (Figure 3.9), which was not observed in any of the three control groups (p<0.05, 2 test). In addition, a large proportion (~41%) of miR-Fzr1_178-199 embryos were observed to be dead by day 4 of culture in contrast to the control groups untreated (~7% in non-injected and ~8% in KCl controls). As seen previously during 2-cell stage and morulae formation, embryos injected with the negative control plasmid displayed lowered percentages of development; as such it was not surprising that a slightly higher proportion (~23%) of them in comparison to untreated and KCl controls were dead by day 4 of in vitro culture. Again, this slight decrease in morulae formation in the negative plasmid control group could be due to embryonic sensitivity to the addition of foreign plasmid DNA.

Page | ‐ 92 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

a a (139) b 100 (72) (110) 80 c (216) 60

40 at Day 2 (%) 20 Embryos at 2-cell stage 0 Non KCl Neg miRFzr1178

Figure 3.7 Percentage of embryos developing to the 2-cell stage by Day 2 of culture after miRNA microinjection

After 2 days in culture, untreated and KCl control embryos were at 2-cell stage (p=0.2438;2- test). A small but significant decrease in the percentage of 2-cell embryos was observed following injection of miRNA negative control compared to untreated controls, but not to KCl controls (p=0.0293; 2-test). However a much lower percentage of miR-Fzr1178-199 microinjected embryos (~50%) were at the same developmental stage which was statistically significant compared to all three control groups (p < 0.001; 2-test). Non; untreated controls, KCl; KCl microinjected control, Neg; pcDNA™6.2-GW/EmGFP-miR-neg control plasmid. In parenthesis, number of embryos analysed. Letters denote statistically significant differences.

Page | ‐ 93 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

2-cell Morula kDa KCl Neg miRFzr1178-199 KCl miRFzr1178-199 60 Fzr1

Gapdh 38

3.0

2.5

2.0

1.5

1.0 Fzr1 Expression 0.5

0.0 KCl Neg miRFzr1178-199 KCl miRFzr1178-199 2-cell Morulae

Figure 3.8 Fzr1 constitutive knockdown in embryos (A) Immunoblot of Fzr1 of protein extracted from embryos at the 2-cell stage of KCl injected, pcDNA™6.2-GW/EmGFP-miR-neg control plasmid (Neg) and miR-Fzr1178-199 injected after 2 days in culture; and morulae of KCl control and miR-Fzr1178-199 injected embryos after 4 days in culture. 30 – 80 embryos per lane (n= 2 blots) and immunoblot of Gapdh for protein loading control. (B) Densitometric analysis of 2-cell embryos and morulae in (A), normalized to 2-cell stage KCl controls.

Page | ‐ 94 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

aaa b (139) (72)(110) (216) 100 D42cell 80 D4 mor dead 60

40 Embryos (%) 20

0 Non KCl Neg Ctrl miRFzr1178-199

Figure 3.9 Embryo developmental progression after four days in culture. The majority of untreated (92%), KCl (92%) and miRNA negative (73%) controls formed morulae but only 36% of miR-Fzr1178-199 microinjected embryos were at the same developmental stage after four days in culture. Instead, 22% of miRNA treated embryos were arrested at the 2- cell stage and this was not observed in any of the control groups. In addition, 41% of miR-Fzr1178- 199 treated embryos were found to be dead by day 4 of culture and was found to be statistically different compared to all the control groups (p<0.05, 2 test), in contrast to <10% in untreated and KCl controls and 23% in negative controls. Non; untreated controls, KCl; KCl microinjected control, Neg; pcDNA™6.2-GW/EmGFP-miR-neg control plasmid. Different letters denote statistical significance for embryos arresting at the 2-cell stage after 4 days in culture (p<0.05, 2 test). In parenthesis, number of embryos analysed.

Page | ‐ 95 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

3.3. Discussion The experiments described in this Chapter demonstrated that plasmid injection allowing constitutive miRNA expression could effectively knockdown Fzr1 expression in embryos, resulting in a phenotypic effect. It was therefore a viable option to transfer this expression cassette to a plasmid (pT-REx DEST30 vector) that would allow inducible expression of the miRNA. Although this recombination of the expression cassette into the inducible vector was successfully performed, the logical continuation of this work was not continued due to the availability of Fzr1 knockout mice at the University of Newcastle and as such a different approach could be employed to investigate the role of Fzr1 during preimplantation embryo development.

3.3.1. Fzr1 expression in preimplantation embryogenesis Previous Fzr1 knockout studies had observed normal preimplantation development but were embryonically lethal when foetuses failed to develop past E10.5, therefore establishing that Fzr1 is essential for post-implantation embryo development (García-Higuera et al., 2008; Li et al., 2008). However, in these knockout studies, the contribution of maternal stores of Fzr1 had hindered the investigation of its role during the early stages of embryogenesis. In this current study, knockdown of Fzr1 expression was achieved using a Fzr1-specific miRNA approach to investigate its involvement during preimplantation embryogenesis.

Here, I had successfully characterized the expression profile of Fzr1 protein over the course of preimplantation embryo development. An initial decrease in Fzr1 protein expression was observed in MII eggs and zygotes. This is consistent with previous reports of transcriptional quiescence that oocytes undergo during meiotic maturation followed by rapid degradation of polyadenylated RNA in MII eggs (Bachvarova, 1985; Clegg and Pikó, 1983; Su et al., 2007) and autoubiquitination of APCFzr1 to self-regulate its own activity (Rape and Kirschner, 2004). In addition, measureable levels of Fzr1 had been reported previously in MII eggs following egg activation (Chang et al., 2004), as such the presence of Fzr1 expression in MII eggs was expected. In mice, embryonic genome activation begins at the late 1-cell stage and EGA occurs at the 2-cell stage (Piko and Clegg, 1982; Telford et al., 1990). During this period of EGA, there is rapid degradation of maternal transcripts (Aoki et al., 1997; Flach et al., 1982; Hamatani et al., 2004; Petzoldt et al., 1980; Yu et al., 2001) and loss of total RNA (Bachvarova and De Leon, 1980; Clegg and Piko, 1978; Levey et al., 1978; Olds et al., 1973). As such, this could possibly account for the decrease of Fzr1 protein expression in MII eggs and early mouse embryos.

Page | ‐ 96 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

Fzr1 protein remained at low, but detectable levels following EGA until the 8-cell stage. Interestingly, Fzr1 expression was found to increase at the morulae stage, and by the blastocyst stage, protein levels were comparable to those in MII eggs. Morula formation involves the initiation of compaction in embryo; a process essential for setting up blastocyst formation (Johnson et al., 1986; Johnson and McConnell, 2004). During compaction, blastomeres get polarized and cells are allocated specific locations forming populations of inner and outer cells that would define their differentiative fate to become part of the ICM or the TE. Previous knockout studies of Fzr1 had identified that its loss had resulted in defects in endoreduplication, necessary for TGC formation (García-Higuera et al., 2008; Li et al., 2008). Therefore the increase in levels of Fzr1 protein that I observed at the morulae and blastocyst stage are consistent with a role for Fzr1 in the very early events of placentation. However, protein expression levels on a Western blot are not always a predictor of protein activity, and so the lower Fzr1 protein levels detected prior to the morula stage do not necessarily reflect the importance of Fzr1 in these early stages. Indeed this APC activator does seem important at these stages as shown by Fzr1 miRNA knockdown.

3.3.2. Optimizing transfection and efficacy testing of miRNA in F9 cells In the current study, I was able to validate the efficacy of miRNAs targeted to Fzr1 and demonstrated successful loss of Fzr1 protein in F9 cell line and mouse embryos cultured in vitro. Since the initial stages of Fzr1 miRNA generation were performed in F9 cells, it was necessary to optimise tranfection rate in this cell line so that the efficiency of Fzr1 knockdown could be assessed. A protocol for transfecting F9 cells using Lipofectamine LTX/Plus reagent was optimized and the transfection efficiency was ~30-40%. Previous studies utilizing lipofectamine mediated transfection of siRNA into cells had achieved knockdown percentages ranging between 40 to 60% of gene silencing (Dalby et al., 2004; Zhang et al., 2006; Zhang et al., 2003). It was therefore concluded that an optimized transfection protocol has been established since Fzr1 knockdown efficiency using only one miRNA was comparable to previous knockdown studies that employed a similar technique. As such, only miR-Fzr1178-199 was selected at random for all subsequent knockdown of Fzr1.

Even though there were slight differences in the level of transfection achieved when cells were transfected with pEGFP-N3 and miR-Fzr1178-199 plasmid (~30% vs 40% respectively), this difference could be simply due transfection of different plasmids, and the miRNA vector could have been transfected more efficiently than the pEGFP-N3 plasmid. Other

Page | ‐ 97 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

factors affecting transfection efficiency includes differences in the purity and size of the plasmid used (Kreiss et al., 1999; Weber et al., 1995). Another possibility accounting for the difference in transfection efficiency would be due to the use of different methods for evaluating the efficacy of knockdown (measure of EGFP positive fluorescence for pEGFP- N3 plasmid transfection vs western blot for Fzr1 protein expression after tranfection of miR-Fzr1178-199 plasmid).

3.3.3. Reduced Fzr1 expression resulted in 2-cell arrest in embryos To investigate the role of Fzr1 in early embryos, microinjection of the Fzr1-miRNA knockdown plasmid at the 1-cell stage was used. However, one of the drawbacks of microinjecting plasmids into 1-cell embryos is its expression is not expected to occur until the time of EGA at the 2-cell stage (Henery et al., 1995; Ueno et al., 2008). Therefore, this technique is potentially limited to examining embryos from the 2-cell stage onwards. Furthermore, no early effect was expected, since Fzr1 immunoblot analysis during preimplantation embryo development showed that this protein remains poorly expressed up until the morulae stage. However, despite these concerns, I did observe early effect of Fzr1 knockdown. The low Fzr1 expression during the early stages of embryogenesis although small could still be physiologically significant. Also some transcription is reported to occur in 1-cell embryos, ahead of EGA at the 2-cell stage.

Microinjection of the plasmid containing miR-Fzr1178-199 into zygotes resulted in a smaller proportion of embryos progressing to the 2-cell stage by day 2 of culture. In addition, the injection also caused approximately one-fifth of embryos to remain arrested at the 2-cell stage by day 4 of culture, when they were expected to have progressed to the morula stage, an observation that was not seen in any of the control groups. F1 hybrid embryos do not usually arrest during in vitro development (Biggers and Blandau, 1971; Erbach et al., 1994; Whitten and Biggers, 1968; Whittingham, 1975), unlike other blocking strains of mice such as CF1 (refer to 1.2.3)(Biggers and Blandau, 1971; Cross and Brinster, 1973; Whitten, 1957; Whittingham, 1975). In addition, several embryo culture media such as CZB, SOM and KSOM have been demonstrated to successfully sustain blastocyst formation during in vitro embryo culture, overcoming the conventional 2-cell block (Chatot et al., 1989; Lawitts and Biggers, 1991; Lawitts and Biggers, 1993). As such, the use of F1 hybrids and a non-blocking medium, KSOM in the present study was not expected to result in any 2- cell arrest.

Page | ‐ 98 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

The loss of Fzr1 function could possibly interfere with early cleavage divisions in preimplantation embryo development. APCFzr1 activity has been shown to mediate cell cycle progression by regulating mitotic exit and G1 maintenance (refer to Section 1.4)(Kramer et al., 2000; Peters, 2006) and is crucial during G1/S transition. This is because proteins synthesized during G1/S/G2 phases of the cell cycle would have to be timely eliminated. Degradation fo these mitotic cyclins and cell cycle regulators have been found to be targeted for degradation by APCFzr1 (refer to Sections 1.4.3 and 1.5.1). Overexpression of Fzr1 has been demonstrated to delay S-phase onset in human cells (Sorensen et al., 2000) while its loss promoted premature S-phase entry in both MEFs and human cell lines (Sigl et al., 2009). Therefore, the loss of Fzr1 in the embryos could possibly lead to dysregulated mitotic protein expression and consequently interfere with S- phase progression, resulting in arrest of 2-cell stage embryos. This observation was not too unsurprising because previous studies performed in mouse embryonic fibroblast (MEFs) and human cell lines had also observed that loss of Fzr1 resulted in cells experiencing difficulties with cell cycle progression, such as defects during cytokinesis and chromosome separation, leading to chromosomal aberrations as well as premature entry into senescence (Engelbert et al., 2007; García-Higuera et al., 2008; Li et al., 2008). Further analysis, such as 5-bromo-2-deoxyuridine (BrdU) assay, fluorescence activated cell sorting (FACS) of disaggregated blastomeres or immunohistochemistry are needed to identify which stage of the cell cycle miR-Fzr1_178-199 injected embryos are arresting at, to provide some indication of what the resultant defect might be due to loss of Fzr1.

Since miR-Fzr1178-199 treated embryos were arresting at the 2-cell stage, coinciding with the time of EGA, this could possibly suggest an important role for Fzr1 during this period. To further investigate this, the use of the inducible Fzr1 knockdown plasmid would provide an opportunity to contrast the loss of Fzr1 after the event of EGA with my current observations.

3.3.4. Incomplete Fzr1 knockdown in embryos Since less than half of miRNA treated embryos successfully formed 2-cell embryos by day 2 of culture and ~25% of them had remained arrested at the 2-cell stage after 4 days, it was not surprising that only a third formed morulae, as compared to > 75% in all control groups. Since knockdown efficiency is not always consistent between embryos, it was predicted that those with greater levels of Fzr1 knockdown were the ones that remained arrest at the 2-cell stage, while those with lesser knockdown continued developing to form morulae by

Page | ‐ 99 ‐

Chapter 3 Fzr1 knockdown using miRNA plasmid

day 4 of culture. In support of this, Western blot analysis performed on miR-Fzr1178-199 morulae showed lesser knockdown was achieved in these miRNA treated morulae as compared to those that were arrested at the 2-cell stage as compared to KCl controls. Although, an alternative explanation may be the knockdown effect is very transient. Since the level of Fzr1 knockdown in individual blastomeres and embryos cannot be assessed, and with knockdown efficiency likely to have a confounding influence on the severity of the phenotype observed, the involvement of Fzr1 during early embryogenesis cannot be conclusively drawn. In spite of incomplete Fzr1 knockdown in embryos, observations made from this current study provide some insight into the possible involvement of Fzr1 during preimplantation embryo development, resulting in their arrest at the 2-cell stage. This is in contrast to previous Fzr1 knockout studies, where normal preimplantation embryo development was observed, possibly due to the presence of maternal Fzr1 contribution (García-Higuera et al., 2008; Li et al., 2008). Therefore, I conclude from the above observations here, seems to suggest that Fzr1 may have an important function during the earliest stages of cleavage stage embryos.

Even though complete Fzr1 knockdown cannot be achieved by plamid constitutively expressing miRNA the use of an inducible Fzr1 knockdown plasmid may provide an opportunity to activate the RNAi at various time points allowing for temporal studies during embryogenesis. The CMV promoter would allow efficient and high-level expression of the plasmid and the GFP marker would enable visualization of when the miRNA has been translated while the tetracycline operator would serve as binding sites for the antibiotic added to activate gene repression.

At the time of completion of these studies in this Chapter, access to an oocyte-specific Fzr1 knockout became available. Since observations from Fzr1 knockdown using the miRNA plasmid suggested its possible involvement as early as the 2-cell stage, the use of the Fzr1 knockout mouse may help confirm this by a cleaner approach. The knockout would not have to be microinjected to achieve gene silencing and there would be the advantage of achieving complete Fzr1 loss in the embryos, which is unlikely to be attained by using the vector-based knockdown. As such, further preimplantation embryo development studies were conducted in the absence of maternal Fzr1 contribution using the Fzr1 knockout and would be discussed in the following chapters to elucidate its role during this period.

Page | ‐ 100 ‐

Chapter 4 Involvement of Fzr1 in meiosis

4. Fzr1 in Meiosis

4.1. Introduction Knockout mice have become a widely used tool for investigating specific gene function in recent years. Such mice are genetically engineered whereby an existing gene in the genome is replaced or disrupted resulting in loss of gene function. Phenotypic examination of the knockout mouse can subsequently infer the probable role of the gene product.

Knockout mouse technology presents an invaluable tool because humans and mice share many genes, there are however limitations. The gene of interest could have an essential cellular role and therefore deficiency or loss of function of the gene may be developmentally or embryonically lethal. The inability to develop into an adult knockout mouse poses numerous restrictions upon a study, limiting it possibly to early embryonic development or pre-implantation development only. This would inherently make it more challenging to accurately determine a gene’s function.

Over the years, many oocyte-specific knock-out mice had been created, such as Factor in the germline (Figla)(Soyal et al., 2000), zona pellucida 1 (Zp1)(Rankin et al., 1999), zona pellucida 2 (Zp2)(rankin 2001), zona pellucida 3 (Zp3)(Liu et al., 1996; Rankin et al., 1996), growth differentiation factor 9 (Gdf9)(Dong 1996), bone morphogenetic protein 15 (Bmp15)(Yan et al., 2001), Mos (Colledge et al., 1994; Hashimoto et al., 1994), maternal antigen that embryos require (Mater)(Tong et al., 2000), glycosylphosphastidylinositol (GPI) -anchored proteins (Alfieri et al., 2003) and Foxo3 (Liu et al., 2007). These models are examples of non-conditional knockout of oocyte specific genes. However the use of an oocyte-specific gene promoter to drive Cre-recombinase to allow for examination has become a well-established method of studying aspects of oocyte development.

To overcome embryonic lethality, conditional knockouts can be created using Cre/loxP homologous recombination technology (Gu et al., 1994; Sauer and Henderson, 1989). In this system, expression of transgenic Cre-recombinase is driven by a cell-specific promoter, resulting in the deletion of the gene in the desired tissue. Bacteriophase P1-derived Cre- recombinase enzyme recognises loxP sites that have been targeted to flank an important segment (usually a coding region) within the gene of interest thus allowing excision of the segment.

The creation of a floxed mouse itself does not usually affect gene expression, thereby avoiding embryonic lethality (Dragatsis and Zeitlin, 2001; Gu et al., 1994; Hennet et al., Page | ‐ 101 ‐

Chapter 4 Involvement of Fzr1 in meiosis

1995; Lee et al., 2008; Sakai et al., 2001; Shibata et al., 1997; Terry et al., 1997). The loxP sites are introduced into mouse embryonic stem (ES) cells either by pronuclear injection of the fertilized egg or when an artificial piece of homologous DNA targeted to the chromosome is introduced into the cell by transfection or nuclear microinjection. Since pluripotent ES cells from mouse embryos have the capacity to differentiate into nearly any adult cell type (Beddington and Robertson, 1989; Loh and Lim, 2011; Loh et al., 2006), recombinants can then be injected back into a normal developing mouse embryo before being transferred back into a foster mother. Transmission is achieved through the germ line and is then bred for several generations to derive the homozygous knockout mouse.

Since the creation of knockout mice using the Cre/loxP technology can be tissue specific, it has thus become an excellent tool for generating specific deletion of oocyte genes. This in turn enabled the study of folliculogenesis, oogenesis and preimplantation embryonic development. As oocytes progress in the follicular environment, maturing during oogenesis and during embryo development, there are a variety of genes that are expressed by oocytes as it progresses in the follicular environment, as it matures during oogenesis and during embryo development (Lan et al., 2003b; Matzuk et al., 2002; Rajkovic and Matzuk, 2002; Varani and Matzuk, 2002), however, the expression of many of these genes are not oocyte specific (Fitzpatrick et al., 1998; Fuhrmann et al., 2001; Lan et al., 2003a). In addition, as the oocyte develops, it also expresses particular genes specific to that stage, which would then act to be an excellent promoter of the Cre-recombinase for that particular stage.

There is significant choice in the promoter chosen to drive the expression of the Cre- recombinase. For example, several Cre transgenic mouse lines have been created driven by either the Zp3 or homeobox gene Msx2 promoter (de Vries et al., 2000; Sun et al., 2000). In mammals, growing oocytes, ovulated eggs and early embryos are surrounded by an extracellular matrix known as the zona pellucida (ZP). Three forms of ZP glycoproteins have been identified in mice; ZP1, ZP2 and ZP3 (Bleil and Wassarman, 1980). In mice, ZP3 has been observed to be expressed only in oocytes during the growing phase (Epifano et al., 1995). While Msx2-Cre will drive recombinase activity only in preantral follicles, GDF-9- Cre can initiate recombinase activity in primordial follicles (Lan et al., 2004).It has been reported that Cre-recombinase activity driven by the ZP3 promoter has only been shown to be expressed during the primary and late follicular stages (de Vries et al., 2000; Lan et al., 2003b).

Page | ‐ 102 ‐

Chapter 4 Involvement of Fzr1 in meiosis

Previously, studies have been carried out to investigate the role of Fzr1 function in oocytes using anti-sense morpholino technology (Brunet et al., 2008; Homer et al., 2009; Reis et al., 2006; Schindler and Schultz, 2009). However, since knockdown is rarely complete, the residual expression of the protein may have interfered with the results observed. Complete knockout of Fzr1 in mice has failed to produce viable pups (García-Higuera et al., 2008; Li et al., 2008) and in order to proceed with further study of this protein in embryos, it was essential to establish a conditional knockout system that targets only the gametes. Here, by crossing floxed Fzr1 (Fzr1fl/fl) and ZP3-Cre mice, an oocyte-specific knockout model of Fzr1 was created (García-Higuera et al., 2008). In the resulting Fzr1fl/fl / Zp3-Cre+/T (Fzr1-/-) progeny, Cre-recombinase is driven by the oocyte-specific ZP3 promoter, therefore providing a source of fully grown oocytes lacking Fzr1 protein (de Vries et al., 2000; Lan et al., 2004). Whereas crossing the flox Fzr1 mouse with an MVH-Cre mouse, generates a sperm-specific knockout model. DEAD(Asp-Glu-Ala-Asp) box polypeptide 4 (Ddx4, also known as MVH), is a male primordial germ cel marker. However, in this model, there was block during spermatogenesis and as such knockout males were infertile, making it impossible to mate Fzr1 null males and females to generate embryos devoid of Fzr1 stores.

Page | ‐ 103 ‐

Chapter 4 Involvement of Fzr1 in meiosis

4.2. Results

4.2.1. Creation of an oocyte specific knock-out of Fzr1 To create Fzr1-/- mice, Fzr1fl/fl females were crossed with ZP3Cre [C57BL/6-Tg(Zp3- cre)93Knw] males. Male F1 offsprings with genotype of Fzr1+/fl/ZP3Cre were then mated with Fzr1fl/fl females to generate Fzr1 oocyte-specific knockout (Fzr1-/-) and control (Fzr1fl/fl) littermates (Holt et al., 2011). For details of Fzr1 knockout mouse generation refer to Section 2.1.3.

To confirm successful loss of Fzr1 protein in GV oocytes of the knockout model, oocytes from Fzr1-/-, Fzr1fl/fl and Fzr1+/+ mice were isolated and immunoblotted using an antibody raised against Fzr1 (Holt et al., 2011). Fzr1 protein levels were readily detectable in the 50 GV oocytes from Fzr1fl/fl and Fzr1+/+ mice but were negligible in Fzr1-/- mice (Figure 4.1A). Densitometric analysis of the immunoblot confirmed that Fzr1fl/fl mice contained similar levels of Fzr1 protein to wild-type Fzr1+/+ and were therefore used as controls for all further experiments. It was also concluded that complete Fzr1 knockout was successfully achieved using ZP3 driven Cre-recombinase activity (Figure 4.1B).

4.2.2. Isolation and examination of MII eggs from Fzr1-/- mice It has previously been shown that Fzr1 is crucial for the maintenance of GV arrest in fully grown mouse oocytes (Holt et al., 2011; Reis et al., 2006). However, loss of Fzr1 expression has also been shown to result in premature chromosomal segregation and non- disjunction during MI (Reis et al., 2007). Therefore, to determine whether Fzr1 is required for the subsequent progression of meiosis following GVBD; marking the resumption of MI until MII arrest, female mice were hormonally stimulated and oviducts were examined for the presence of MII eggs.

Morphologically normal MII eggs could be isolated from Fzr1-/- mice as assessed by the presence of a first polar body (Figure 4.2A). This indicates that Fzr1 does not play an essential role in the completion of MI. The number of MII eggs ovulated by Fzr1-/- mice were almost half of those in Fzr1fl/fl mice (12.6 ± 7.6 vs 24.6 ± 8.7 per female; n = 10 for each genotype; *, p = 0.03; 2 test, Figure 4.2B). However, a previous report examining this mouse model showed there was a 40% decrease of GV oocytes present in Fzr1-/- mice caused by premature GVBD (Holt et al., 2011), which would therefore account for the fewer number of MII eggs obtained in the current study.

Page | ‐ 104 ‐

Chapter 4 Involvement of Fzr1 in meiosis

Fifty MII eggs were isolated from either Fzr1fl/fl or Fzr1-/- females and immunoblotted for levels of Fzr1 protein expression. Densitometric analysis of Fzr1fl/fl samples revealed that there was a 55% decrease in Fzr1 protein levels in MII eggs compared with GV oocytes (Figure 4.1 and Figure 4.3). Similar to the GV oocyte immunoblot (Figure 4.1), MII eggs isolated from Fzr1-/- females did not have readily detectable Fzr1 signal (Figure 4.3), confirming the complete loss of Fzr1 protein in ovulated eggs following Cre-mediated recombination of the floxed Fzr1 alleles in growing oocytes.

Page | ‐ 105 ‐

Chapter 4 Involvement of Fzr1 in meiosis

GV kDa fl/fl -/- 60 FZR1 50

Gapdh 38

1.0

0.8

0.6

0.4

FZR1 Expression 0.2

0.0 fl/fl -/-

Figure 4.1 Western blot of Fzr1 expression in GV oocytes of Fzr1fl/fl and Fzr1-/- mice (A) Fzr1 immunoblot in GV oocytes from Fzr1fl/fl and Fzr1-/- mice; 50 oocytes per lane. Gapdh expression was used as a control from protein loading (n = 4 blots). (B) Densitometric analysis of (A), normalized to Fzr1fl/fl GV oocytes.

Page | ‐ 106 ‐

Chapter 4 Involvement of Fzr1 in meiosis

A B * p=0.03 i fl/fl 40 (10)

(10) 20 ii -/-

10 Number of MII Eggs / mouse

0 fl/fl -/-

Figure 4.2 Number of MII eggs isolated from Fzr1-/- females. (A) Brightfield images of ovulated MII eggs from (i) Fzr1fl/fl and (ii) Fzr1-/- females. (B) MII egg numbers from hormonally primed and superovulated Fzr1fl/fl and Fzr1-/- mice (*, p = 0.03; t- test). In parenthesis, number of mice analysed. Scale bar, (A) 10m.

Page | ‐ 107 ‐

Chapter 4 Involvement of Fzr1 in meiosis

MII kDa fl/fl -/- 60 FZR1 50

Gapdh 38

1.0

0.8

0.6

0.4

FZR1 Expression 0.2

0.0 fl/fl -/- Figure 4.3 Immunoblot of Fzr1 expression in MII eggs isolated from Fzr1-/- mice (A) Immunoblot of Fzr1 in MII eggs from Fzr1fl/fl and Fzr1-/- mice; 50 eggs per lane. Gapdh expression was used as a control for protein loading (n = 4 blots). (B) Densitometric analysis of (A), normalized to Fzr1fl/fl GV oocytes in Figure 4.1.

Page | ‐ 108 ‐

Chapter 4 Involvement of Fzr1 in meiosis

4.2.3. Low aneuploid rates and smaller spindle formation from MII eggs isolated from Fzr1-/- female mice Although morphologically normal MII eggs could be isolated from Fzr1-/- mice (Section 4.2.2), it was however not obvious if these eggs were viable. Therefore, two parameters were examined to determine the quality of these MII eggs. Firstly, their rate of aneuploidy and secondly, the structure of the formation of meiotic spindle and arrangement of the chromosomes on the metaphase II plate.

Formation of a meiotic spindle is essential for the completion of the second meiotic division by ensuring correct chromosome segregation and so establishment of a diploid embryo following fertilization. To determine if MII spindles formed normally in the absence of Fzr1, MII eggs isolated from Fzr1-/- mice were immunostained against tubulin and chromatin. Both Fzr1fl/fl and Fzr1-/- MII eggs possessed anastral barrel-shaped spindles, and there were no gross differences in the alignment of congressed sister chromatids on the metaphase plate (Figure 4.4A). However, apical (pole-to-pole) and equatorial lengths of the Fzr1-/- spindles were markedly decreased compared with Fzr1fl/fl eggs (*, p <0.01; student t- test; Figure 4.4B). These data suggest that MII spindle formation may be perturbed in the absence of Fzr1, but this does not translate into loss of chromosomal alignment.

It has previously been observed that a loss of APCFzr1 activity during in vitro maturation resulted in a significant increase in aneuploidy rates (Reis et al., 2006). Since high aneuploidy rates would predispose embryos to poor developmental outcomes, it was therefore necessary to evaluate the aneuploidy rates of in vitro matured MII eggs isolated from Fzr1-/- mice. Using a monastrol-based in situ technique to spread chromosomes (Figure 4.5A), sister kinetochores of MII eggs were immunostained against the CREST epitope (Duncan et al., 2009; Spruck et al., 2003). There was a slight increase in aneuploid MII eggs isolated from Fzr1-/- mice (11% versus 4%, n = 73 and 72 respectively). However this was not high enough to reach statistical significance (n.s., p = 0.11; 2 test; Figure 4.5B).

Page | ‐ 109 ‐

Chapter 4 Involvement of Fzr1 in meiosis

A B * * p <0.01 p<0.01

(8) i fl/fl 20 (7)

15 (8) m)

 (7) 10 ii -/- Length ( 5

0 fl/fl -/- fl/fl -/- apical equatorial

Figure 4.4 Chromosomal alignment and MII spindle measurements in Fzr1-/- mice (A) Representative confocal Z-projection images of spindle and chromosome assembly in (i) Fzr1fl/fl and (ii) Fzr1-/- eggs. Hoechst, stains chromosomes (blue), microtubules were immunolabelled with anti-tubulin antibody (grey). (B) Meiotic spindle lengths in Fzr1fl/fl and Fzr1-/- MII eggs. Apical (green dotted line) and equatorial (red dotted line)(*, apical; p < 0.01 and equatorial; p < 0.01; t-test). In parenthesis, number of eggs analysed. Scale bar, (A) 5m.

Page | ‐ 110 ‐

Chapter 4 Involvement of Fzr1 in meiosis

Chromatin CREST Merge

i ii iii

B n.s. 100

40 Aneuploid eggs (%)

20 (73) (72) 0 fl/fl -/-

Figure 4.5 Assessment of aneuploidy rates in MII eggs of Fzr1-/- mice by monastrol chromosome spread (A) Representative confocal Z-projection images of an MII eggs after monastrol spread. (i) Hoechst (blue) labels chromosomes, (ii) CREST (red) labels kinetochores and (iii) overlay of Hoechst and CREST images. (B) Aneuploidy rates in Fzr1fl/fl and Fzr1-/- MII eggs (n.s., p = 0.11; 2 test). In parenthesis, number of eggs analysed. Scale bar, (A) 5m.

Page | ‐ 111 ‐

Chapter 4 Involvement of Fzr1 in meiosis

4.2.4. Viable offspring are produced in the absence of maternal Fzr1 stores To determine if maternal stores of Fzr1 were necessary for fertilization and proper embryo development, Fzr1-/- female mice or their littermate controls were pair-mated with wild- type C57/BL6 males for a period of 6 months. Recording of the cumulative number of pups born to Fzr1fl/fl and Fzr1-/- females, showed that loss of Fzr1 in their eggs did not affect their ability to conceive and produce pups (Figure 4.6A). All the pups thrived and appeared healthy until at least three days after birth when culled.

The number of days between litters was similar for control and Fzr1-/- mice (23.16 ± 4.67 vs 23.64 ± 5.74 days, n = 43 and 44 respectively; n.s., p = 0.62; student t-test; Figure 4.6B). The litter size from Fzr1-/- females were significantly smaller than Fzr1fl/fl females (Fzr1-/-; 6.78 ± 2.60 pups, n = 49 versus Fzr1fl/fl; 8.10 ± 2.72 pup, n = 51; *, p = 0.02; student t-test; Figure 4.7). However, this is consistent with the reduced number of MII eggs that were collected from hormonally stimulated mice (Figure 4.3).

Based on the observations that Fzr1-/- females were fertile when mated to wild-type males, it was concluded that proper embryo implantation and development is not dependent upon maternal Fzr1, and instead paternal Fzr1 is sufficient. Together, the results discussed so far indicated that Fzr1 is not essential for the completion of meiosis after release from GV arrest, or at least in a subset of healthy oocytes, fertilization or embryo development.

Page | ‐ 112 ‐

Chapter 4 Involvement of Fzr1 in meiosis

80 fl/fl -/- 70

Cumulative No. of Pups 20

0 0 50 100 150 200 250 Days

n.s. 30

(43) (44)

10 Days Between Litters

0 fl/fl -/-

Figure 4.6 Pup numbers and days between litters in Fzr1fl/fl and Fzr1-/- mice (A) Cumulative number of pups born to Fzr1fl/fl and Fzr1-/- females mated with wild-type males. (B) Days between successive litters for each female mouse (n.s., p=0.62; t-test). In parenthesis, number of litters analysed. 6 females of each genotype were examined.

Page | ‐ 113 ‐

Chapter 4 Involvement of Fzr1 in meiosis

* 10 (6) 8 (6)

4 Litter size

0 fl/fl -/-

Figure 4.7 Litter size of Fzr1fl/fl and Fzr1-/- mice Litter sizes per Fzr1fl/fl and Fzr1-/- mouse mated with wild-type C57/BL6 males (*, p=0.02; t- test). Averaged of 49 Fzr1fl/fl and 51 Fzr1-/- cumulative litters were examined. In parenthesis, number of females analysed.

Page | ‐ 114 ‐

Chapter 4 Involvement of Fzr1 in meiosis

4.3. Discussion Previous attempts to reduce Fzr1 protein levels in oocytes have used a Fzr1 anti-sense morpholino to achieve the loss of approximately 90% of Fzr1 protein (Reis et al., 2006). In the previous chapter (3-Fzr1 Knockdown Study in F9 cells and Embryos), Fzr1 knockdown through microinjection of an shRNA plasmid achieved approximately 50% gene silencing. Therefore, the use of the Cre/Lox technology is by far the most effective method to obtain Fzr1 protein loss in fully grown mouse oocytes. Here, using the oocyte-specific Fzr1 knockout mouse model, I was able to address whether Fzr1 was necessary for meiotic maturation of oocytes in vivo by examining eggs isolated from superovulated Fzr1-/- females. By mating Fzr1-/- females to wild-type males, I was able to determine that Fzr1 was in fact not essential for either MI or MII. In addition, the generation of viable pups from mating Fzr1-/- females also indicated that maternal Fzr1 was not essential for embryo development.

4.3.1. Fzr1 is important for maintaining GV arrest Fzr1 has previously been shown to be involved in maintaining prophase I arrest in fully grown GV oocytes from antral follicles (Holt et al., 2011; Homer et al., 2009; Marangos et al., 2007; Reis et al., 2006; Schindler and Schultz, 2009; Yamamuro et al., 2008). The function of Fzr1 during GV arrest is primarily to limit cyclin B1 accumulation (Reis et al., 2006). The absence of Fzr1 activity in oocytes consequently led to a 5-fold increase in cyclin B1 protein level, which promoted high Cdk1 activity resulting in precocious GVBD in oocyte-specific Fzr1 knockout mice (Holt et al., 2011). However, Cdk1 activation is not only dependent on control by cyclin B1 in the follicular environment. A cAMP-mediated pathway also acts to dampen premature Cdk1 activity (Mehlmann, 2005; Solc et al., 2010; Sun et al., 2009), and as such, even though there is a rise in cyclin B1 levels in Fzr1-/- mice, 60% of oocytes remain GV arrested (Holt et al., 2011).

4.3.2. Loss of Fzr1 does not affect in vivo matured Fzr1-/- egg In addition to measurable Fzr1 activity in maintaining GV arrest as described in section 4.3.1 (Holt et al., 2011; Marangos et al., 2007; Reis et al., 2006; Schindler and Schultz, 2009; Yamamuro et al., 2008), APCFzr1 activity has also been demonstrated to be present at prometaphase I during meiotic maturation by regulating BubR1, a spindle assemble checkpoint (SAC) protein and Cdc20 activity to prevent non-disjunction in oocytes (Homer et al., 2009; Reis et al., 2007). It was reported that loss of Fzr1 activity by antisense morpholino knockdown had resulted in accelerated MI progression due to Cdc20 stabilization, bringing forward cyclin B1 degradation even though homolog congression Page | ‐ 115 ‐

Chapter 4 Involvement of Fzr1 in meiosis

was not achieved. This consequently led to premature segregation and non-disjunction of chromosomes (Reis et al., 2007). Recently, accelerated MI progression resulting in chromosomal non-disjunction was also reported in the oocyte-specific Fzr1 knockout mouse. In the absence of Fzr1, earlier bipolar spindle assembly was observed, resulting in stabilization of Cdc20 activity and the early onset of SAC satisfaction that brought forward cyclin B1 degradation. Hence, even though bivalent congression was not achieved, chromosome separation still occurred resulting in non-disjunction in the mouse oocytes (Holt et al., 2012). As such, two important roles of Fzr1 during meiosis have been identified; to maintain prophase I arrest and to regulate prometaphase progression to prevent chromosomal non-disjunction. Although Fzr1 has been found to be involved in meiotic progression following GVBD in vitro (Holt et al., 2011; Reis et al., 2007), it is still unknown whether Fzr1 has a role during the same process in vivo.

It was observed in control Fzr1fl/fl mice that levels of Fzr1 protein were 55% lower in MII eggs compared to GV oocytes. This could possibly be the result of an auto-ubiquitylation degradation pathway because Fzr1 has been reported to be a substrate of APCFzr1 itself in a variety of somatic cell lines (Benmaamar and Pagano, 2005; Listovsky et al., 2004). In addition, there has been a report observing decreased rates of Fzr1 translation in maturing oocytes (Chen et al., 2011). As such, my current observations of decreased Fzr1 expression in MII eggs as compared to GV oocytes are consistent with these previous reports of reduced APCFzr1 expression during oocyte maturation. In this study, morphologically normal MII eggs could also be isolated from Fzr1-/- females and therefore proved that loss of Fzr1 did not negatively impact oocyte maturation to form MII eggs in vivo.

4.3.3. Loss of Fzr1 has small but significant effect on spindle formation but not aneuploidy rates in MII eggs in vivo The loss of Fzr1 did not prevent the generation of morphologically normal MII eggs. Chromatids aligned along the metaphase plate, even though there were minor differences such as; shorter and narrower spindles were observed when compared to control Fzr1fl/fl MII eggs. During the cell cycle, proper chromosomal attachments to microtubules are monitored by the SAC to ensure chromosome segregation fidelity, and APC activity is usually inhibited by SAC until correct chromosome attachments have been achieved and the cell is ready for anaphase onset (Brunet et al., 2008; Hached et al., 2011; Homer et al., 2005). Previous reports have implicated Fzr1 in spindle formation (Holt et al., 2012; Schindler and Schultz, 2009), while loss of Cdc14B, a phosphatase that counteracts Cdk

Page | ‐ 116 ‐

Chapter 4 Involvement of Fzr1 in meiosis

activity resulted in reduced Fzr1 expression, which led to aberrant spindle formation during egg maturation (Schindler and Schultz, 2009). In a separate study using the oocyte-specific knockout model, Fzr1-/- oocyte spindles were observed to assemble and elongate earlier than controls due to earlier dissociation of the SAC protein, MAD2 from kinetochores resulting in SAC satisfaction (Holt et al., 2012). In light of these previous observations, it was not surprising that there were minor differences in the MII spindle measurements of Fzr1-/- eggs. However, chromosome congression did not seem to be affected in any of the Fzr1-/- eggs. To further investigate whether these small differences observed in Fzr1-/- spindle formation had any detrimental effects to chromosomal alignment, aneuploidy rates were assessed.

Since spindle formation would directly affect chromosomal alignment and segregation (Holt et al., 2012), the difference in spindle measurements observed in Fzr1-/- MII eggs may increase the possibility of aneuploidy rates in these eggs. In addition, loss of APCFzr1 activity has been associated with increased aneuploidy rate during in vitro oocyte maturation (Holt et al., 2012; Reis et al., 2007). This raises the possibility that Fzr1 targets important regulators of homolog segregation in meiosis I. The availability of this Fzr1 knockout model therefore enable for the examination of whether healthy MII eggs could be ovulated following in vivo maturation by these females. When oocytes were allowed to mature in Fzr1-/- females, only a small increase in egg aneuploidy incidence was observed and this was found not to be statistically significant when compared to controls. Therefore, it can be concluded that even though the loss of Fzr1 activity may result in increased aneuploidy rates in oocytes matured in vitro, absence of Fzr1 was found to not have a significant impact on in vivo matured oocytes. Therefore, this suggests that the presence of granulosa cells during in vivo maturation could possibly offer some level of protection against aneuploidy in the absence of Fzr1.

The involvment of granulosa cell-oocyte communication has been found to important for meiotic completion (Matzuk et al., 2002). In the mouse, small and meiotically incompetent GV oocytes, when denuded were observed to remain arrested during in vitro culture (Hirao et al., 1993; Sorensen and Wassarman, 1976). Furthermore, it has been reported that Fzr1-/- oocytes surrounded by the cumulus cells remained at the GV arrested stage, however, when these meiotically incompetent oocytes were denuded and cultured in vitro, a proportion of them were observed to undergo spontaneous GVBD (Holt et al., 2011). In addition, defects in the regulatory mechanism between granulosa cells and oocyte had been implicated with poor oocyte quality, and will not be able to produce a viable embryo (Eppig et al., 1997). Page | ‐ 117 ‐

Chapter 4 Involvement of Fzr1 in meiosis

As such, the preservation of granulosa cells during in vivo matured MII eggs of Fzr1-/- mouse might have prevented the exacerbation of aneuploidy incidence in the absence of Fzr1. However, this interesting phenomenon requires further investigation. Additionally, environmental and culturing conditions have also been known to exert various effects on oocytes and embryos in vitro, hence could also provide some evidence between the discrepancies observed between in vivo and in vitro phenotypes observed due to the absence of Fzr1.

The slightly narrower and shorter formation of the meiotic spindles could probably account at least in part for the increase in aneuploid rate observed in Fzr1-/- eggs. However, these minor differences in spindle structure did not seem to have any deleterious effect, and normal chromosome alignment was still observed, suggesting that Fzr1 is not essential for proper spindle assembly.

4.3.4. Maternal Fzr1 in fully grown oocytes is not essential for meiotic completion and embryo development Viable pups were produced when Fzr1-/- females were mated with wild-type males. This provided further evidence that eggs produced by Fzr1-/- females were healthy. Fzr1 activity has previously been reported to maintain GV arrest (Holt et al., 2011; Marangos et al., 2007; Reis et al., 2006; Schindler and Schultz, 2009; Yamamuro et al., 2008), prometaphase of meiotic maturation (Homer et al., 2009; Reis et al., 2007) and at fertilization; between the period of second polar body extrusion and pronucleus formation (Chang et al., 2004). However, since viable pups could be produced in the absence of Fzr1 during these periods of time in Fzr1-/- females, this suggests that Fzr1 does not have an essential role in these processes in vivo. As such, these observations may probably reflect a similar situation during mitotic exit of somatic cells, whereby measurable of Fzr1 activity had been detected during anaphase onset (Hagting et al., 2002; Lindon and Pines, 2004) but was found to be non-essential (Engelbert et al., 2007; Floyd et al., 2008; Sigl et al., 2009).

APCFzr1 activity has been reported at fertilization following second polar body extrusion until the time of pronuclear formation (Chang et al., 2004). In this current study, the generation of viable pups from Fzr1-/- females from natural mating with normal males has also shown that maternal Fzr1 store was not essential for embryo development and paternal Fzr1 contribution was sufficient for sustaining embryogenesis. Maternal effect genes are as suggested by its name, genes that are contributed maternally that influences embryo development. This is of importance especially in early development when embryos are Page | ‐ 118 ‐

Chapter 4 Involvement of Fzr1 in meiosis

transcriptionally silent and are heavily dependent on maternal products for growth (Li et al., 2010; Tashiro et al., 2010). Several maternal effect genes have been identified and were found to be essential for embryo development which cannot be rescued by paternal alleles (Howell et al., 2001; Ma et al., 2006; Tong et al., 2000; Wu et al., 2003; Zheng and Dean, 2009). Here, the generation of healthy pups from Fzr1-/- females mated with wild-type males has also proved that Fzr1 is not a maternal effect gene because absence of Fzr1 contribution from the mother did not affect embryo development.

The next question to be addressed following on from observations in this Chapter is whether embryogenesis would occur in the absence of bother maternal and paternal Fzr1. This can be investigated by the creation of parthenotes from eggs collected from Fzr1-/- females, in which no parental Fzr1 expression would be present. However, before this can be investigated, conditions for parthenogenesis and embryo culture would have to be determined and optimized and will therefore form the basis of the next chapter.

Page | ‐ 119 ‐

Chapter 5 Embryo culture and media

5. Embryo Culture and Media

5.1. Introduction The mouse has been a well-recognized animal for experimental studies in biomedical research for many years. Here, the focus will fall on in vitro embryo development where since the mid-1950s, the first chemically defined media was formulated for embryo culture (Whitten, 1957). With respect to mammalian embryo development, there have been reports of delays in cleavage stage development (Bowman and McLaren, 1970a; Harlow and Quinn, 1982), strain specific embryonic blocks, such as SJL/L, C57BL/10J, 129/Rr and DBA (Biggers, 1971; Biggers and Blandau, 1971; Biggers, 1998; Goddard and Pratt, 1983; Whitten, 1957; Whitten and Biggers, 1968; Whittingham, 1975) and reduction in embryo viability (Lane and Gardner, 1992). As such, there has been a need to formulate a medium that would be able to sustain in vitro preimplantation embryonic growth.

Culture of preimplantation embryos was initially performed using a simple balanced salt solution and carbohydrates, modified from Krebs-Ringer bicarbonate solution supplemented with glucose and BSA (Whittingham, 1971). It was later discovered that embryos of various species during cleavage stages have limited capacity to utilize glucose as an energy reserve (Biggers et al., 1967; Conaghan et al., 1993; Spindle and Pedersen, 1973). Instead pyruvate, lactate and amino acids were preferred sources of energy and so media formulations were modified to reflect this fact (Biggers et al., 1967; Brinster, 1965a; Conaghan et al., 1993; Gardner and Leese, 1986; Leese and Barton, 1984). After compaction in embryos, there is a greater demand for energy expenditure, resulting in increased uptake and utilization of glucose by the embryo until the blastocyst stage. As such, this led to the development of culturing preimplantation embryos in a two-step sequential media system (Biggers and Summers, 2008; Chatot et al., 1989; Lane and Gardner, 2007; Whitten and Biggers, 1968). However, it was later reported that culturing embryos in a one-step (not renewing medium) or in a two-step (renewing medium mid-way through development) protocol made no significant effect on blastocyst development and yield (Biggers et al., 2005).

The increased knowledge gained over the years of culturing preimplantation embryos in vitro has led to significant changes from the first media that was formulated. The first tabulated embryo culture media was Brinster’s Medium for Ovum Culture (BMOC) developed in response to strain dependent block in embryos (Whitten and Biggers, 1968). Here, the addition of EDTA was used to overcome the 2-cell block in inbred mice (see Page | ‐ 120 ‐

Chapter 5 Embryo culture and media

Section 1.2.3) by chelating deleterious heavy metals from the medium (Abramczuk et al., 1977). Since then, three culture media, Chatot-, Ziomek- and Bavister-medium (CZB)(Chatot et al., 1989), simplex optimized medium (SOM)(Lawitts and Biggers, 1991; Lawitts and Biggers, 1992) and K+ modified simplex optimized medium (KSOM)(Erbach et al., 1994; Lawitts and Biggers, 1993) have shown the most success in sustaining in vitro embryo culture with high rates of blastocyst formation.

When CZB medium was developed, L-glutamine was incorporated to overcome the 2-cell block in outbred mice strains (Chatot et al., 1989), and since then, glutamine has been widely included in most chemically defined media formulated for preimplantation embryo development. However, due to the instable nature of glutamine, it results in the accumulation of ammonium which is detrimental towards embryonic development (Lane and Gardner, 1994). In the early 1990s, using an experimental strategy known as simplex optimization, SOM medium was created. A simplex is a geometrical figure with (n + 1) vertices, where n is the number of components being tested. Therefore an experiment intending to test 2 components would result in a triangle with 3 vertices which defines 3 variations of media. Simplex optimization begins with defining a START simplex and the medium that results in the worst response was identified. During this process, 10 components were tested and using a computer program for calculations to determine the ideal concentration after each individual component has been raised to relatively high concentrations while all remaining components were only slightly raised. Embryos were cultured in each medium and their responses were tabulated to be used for standard simplex calculation that generated a new medium with the adjusted concentrations of all tested components, giving rise to SOM medium.The creation of SOM medium identified that high

concentrations of NaCl, pyruvate, KH2PO4 and glucose were detrimental for embryo development (Lawitts and Biggers, 1991; Lawitts and Biggers, 1992). In addition, it was also discovered that in the absence of glutamine, increasing NaCl concentration decreases blastocyst development but in the presence of glutamine, low salt concentration also inhibits embryo growth (Anbari and Schultz, 1993; Biggers et al., 1993). Therefore, glutamine has a protective function only in high NaCl concentration (Anbari and Schultz, 1993; Biggers et al., 1993). As such, SOM medium was modified to contain decreased concentrations of both sodium and potassium and was tested out on outbred CF1 mice which were previously known to block at the 2-cell stage. When cultured in SOM medium, CF1 zygotes were able to develop into blastocysts. However analyses of intracellular K+/Na+ ratio in two-cell stage embryos cultured from zygotes in SOM was found to be 3

Page | ‐ 121 ‐

Chapter 5 Embryo culture and media

instead of the normal value of 10 (Biggers et al., 1993). This led to modifications to increase potassium levels by 10-fold from 0.25mM to 2.5mM and the sodium concentration was increased by ~12% from 85mM to 95mM, resulting in the generation of KSOM medium (Erbach et al., 1994; Lawitts and Biggers, 1993). It was observed that KSOM was able to produce higher blastocyst yield, stimulated high rates of trophoblast cell division and was able to support preimplantation embryonic growth in outbred CF1 mouse strain better than CZB and SOM media. (Erbach et al., 1994).

A couple of independent studies reported that development of outbred two-cell mouse embryos did not have an absolute requirement for exogenous amino acids to form blastocyst (Brinster, 1965b; Cholewa and Whitten, 1970). However, studies using mouse blastocyst explants around the time of implantation suggested otherwise (Gwatkin, 1966; Spindle and Pedersen, 1973). It was also found that in the fluid of the female reproductive tract, there is a substantial amount of free amino acids (Menezo, 1972; Miller and Schultz, 1987). Additionally, oocytes and embryos also maintain their own endogenous amino acids (Schultz et al., 1981). Previous culture media without the addition of amino acids had reported delayed cleavage rates (Bowman and McLaren, 1970a), 2-cell block (Telford et al., 1990; Whitten, 1957) and reduced embryo viability after transfer (Bowman and McLaren, 1970b; Fissore et al., 1989; Hoshi and Toyoda, 1985; Lane and Gardner, 1992; Loutradis et al., 1987; Nasr-Esfahani et al., 1992) The addition of all 20 amino acids (essential and non- essential) into modified tubal fluid medium (mMTF) resulted in embryos that developed at a faster rate, with no change to the yield of blastocysts formation but with an increased incidence of partially hatched blastocysts (Gardner and Lane, 1993). Culture of several strains of mice embryos in the presence of Eagle’s non-essential amino acids (NEAA) and glutamine was found to improve blastocyst development, increased total cell count in blastocysts, and partial blastocyst hatching leading to better implantation rates, as well as improved foetal development after transfer (Biggers et al., 1997; Gardner and Lane, 1993; Gardner and Lane, 1996; Gardner and Leese, 1993; Ho et al., 1995; Mehta and Kiessling, 1990). In addition, media supplemented with amino acids has now been found to support development of cow, sheep, rats and rabbit zygotes to blastocyst (Gardner et al., 1994; Liu and Foote, 1995; Miyoshi et al., 1995; Takahashi and First, 1992; Thompson et al., 1992). As such, both essential (EAA) and NEAA have been incorporated into various embryo culture media, such as KSOM supplemented with amino acids (KSOM/AA)(Ho et al., 1995).

Page | ‐ 122 ‐

Chapter 5 Embryo culture and media

It has also been reported that the 2-cell block experienced by some embryos was dependent on the strain of mouse that the oocytes originated from (Goddard and Pratt, 1983). For a long time, it was known that there was significant interspecies variation in eggs produced by different strains of mice. These differences lie in the diameter of the egg produced, the type, number and distribution of cytoplasmic granules within the egg (Boyd and Hamilton, 1952; Braden, 1959). F1 hybrids from intercrossing two inbred strains have been shown to produce increased numbers of oocytes and are more tolerant to changes and deficiencies to their environment, making them easier to culture in vitro (Bradford and Nott, 1969; Larman et al., 2006; Thouas et al., 2004). As such, F1 hybrids are used commonly for oocyte and embryo studies. Following the sequencing of the human genome, almost ten years ago, Nature published the genome of the C57Bl6 mouse, chosen because of its ‘widespread use among the research community and favourable breeding characteristics’ (Battey et al., 1999). As such, the inbred C57Bl6 strain is also commonly used in laboratories for examining oocyte and preimplantation embryo development due to the comprehensive studies performed on this strain of mouse (Braden, 1959; Braden, 1957; Bradford and Nott, 1969; Evsikov et al., 2006; Gao et al., 2004). This strain is the background onto which was bred the Fzr1 knockout mice used in this thesis (see Chapters 4 and 6)(García-Higuera et al., 2008).

Here in this chapter, 3 lines of mice, F1 hybrid (B6CBF1; C57Bl6 X CBA), C57Bl6 and Fzr1fl/fl were used to assess two embryo culture media; KSOM and KSOM/AA to examine which medium would give better rates of embryo development and how this would affect further work in Chapter 6, since both media have been reported to overcome the 2-cell block and produce promising rates of blastocyst development during in vitro culture of pronuclear zygotes.

Page | ‐ 123 ‐

Chapter 5 Embryo culture and media

5.2. Results

5.2.1. Quality of zygotes collected from different strains of mouse In the later sections of this thesis, Fzr1 oocyte-specific knockout mice that had been bred on a C57Bl6 background were used for generating parthenotes, which were then evaluated for embryo development (Chapter 6). As demonstrated in section 4.2.1, mice possessing Fzr1 alleles flanked by loxP sites at exons 2 and 3 (refer to section 2.1.3) but not the Cre- promoter, express levels of Fzr1 protein comparable to wild-type siblings (contains no Fzr1 floxed alleles or Cre-promoter) and are therefore used as controls (Fzr1fl/fl, refer to sections 4.2.1 and 4.2.2). However, it was important to confirm embryo quality and development was normal in these mice since a previous report has shown unexpected phenotypes in mice containing flox alleles (Shui and Tan, 2004). Therefore eggs and embryos collected from control Fzr1fl/fl mice were examined together with F1 hybrids and C57Bl6 embryos.

To examine the quality of zygotes produced from these strains, hormonally stimulated females were mated with wild-type B6CBF1 males and the number of intact and fragmented/lysed embryos was tabulated. Zygotes were collected from donor females approximately 21 hours post-hCG injection and the number from each female was recorded. There was no statistically significant difference in the percentage of intact embryos that were isolated from each female between the three strains of mice; B6CBF1 hybrid, Bl6C57 or Fzr1fl/fl (n.s., p > 0.05, 2 test; Figure 5.1).

Page | ‐ 124 ‐

Chapter 5 Embryo culture and media A

B F1 (290) C57Bl6 (103) fl/fl (164) 100 a a a 80

No.ofembryos(%) 20

0 Intact Fragmented/lysed Figure 5.1 Percentage of intact embryos collected from different strains of mice (A) Representative images of intact zygotes (left) and fragmented embryos (right, scale bars, 30m). (B) Percentage of embryos collected from the various mouse lines (B6CBF1 hybrid, Bl6C57 and Fzr1fl/fl) at E0.5 that were intact or fragmented /lysed. In parenthesis, number of embryos analysed. No statistical significance between the strains was observed (F1 hybrid vs C57Bl6; p=0.097, F1 hybrid vs Fzr1fl/fl; p=0.584 and C57Bl6 vs Fzr1fl/fl; p=0.327, 2 test).

Page | ‐ 125 ‐

Chapter 5 Embryo culture and media

5.2.2. Rates of blastocyst formation in embryos between strains of mice in KSOM and KSOM/AA media As shown above in Section 5.2.1, morphologically normal zygotes were isolated from the various strains of mice. Therefore their ability to be cultured in vitro to form blastocysts needed to be assessed. However, first a suitable embryo culture medium has to be selected Media components can vary from a simple balanced salt solutions and carbohydrates, like with Brinster’s medium for egg culture (BMOC)(McKenzie and Kenney, 1973), to having very complex components, such as Ham’s F-10 (John and Kiessling, 1988). As discussed previously (Section 5.1), because of increased total cell count, percentage of partial hatching, faster and improved blastocyst development rate, KSOM and KSOM/AA were selected to be used for evaluating embryonic development in vitro for experimentation in this thesis.

To evaluate which media was optimal for embryo culture in vitro, pooled zygotes from several donor pair-mated female B6CBF1 hybrid and C57Bl6s were collected at E0.5, approximately 21 hours post-hCG and were cultured in their respective medium until blastocyst formation after 5 days. There was no statistical difference in blastocyst formation rates for C57Bl6 embryos between the two media tested (n.s., p=0.414, 2 test; Figure 5.2). However, B6CBF1 embryos cultured in KSOM/AA had a significantly higher rate of blastocyst formation compared with those grown in KSOM (*, p=0.004, 2 test).

5.2.3. Rate of blastocyst formation from parthenogenetically activated eggs cultured in KSOM or KSOM-AA An important technique utilized in the current thesis for examining embryo development was the activation (refer to Sections 2.3.3 and 6.1) and development of parthenotes from superovulated MII eggs collected from hormonally primed females. Therefore, it was also important to assess the suitability of culture medium to sustain in vitro growth of parthenotes during and after egg activation.

Here, superovulated MII eggs collected from B6CBF1 hybrids or C57Bl6 females were activated in strontium supplemented, calcium-free KSOM or KSOM/AA approximately 13-16 hours after hCG stimulation. The rates of blastocyst formation from these parthenotes were examined for differences between the two media. It was observed that blastocyst formation of embryos derived from B6CBF1 females was not affected by culturing in either KSOM or KSOM/AA (Figure 5.3; n.s., p=0.618, 2 test). However

Page | ‐ 126 ‐

Chapter 5 Embryo culture and media

parthenotes produced from C57Bl6 females achieved a significantly higher blastocyst rate when grown in KSOM-AA as compared to those cultured in KSOM (Figure 5.3; *, p=0.033, 2 test).

Therefore results from the above experiment and those in Section 5.2.2 suggest that KSOM/AA may be a better media to use for supporting embryo development to blastocysts in both parthenotes and fertilized embryos. It was therefore chosen as the preferred medium over KSOM to use for all further embryo development experimentations.

Page | ‐ 127 ‐

Chapter 5 Embryo culture and media

* p=0.004

100 n.s. KSOM (148) 80 (118) KSOM/AA (27) (217) 60

20 Blastocyst formation (%) 0 F1 C57Bl6

Figure 5.2 Rate of blastocyst formation from zygotes of mated females cultured in KSOM and KSOM/AA. Blastocyst formation following five days of in vitro culture of zygotes from fertilized eggs in two strains of mice, B6CBF1 hybrids and C57Bl6. For F1 hybrids, there were significantly higher rates of blastocyst formation in embryos cultured in KSOM/AA compared to those cultured in KSOM (*, p = 0.0042, 2 test). However, there was no significant difference in the rate of full blastocyst formation observed in C57Bl6 embryos that were culture in either of the media (n.s., p= 0.4135, 2 test).

Page | ‐ 128 ‐

Chapter 5 Embryo culture and media

n.s. 100 KSOM (97) * KSOM/AA 80 (96) p = 0.033

60 (300) 40 (117)

20 Blastocyst formation (%) 0 F1 C57Bl6

Figure 5.3 Blastocyst formation rates of parthenotes cultured in KSOM or KSOM/AA. Assessment of blastocyst formation rates in parthenotes of B6CBF1 hybrid and C57Bl6 strains after five days in culture. In B6CBF1 hybrid embryos, there was no significant difference between the two culture media (n.s., p=0.618, 2 test). However in C57Bl6 embryos there was a significantly higher rate of full blastocyst formation when cultured in KSOM/AA as compared to KSOM (*, p = 0.033, 2 test).

Page | ‐ 129 ‐

Chapter 5 Embryo culture and media

5.2.4. Assessment of blastocyst formation rate in Fzr1fl/fl embryos in comparison to B6CBF1 hybrids and C57Bl6 From the above experiments (Sections 5.2.2 and 5.2.3), I have identified that KSOM/AA is a better medium for supporting embryo development to form blastocysts in both fertilized eggs and activated parthenotes. Since Fzr1fl/fl embryos were to be used as controls in subsequent experiments, and the percentage of healthy zygotes isolated from Fzr1fl/fl females were not different as compared to B6CBF1 hybrid and C57Bl6s (Section 5.2.1), therefore, the rate of Fzr1fl/fl blastocyst formation had to be examined to assess whether the insertion of the flox cassette had any impact on embryo development.

Here, Fzr1fl/fl zygotes collected from mated females were cultured in KSOM/AA, and the rate of blastocyst formation was assessed after 5 days in culture and compared against B6CBF1 hybrid and C57Bl6 embryos. It was observed that B6CBF1 hybrid embryos had a significantly higher rate of blastocyst formation as compared to C57Bl6 (p=0.0001, 2 test) and Fzr1fl/fl (p<0.0001, 2 test). However, there was no significant statistical difference in the blastocyst formation rates between C57Bl6 and Fzr1fl/fl embryos (n.s., p=0.2599, 2 test).

Page | ‐ 130 ‐

Chapter 5 Embryo culture and media

a 80 (188)

60 b (82) b (155) 40

20 Blastocyst formation (%)Blastocyst 0 F1 C57Bl6 fl/fl

Figure 5.4 Blastocyst formation in Fzr1fl/fl embryos in comparison to F1 hybrids and C57Bl6, cultured in KSOM/AA medium

(A) Representative image of fully expanded blastocyst. Scale bar, 30m. (B) Percentage of blastocyst formation rate in each mouse strain, B6CBF1 hybrid, C57Bl6 and Fzr1fl/fl after five days of in vitro culture using KSOM/AA medium. Different letters denote statistical significance (p ≤ 0.0001; 2 test). In parenthesis, number of embryos analysed.

Page | ‐ 131 ‐

Chapter 5 Embryo culture and media

5.3. Discussion

5.3.1. Comparable embryo quality of fertilized zygotes from F1 hybrid, C57Bl6 and Fzr1fl/fl In this chapter, experiments were performed on B6CBF1 hybrid, C57Bl6 and Fzr1fl/fl embryos to determine a suitable medium for in vitro culture of fertilized eggs as well as parthenotes. Prior to examining which of the selected media could better support blastocyst formation, embryo quality between the strains of mice would have to be assessed first to ensure that their quality were morphologically comparable. Here, embryo quality was assessed morphologically and was scored as either intact or fragmented/lysed, approximately 21 hours post-hCG injection. Results revealed no significant differences between all 3 strains mice (B6CBF1 hybrid, C57Bl6 and Fzr1fl/fl). This was as expected because previous studies conducted in F1 hybrids and C57Bl6 females were able to successfully collect morphologically normal zygotes (Gao et al., 2004; Nakao et al., 1997; Warner et al., 1998). Since Fzr1fl/fl mice have normal levels of Fzr1 (see Chapter 4), being used subsequently as controls for the Fzr1 knockout mice, and have been bred onto a pure C57Bl6 background, they too were expected to produce embryos that were similar to C57Bl6s.

5.3.2. KSOM/AA is an optimal culture medium for F1 hybrids and C57Bl6 embryos Since the development of chemically defined embryo culture media, various modifications have been implemented to improve the rates and quality of blastocyst formation as discussion in Section 5.1. Manipulation and in vitro culture of embryos have been associated with slower development (Bowman and McLaren, 1970a; Rivera et al., 2008) and decreased number of blastomeres due to apoptosis as compared to embryos isolated from the reproductive tract (Hardy, 1999; Hardy et al., 2001; Kamjoo et al., 2002; O'neill, 1998) In this Chapter, I used KSOM and KSOM/AA to culture embryos because of the higher yield and quality (ICM/TE ratio) of blastocyst formation they appear to offer based on extensive previous studies across a wide range of mouse strains (Brison and Schultz, 1997; Lawitts and Biggers, 1991; Lawitts and Biggers, 1993; Rinaudo and Schultz, 2004).

Preliminary studies to determine which culture medium was more suited for embryo development were carried out in B6CBF1 hybrids and C57Bl6 mice. The use of F1 hybrids is because their embryos when cultured in vitro are more tolerant to various culture

Page | ‐ 132 ‐

Chapter 5 Embryo culture and media

conditions and produce higher rates of blastocysts as compared to non-hybrid mouse strains (Gao et al., 2004; Kamjoo et al., 2002; Latham, 1994). Even though F1 hybrid embryos are more robust and are easier for in vitro culture, the extensive use of C57Bl6 embryos is still observed in many laboratories because the mouse genome project uses this strain (Battey et al., 1999). Since the mapping of C57Bl6 DNA sequence and data accessibility, there is knowledge of their genetic polymorphisms as well as the availability of genetic tools incorporating the C57Bl6 strain, and is therefore a preferred mouse strain for conducting studies. Being an inbred strain it also offers the advantage of a reduced variance in genetic makeup between individuals, which is beneficial for studies investigating gene function due to reproducibility of data (Marshall et al., 2007; Threadgill et al., 2002). The Fzr1 knockout mouse was initially created on a mixed genetic background because hybrid mice are better breeders (Suzuki et al., 1996) and are more tolerant to the microinjection procedure (Auerbach et al., 2003), therefore making the process of creating the mutant mice line easier. However, the Fzr1 knockout mice were later bred onto a pure C57Bl6 background to increase reproducibility of data to be used in the experiments detailed in this thesis.

B6CBF1 hybrids and C57Bl6 embryos from fertilized eggs were observed to have different rates of blastocyst formation, whereby C57Bl6 zygotes developed poorly in vitro as compared to F1 hybrids. This observation of poorer blastocyst formation rates in C57Bl6 is consistent with previous reports that F1 hybrids are more tolerant to subtle changes and minor deficiencies to their immediate microenvironment as compared to C57Bl6 (Biggers and Blandau, 1971; Biggers, 1998; Hadi et al., 2005; Whittingham, 1975). Studies have identified various reasons to explain why embryos from certain strains of mice are able to have higher rates of blastocyst formation. 1) Previous studies have found that the origins of the egg that the embryo was derived from would affect developmental outcomes due to genetic influences (Goddard and Pratt, 1983; Scott and Whittingham, 1998). 2) Another factor influencing blastocyst formation between strains of mice is also dependent on their metabolic requirements after forming morulae (Biggers et al., 1967; Conaghan et al., 1993; Gardner, 1998; Spindle and Pedersen, 1973). 3) It was also reported that the choice of culture medium used influences gene expression, affecting embryo development to form blastocysts (Khosla et al., 2001; Rinaudo and Schultz, 2004). Therefore even though the percentage of intact embryos collected from F1 hybrids and C57Bl6s were similar, the sensitivity of C57Bl6 embryos led to poorer in vitro embryonic development, resulting in lower blastocyst yield, regardless of culture in KSOM or KSOM/AA medium.

Page | ‐ 133 ‐

Chapter 5 Embryo culture and media

5.3.3. Parthenogenetic activation in F1 hybrids and C57Bl6 An important technique utilized in Chapter 6 to study Fzr1 function during preimplantation development was to create parthenotes from eggs collected from the Fzr1 knockout mice. Therefore it was essential here to assess blastocyst formation rates of parthenogenetically activated embryos in both KSOM and KSOM/AA. Generation of diploid parthenotes using strontium and cytochalasin D have been shown to produce better rates of blastocyst formation as compared to haploid parthenotes, which were susceptible to apoptosis (Henery and Kaufman, 1992; Kim et al., 1997; Liu et al., 2002). Here, I was able replicate this procedure creating diploid parthenotes, verify the rate of blastocyst formation and also identify a suitable medium for their in vitro culture. It was observed that parthenotes created from both B6CBF1 hybrids and C57Bl6s thrived better in KSOM/AA medium as compared to KSOM. Therefore, KSOM/AA was deemed to be a better culture medium to be used for in vitro culture in the laboratory for the rest of the experiments covered in this thesis.

As with embryos from fertilized eggs, parthenotes generated from B6CBF1 hybrids were able to obtain high blastocyst yield (~70-80%, depending on whether KSOM or KSOM/AA was used), whereas only ~30-40% of C57Bl6 parthenotes successfully formed blastocyst in culture. This lower blastocyst formation in C57Bl6 parthenotes was in agreement to a previous study that generated parthenotes using inbred C57Bl6, and F1 hybrids of C57Bl6 cross with DBA (Gao et al., 2004), that showed similar figures in their blastocyst formation rates. It was reported that 97% of parthenotes generated from F1 hybrids were able to successfully form blastocysts, whereas C57Bl6 parthenotes although developing at high rates to the 8-cell or morulae stage, only had ~45% blastocyst formation rates when cultured in KSOM or KSOM/AA media (Gao et al., 2004). Therefore it was expected for parthenotes generated from C57Bl6 females to have lower blastocyst formation rates as compared to B6CBF1 hybrids, because of genetic strain differences rather than due to poor quality culture conditions.

5.3.4. Insertion of a flox cassette into the Fzr1 gene does not affect embryo development

The creation of a floxed mouse does not usually affect gene expression (Dragatsis and Zeitlin, 2001; Gu et al., 1994) but if it did, it may affect embryo development. Therefore, it was necessary to assess whether embryos collected from Fzr1fl/fl females possess the capacity to produce blastocysts in vitro. As expected, I found that the rate of blastocyst

Page | ‐ 134 ‐

Chapter 5 Embryo culture and media

formation although low in comparison to B6CBF1 hybrids, was comparable to C57Bl6 embryos since the Fzr1 knockout mouse was bred onto the pure C57Bl6 background. Therefore the insertion of the flox cassettes into the Fzr1 gene did not have any detrimental impact on early embryo development in Fzr1fl/fl mice, and would therefore serve as an appropriate control in future experiments when working with the oocyte-specific Fzr1 knockout mouse. In conclusion, I have established that Fzr1fl/fl eggs can generate diploid parthenotes that are capable of forming blastocysts when cultured in KSOM/AA medium. As such, the function of Fzr1 can now be examined in the Fzr1 knockout mouse.

Page | ‐ 135 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6. Fzr1 in Embryo Development

6.1. Introduction In previous knockout studies, the loss of Fzr1 resulted in embryonic lethality postimplantation after E10.5 (García-Higuera et al., 2008; Li et al., 2008). However, this does not reveal if Fzr1 is essential for earlier preimplantation embryo development because of maternal Fzr1 contribution in the eggs of the heterozygote (Fzr1lox/+) mothers. From the studies described in Section 4.2.4, it is known that maternal stores of Fzr1 were not essential for the completion of either meiosis or embryo development since fertilization of Fzr1-/- eggs by wild-type males yielded viable embryos. The next question was therefore to determine whether early embryo development would be compromised in the absence of both maternal and paternal contribution. Although a sperm-specific knockout mouse model of Fzr1 (MVH-Cre/Fzr1lox) has been developed within the University of Newcastle and was available to me, I was unable to perform Fzr1-/- x Fzr1-/- matings because these males do not produce mature sperm (Pye, Holt, García-Higuera, Monreno, Jones & McLaughlin, manuscript in preparation). Instead, I utilized an in vitro method of parthenogenetic activation to generate diploid embryos lacking Fzr1 from Fzr1-/- eggs.

During fertilization, the sperm triggers a series of repetitive calcium oscillations lasting for several hours, stopping only during pronuclear formation (Cuthbertson et al., 1981; Jones et al., 1995; Kline and Kline, 1992; Marangos et al., 2003). It is now known that these calcium changes occuring at fertilization are essential for stimulating meiotic resumption in the egg as these events are prevented with the calcium chelator, BAPTA (Kline and Kline, 1992). The result of this rhythmic calcium pattern is to release the MII egg from arrest by degrading cyclin B1 through the action of the APC (Hyslop et al., 2004; Nixon et al., 2002). This series of intracellular calcium spikes is believed to mediate meiotic resumption, cortical granule exocytosis, pronuclear formation and correct timing of events during preimplantation embryogenesis (Bos-Mikich et al., 1997; Ducibella et al., 2002; Kono et al., 1996; Rogers et al., 2006).

In most forms of parthenogenetic activation, the calcium change driven by the sperm is in some way mimicked in the egg. There are several methods to activate MII eggs. Treating the egg with 7% ethanol or ionomycin causes a single prolonged increase in calcium. Alternatively, calcium can be injected into the egg (Colonna et al., 1989; Cuthbertson et al., 1981; Liu et al., 2002; Swann and Ozil, 1994) or introduced by means of an electrical pulse (Ozil, 1990). Another method is to incubate eggs in calcium-free media containing Page | ‐ 136 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

strontium chloride. This is the only parthenogenetic chemical agent for mouse eggs that is capable of inducing repetitive intracellular calcium release in a similar manner as observed during normal fertilization (Kline, 1996; Kline and Kline, 1992; Liu et al., 2002; O'neill et al., 1991; Swann and Ozil, 1994). This closely reproduces physiological egg activation and is a more efficient method for egg activation as compared to a single rise in calcium signal

(Ducibella et al., 2002; O'neill et al., 1991; Ozil, 1998).

Activated haploid parthenotes have been shown to develop normally to form blastocysts (Otaegui et al., 1999). However, extrusion of the second polar body can be prevented to generate diploid parthenotes, and this is usually achieved by exposing eggs to cytochalasin B or D during activation (Balakier and Tarkowski, 1976). This will inhibit cytoskeleton movement, spindle rotation and cytokinesis (Navarro et al., 2005; Zhu et al., 2003). Diploid parthenotes have been shown to develop better in culture than those that are haploid (Liu et al., 2002) and therefore was the method adopted here. This activation protocol involved incubating eggs in activating media with cytochalasin D (CCD) for 4 hours and this was found previously, not only to give rise to blastocysts, but also the correct segregation of stem cell markers, which influences the quality of cells making up the ICM and TE (Bianchi et al., 2010).

Here, the Fzr1 knockout mice were bred onto a pure inbred C57Bl6 mouse strain. This was advantageous since there would be less genetic variation between individuals, thereby reducing the confounding influences of a mixed genetic background. In the previous chapter (Chapter 5), control Fzr1fl/fl embryos have been shown to give good blastocyst developmental rates following parthenogenetic activation using strontium to trigger calcium release within the egg when cultured in KSOM-AA medium, therefore this medium was used here for generation and culture of parthenotes.

Page | ‐ 137 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.2. Results

6.2.1. Successful egg activation in MII eggs from Fzr1-/- mice To produce Fzr1-/- parthenogenetically activated embryos, MII eggs were isolated from superovulated Fzr1-/- females and activated in Ca2+ -free medium supplemented with Sr2+, as described previously (Sections 2.3.3 and 6.1). Parthenotes were made diploid with the addition of CCD to preventing second polar body extrusion (Figure 6.1)(Navarro et al., 2005; Rogers et al., 2006). Fzr1fl/fl embryos were used as controls in all experiments for this chapter of the thesis.

To determine if the process of activation had any detrimental effect on Fzr1 expression over the course of embryo development, control Fzr1fl/fl females were hormonally stimulated and were either mated with wild-type males before zygotes were isolated for culture, or MII eggs were collected for activation and parthenotes were grown in vitro. Protein from 100 eggs/embryos (MII eggs, 2-cell embryos, morulae and blastocysts) were then immunoblotted for Fzr1 (Figure 6.2A & B). It was observed that there was no difference in Fzr1 expression at any of the stages over the course of embryo development between fertilized embryos or activated parthenotes (Figure 6.2C).

To determine if Fzr1-/- MII eggs were capable of being artificially activated, MII eggs were isolated from Fzr1-/- females, activated with Sr2+ supplemented medium without CCD in this instance, and the rate of second polar body extrusion examined. Eggs were scored 6 hours after Sr2+ addition for the presence of second polar body formation and chromatin was Hoechst stained to examine for normal DNA segregation (Figure 6.3A). Since there was no significant difference in the percentage of activated eggs, determined by the presence of 1 pronucleus (Fzr1fl/fl: 82%, n = 87 vs Fzr1-/-: 83%, n = 74; n.s., p = 1.00; 2 test; Figure 6.3B), diploid parthenotes were next generated by addition of CCD to the activation medium to prevent second polar body extrusion. Again, there was no significant difference in the percentage of activated eggs, determined by the presence of 2 pronuclei 9 hours post-activation (Fzr1fl/fl: 68% , n = 112 vs Fzr1-/-: 57%, n = 98; n.s., p = 0.11; 2 test; Figure 6.4).

Since Fzr1-/- MII eggs can be activated normally to form 2 pronuclei in the presence of Sr2+ and CCD, I next wanted to examine if there was a difference in time required for 2 pronuclei formation to occur in these eggs. This is because Fzr1 is known to be involved in regulating mitotic progression by influencing the timing of cell cycle stages and it has been

Page | ‐ 138 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

reported previously that the loss of Fzr1 has resulted in shortening of the G1 phase and lengthening of S phase (Sigl et al., 2009). In addition, Fzr1 activity had been detected in eggs following second polar body extrusion after fertilization (Chang 2004). To investigate this, MII eggs were microinjected with histone2B (H2B)-mCherry cRNA prior to activation. The expression of H2B-mCherry in the eggs would enable the tracking of chromosome movements using live-cell imaging and therefore allow the measurement of the time between Sr2+ addition and pronuclei formation to be determined with accuracy in each egg (Figure 6.5). Pronuclear formation in zygotes was verified by the presence of the nuclear envelope in the corresponding bright-field images, similar to those shown previously in Figure 6.4. The time taken by Fzr1-/- eggs to form 2 pronuclei was found not to be different from Fzr1fl/fl eggs (Fzr1-/-: 7.4 hours, n = 11 vs Fzr1fl/fl: 7.8 hours post- activation, n = 22; n.s., p = 0.35; student t-test, Figure 6.6).

Page | ‐ 139 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

PMSG hCG MII collection Anaphase Pronuclei Time = 0hr Time = 48hr and activation Time = 65-67hr Formation Time = 60hr Time = 69-73hr

P.B.E.

1hr

Sr2+ + 4hrs 1Pronuclei PBE2 Formation

ICM P.N . TE MII egg Sr2+ + 5hrs 5 days CCD + 4hrs

2 Pronuclei Blastocyst Formation

Figure 6.1 Schematic diagram of MII egg activation protocol using Sr2+ and CCD (A) Time line of hormonal treatment of 4 to 8 weeks old females to induce superovulation. Priming with PMSG followed by hCG 48 hours later. MII eggs were isolated 12 hours following hCG, with pronuclei formation expected approximately 9 hours after treatment. (B) MII eggs were either 1) activated in Sr2+ supplemented media; or 2) activated in Sr2+ supplemented media with the addition of CCD. Presence of Sr2+ in the media mimics the calcium oscillations observed in eggs at fertilization, resulting in the extrusion of the second polar body and formation of 1 pronucleus. The addition of CCD inhibits actin polymerization and prevents extrusion of second polar body. Therefore, the egg retains the second haploid set of chromosomes and forms a diploid parthenote, capable of developing into a fully expanded blastocyst after 5 days in culture.

Page | ‐ 140 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

A C mated parthenotes MII 2C M B kDa 1.2 62 FZR1 0.8 49 FZR1

0.4 Gapdh 38

0 MII 2C M B B

MII 2C M B kDa 60 FZR1 50

40 Gapdh

Figure 6.2 Immunoblot of Fzr1 expression in mated and activated Fzr1fl/fl embryos Fzr1 immunoblots of MII, 2-cell (2C), morulae (M) and blastocysts (B) from Fzr1fl/fl (A) mated and (B) activated parthenotes; 100 eggs/embryos per lane. Gapdh expression was used as a control for protein loading (n = 2 blots per mated/parthenote treatment). (B) Associated densitometric analysis of (A), normalized to MII eggs.

Page | ‐ 141 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Brightfield Hoechst

fl/fl PB

PN PB -/-

B n.s. 100 (87) (74) 80

20 Pronucleus formation (%)

0 fl/fl -/-

Figure 6.3 Fzr1-/- MII eggs can be activated normally by Sr2+ containing medium. (A) Image of activated MII eggs in Sr2+ supplemented calcium-free media after 5 hours. Note presence of 1 pronucleus (PN) and an extruded second polar body (PB) in both Fzr1fl/fl (top) and Fzr1-/- (bottom) egg, confirmed by Hoechst chromatin labelling (second column). Scale bar, 10m. (B) Pronucleus formation rate in MII eggs from Fzr1fl/fl and Fzr1-/-mice assessed after 5 hours of Sr2+ addition (n.s., p = 1.00; 2 test). In parenthesis, number of eggs analysed.

Page | ‐ 142 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

i n.s. 80 (112)

60 (98)

40 ii

Pronuclei (%) Pronuclei 20

0 fl/fl -/-

Figure 6.4 Fzr1-/- MII eggs form 2 pronuclei when activated in the presence of Sr2+ and cytochalasin D. (A) Images of activated MII eggs (i) 5 hours and (ii) 9 hours after Sr2+ and CCD addition. (i) Note the absence of an extruded second polar body following activation. (ii) Presence of 2 pronuclei (marked by dotted lines) after 9 hours indicative of a diploid parthenote. Scale bar, 10m. (B) Assessment of pronuclei formation rates in MII eggs from Fzr1fl/fl and Fzr1-/- mice after 9 hours of Sr2+ and CCD addition (n.s., p = 0.11; 2). In parenthesis, number of eggs analysed.

Page | ‐ 143 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

2:15 2:50 4:40 4:45

5:55 6:15 7:45 7:50

7:55 8:00 8:05 8:10

8:20 8:40 9:05 9:30

Figure 6.5 Time lapse imaging of activated parthenotes for assessment of pronuclei formation Time lapse imaging of H2B-mCherry fluorescence in microinjected MII eggs after Sr2+ and CCD addition. H2B-mCherry fluorescence could be detected initially after 3 hours of activation. Between times 4:40 to 7:45 (hh:mm), chromosome remained congressed on the metaphase plate. At 7:50 the metaphase to anaphase transition occurred. By 9:30, 2 distinct pronuclei were formed. Scale bar, 10m; dotted line shows outline of embryo. Time is shown in hh:mm post- activation. Images here are only representative of the activation process even though the time of taken for this particular egg to activate was slower than average.

Page | ‐ 144 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

A B n.s. fl/fl

10 (11) (22)

6 -/-

(hours) 4 PN Formation 2

0 fl/fl -/-

Figure 6.6 Number of hours post-activation for pronuclei formation in Fzr1-/- mice (A) H2B-mCherry fluorescence, showing two pronuclei in Fzr1fl/fl and Fzr1-/- 1-cell embryos. Scale bar, 10m; dotted lines show outline of embryos. (B) Box plots of the timings of 2 pronuclei formation in eggs expression H2B-mCherry (n.s., p = 0.35; t- test). In parenthesis, number of eggs analyzed.

Page | ‐ 145 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.2.2. Loss of Fzr1 impacts preimplantation embryo development To examine the effects of Fzr1 loss during early embryogenesis, Fzr1-/- zygotes were cultured following parthenogenesis and compared with Fzr1fl/fl parthenotes. Diploid parthenotes were cultured and scored regularly, every 30 minutes interval by eye up to 120 hours post-hCG injection. Normally embryos would reach blastulation after this period (Bączkowski et al., 2004; Bowman and McLaren, 1970a; Brinster, 1963), however Fzr1-/- embryos were observed to have a slower rate of growth and no blastulation was ever seen, even though normal preimplantation embryo development was observed in Fzr1fl/fl parthenotes.

There were significant delays in blastomere divisions during preimplantation embryo development of Fzr1-/- parthenotes. At day 2, while 61% of Fzr1fl/fl embryos (n = 153) were at the 2-cell stage, only 36% of Fzr1-/- embryos (n = 108) were at the same developmental stage, a significantly fewer number, (p < 0.001; 2 test, Figure 6.7). At day 3, when 62% of Fzr1fl/fl embryos (n = 113) were at the 4-cell stage, only 15% of Fzr1-/- embryos (n = 55) were at the same stage, with 76% of embryos delayed at the 2-cell stage (p < 0.001; 2 test, Figure 6.8). At day 3.5, 65% of Fzr1fl/fl embryos (n = 104) were at the 5-8 –cell stage but only 12% of Fzr1-/- embryos (n = 52) were at the same developmental stage, with 87% of embryos remaining at the 2- and 4-cell stage (p < 0.001; 2 test, Figure 6.9). This delay to embryo development became most evident by day 4, when 87% of Fzr1fl/fl embryos (n= 98) had formed morulae, compared to only 22% of Fzr1-/- embryos (n = 36). The remaining Fzr1-/- embryos were at this time either arrested at the 2-cell stage (14%) or were delayed at the 4-8 –cells stage (64%; p < 0.001; 2 test, Figure 6.10).

The first few mammalian embryonic cleavages are normally synchronous (Bard et al., 1998; Ciemerych and Sicinski, 2005; Endoh et al., 2007) due to tightly regulated cell cycle checkpoints. Fzr1-/- embryos not only divided much more slowly than Fzr1fl/fl embryos, they also did so with much greater asynchrony. The mean timings of the first 3 embryonic mitotic divisions were examined: 1) 1- to 2-cell transition, 2) 2- to 4-cell transition and 3) 4- to 5-8 cell transition (Figure 6.11A). In all 3 mitotic divisions, there was significant asynchrony experienced by Fzr1-/- embryos in comparison to Fzr1fl/fl embryos as indicated by analysis of the spread of times required for each transition. The population of embryos used for examination here were those that fell within the 25th and the 75th percentile during the range of division timings.

Page | ‐ 146 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

There was a greater spread of timing for each round of division as shown in Figure 6.11B. Assessment of times revealed that the majority of Fzr1fl/fl embryos completed their first embryonic cleavage to form 2-cell embryos within a very narrow time window of 3 hours (27.5 to 30.5 hours post hCG, n = 103), while the spread of timing for this division was slightly greater in Fzr1-/- embryos (3.3 hours; 31.5 to 34.9 hours post hCG, n = 53; *, p < 0.001; Welch t-test, Figure 6.11Bi). The second cleavage division, where embryos divide from 2-cell embryos to reach the 4-cell stage, in Fzr1fl/fl embryos happened predominantly during a 4 hour period (50 to 54 hours post hCG, n = 96) whereas for Fzr1-/- embryos this was observed over 12 hours (53.5 to 68 hours post hCG, n = 37; *, p < 0.001; Welch t-test, Figure 6.11Bii). The third cleavage cycle to form embryos at the 5-8 cell stage, was observed to occur in Fzr1fl/fl embryos over 2.5 hours (65 to 67.5 hours post hCG, n = 90), as compared to 12 hours for Fzr1-/- embryos (71 to 83 hours post hCG, n = 36; *, p < 0.001; Welch t-test, Figure 6.11Biii). This could be indicative that Fzr1-/- embryos experience varying degrees of difficulties completing their division cycles resulting in greater asynchrony in their mean division times.

Page | ‐ 147 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Day 2 (36 hours post hCG)

100 fl/fl 80 -/-

40 Total Embryos (%) 20

0 1cell 2cell 4cell 5-8 cell Morula

Figure 6.7 Delay in early embryogenesis at Day 2 for Fzr1-/- embryos Embryos were scored at 36 hours post-hCG, day 2 of culture after egg activation for the formation of all stages of preimplantation embryogenesis. At this time, it was anticipated that embryos would be at the 2-cell stage as seen in control Fzr1fl/fl embryos. However, there was significantly lesser Fzr1-/- parthenotes observed to have formed the 2-cell embryo at this time. 153 Fzr1fl/fl and 108 Fzr1-/- embryos were analyzed. The majority of Fzr1fl/fl parthenotes were at the 2-cell stage (61%) whereas only 36% of Fzr1-/- embryos were at the same developmental stage (p < 0.001; 2 test).

Page | ‐ 148 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Day 3 (60 hours post hCG)

100 fl/fl -/- 80

40 Total Embryos (%)

0 1cell 2cell 4cell 5-8 cell Morula

Figure 6.8 Delay in early embryogenesis at Day 3 for Fzr1-/- embryos Embryos were scored at 60 hours post-hCG, day 3 of culture after egg activation for the formation of all stages of preimplantation embryogenesis. At this time, it was anticipated that embryos would be at the 4-cell stage as seen in control Fzr1fl/fl embryos. However, there was significantly lesser Fzr1-/- parthenotes observed to have formed the 4-cell embryo at this time. 108 Fzr1fl/fl and 55 Fzr1-/- embryos were analysed. Whilst the majority of Fzr1fl/fl parthenotes were at the 4-cell stage (62%), only 15% of Fzr1-/- embryos were at the same developmental stage, with ~31% remaining at the 2-cell stage ( p < 0.001; 2 test).

Page | ‐ 149 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Day 3.5 (72 hours post hCG)

100 fl/fl -/- 80

40 Total Embryos (%)

0 1cell 2cell 4cell 5-8 cell Morula

Figure 6.9 Delay in early embryogenesis at Day 3.5 for Fzr1-/- embryos Embryos were scored at 72 hours post-hCG, day 3.5 of culture after egg activation for the formation of all stages of preimplantation embryogenesis. At this time, it was anticipated that embryos would be at the 5-8 cell stage as seen in control Fzr1fl/fl embryos. However, there was significantly lesser Fzr1-/- parthenotes observed to have formed the 5-8 cell embryo at this time. 104 Fzr1fl/fl and 52 Fzr1-/- embryos were analysed. Most Fzr1fl/fl parthenotes were at the 5-8-cell stage (65%) whereas only 12% of Fzr1-/- embryos were at the same developmental stage (p < 0.001; 2 test). The remaining 88% of Fzr1-/- parthenotes were delayed at either the 2- or 4-cell stage.

Page | ‐ 150 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Day 4 (84 hours post hCG)

fl/fl 100 -/- 80

40 Total Embryos (%)

0 1cell 2cell 4cell 5-8 cell Morula

Figure 6.10 Delay in early embryogenesis at Day 4 for Fzr1-/- embryos Embryos were scored 84 hours post-hCG, day 4 of culture after egg activation for the formation of all stages of preimplantation embryogenesis. At this time, it was anticipated that embryos would be at the morulae stage as seen in control Fzr1fl/fl embryos. However, there was significantly lesser Fzr1-/- parthenotes observed to have formed the morulae at this time.98 Fzr1fl/fl and 36 Fzr1-/- embryos were analysed. Here, the majority of Fzr1fl/fl parthenotes had formed morulae (87%), however only 22% of Fzr1-/- embryos were at the same developmental stage (p < 0.001; 2 test). The remaining 78% of Fzr1-/- parthenotes were delayed at some point earlier in embryo development.

Page | ‐ 151 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

ABi * 50 (53) 40 (103)

1 cell 30 20 1st cleavage

Hours hCG post 10

0 fl/fl -/- Bii * 80 (37) (96) 2 cell 60 2nd cleavage 40

20 Hours post hCGHours

0 fl/fl -/- Biii 4 cell * 120 (36) 3rd cleavage 100 (90) 80 60 40

Hours hCG post 20 0 5-8 cell fl/fl -/-

Figure 6.11 Asynchrony in early cleavage divisions of Fzr1-/- embryos (A) Representative images showing developmental stages of embryos undergoing first, second and third cleavage divisions from the 1- to 2-cell, 2- to 4-cell and 4- to 5-8-cell division respectively. Scale bar, 10m. (B) Timing of (i) 1- to 2-cell, (ii) 2- to 4- cell, and (iii) 4 - to 5-8- cell division assessed by regular scoring of embryos every 30 minutes interval by eye (*, p < 0.001 ; t-test).

Page | ‐ 152 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.2.3. Loss of Fzr1 results in early development arrest To further analyse the effects of Fzr1 loss, the chromatin of Fzr1fl/fl and Fzr1-/- arrested 2- cell embryos were examined using tubulin immunofluorescence and Hoechst counter- staining. Since few Fzr1-/- parthenotes made it past this block and subsequently died by day 4.5 of culture, embryos were analysed after growing in vitro for 4 days.

The small number of 2-cell arresting control Fzr1fl/fl embryos that were examined appeared to be blocked in interphase; determined by decondensed chromatin within a single nucleus in both blastomeres (Figure 6.12A and Figure 6.13; n = 6). This phenotype is consistent with the previously reported conventional 2-cell block phenomenon observed during in vitro mouse embryonic development (Hamatani et al., 2004; Schultz, 2002; Wang et al., 2004). In Fzr1-/- 2-cell arrested embryos, only about 30% (13/44) were arrested in interphase and as such were indistinguishable from Fzr1fl/fl embryos (Figure 6.12A and Figure 6.13). The remaining 70% of arrested Fzr1-/- embryos displayed chromatin arrangements that were never observed in Fzr1fl/fl embryos (Figure 6.13). About 15% (7/44) of Fzr1-/- embryos although arrested in interphase, possessed binucleated blastomeres as seen in Figure 6.12Bi. Another 30% (13/44) had either micronuclei or fragmented chromatin in one or both blastomeres (Figure 6.12Bii & iii respectively). In the remaining 30% (12/44) of Fzr1-/- arrested embryos there was at least 1 blastomere in mitosis. In some cases distinctive chromatin characteristic of prophase, prometaphase or telophase were observed (Figure 6.12Biv).

Page | ‐ 153 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Figure 6.12 Examination of cell cycle phases in 2-cell arrested parthenotes after 4 days in culture (A) 2-cell arrested Fzr1fl/fl and Fzr1-/- embryos blocked in interphase. (BB) 2-cell arrested Fzr1-/- embryos with (i) binucleated DNA, (ii) micronuclei, (iii) fragmented DNA, and (iv) mitotic cell with condensed chromatin. Scale bar, 20m.

Page | ‐ 154 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

(6) 100

80 (24) 60 (20) 40

20 Arrested embryos (%) (0) 0 fl/fl -/-fl/fl -/- Interphase Mitosis

Figure 6.13 Percentage of 2-cell arrested Fzr1fl/fl and Fzr1-/- embryos at interphase or undergoing mitosis after day 4 in culture Percentage of embryos with either both blastomeres in interphase or at least 1 blastomere at mitosis. Chromatin from 2-cell arrested Fzr1fl/fl and Fzr1-/- embryos was examined. Embryos with decondensed chromatin were classified as being in interphase, while embryos with condensed chromatin and had no distinct nuclear envelope were classified as undergoing mitosis. In parenthesis, the number of embryos analysed.

Page | ‐ 155 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.2.4. First mitotic division in Fzr1 knockout embryos It was possible that the 2-cell stage arrest of Fzr1-/- embryos might have been caused by an accumulation of errors from the preceding mitosis. To investigate this further, MII eggs were microinjected with H2B-mCherry cRNA prior to activation. This would allow visualization of the chromatin during the first mitotic division using live cell imaging. In all of the control Fzr1fl/fl embryos (n=13) following pronuclei formation, there was a coalescing of the two pronuclei in a process known as syngamy. This produces a mononuclear embryo that will then begin the mitotic process giving rise to a 2-cell embryo (Figure 6.14 and Figure 6.16). However, this was not the case in about 33% of pronuclei fusion. The difference in the number of embryos undergoing syngamy in control and Fzr1-/- embryos was found to be statistically significant (p=0.04, 2 test; Figure 6.16). In Fzr1-/- embryos the 2 pronuclei each formed independent mitotic spindles and underwent separate divisions at the same time. This consequently resulted in the formation of a 2-cell embryo that was binucleated (Figure 6.15, Figure 6.12Bi).

Despite the above observations, there was still approximately 67% (n=8/12) of Fzr1-/- embryos that did carry out proper syngamy. However, it was observed from live cell imaging that while only a small proportion of control Fzr1fl/fl (31%, n=4/13) embryos presented with errors during the first mitotic division, abnormalities in chromosome segregation were observed in all Fzr1-/- (100%, n=8/8) embryos (Figure 6.17). The difference in the number of embryos presenting with errors during the first embryonic mitotic division was found to be statistically significant between controls and Fzr1-/- embryos (p<0.005, 2 test; Figure 6.18). In the 4 control embryos, lagging chromosomes were observed during anaphase but were eventually resolved by the end of the mitotic division, giving rise to morphologically normal 2-cell embryos. The same observation was seen only in 1/8 of Fzr1-/- embryos. Instead, 4/8 of Fzr1-/- parthenotes with lagging chromosomes went on to form micronuclei at the end of mitosis in the 2-cell embryos, while 3/8 of them were unable to complete mitosis and remained arrested during mitosis (Figure 6.17 and Figure 6.18).

Page | ‐ 156 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Figure 6.14 First mitotic division in an Fzr1fl/fl embryo Representative images from live ceell imaging of an Fzr1fl/fl embryo expressing H2B-mCherry during the first mitotic division. Time stamp (hh:mm) represents time elapsed relative to the first image acquired. At time 00:00, the embryo has 2 pronuclei. From time 11:55 until 12:25, there is the fusion of pronuclei giving rise to a mononuclear embryo. At time 13:20, chromosomes have aligned on a metaphase plate and anaphase was observed between 14:15 and 14:45, before finally forming a 2-ceell embryo by 15:10, which was veriified by the formation of a nuclear envelope around the nucleus of each blastomere. Scale bar; 500m.

Page | ‐ 157 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Figure 6.15 First mitotic division in an Fzr1-/- embryo Representative images from live cell imaging of an Fzr1--/- 1-cell pathenote expressing H2B- mCherry during the first mitotic division. Time stamp (hh:mm) relative to first image. At time 00:00, the embryo has 2 pronuclei. No fusion of pronuclei was observed in this embryo. Instead at 11:05, the chromatin in each of the pronuclei started to condense and began congression along independent metaphase plates such that 2 sets of separate aligneed chromosomes can be observed at 11:50. Anaphase was then initiated simultaneously in each set of chromosomes at 14:55, forming a 2-cell embryo that was binucleated in each blastomere by 22:10. Scale bar; 50m.

Page | ‐ 158 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

p=0.04*

(13) 100

80 (12)

20 Syngamy of embryos (%) 0 fl/fl -/-

Figure 6.16 Percentage of Fzr1fl/fl and Fzr1-/- embryos that underwent syngamy Rate of syngamy in Fzr1fl/fl and Fzr1-/- parthenote embryos following egg activation. Significantly more control embryos were observed to have pronuclei fusion as compared to Fzr1-/- embryos following pronuclei formation (*, p=0.04, 2 test). In parenthesis, number of embryos analysed.

Page | ‐ 159 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Figure 6.17 Errors duringn the first mitotic division in Fzr1-/- parthenotes Representative images of Fzr1-/- 1-cell parthenotes that experienced abnormalities during the first mitotic division. Top; example of an embryo displaying lagging chromosomes, middle; an example of an embryo that failed to resolve a lagging chromosome that went on to form micronuclei; and bottom an embryo that remained mitotically arrested. Scale bar; 50m.

Page | ‐ 160 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

* p<0.005

(8) 100 lagging 80 lag + MN )

% arrest 60

(13) 40

Mitotic Error ( 20

0 fl/fl -/-

Figure 6.18 Percentage of 1-cell parthenotes that experienced mitotic difficulties during live cell imaging of first mitosis The percentage of Fzr1fl/fl and Fzr1-/- embryos that had lagging chromosomes, formed micronuclei or were arrested during the first mitotic division. Only a third (n=4/13) of control parthenotes showed lagging chromosomes during anaphase and these were eventually resolved by the end of the mitotic division. All Fzr1-/- parthenotes that had successfully undergone syngamy presented with lagging chromosomes and only 1/8 was able to resolve the lagging chromosome and form a morphologically normal 2-cell embryo. In 4/8 Fzr1-/- parthenotes, the lagging chromosomes went on to form micronuclei in the 2-cell embryo (lag+MN), while the remaining 3/8 Fzr1-/- embryos remained arrested during mitosis. The number of embryos that presented with mitotic errors was significantly different between control and Fzr1-/- embryos (p<0.005, 2 test). In parenthesis, number of embryos analysed.

Page | ‐ 161 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.2.5. Aneuploidy rates in Fzr1 knockout mice The loss of APCFzr1 has been reported to increase aneuploidy rates in mouse oocytes cultured in vitro (Reis et al., 2007), and also in mouse embryonic fibroblasts (MEFs) (Engelbert et al., 2007; Gutierrez et al., 2010). Therefore, I wanted to investigate if the 2- cell arrested Fzr1-/- embryos (Section 6.2.3) were also aneuploid. To examine this, embryos were cultured for sufficient time to allow S-phase entry after the 2-cell stage and were held in metaphase arrest by treatment with the spindle destabilizing drug, nocodazole (Jordan et al., 1992; Wassmann et al., 2003). Embryos were subsequently washed out into media to recover for an hour before chromatin spreading by monastrol-treatment and sister kinetochores were then immunostained using CREST antibody. Since somatic mouse cells contain 20 pairs of chromosomes, there would be 40 sister kinetochores in each diploid cell. However because these 2-cell embryos were fixed after S-phase, but prior to completion of mitosis, they should possess a 4n DNA content and thus have 80 sister kinetochores (Figure 6.19).

More than 80% (23/28) of Fzr1fl/fl embryos contained the expected number of chromosomes. However, for Fzr1-/- embryos it was not possible to treat and fix the embryos during metaphase of their second embryonic cell cycle, possibly because they were delayed and asynchronous in their cleavage divisions. Unfortunately, treating them at any other stage of the cell cycle would not produce a spread sufficient for making counting of sister kinetochores possible (Figure 6.21). Out of the 60 Fzr1-/- 2-cell arrested embryos analysed after 4 days in culture, only 1 (Figure 6.21vii) was able to produce a spread that could be accurately examined, containing 80 sister kinetochores. As such, it was not possible to examine the ploidy state of Fzr1-/- 2-cell arrested embryos.

Page | ‐ 162 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

A Brightfield Hoechst CREST Merge

B 7 1 8 2 3 4 5 6

15 16 17

9 18 19 11 10 13 20 21 22 12 14

23 33 37 29 32 36 24 30 34 35 38 27 31 25 28 41 42 26 40 43 39 44

47 57 64 48 49 58 53 63 52 59 62 45 46 51 61

55 54 56 60

71 67 72

66 68 73 79 80 69 76

70 74 65 75 78 77

Figure 6.19 Chromosomal counts in an Fzr1fl/fl embryo (A) Representative Z-stack image of a 2-cell embryo after undergoing S-phase and monastrol treatment to spread the chromosomes during metaphase. Scale bar, 20m. (B) Chromosomes from (A), dashed box; shows merged images CREST staining and DNA of 1 blastomere. Single sections of scanned images to depict counting of kinetochore pairs. Scale bar, 5m.

Page | ‐ 163 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

100

40 (28) Total Embryos(%) Total 20

0 Aneuploid

Figure 6.20 Aneuploidy rate in Fzr1fl/fl 2-cell embryos 48 hours post-hCG Percentage of Fzr1fl/fl embryos that were aneuploid (> or < 80 kinetochore). In parenthesis, number of embryos analysed.

Page | ‐ 164 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis Brightfield Hoechst CREST Merge i

iii

vii

Figure 6.21 Monastrol induced chromosome spreads in Fzr1-/- embryos. (i) Representative Z-stack images of Fzr1-/- 2-cell embryos after monastrol treatment. (ii) chromosomes from (i), showing colocalization of CREST and Hoechst staining. (iii) Blastomere in interphase; (iv - vii) blastomeres examined during different times between 2- and 4-cell stage. Scale bar, (i) 20m , (ii-vii) 5m.

Page | ‐ 165 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.2.6. Increased -H2AX foci in Fzr1-/- arrested embryos.

Since Fzr1 has been implicated in the genomic stress response (refer to Section 1.5.2)(Engelbert et al., 2007; Floyd et al., 2008; García-Higuera et al., 2008; Li et al., 2008; Schwab et al., 1997; Sudo et al., 2001), I decided to examine for -H2AX immunostaining in both Fzr1fl/fl and Fzr1-/- parthenotes. -H2AX is a phosphorylated variant of histone H2AX that arises specifically at sites of damaged DNA (Fillingham et al., 2006).

Mitomycin C (MMC) is a chemotherapeutic agent that causes DNA interstrand crosslinks and has been used widely in research to induce DNA damage to examine repair mechanisms (Fu et al., 2012). To determine if the -H2AX antibody used was specific to damaged DNA, GV arrested oocytes were treated with 20g/ml MMC for 4 hours, before being immunostained for -H2AX. As expected, MMC treated GV oocytes were heavily positive for -H2AX with numerous distinct foci of damaged DNA (Figure 6.22A), which were absent in untreated controls (Figure 6.22B).

After confirming the ability of the -H2AX antibody to detect damaged DNA, 2-cell arrested Fzr1-/- embryos were fixed at day 4 (n = 20, Figure 6.23) as well as Fzr1fl/fl embryos which had reached morulae stage by this time (n = 20). 2-cell stage Fzr1fl/fl embryos (n = 23) were also fixed at day 2, representative of the same developmental stage (Figure 6.24). All embryos were immunostained for -H2AX. -H2AX foci were readily observed in 81% of Fzr1-/- 2-cell arrested embryos (n=20) but not in most Fzr1fl/fl controls; with only 15% of 2-cell embryos and 10% of morulae displaying a positive signal (Figure 6.25). There was no statistical significance in the number of -H2AX foci present between Fzr1fl/fl 2-cell embryos and morulae (n.s., p = 0.52; 2 test). However, the number of - H2AX foci present in Fzr1-/- 2-cell arrested embryos were statistically greater compared to Fzr1fl/fl 2-cell embryos and morulae (p < 0.001; 2 test).

Page | ‐ 166 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

A -H2AX Propidium Ioidide Merged

i GV Z- StackedZ- 20ug/mlMMC

ii Z-stacked of Z-stacked Sections 4 - 10 iii Z-stacked of Sections 17 11- iv Z-stacked of Sections 18 - 27 v Z-stacked of Sections- 34 28

B GV Untreated Z- Stacked

Figure 6.22 -H2AX foci in GV oocytes treated with mitomycin C

(A) Representative image of -H2AX immunostaining in a GV oocyte treated with 20g/ml MMC for 4 hours. (i) Z-stack of scanned sections. (ii to v) Z-stack of several scanned sections showing specific -H2AX foci (overlay, yellow); scale bar, 10m. (B) Representative image of an untreated GV oocyte showing no detectable -H2AX foci; scale bar, 10m.

Page | ‐ 167 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

-H2AX Propidium Ioidide Merged

i KO Day 4 Day KO Z- Stacked 2-cell arrest 2-cell Z-stacked of Sections13 5 - Z-stacked of Z-stacked Sections30 23 - iv Z-stacked of Z-stacked Sections37 32 - v Z-stacked of Sections40 38 -

Figure 6.23 -H2AX immunostaining in an Fzr1-/- embryo after 4 days in culture

(i)Representative image of -H2AX immunostaining in a 2-cell arrested Fzr1-/- embryo at Day 4 in culture. (ii to v) Z-stack of several scanned sections to show the presence of positive - H2AX sites (green foci and circles) on individual chromosomes. Scale bar, 10m.

Page | ‐ 168 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

-H2AX Propidium Ioidide Merged

i Morula Z- stacked fl/fl Day 4 Day fl/fl

ii Inset Z- stack of stack Z-

iii Z-stacked of Sections 2 - 5 - 2 Sections

iv Z-stacked of Z-stacked Sections 6 - 10

v Z-stacked of Sections - 13 11 vi Z-stacked of Sections 14 - 16

Figure 6.24 -H2AX immunostaining in an Fzr1fl/fl embryo

(i) Representative -H2AX immunostaining in a Fzr1fl/fl embryo at Day 4 in culture. (ii) Dashed circle from (i), a blastomere undergoing mitosis. (iii to vi) Z-stack of several scans, absence of any detectable -H2AX foci on chromosomes. Scale bar, 10m.

Page | ‐ 169 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

100 b (20) 80

60 (%) 40 a (23) a 20 (20) -H2AX positive blastomeres  0 fl/fl D2 fl/fl D4 -/- D4 2cell morula 2cell

Figure 6.25 -H2AX counts in Fzr1fl/fl and Fzr1-/- embryos

Percentage of blastomeres that had positive -H2AX foci on their chromatin at either Days 2 or 4 in culture. In parenthesis, number of embryos analysed; different letters denotes significantly different (a: n.s., p = 0.52 and b: *, p<0.0001; 2 test).

Page | ‐ 170 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.2.7. Delayed embryonic development results in early compaction in 4-cell Fzr1-/- embryos In the small proportion of Fzr1-/- embryos (8/76) that did not arrest at the 2-cell stage, their developmental progression was examined. Morphologically, the timing of compaction, relative to hormonal stimulation of mice, and so timing of egg activation, was not significantly different between Fzr1fl/fl and Fzr1-/- embryos (79.2 ± 5.5 versus 78.2 ± 4.7 hours post hCG respectively, p = 0.66; Student’s t-test, Figure 6.26). At this time, ~80 hours post hCG, most Fzr1fl/fl embryos had formed morulae. However, because of their slower cell cycle division, this corresponded to the 4-8 cell stage in the majority of Fzr1-/- embryos (Figure 6.9 and Figure 6.10).

One of the hallmarks of compaction is the association of apposing cell membranes between adjacent blastomeres, resulting in intercellular flattening that is mediated by calcium- dependent adhesion involving E-cadherin (Fleming et al., 2001; Hyafil et al., 1980; Peyriéras et al., 1983). Therefore, to investigate how the loss of Fzr1 affects compaction, E-cadherin immunofluorescence in Fzr1fl/fl and Fzr1-/- embryos was examined. E-cadherin signal was detected in 64% of Fzr1-/- (n = 17) at the 4-cell stage but was never observed in Fzr1fl/fl embryos (n = 17) at the same developmental stage (p <0.001; 2 test, Figure 6.27). As expected in Fzr1fl/fl embryos, E-cadherin immunostaining was only cytoplasmic in non- compacting 4- and 8-cell embryos, and stained intensely at sites of cell-to-cell contact between adjacent compacting morulae (Figure 6.28).

These observations suggest that embryos retain the ability to undergo compaction even in the absence of Fzr1, and this process is independent of the number of blastomeres present. Despite the ability of Fzr1-/- embryos to undergo compaction, few (5% versus 53%, n= 5/107 vs 89/169, p < 0.001; 2 test, Figure 6.29) developed past the morulae stage to form blastocyst, and were instead dead by 120 hours post-hCG.

Although the percentage of control embryos that were observed to be dead by 120 hours post-hCG was relatively high at 53%, this was to be expected of parthenotes created from this C57Bl6 strain of mice, as determined from Chapter 5, Section 5.2.3. F1 hybrid parthenotes, which were cultured simultaneously, showed 85% (121/141) blastocyst formation, and this was significantly higher than either Fzr1fl/fl or Fzr1-/- embryos at 120 hours post-hCG (p < 0.001; 2 test, Figure 6.29). Together, the observations made in this chapter and those from Section 5.2.3 indicated that the culture system employed here was

Page | ‐ 171 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

effective for sustaining in vitro development of preimplantation embryos and the high mortality rate seen in all Fzr1 mice (Fzr1fl/fl and Fzr1-/-) was due to the strain of mice.

Page | ‐ 172 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

A Brightfield Hoechst

fl/fl Before compaction

fl/fl

After -/- compaction

n.s. 100 (19) (8) 80

40 Compaction time (hours post-hCG) 20

0 fl/fl -/-

Figure 6.26 Timing of compaction in Fzr1fl/fl and Fzr1-/- embryos. (A) Image of Fzr1fl/fl and Fzr1-/- embryos after Day 4 in culture showing the morphology of an embryo before and after initiation of compaction. Scale bar, 10m. (B) Timing of compaction in Fzr1fl/fl and Fzr1-/- embryos (n.s., p = 0.66; t-test).

Page | ‐ 173 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis A

100 *

80 (17)

40 of total (%)

compacted 4-cell embryos (17) 0 fl/fl -/- B E-cadherin + chromatin E-cadherin chromatin

-/- 4-cell 80hr 4-cell 55hr f/f

fl/fl 8-cell 70hr Morula 80hr Figure 6.27 Slow division of Fzr1-/- embryos results in compaction at the 4-cell stage.

(A) Percentage of 4-cell embryos (~55 hours of culture for Fzr1fl/fl 4-cell embryos and >100 hours post-hCG in Fzr1-/-) were scored for compaction rates based on morphology (*, p = <0.001; 2 test). (B) Representative images of E-cadherin immunostaining in embryos at the indicated times. Strong E-cadherin signal was observed in Fzr1-/- 4-cell embryo and Fzr1fl/fl morula. Scale bar, 20m, time indicated are hours post hCG. In parenthesis, the number of embryos analysed.

Page | ‐ 174 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis 300 400 400 500 400 m) 300 m) 300 m)  m)  200   300 200 200 200 100 Distance ( Distance ( Distance ( 100 Distance ( 100 100 0 0 0 0 0 0 0

0 80 60 40 20

80 60 40 20 80 60 40 20

80 60 40 20 100

100

100 Intensity Intensity Intensity Intensity +

chromatin E-cadherin

4-cell 4-cell 8-cell Morula -/- fl/fl Figure 6.28 Quantitative analysis of E-cadherin immunofluorescence in Fzr1-/- and Fzr1fl/fl embryos Confocal sections of Fzr1fl/fl and Fzr1-/- embryos at the time points indicated showing E- cadherin immunofluorescence. Intensity traces of E-cadherin were plotted; marked by solid white lines using one of the Z-sections and was measured in an arbitrary fluorescence scale using 8-bit images. As strong E-cadherin signal was observed between adjacent blastomeres in Fzr1-/- 4-cell stage embryos and Fzr1fl/fl morula indicative that compaction had been initiated. Scale bar, 20m.

Page | ‐ 175 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

c 100 (107)

b 60 (169)

40 a

Dead Embryos (%) 20 (141)

0 F1 fl/fl -/-

Figure 6.29 Death rate of embryos after 120 hours post hCG Assessment of death rate in F1 hybrid, Fzr1fl/fl and Fzr1-/- embryos after 120 hours post-hCG. Different letters denote statistical significance (a-c: *, p < 0.001; 2 test).

Page | ‐ 176 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

6.3. Discussion

6.3.1. Fzr1 knockout mice Previous examination of the role of Fzr1 in early embryonic development has been hampered by the presence of maternal transcripts and protein stores in the egg accumulated during oocyte maturation. Here, by using an oocyte-specific Fzr1 knockout approach, which is free of these drawbacks, it has been shown that this co-activator of the APC is essential for early mouse embryonic development. Since few parthenotes generated in the absence of Fzr1 successfully developed past the first three embryonic mitotic divisions, this demonstrates that Fzr1 is essential even at the earliest stages of mouse embryonic development, and is therefore different from observations based on conventional knockouts (García-Higuera et al., 2008; Li et al., 2008), where embryos were able to develop to postimplantation stages, before dying at approximately E10.5. This difference in developmental potential during preimplantation embryogenesis is likely to be due to the presence of maternal Fzr1 stores in the conventional knockout. Here, in the absence of any Fzr1 during early embryogenesis, parthenotes generated from Fzr1-/- eggs were observed to experience developmental difficulties and hence were not able to form blastocysts.

The loss of Fzr1 resulted in the failure of syngamy in some Fzr1-/- parthenotes, producing binucleated 2-cell embryos. There was also increased genomic instability, resulting in a proportion of Fzr1-/- embryos arresting at the 2-cell stage. When Fzr1 was absent in embryos, parthenotes displayed delayed and asynchronous development, and this consequently resulted in the premature initiation of compaction at the 4-cell stage, and no blastocysts were ever seen in Fzr1-/- parthenotes.

6.3.2. Loss of Fzr1 does not affect pronuclear formation in parthenotes The use of strontium on eggs to produce parthenotes is widely used (Bos-Mikich et al., 1997; Kline, 1996; Rogers et al., 2006), as is the process of using CCD to inhibit cytokinesis and so generate diploid embryos (Balakier and Tarkowski, 1976). This technique of creating diploid parthenotes has been shown to result in the same rate of preimplantation development as when embryos are created by in vitro fertilization (Liu et al., 2002). Here, I successfully replicated this technique and found that the rate and length of time taken for Fzr1-/- eggs to form the 2 pronuclei after activation was no different to controls, which suggests that Fzr1 does not have an essential role in mediating pronuclear

Page | ‐ 177 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

formation; even though measurable APCFzr1 activity had been detected in MII eggs following activation at fertilization (Chang et al., 2004).

Previously, it has been reported that the method of activation employed affects gene expression in parthenotes (Cui et al., 2007; Rogers et al., 2006). So here the levels of Fzr1 expression in parthenotes during various stages of embryogenesis were assessed to see if they were normal. Activation performed in the presence of strontium and CCD treatment did not affect Fzr1 expression during embryogenesis as compared to fertilized blastocysts. Therefore, the method for parthenogenetic activation was deemed appropriate for further studies.

6.3.3. Formation of binucleated Fzr1-/- embryos as a result of failure of pronuclear fusion

Approximately one-third of interphase arrested Fzr1-/- embryos were binucleated, a phenotype that was never seen in controls. In addition, the same observation of binucleate cells had also been previously reported in Fzr1-/- MEFs (García-Higuera et al., 2008; Li et al., 2008). Since Fzr1 has been implicated in regulating cell cycle progression (refer to Section 1.4), the formation of these binucleated Fzr1-/- embryos could have been due to a failure of cytokinesis in the preceding mitosis. Despite the above being a plausible mechanism for the generation of binucleated embryos, real-time imaging revealed a different cause. Binucleated embryos were created by a failure in the coalescence of DNA of both pronuclei (syngamy/ karyogamy). This was an intriguing observation since the process of syngamy is an important milestone for the embryo, bringing about chromosomal mixing in both the maternal and paternal pronuclei (Lillie, 1919; Longo, 1973; Longo and Anderson, 1968), however little is known about the underlying mechanism of this process.

To date, most studies on syngamy have been carried out in non-mammalian models such as zebrafish, sea urchins and starfish (Abrams et al., 2012; Duncan et al., 2009; Lindeman and Pelegri, 2012; Schatten et al., 1985). Even though the balance of Cyclin B1-CDK1 activity (Tachibana et al., 2008) and the identification of several genes, such as futile cycle (fue)(Dekens et al., 2003), lymphoid-restricted membrane protein (lrmp)(Lindeman and Pelegri, 2012), Prm3p/Kar5 (Shen et al., 2009) and Brambleberry (Abrams et al., 2012) have been reported in various organisms to mediate microtubule formation or fusion of nuclear membranes during syngamy, little is known about this process in mammals.

Page | ‐ 178 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Here in Fzr1-/- embryos, it was observed that there was a failure in either pronuclei migration or fusion, such that each pronucleus formed an independent mitotic spindle and underwent a separate mitotic division, producing binucleated 2-cell embryos. However, these observations were not seen in all embryos, and could be due to differences in low level expression of Fzr1, below the level of detection, since knockout of Fzr1 caused by Cre-recombinase expression may not always be 100% effective. As a result, this extremely low expression of Fzr1 may have a significant impact on the ability of Fzr1-/- embryos to continue development.

It has been reported that microtubules within fertilized eggs form sheaths that envelope adjacent pronuclei, guiding them together to fuse, such that treatment with drugs that inhibit microtubule formation prevent pronuclear fusion (Schatten et al., 1985). Therefore, potential candidates that could explain the block to syngamy include proteins that are involved in microtubule/microfilament dynamics, such as Plk1 and Aurora kinases, which are reported Fzr1 substrates (Carmena and Earnshaw, 2003; Floyd et al., 2008; Nigg, 2001; Taylor and Peters, 2008). Previous studies have demonstrated the role of Fzr1 in regulating microtubule/spindle function (Holt et al., 2012; Schindler and Schultz, 2009), as discussed in Chapter 4. Therefore, Fzr1 may have a role in regulating microtubule dynamics in zygotes, which is necessary for pronuclei fusion. To investigate this further, Fzr1-/- embryos could be injected with a fluorescently labelled tubulin to examine for microtubule formation and arrangement during this process.

6.3.4. Increased genomic stress in Fzr1-/- embryos Fzr1 has been implicated in many responses to genomic stress, and can be regarded as a tumour suppressor (Engelbert et al., 2007; García-Higuera et al., 2008; Qiao et al., 2010). Briefly, there are pathways in cells that prevent cell proliferation until damaged DNA has been repaired, by either the sensor kinase ataxia-telangiectasia mutated (ATM) or ataxia- telangiectasia and Rad3-related (ATR) (Bartek et al., 2004; Cimprich and Cortez, 2008; Kastan and Bartek, 2004). An important regulator of damaged DNA is ATM, which phosphorylates H2AX, generating an epitope recognized by the anti--H2AX antibody (Lukas et al., 2011). High incidence of fragmented DNA in arrested Fzr1-/- embryos suggest that they were experiencing significant DNA stress. This increase of -H2AX foci in 2-cell arrested Fzr1-/- embryos was probably due to breakages of chromatin, and as such is consistent with fragmented DNA observed in Fzr1-/- embryonic fibroblasts (García-Higuera et al., 2008; Li et al., 2008).

Page | ‐ 179 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

APCFzr1 has been reported to be active from late mitosis to the G1-S transition of the cell cycle (Peters, 2006), and Fzr1 loss has been implicated in the shortening of G1-phase and forced premature S-phase entry. This early entry into the replicative stage, before the cell is ready, could influence substrate stabilization, eg., Aurora kinases and Plk1 (Engelbert et al., 2007; Sigl et al., 2009). Another important protein target of APCFzr1 activity is Geminin, which acts as a promoter and an inhibitor of DNA replication (refer to Section 1.4.4)(McGarry and Kirschner, 1998; Wohlschlegel et al., 2000; Yanagi et al., 2002). Briefly, interaction of Geminin and Cdt1 mediate initiation of DNA replication by regulating chromatin loading of the MCM complex. Geminin inhibits DNA synthesis by preventing loading of the MCM complex into the pre-RC, preventing the origin from firing (McGarry and Kirschner, 1998). During mitosis, Geminin stabilizes Cdt1, maintaining sufficient amounts for the licensing of replication origins in the following cell cycle (Ballabeni et al., 2004). As such, when APCFzr1 activity is dysregulated, faithful DNA segregation following replication will not be governed, giving rise to lagging chromosomes during anaphase that can result in fragmented DNA and micronuclei formation. Therefore the loss of Fzr1 in embryos would lead to compromised fidelity during DNA replication, resulting in the increased incidence of damaged DNA as seen in Fzr1-/- embryos.

Similar to Fzr1-/- embryos, Fzr1-/- fibroblast cells also displayed a variety of aberrations such as, bi- or multinucleated cells, misaligned chromosomes during metaphase or they possessed multipolar spindles; probably resulting from an increase of genomic instability. (García-Higuera et al., 2008). In addition, osteosarcoma U2-OS cells that lack Fzr1 are also multinucleated (Engelbert et al., 2007), suggesting a conserved defect associated with the loss of Fzr1.

6.3.5. Loss of Fzr1 delays embryo development Even though viable MII eggs could be isolated and parthenogenetically activated from Fzr1-/- mice, embryo development was strikingly slower as compared to Fzr1fl/fl controls during the early cleavage divisions. Studies performed in MEFs and human cell lines lacking Fzr1 have also showed similar observations of slower rates of proliferation (Engelbert et al., 2007; García-Higuera et al., 2008; Li et al., 2008). Furthermore, examination of Fzr1 mutant MEFs revealed that a smaller proportion of cells were undergoing active DNA replication (Li et al., 2008), and were instead entering quiescence prematurely. The loss of Fzr1 has also been implicated with increased transcription of p16, a senescence regulator and is thought to account for slower cell growth and premature entry

Page | ‐ 180 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

into quiescence in mutant MEFs lacking Fzr1 (Li et al., 2008), suggesting that Fzr1 could have a role in maintaining the replicative lifespan of cells (García-Higuera et al., 2008; Li et al., 2008).

In the cell cycle, Fzr1 is important for maintaining G1 progression (Blanco et al., 2000; Jacobs et al., 2002; Sudo et al., 2001; Visintin et al., 1997), regulating S-phase entry (Bashir et al., 2004; Sigl et al., 2009; Wäsch and Cross, 2002; Wei et al., 2004), and mediating mitotic exit (García-Higuera et al., 2008). It may be at any of these timepoints the absence of Fzr1 consequently delays cell cycle progression. In the somatic cell cycle, loss of Fzr1 has been shown to result in premature S-phase entry due to precocious accumulation of mitotic cyclins that triggered untimely DNA replication (Sigl et al., 2009). In addition to mitotic cyclin accumulation, loss of Fzr1 also resulted in APCFzr1 substrate stabilization such as: Skp2, Aurora kinases, and Cdc20, that led to aberrations in cell cycle progression (Engelbert et al., 2007; García-Higuera et al., 2008; Holt et al., 2012; Li et al., 2008). The timely degradation of these Fzr1 substrates during the cell cycle is essential for ensuring smooth progression through mitosis. During anaphase, Aurora A is important for mediating spindle midzone organization, timing of spindle elongation as well as cytokinesis (Floyd et al., 2008; García-Higuera et al., 2008; Peters, 2006), as such governing proper progression of cytokinesis and mitotic exit. In oocytes, the loss of Fzr1 led to Cdc20 stabilization, which consequently led to premature SAC satisfaction, due to quicker assembly of the meiotic spindle. As a result, abnormal bivalent congression and defects in chromosome separation leading to non-disjunction was observed, , resulting in increased aneuploidy rates (Holt et al., 2012; Reis et al., 2007). Therefore from the above discussed, loss of Fzr1 could lead to increased genomic instability due to premature S- phase entry and defective mitotic exit due to inappropriate substrate stabilization could in part account for delays experienced by cleavage stage Fzr1 -/- embryos.

The asynchrony observed in Fzr1-/- embryos in their timing of division as compared with Fzr1fl/fl parthenotes suggests that the loss of Fzr1 results in varying degrees of difficulties in completing cell divisions for individual embryos. These problems are likely to be numerous because of the vast array of substrates that are targeted by APCFzr1 (Carmena and Earnshaw, 2003; Lindon and Pines, 2004; Qiao et al., 2010; Wäsch and Engelbert, 2005). Even though oocytes and eggs collected from Fzr1-/- mice did not show any detectable Fzr1, however this could simply be because the expression of Fzr1 may just have fallen below the level of our detection using Western blot analysis. As mentioned in Section 6.3.3, there may be differences in low level Fzr1 expression, and as such, the scale of the problem in Page | ‐ 181 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

each parthenote may vary slightly between individuals. Therefore, there is the possibility that variations in extremely low levels of Fzr1 expression might have profound influences on the developmental outcome of Fzr1-/- embryos, and possibly account of the heterogeneity of observations made.

6.3.6. Loss of Fzr1 results in 2-cell arrest It is known that embryos from several strains of mice block at the 2-cell stage when cultured in vitro (Hamatani et al., 2004; Schultz, 2002; Summers et al., 1995; Wang et al., 2004). In the previous chapter, it has been established that embryos derived from C57Bl6 mice were successfully able to form blastocysts in the medium used here (refer to Chapter 5), such that few Fzr1fl/fl embryos were seen arrested at the 2-cell stage. As such, it was initially surprising when Fzr1-/- embryos were observed to arrest at the 2-cell stage. The arrest in Fzr1-/- parthenotes is attributed to be due to Fzr1 loss rather than treatment using CCD, since control Fzr1fl/fl parthenotes did not have any developmental arrest even though they were generated using the same method. In addition, damage caused to the oocytes due to Fzr1 loss has also been ruled out because live pups were produced when Fzr1-/- females were mated with wild-type males as discussed previously (Section 4.2.4). The fact that viable offspring could be generated when Fzr1-/- females were mated with wild-type males, but parthenote embryos from the same females that were lacking Fzr1 completely were not able to produce blastocysts, suggests that the paternal Fzr1 protein present in the sperm can perform a knockout rescue. However, this still remains to be formally proven and potentially the effect of Fzr1 may only ever be apparent in parthenotes.

In embryos following the loss of Fzr1, the majority failed to complete the second mitotic division and remained arrested at the 2-cell stage. Conventionally when embryos arrested at the 2-cell stage, this block has been associated with the G2 phase of the cell cycle (Goddard and Pratt, 1983). Here, it was interesting to note that a proportion of 2-cell arrested Fzr1-/- embryos were not blocked in interphase. In addition, there was also no particular phase of the cell cycle delineating the arrest due to Fzr1 loss, with only 45% of Fzr1-/- arrested 2-cell embryos in interphase and the remaining 55% at some stage of mitosis.

Loss of Fzr1 resulted in mitotically 2-cell arrested Fzr1-/- embryos displaying a variety of spindle and segregation defects; including arrest in telophase without cytokinesis and elongated spindles during prometaphase arrest. Similar spindle and chromosomal defects had previously been reported in both HeLa cells and MEFs lacking Fzr1 (Floyd et al., 2008; Page | ‐ 182 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

García-Higuera et al., 2008). Since APCFzr1 targets many substrates for degradation during the cell cycle, the loss of Fzr1 therefore resulted in the accumulation of these substrates. During exit of mitosis, the cell degrades proteins such as Aurora A, Aurora B and Plk1 in a APCFzr1-dependent manner (Pines, 2006), in particular, reduced APCFzr1 activity has been found to specifically result in Aurora kinases stabilization during mitotic exit (Floyd et al., 2008), highlighting the importance of the degradation of these kinases in the control of mitotic exit and cytokinesis. Therefore the loss of Fzr1 and the above described defects could probably reflect higher levels of these kinases and further work will have to be performed to investigate this.

6.3.7. Aneuploidy rates in the absence of Fzr1 As previously mentioned, the loss of APCFzr1 activity has been reported to result in increased rates of aneuploidy in oocytes cultured in vitro from GV arrest (Reis et al., 2006). Loss of Fzr1 in MEFs have also shown increased rates of aneuploidy (Engelbert et al., 2007; García-Higuera et al., 2008). Therefore, I wanted to see if the loss of Fzr1 in embryos would result in a similar phenomenon during development. Most techniques used for evaluating rate of aneuploidy require treatment of the samples during metaphase, such as in situ hybridisation with DNA probes and fluorescent in situ hybridisation, which is an air-drying technique to flatten chromosomes (Rothfels and Siminovitch, 1958; Tucker and Preston, 1996; Tutt et al., 1999). However, in Fzr1-/- embryos, assessment of aneuploidy could not be easily performed using the same monastrol technique that worked well on MII eggs and control Fzr1fl/fl embryos, because of the asynchrony of blastomere division. Even though Fzr1-/- embryos were treated with nocodazole to induce a metaphase arrest (Maro et al., 1986), and monastrol, to induce the formation of a monopolar spindle, and so spread the chromosomes (Khodjakov et al., 2003; Sumara et al., 2004). At various times, between 45 to 66 hours post-hCG, Fzr1-/- embryos were found not to arrest at metaphase, as such, further treatment of samples with monastrol did not enable kinetochores to be counted accurately. Due to asynchrony of blastomere divisions, it was difficult to determine the time embryos underwent DNA replication and with prolonged treatment of nocodazole, Fzr1-/- embryos began to look unhealthy or died during the procedure. For further studies, it still may be possible to explore aneuploidy induction in Fzr1-/- embryos using spectral karyotyping (SKY) - chromosomal painting. This could be performed to label individual chromosomes and thus identify aneuploid blastomeres. This technique is accurate, and is used to detect chromosomal translocations, multiple copies of a particular chromosome, and the presence of small chromosomal fragments (Liyanage et al., 1996; Rao et al., 1998; Page | ‐ 183 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

Schröck et al., 1997). However, this technique would also require chromosomes to be condensed and collection of samples may again prove difficult. In cases where whole genome duplications have occurred, embryos with chromosomes 3n, a potential method to detect this would be to dissociate embryonic cells and perform flow cytometric studies, such as fluorescence activated cell sorting (FACS). This technique has been used widely, such as in assessing the polyploidy state of TGCs during endoreduplication (Tanaka et al., 1998; Ullah et al., 2008).

6.3.8. Loss of Fzr1 results in initiation of compaction in 4-cell embryos Due to the loss of Fzr1, embryos experienced significant delays during the first three mitotic divisions, which were thought to induce the earlier onset of compaction in 4-cell staged Fzr1-/- embryos. Compaction is usually initiated in embryos at the 8-cell stage after blastomere polarization (Chen et al., 2010; Eckert and Fleming, 2008), and is marked by the formation of tight junctions between adjacent blastomeres and cell surface flattening (refer to Section 1.2.4). In agreement with previous reports, E-cadherin immunostaining was mainly cytoplasmic in non-compacting Fzr1fl/fl embryos at the 4- and early 8-cell stage. In contrast, E-cadherin was evident at sites of cell-to-cell contact in a large proportion of Fzr1-/- 4-cell embryos. However, in both control and Fzr1-/- embryos, compaction was initiated at the same time relative to egg activation. Therefore, even though loss of Fzr1 resulted in premature initiation of compaction, the process still occurred at the same chronological time relative to activation, suggesting that this process remains independent of the number of blastomeres present. In agreement with this, previous studies observed compaction in arrested 4-cell embryos using a pharmacological block to DNA replication (Smith and Johnson, 1985; Valdimarsson and Kidder, 1995). These observations suggest the presence of an embryonic clock, whose timing is independent of number of blastomeres present. In fact, this clock may be involved in a temporal (cyclical, eg. hours relative to embryo formation) or sequential order of developmental events governing various processes occurring during embryogenesis. In support of the idea that some aspects of embryogenesis, including compaction, are governed by a cytoplasmic clock, studies using CCD to block cytokinesis and so alter blastomere numbers, have found that the timing of compaction is not affected (Day et al., 1998; Johnson and Day, 2000; Wiekowski et al., 1991; Zhang et al., 2009). Early embryos therefore appear to be programmed to undergo certain characteristic development at specific times during embryogenesis. However, it remains largely unknown what mechanisms are behind these precise timings. It has been proposed that events happening during DNA replication at the 2-cell stage set in motion a Page | ‐ 184 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

‘developmental clock’ that controls gap junction assembly necessary for compaction (Valdimarsson and Kidder, 1995). However, it is important to note that developmental events occurring within the embryo are not necessarily controlled by a single mechanism. In Xenopus for example, embryos undergo an event known as midblastula transition (MBT), often connected with EGA (Kirschner et al., 1985). This event has been shown to be independent of the number of mitotic cycles the embryos have undergone, the number of DNA synthesis cycles, or the time lapsed since fertilization (Kobayakawa and Kubota, 1981). However, this event has been oversimplified and instead of a single cellular transition, MBT is the result of several temporally independent switches (Newport and Kirschner, 1982a; Newport and Kirschner, 1982b; Yasuda and Schubiger, 1992). Therefore it is important to take into account that as with MBT in Xenopus, compaction in mammals may not be dependent on just an embryonic clock governing the event. Effective cell-to- cell interactions and other independent processes in the embryo may also work collectively, affecting the progression of compaction and blastocyst formation.

Despite Fzr1-/- embryos being able to undergo compaction, no embryos were ever seen to undergo blastulation, and instead they died shortly after forming morulae. Since compaction had been initiated prematurely in Fzr1-/- embryos, at the 4-cell stage, there may be insufficient blastomere numbers for proper cell-to-cell communication. This is important because during compaction cell polarization occurs; based on spatial location of blastomeres relative to one another to form the TE, which is essential for blastocoelic cavity formation and specification of ICM cell population (Barcroft et al., 2003; Lewis and Wright, 1935). Therefore, the lack of sufficient blastomere numbers in compacted Fzr1-/- embryos could be a possible explanation as to why no parthenotes were observed to form blastocysts. Another possibility for the cell death at the morula stage could be defects in methylation reprogramming in these parthenotes. In the mouse embryo, it has been reported that stage- and tissue-specific DNA modifications, such as demethylation and remethylation occur during preimplantation embryogenesis (Monk et al., 1987; Singer et al., 1979). It has also been observed that in the blastocyst, cells of the ICM are demethylated before genome remethylation during reprogramming, while cells of the TE remain highly methylated (Dean et al., 2001; Fulka et al., 2004). In addition, global hypermethylation has been observed in the early embryo and only cells of the inner population in the compacted morula would be demethylated (Smith et al., 2012, personal communication, Li and O’neill, manuscript in preparation). As such, the absence of inner and outer cell populations in the compacted 4-cell Fzr1-/- morula may have disrupted the epigenetic modifications in

Page | ‐ 185 ‐

Chapter 6 Fzr1 knockout mice in embryogenesis

preparation for blastocyst formation. Furthermore, the maintenance of CpG methylation in newly synthesized DNA in cells is dependent on the enzyme DNA methyltransferase (DNMT1), and the proteasomal degradation of DNMT1 has been shown to be APCFzr1 dependent (Ghoshal et al., 2005); as such dysregulation in APCFzr1 activity would affect DNA methylation through DNMT1. Therefore, perhaps the lack of sufficient blastomere numbers in Fzr1-/- embryos and aberrant methylation/demethylation of CpG islands at the 4-cell stage due to premature compaction thus inhibited Fzr1-/- embryo developmental progression to form a blastocyst.

6.3.9. Concluding remarks I have shown in the current study that Fzr1 is crucial for early preimplantation mouse embryogenesis, and this is in contrast to previous observations using conventional Fzr1 knockouts that showed that this APC activator only plays an important role postimplantation, when endoreduplication is being initiated. In the absence of Fzr1, a large proportion of embryos do not develop past the first three mitotic divisions, and even those that do successfully develop for 4 days in culture failed to form blastocysts. Therefore, this parthenogenetic model using an oocyte-specific knockout of Fzr1 has enabled the examination of the role of Fzr1 during preimplantation embryo development for the first time.

Page | ‐ 186 ‐

Chapter 7 General discussion

7. General Discussion

The aim of the project was to investigate the role of Fzr1 during meiotic progression, meiosis MII arrest and activation as well as preimplantation embryo development. During the last decade, and including the period of my thesis study, it has been established that APCFzr1 is important in: (i) maintaining prophase I arrest in GV oocytes (Holt et al., 2011; Homer et al., 2009; Reis et al., 2006); and (ii) the smooth progression of oocytes through meiosis I (Homer et al., 2009; Reis et al., 2007). Additionally, APCFzr1 activity has been detected during the period following second polar body extrusion of in vitro activated MII mouse eggs (Chang et al., 2004), which is unusual because APCCdc20 activity only has been reported to mediate meiotic exit in eggs of many other non-mammalian species (Fay et al., 2002; Kitagawa et al., 2002; Lorca et al., 1998; Raff et al., 2002; Sigrist and Lehner, 1997). However, the involvement of Fzr1 had thus far, at the start of my thesis, only been addressed during in vitro culture, using antisense knockdown approaches. Knockout studies were published just prior to the start of my PhD, where it was found Fzr1 mediated endoreduplication of TGCs, a necessary event for placentation (García-Higuera et al., 2008; Li et al., 2008). Critically, however, for the purposes of studying Fzr1 during meiosis, due to the presence of maternal Fzr1 contribution, even a conventional knockout is not a particularly useful experimental tool.

At the start of my PhD period, the approach taken to study Fzr1 was miRNA knockdown; with the ultimate aim of generating an inducible miRNA construct. This would allow miRNa expression to be precisely timed. This was thought especially important when dealing with a protein such as Fzr1 that has a number of cellular functions at different phases of the cell cycle. Findings from Chapter 3, using miRNA (although not inducible) suggested that Fzr1 has a role in early embryo development, because the loss of Fzr1 resulted in a 2-cell stage arrest. To further investigate the importance of Fzr1 during this period by an miRNA approach, the initial plan was to develop this construct further to become an inducible Fzr1 miRNA; made in order to initiate Fzr1 repression during and immediately after EGA. Such an approach would allow examination of phenotypic changes that would provide an insight Fzr1’s possible role in the early embryo.

Due to the limitations of siRNA technology (Elbashir et al., 2001; Hsieh et al., 2004; Kumar et al., 2007), the miRNA approach never achieved complete knockdown, although miRNA can give higher efficiency in gene knockdown as compared to conventional shRNA (Total, 2006). This probably resulted in the heterogeneity of observations made,

Page | ‐ 187 ‐

Chapter 7 General discussion

with only a proportion of Fzr1 miRNA treated embryos showing a 2-cell arrest, while others progressed to form morulae. In this study, even though lowered Fzr1 expression was observed in miRNA treated morulae in comparison to controls, the level of knockdown achieved was not as great as in those found to be arrested at the 2-cell stage. I suggest this is because those with the greatest level of knockdown showed the earliest developmental arrest. The inducible miRNA construct was not optimized, to follow up on the standard miRNA because at that stage of my PhD studies the creation of an oocyte-specific knockout became available to me in Newcastle, and it is on that project I focused my time. By conditionally knocking out Fzr1 in oocytes from growing follicles (Cre-recombinase driven by the ZP3 receptor), it allowed examination of Fzr1 function both in vitro and in vivo. This has an added advantage over the miRNA approach, which allows only in vitro investigation.

In Chapter 4, successful knockout of Fzr1 in oocytes and MII eggs were verified and the in vivo role of Fzr1 during meiotic maturation was evaluated. Previous in vitro studies have demonstrated the importance of Fzr1 during meiosis I (Holt et al., 2011; Homer et al., 2009; Peters, 2006; Reis et al., 2006; Reis et al., 2007) and its presence detected in MII eggs following polar body extrusion (Chang et al., 2004). However, here, I was able to show that Fzr1 loss did not adversely affect in vivo oocyte maturation. Even though there was a decreased number of MII eggs, they appeared healthy and viable, capable of generating pups when females were mated with wild-type males. As such, even though Fzr1 may be present during meiosis, it does not seem to play an essential role during oocyte maturation. Because, loss of Fzr1 in vitro has been associated with increased aneuploidy rates in oocytes (Homer et al., 2009; Reis et al., 2006; Reis et al., 2007), it may be likely that in vivo presence of cumulus cells surrounding the oocytes, or some other factor, offers some level of protection against this process. In addition, the effects of culturing could possibly affect oocyte quality and sensitivity, hence the difference in observations between in vivo and in vitro phenotypes. The reasons why aneuploidy rates are so much higher in vitro following Fzr1 loss, as compared to in vitro, warrants further investigation.

In order to examine for effects of Fzr1 loss during preimplantation development, using the knockout mice, I had to examine the effects of various culture conditions using the background strain (C57Bl6) of the knockout mice. KSOM/AA had been shown previously to improve blastocyst formation in culture (Ho et al., 1995; Lawitts and Biggers, 1993), and here in Chapter 5 was found to be the medium of choice. Embryos from fertilized eggs and parthenotes of B6CBF1 hybrids developed better in culture using KSOM/AA as compared Page | ‐ 188 ‐

Chapter 7 General discussion

to C57Bl6 embryos, probably due to their higher tolerance of culture conditions. When Fzr1fl/fl parthenotes were cultured, they displayed similar blastocyst rates compared to wild-type C57Bl6 embryos, and as such were considered an appropriate control to use against the Fzr1 knockout embryos.

Parthenotes generated from oocyte-specific Fzr1 knockout mice in Chapter 6, showed a 2- cell arrest, in agreement with the observations made in Chapter 3, using miRNA to achieve Fzr1 knockdown. Genomic aberrations were observed in such embryos that have been previously described following Fzr1 loss in somatic cells, including multipolar mitotic spindles, formation of anaphase bridges, micronuclei and centrosome abnormalities, DNA fragmentation, was also observed as well as numerous -H2AX positive foci. The likely reason for such problems is the role Fzr1 plays in regulating cell cycle progression by maintaining G1 phase and mediating the G1/S transition. Loss of Fzr1 has been shown to result in premature S-phase entry in cultured somatic cells, and as such DNA replication fidelity may be compromised resulting in genomic instability. Loss of Fzr1 had also led to delayed and asynchronous cleavage divisions suggesting difficulties experienced by the blastomeres progressing through the cell cycle. Since Fzr1 targets various cell cycle proteins for their timely degradation, loss of Fzr1 in embryos could possibly result in substrate accumulation that inhibited smooth progression of cleavage divisions.

Tracking the events of first mitosis in Fzr1-/- embryos revealed the formation of binucleated embryos, which were due to a failure to undergo syngamy. This interesting finding that Fzr1 plays a role in pronuclear fusion in mammalian 1-cell embryos, may be related to the known involvement of microtubules in this process (Brawley and Quatrano, 1979; Reinsch and Karsenti, 1997; Schatten et al., 1985). Loss of Fzr1 has been demonstrated to lead to aberrations in spindle assembly (Floyd et al., 2008; García-Higuera et al., 2008; Holt et al., 2012; Peters, 2006; Schindler and Schultz, 2009), which could possibly account for the lack of syngamy. To take these studies further, a fluorescently labelled microtubule probe (e.g. MAP4) could be microinjected into embryos and used for live cell tracking, to examine precisely how microtubule dynamics are influenced by Fzr1 loss.

Embryos undergo compaction at the late 8-cell stage, in preparation for blastulation by setting up two distinct cell populations that will contribute to either the TE or ICM (Fleming, 1987; Johnson and Ziomek, 1981). Since Fzr1 is involved in endoreduplication (García-Higuera et al., 2008; Li et al., 2008), and characterization of Fzr1 expression profile in Chapter 3 revealed an increased of Fzr1 levels beginning from the morula stage,

Page | ‐ 189 ‐

Chapter 7 General discussion

therefore perhaps this increase in Fzr1 expression in morulae could possibly suggest its involvement even in the earliest stages of placentation during cell lineage specification in preimplantation embryos. In agreement with this idea, abnormalities were observed in Fzr1-/- parthenotes in the compaction process.

In those Fzr1-/- embryos that progressed past the 2-cell arrest, due to cleavage delay, compaction was initiated at an earlier developmental stage, even though the chronological time, relative to time of activation, was the same as controls. Probably due to the lack of sufficient blastomere numbers, cell-to-cell communication was disrupted, and establishment of the inner and outer cell populations necessary for TE and ICM formation was affected. Therefore, even though Fzr1-/- embryos were able to undergo compaction, none were able to form blastocysts. Further work on this could be made with an inducible miRNA knockdown plasmid, which was the planned outcome of Chapter 3. Such a construct could be used to induce Fzr1 silencing at various time points over the course of embryogenesis. This approach may lend itself to answering whether blastocyst formation is possible when Fzr1 is lost only at later preimplantation timepoints. Immunofluorescence probing for lineage markers like Cdx2 (TE)(Strumpf et al., 2005) and Oct4 and/or Nanog (ICM)(Loh et al., 2006; Magnani and Cabot, 2008; Silva et al., 2009) could also be performed on compacted Fzr1-/- 4-cell morulae to identify if cell line specification was achieved in these embryos.

Embryonic studies using various metazoan models such zebrafish, fruitfly and Xenopus, have shown short cell cycle divisions until the time of EGA, consisting of alternating S- and M- phases in the absence of Gap phases (Dalle Nogare et al., 2009; Gotoh et al., 2011; Lee and Orr-Weaver, 2003; Philpott and Yew, 2008; Zamir et al., 1997). However in early mouse embryogenesis, Gap phases are present, albeit short lasting, for approximately an hour (Howlett and Bolton, 1985; Smith and Johnson, 1985). It has been suggested that the temporal expression of Fzr1 in these other non-mammalian embryos influences Gap phase establishment during EGA (Kramer et al., 2000; Lorca et al., 1998; Sigrist and Lehner, 1997). This would be supported by similar arguments in the somatic divisions of adult cells, where Fzr1 may be involved in Gap phase maintenance (Carmena and Earnshaw, 2003; Carter et al., 2006; Lindon and Pines, 2004; Malumbres and Barbacid, 2009; Wäsch and Engelbert, 2005). Therefore, its presence and function in early mouse embryonic cell cycles may be suggestive that the cell cycles of early mammalian embryos are more similar to those of mammalian somatic cells than they are to those of non-mammalian embryos.

Page | ‐ 190 ‐

Chapter 7 General discussion

In summary, I have shown here that Fzr1 is crucial for successful early mouse embryogenesis at a much earlier time point than previously concluded based on knockout studies (García-Higuera et al., 2008; Li et al., 2008). Presumptively this is due to the persistence of maternal Fzr1 stores present in the conventional knockout. In my current study, the majority of Fzr1-/- embryos failed to develop past the first three embryonic divisions. This penetrance of lethality is in contrast to various cultured cell lines, where even though loss of Fzr1 has been associated with genomic instability, cells are nonetheless viable, and continue to proliferate (Engelbert et al., 2007; Floyd et al., 2008; García- Higuera et al., 2008; Li et al., 2008; Schwab et al., 1997; Sudo et al., 2001). However, here, the effects due to the loss of Fzr1 in mouse embryos are more pronounced, suggesting a possible exclusive involvement of Fzr1 in regulating important developmental processes. An overview of the involvement of Fzr1 during meiosis and embryogenesis is shown in Figure 7.1.

Most of the data presented in Chapters 4 and 6 have been published in a peer-reviewed article in the Journal of Cell Science. The title of the publication is ‘The Anaphase- Promoting Complex activator Fizzy-Related-1 (Fzr1) is involved in the establishment of a single mitotic spindle in 1-cell embryos and in the mitotic divisions of early mammalian embryos’ (Seah et al., 2012b). The body of this work has also been presented in the Oozoa award presentation session during the 2012 Society for Reproductive Biology Annual Conference (Seah et al., 2012a).

Page | ‐ 191 ‐

Chapter 7 General discussion

Compaction/ GV arrest Prometaphase Pronuclei Cleavage lineage maintainence progression Fusion divisions specification

Fertilization Compaction

< <

X X X X X ICM GV X Blastocoel TE

Fully expanded Prophase I Prometaphase IPBE 1 Metaphase II PN Syngamy 2-cell stage 4-cell stage 8-cell stage Morula blastocyst Meiosis Cleavage stage Blastulation

Figure 7.1 Overview of Fzr1 in meiosis and embryogenesis Fzr1 plays a role in maintaining GV arrest in oocytes and smooth progression of prometaphase I during meiosis. Fzr1 is involved in mediating the process of syngamy in zygotes and is crucial for maintaining genomic stability during cleavage stages in early embryos. Loss of Fzr1 delays blastomere divisions resulting in premature compaction in embryos that consequently affected blastocyst formation.

Page | ‐ 192 ‐

References

8. References

Aberdam, E., Hanski, E. and Dekel, N. (1987). Maintenance of meiotic arrest in isolated rat oocytes by the invasive adenylate cyclase of Bordetella pertussis. Biology of reproduction 36, 530-535. Abramczuk, J., Solter, D. and Koprowski, H. (1977). The beneficial effect of EDTA on development of mouse one-cell embryos in chemically defined medium. Developmental biology 61, 378-383. Abrams, E. W., Zhang, H., Marlow, F. L., Kapp, L., Lu, S. and Mullins, M. C. (2012). Dynamic Assembly of Brambleberry Mediates Nuclear Envelope Fusion during Early Development. Cell 150, 521-532. Adamson, E. and Gardner, R. (1979). Control of early development. British medical bulletin 35, 113-119. Albertson, D. G. (1984). Formation of the first cleavage spindle in nematode embryos. Developmental biology 101, 61-72. Alfieri, J. A., Martin, A. D., Takeda, J., Kondoh, G., Myles, D. G. and Primakoff, P. (2003). Infertility in female mice with an oocyte-specific knockout of GPI-anchored proteins. Journal of cell science 116, 2149-2155. Ambros, V. (2001). microRNAs: tiny regulators with great potential. Cell 107, 823-826. Amon, A. (1999). The spindle checkpoint. Current opinion in genetics & development 9, 69-75. Anbari, K. and Schultz, R. M. (1993). Effect of sodium and betaine in culture media on development and relative rates of protein synthesis in preimplantation mouse embryos in vitro. Molecular Reproduction and Development 35, 24-28. Aoki, F., Worrad, D. M. and Schultz, R. M. (1997). Regulation of transcriptional activity during the first and second cell cycles in the preimplantation mouse embryo. Developmental biology 181, 296-307. Arslan, P., Di Virgilio, F., Beltrame, M., Tsien, R. and Pozzan, T. (1985). Cytosolic Ca2+ homeostasis in Ehrlich and Yoshida carcinomas. A new, membrane-permeant chelator of heavy metals reveals that these ascites tumor cell lines have normal cytosolic free Ca2+. Journal of Biological Chemistry 260, 2719-2727. Auerbach, A. B., Norinsky, R., Ho, W., Losos, K., Guo, Q., Chatterjee, S. and Joyner, A. L. (2003). Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic research 12, 59-69. Austin, C. R. and Short, R. V. (1982). Germ cells and fertilization: Cambridge University Press. Avilion, A. A., Nicolis, S. K., Pevny, L. H., Perez, L., Vivian, N. and Lovell-Badge, R. (2003). Multipotent cell lineages in early mouse development depend on SOX2 function. Genes & development 17, 126-140. Ayad, N. G., Rankin, S., Murakami, M., Jebanathirajah, J., Gygi, S. and Kirschner, M. W. (2003). Tome-1, a trigger of mitotic entry, is degraded during G1 via the APC. Cell 113, 101- 114. Bachvarova, R. (1985). Gene expression during oogenesis and oocyte development in mammals. Developmental biology (New York, NY: 1985) 1, 453-524.

Page | ‐ 193 ‐

References

Bachvarova, R. and De Leon, V. (1980). Polyadenylated RNA of mouse ova and loss of maternal RNA in early development. Developmental biology 74, 1-8. Bachvarova, R., De Leon, V., Johnson, A., Kaplan, G. and Paynton, B. V. (1985). Changes in total RNA, polyadenylated RNA, and actin mRNA during meiotic maturation of mouse oocytes. Developmental biology 108, 325-331. Bączkowski, T., Kurzawa, R. and Głąbowski, W. (2004). Methods of embryo scoring in in vitro fertilization. Reproductive biology 4, 5-22. Balakier, H. and Tarkowski, A. (1976). Diploid parthenogenetic mouse embryos produced by heat-shock and Cytochalasin B. Journal of embryology and experimental morphology 35, 25-39. Ballabeni, A., Melixetian, M., Zamponi, R., Masiero, L., Marinoni, F. and Helin, K. (2004). Human geminin promotes pre-RC formation and DNA replication by stabilizing CDT1 in mitosis. The EMBO journal 23, 3122-3132. Baltz, J., Biggers, J. D. and Lechene, C. (1991). Relief from alkaline load in two-cell stage mouse embryos by bicarbonate/chloride exchange. Journal of Biological Chemistry 266, 17212- 17217. Baltz, J. M. (2001). Osmoregulation and cell volume regulation in the preimplantation embryo. Current topics in developmental biology 52, 55-106. Barcroft, L. C., Offenberg, H., Thomsen, P. and Watson, A. J. (2003). Aquaporin proteins in murine trophectoderm mediate transepithelial water movements during cavitation. Developmental biology 256, 342-354. Bard, J. B. L., Kaufman, M. H., Dubreuil, C., Brune, R. M., Burger, A., Baldock, R. A. and Davidson, D. R. (1998). An internet-accessible database of mouse developmental anatomy based on a systematic nomenclature. Mechanisms of Development 74, 111-120. Bardin, A. J. and Amon, A. (2001). Men and sin: what's the difference? Nature Reviews Molecular Cell Biology 2, 815-826. Bartek, J., Lukas, C. and Lukas, J. (2004). Checking on DNA damage in S phase. Nature Reviews Molecular Cell Biology 5, 792-804. Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297. Bashir, T., Dorrello, N. V., Amador, V., Guardavaccaro, D. and Pagano, M. (2004). Control of the SCFSkp2–Cks1 ubiquitin ligase by the APC/CCdh1 ubiquitin ligase. Nature 428, 190-193. Bassermann, F., Frescas, D., Guardavaccaro, D., Busino, L., Peschiaroli, A. and Pagano, M. (2008). The Cdc14B-Cdh1-Plk1 axis controls the G2 DNA-damage-response checkpoint. Cell 134, 256-267. Battey, J., Jordan, E., Cox, D. and Dove, W. (1999). An action plan for mouse genomics. Nature genetics 21, 73-75. Beck, J. A., Lloyd, S., Hafezparast, M., Lennon-Pierce, M., Eppig, J. T., Festing, M. and Fisher, E. (2000). Genealogies of mouse inbred strains. Nature genetics 24, 23-26. Beddington, R. and Robertson, E. (1989). An assessment of the developmental potential of embryonic stem cells in the midgestation mouse embryo. Development 105, 733-737. Bembenek, J. and Yu, H. (2001). Regulation of the anaphase-promoting complex by the dual specificity phosphatase human Cdc14a. Journal of Biological Chemistry 276, 48237-48242.

Page | ‐ 194 ‐

References

Benmaamar, R. and Pagano, M. (2005). Brief Report Involvement of the SCF Complex in the Control of Cdh1 Degradation in S Phase. Cell Cycle 4, 1230-1232. Bernstein, E., Caudy, A. A., Hammond, S. M. and Hannon, G. J. (2001). Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363-365. Bharadwaj, R. and Yu, H. (2004). The spindle checkpoint, aneuploidy, and cancer. Oncogene 23, 2016-2027. Bianchi, E., Geremia, R. and Sette, C. (2010). Expression of stemness markers in mouse parthenogenetic-diploid blastocysts is influenced by slight variation of activation protocol adopted. In Vitro Cellular & Developmental Biology-Animal 46, 619-623. Biggers, J. (1971). Metabolism of mouse embryos. Journal of reproduction and fertility. Supplement 14, 41-51. Biggers, J. and Blandau, R. (1971). New observations on the nutrition of the mammalian oocyte and the preimplantation embryo. The biology of the blastayst., 319-327. Biggers, J., McGinnis, L. and Lawitts, J. (2005). One-step versus two-step culture of mouse preimplantation embryos: is there a difference? Human Reproduction 20, 3376-3384. Biggers, J., Whittingham, D. and Donahue, R. (1967). The pattern of energy metabolism in the mouse oocyte and zygote. Proceedings of the National Academy of Sciences of the United States of America 58, 560-567. Biggers, J. D. (1998). Reflections on the culture of the preimplantation embryo. International Journal of Developmental Biology 42, 879-884. Biggers, J. D., Lawitts, J. A. and Lechene, C. P. (1993). The protective action of betaine on the deleterious effects of NaCl on preimplantation mouse embryos in vitro. Molecular Reproduction and Development 34, 380-390. Biggers, J. D. and Summers, M. C. (2008). Choosing a culture medium: making informed choices. Fertility and sterility 90, 473-483. Biggers, J. D., Summers, M. C. and McGinnis, L. K. (1997). Polyvinyl alcohol and amino acids as substitutes for bovine serum albumin in culture media for mouse preimplantation embryos. Human Reproduction Update 3, 125-135. Billy, E., Brondani, V., Zhang, H., Müller, U. and Filipowicz, W. (2001). Specific interference with gene expression induced by long, double-stranded RNA in mouse embryonal teratocarcinoma cell lines. Proceedings of the National Academy of Sciences 98, 14428-14433. Blanco, M. A., Sanchez-Diaz, A., De Prada, J. M. and Moreno, S. (2000). APCste9/srw1 promotes degradation of mitotic cyclins in G1 and is inhibited by cdc2 phosphorylation. The EMBO journal 19, 3945-3955. Bleil, J. D. and Wassarman, P. M. (1980). Structure and function of the zona pellucida: identification and characterization of the proteins of the mouse oocyte's zona pellucida. Developmental biology 76, 185-202. Blow, J. J. and Dutta, A. (2005). Preventing re-replication of chromosomal DNA. Nature Reviews Molecular Cell Biology 6, 476-486. Bohnsack, M. T., Czaplinski, K. and Gorlich, D. (2004). Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. Rna 10, 185-191. Bolton, V., Oades, P. and Johnson, M. (1984). The relationship between cleavage, DNA replication, and gene expression in the mouse 2-cell embryo. Journal of embryology and experimental morphology 79, 139-163. Page | ‐ 195 ‐

References

Bornslaeger, E. A., Mattei, P. and Schultz, R. M. (1986). Involvement of cAMP-dependent protein kinase and protein phosphorylation in regulation of mouse oocyte maturation. Developmental biology 114, 453-462. Bos-Mikich, A., Swann, K. and Whittingham, D. G. (1995). Calcium oscillations and protein synthesis inhibition synergistically activate mouse oocytes. Molecular Reproduction and Development 41, 84-90. Bos-Mikich, A., Whittingham, D. G. and Jones, K. T. (1997). Meiotic and mitotic Ca 2+ oscillations affect cell composition in resulting blastocysts. Developmental biology 182, 172- 179. Bowman, P. and McLaren, A. (1970a). Cleavage rate of mouse embryos in vivo and in vitro. Journal of embryology and experimental morphology 24, 203-207. Bowman, P. and McLaren, A. (1970b). Viability and growth of mouse embryos after in vitro culture and fusion. Journal of embryology and experimental morphology 23, 693-704. Boyd, J. and Hamilton, W. (1952). Cleavage, early development and implantation of the egg. Marshall's physiology of reproduction 2, 1-126. Braden, A. (1959). Strain differences in the morphology of the gametes of the mouse. Australian journal of biological sciences 12, 65-71. Braden, A. W. H. (1957). Variation between strains in the incidence oe various abnormalities of egg maturation and fertilization in the mouse. Journal of Genetics 55, 476-486. Bradford, G. and Nott, C. (1969). Genetic control of ovulation rate and embryo survival in mice. II. Effects of crossing selected lines. Genetics 63, 907-918. Brandeis, M. and Hunt, T. (1996). The proteolysis of mitotic cyclins in mammalian cells persists from the end of mitosis until the onset of S phase. The EMBO journal 15, 5280-5289. Braude, P., Bolton, V. and Moore, S. (1988). Human gene expression first occurs between the four-and eight-cell stages of preimplantation development. Nature 332, 459-461. Braude, P., Pelham, H., Flach, G. and Lobatto, R. (1979). Post-transcriptional control in the early mouse embryo. Nature 282, 102-105. Brawley, S. H. and Quatrano, R. S. (1979). Effects of microtubule inhibitors on pronuclear migration and embryogenesis in Fucus distichus (Phaeophyta). Journal of Phycology 15, 266- 272. Brinster, R. (1963). A method for in vitro cultivation of mouse ova from two-cell to blastocyst. Experimental cell research 32, 205-208. Brinster, R. L. (1965a). Studies on the development of mouse embyros in vitro. II. The effect of energy source. Journal of Experimental Zoology 158, 59-68. Brinster, R. L. (1965b). Studies on the development of mouse embyros in vitro. III. The effect of fixed‐nitrogen source. Journal of Experimental Zoology 158, 69-77. Brison, D. R. and Schultz, R. M. (1997). Apoptosis during mouse blastocyst formation: evidence for a role for survival factors including transforming growth factor alpha. Biology of reproduction 56, 1088-1096. Brummelkamp, T. R., Bernards, R. and Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science Signalling 296, 550-553.

Page | ‐ 196 ‐

References

Brunet, S., Dumont, J., Lee, K. W., Kinoshita, K., Hikal, P., Gruss, O. J., Maro, B. and Verlhac, M. H. (2008). Meiotic regulation of TPX2 protein levels governs cell cycle progression in mouse oocytes. PLoS One 3, e3338. Brunet, S. and Maro, B. (2005). Cytoskeleton and cell cycle control during meiotic maturation of the mouse oocyte: integrating time and space. Reproduction 130, 801-811. Buccione, R., Schroeder, A. C. and Eppig, J. J. (1990). Interactions between somatic cells and germ cells throughout mammalian oogenesis. Biology of reproduction 43, 543-547. Bukovsky, A., Caudle, M. R., Svetlikova, M., Wimalasena, J., Ayala, M. E. and Dominguez, R. (2005). Oogenesis in adult mammals, including humans. Endocrine 26, 301-316. Bultman, S. J., Gebuhr, T. C., Pan, H., Svoboda, P., Schultz, R. M. and Magnuson, T. (2006). Maternal BRG1 regulates zygotic genome activation in the mouse. Genes & development 20, 1744-1754. Callaini, G. and Riparbelli, M. (1996). Fertilization in Drosophila melanogaster: centrosome inheritance and organization of the first mitotic spindle. Developmental biology 176, 199-208. Cao, K., Nakajima, R., Meyer, H. H. and Zheng, Y. (2003). The AAA-ATPase Cdc48/p97 regulates spindle disassembly at the end of mitosis. Cell 115, 355-367. Carabatsos, M. J., Sellitto, C., Goodenough, D. A. and Albertini, D. F. (2000). Oocyte- granulosa cell heterologous gap junctions are required for the coordination of nuclear and cytoplasmic meiotic competence. Developmental biology 226, 167-179. Carmena, M. and Earnshaw, W. C. (2003). The cellular geography of aurora kinases. Nature Reviews Molecular Cell Biology 4, 842-854. Carrington, J. C. and Ambros, V. (2003). Role of microRNAs in plant and animal development. Science Signalling 301, 336-338. Carter, M. G., Hamatani, T., Sharov, A. A., Carmack, C. E., Qian, Y., Aiba, K., Ko, N. T., Dudekula, D. B., Brzoska, P. M. and Hwang, S. S. (2003). In situ-synthesized novel microarray optimized for mouse stem cell and early developmental expression profiling. Genome Research 13, 1011-1021. Carter, S. L., Eklund, A. C., Kohane, I. S., Harris, L. N. and Szallasi, Z. (2006). A signature of chromosomal instability inferred from gene expression profiles predicts clinical outcome in multiple human cancers. Nature genetics 38, 1043-1048. Castro, A., Bernis, C., Vigneron, S., Labbé, J. C. and Lorca, T. (2005). The anaphase- promoting complex: a key factor in the regulation of cell cycle. Oncogene 24, 314-325. Castro, A., Vigneron, S., Bernis, C., Labbé, J. C., Prigent, C. and Lorca, T. (2002). The D- Box-activating domain (DAD) is a new proteolysis signal that stimulates the silent D-Box sequence of Aurora-A. EMBO reports 3, 1209-1214. Cerutti, L. and Simanis, V. (2000). Controlling the end of the cell cycle. Current opinion in genetics & development 10, 65-69. Chambers, I. and Smith, A. (2004). Self-renewal of teratocarcinoma and embryonic stem cells. Oncogene 23, 7150-7160. Chang, H. Y., Levasseur, M. and Jones, K. T. (2004). Degradation of APCcdc20 and APCcdh1 substrates during the second meiotic division in mouse eggs. Journal of cell science 117, 6289-6296.

Page | ‐ 197 ‐

References

Chatot, C. L., Ziomek, C., Bavister, B., Lewis, J. and Torres, I. (1989). An improved culture medium supports development of random-bred 1-cell mouse embryos in vitro. Journal of reproduction and fertility 86, 679-688. Chen, J. and Fang, G. (2001). MAD2B is an inhibitor of the anaphase-promoting complex. Genes & development 15, 1765-1770. Chen, J., Melton, C., Suh, N., Oh, J. S., Horner, K., Xie, F., Sette, C., Blelloch, R. and Conti, M. (2011). Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes & development 25, 755-766. Chen, L., Wang, D., Wu, Z., Ma, L. and Daley, G. Q. (2010). Molecular basis of the first cell fate determination in mouse embryogenesis. Cell research 20, 982-993. Cheslock, P. S., Kemp, B. J., Boumil, R. M. and Dawson, D. S. (2005). The roles of MAD1, MAD2 and MAD3 in meiotic progression and the segregation of nonexchange chromosomes. Nature genetics 37, 756-760. Chia, R., Achilli, F., Festing, M. F. W. and Fisher, E. M. C. (2005). The origins and uses of mouse outbred stocks. Nature genetics 37, 1181-1186. Cholewa, J. A. and Whitten, W. (1970). Development of two-cell mouse embryos in the absence of a fixed-nitrogen source. Journal of reproduction and fertility 22, 553-555. Christova, R. and Oelgeschläger, T. (2001). Association of human TFIID–promoter complexes with silenced mitotic chromatin in vivo. Nature cell biology 4, 79-82. Ciechanover, A., Heller, H., Katz-Etzion, R. and Hershko, A. (1981). Activation of the heat- stable polypeptide of the ATP-dependent proteolytic system. Proceedings of the National Academy of Sciences 78, 761-765. Ciemerych, M. A., Maro, B. and Kubiak, J. Z. (1999). Control of duration of the first two mitoses in a mouse embryo. Zygote 7, 293-300. Ciemerych, M. A. and Sicinski, P. (2005). Cell cycle in mouse development. Oncogene 24, 2877-2898. Cimprich, K. A. and Cortez, D. (2008). ATR: an essential regulator of genome integrity. Nature Reviews Molecular Cell Biology 9, 616-627. Ciosk, R., Zachariae, W., Michaelis, C., Shevchenko, A., Mann, M. and Nasmyth, K. (1998). An ESP1/PDS1 complex regulates loss of sister chromatid cohesion at the metaphase to anaphase transition in yeast. Cell 93, 1067-1076. Clegg, K. and Piko, L. (1978). Size distribution of poly (A) tracts in maternally inherited and newly synthesised RNA from early mouse embryos. The Journal of cell biology 79, 168a-168a. Clegg, K. B. and Pikó, L. (1977). Size and specific activity of the UTP pool and overall rates of RNA synthesis in early mouse embryos. Developmental biology 58, 76-95. Clegg, K. B. and Pikó, L. (1982). RNA synthesis and cytoplasmic polyadenylation in the one- cell mouse embryo. Nature 295, 343-344. Clegg, K. B. and Pikó, L. (1983). Poly (A) length, cytoplasmic adenylation and synthesis of poly (A)+ RNA in early mouse embryos. Developmental biology 95, 331-341. Cockburn, K. and Rossant, J. (2010). Making the blastocyst: lessons from the mouse. The Journal of clinical investigation 120, 995-1003. Colledge, W., Carlton, M., Udy, G. and Evans, M. (1994). Disruption of c-mos causes parthenogenetic development of unfertilized mouse eggs. Nature 370, 65-68.

Page | ‐ 198 ‐

References

Colonna, R., Tatone, C., Malgaroli, A., Eusebi, F. and Mangia, F. (1989). Effects of protein kinase C stimulation and free Ca2+ rise in mammalian egg activation. Gamete research 24, 171-183. Conaghan, J., Handyside, A., Winston, R. and Leese, H. (1993). Effects of pyruvate and glucose on the development of human preimplantation embryos in vitro. Journal of reproduction and fertility 99, 87-95. Conti, M. (2002). Specificity of the cyclic adenosine 3′, 5′-monophosphate signal in granulosa cell function. Biology of reproduction 67, 1653-1661. Cortés, F., Mateos, S., Pastor, N. and Domínguez, I. (2004). Toward a comprehensive model for induced endoreduplication. Life sciences 76, 121-135. Courtois, A., Schuh, M., Ellenberg, J. and Hiiragi, T. (2012). The transition from meiotic to mitotic spindle assembly is gradual during early mammalian development. The Journal of cell biology 198, 357-370. Cox, L. J., Larman, M., Saunders, C., Hashimoto, K., Swann, K. and Lai, F. (2002). Sperm phospholipase Czeta from humans and cynomolgus monkeys triggers Ca2+ oscillations, activation and development of mouse oocytes. Reproduction 124, 611-623. Cross, P. and Brinster, R. L. (1973). The sensitivity of one-cell mouse embryos to pyruvate and lactate. Experimental cell research 77, 57-62. Cui, X., Li, X. and Kim, N. (2007). Global gene transcription patterns in in vitro-cultured fertilized embryos and diploid and haploid murine parthenotes. Biochemical and biophysical research communications 352, 709-715. Cullen, B., Emigholz, K. and Monahan, J. (1980). The transient appearance of specific proteins in one-cell mouse embryos. Developmental biology 76, 215-221. Cuthbertson, K., Whittingham, D. and Cobbold, P. H. (1981). Free Ca2+ increases in exponential phases during mouse oocyte activation. Nature 294, 754-757. Cuthbertson, K. S. R. and Cobbold, P. (1985). Phorbol ester and sperm activate mouse oocytes by inducing sustained oscillations in cell Ca2+. Nature 316, 541-542. D'Avino, P. P., Savoian, M. S. and Glover, D. M. (2005). Cleavage furrow formation and ingression during animal cytokinesis: a microtubule legacy. Journal of cell science 118, 1549- 1558. Dalby, B., Cates, S., Harris, A., Ohki, E. C., Tilkins, M. L., Price, P. J. and Ciccarone, V. C. (2004). Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications. Methods 33, 95-103. Dalle Nogare, D. E., Pauerstein, P. T. and Lane, M. E. (2009). G2 acquisition by transcription-independent mechanism at the zebrafish midblastula transition. Developmental biology 326, 131-142. Damjanov, I. and Solter, D. (1975). Ultrastructure of murine teratocarcinomas. Teratomas and Differentiation, Academic Press, New York 59, 209-220. Darwiche, N., Freeman, L. and Strunnikov, A. (1999). Characterization of the components of the putative mammalian sister chromatid cohesion complex. Gene 233, 39-47. Dawson, K. M. and Baltz, J. M. (1997). Organic osmolytes and embryos: substrates of the Gly and beta transport systems protect mouse zygotes against the effects of raised osmolarity. Biology of reproduction 56, 1550-1558.

Page | ‐ 199 ‐

References

Day, M. L., Johnson, M. H. and Cook, D. I. (1998). A cytoplasmic cell cycle controls the activity of a K+ channel in pre-implantation mouse embryos. The EMBO journal 17, 1952-1960. De Leon, V., Johnson, A. and Bachvarova, R. (1983). Half-lives and relative amounts of stored and polysomal ribosomes and poly (A)+ RNA in mouse oocytes. Developmental biology 98, 400-408. de Vries, W. N., Binns, L. T., Fancher, K. S., Dean, J., Moore, R., Kemler, R. and Knowles, B. B. (2000). Expression of Cre recombinase in mouse oocytes: a means to study maternal effect genes. Genesis 26, 110-112. Dean, W., Santos, F., Stojkovic, M., Zakhartchenko, V., Walter, J., Wolf, E. and Reik, W. (2001). Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proceedings of the National Academy of Sciences 98, 13734-13738. Dekens, M. P. S., Pelegri, F. J., Maischein, H. M. and Nüsslein-Volhard, C. (2003). The maternal-effect gene futile cycle is essential for pronuclear congression and mitotic spindle assembly in the zebrafish zygote. Development 130, 3907-3916. Dennis Smith, L. (1989). The induction of oocyte maturation: transmembrane signaling events and regulation of the cell cycle. Development (Cambridge) 107, 685-699. Deshaies, R. (1999). SCF and Cullin/Ring H2-based ubiquitin ligases. Annual review of cell and developmental biology 15, 435-467. DiAntonio, A., Haghighi, A. P., Portman, S. L., Lee, J. D., Amaranto, A. M. and Goodman, C. S. (2001). Ubiquitination-dependent mechanisms regulate synaptic growth and function. Nature 412, 449-452. Diffley, J. (2004). Regulation of early events in chromosome replication. Current Biology 14, R778-R786. Doi, N., Zenno, S., Ueda, R., Ohki-Hamazaki, H., Ui-Tei, K. and Saigo, K. (2003). Short- interfering-RNA-mediated gene silencing in mammalian cells requires Dicer and eIF2C translation initiation factors. Current Biology 13, 41-46. Dragatsis, I. and Zeitlin, S. (2001). A method for the generation of conditional gene repair mutations in mice. Nucleic acids research 29, e10-e10. Ducibella, T., Albertini, D. F., Anderson, E. and Biggers, J. D. (1975). The preimplantation mammalian embryo: characterization of intercellular junctions and their appearance during development. Developmental biology 45, 231-250. Ducibella, T. and Anderson, E. (1975). Cell shape and membrane changes in the eight-cell mouse embryo: prerequisites for morphogenesis of the blastocyst. Developmental biology 47, 45-58. Ducibella, T., Huneau, D., Angelichio, E., Xu, Z., Schultz, R. M., Kopf, G. S., Fissore, R., Madoux, S. and Ozil, J. P. (2002). Egg-to-embryo transition is driven by differential responses to Ca2+ oscillation number. Developmental biology 250, 280-291. Ducibella, T., Ukena, T., Karnovsky, M. and Anderson, E. (1977). Changes in cell surface and cortical cytoplasmic organization during early embryogenesis in the preimplantation mouse embryo. The Journal of cell biology 74, 153-167. Dumollard, R., Carroll, J., Dupont, G. and Sardet, C. (2002). Calcium wave pacemakers in eggs. Journal of cell science 115, 3557-3564.

Page | ‐ 200 ‐

References

Duncan, F. E., Chiang, T., Schultz, R. M. and Lampson, M. A. (2009). Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biology of reproduction 81, 768-776. Ebnet, K., Suzuki, A., Horikoshi, Y., Hirose, T., zu Brickwedde, M. K. M., Ohno, S. and Vestweber, D. (2001). The cell polarity protein ASIP/PAR-3 directly associates with junctional adhesion molecule (JAM). The EMBO journal 20, 3738-3748. Eckert, J. J. and Fleming, T. P. (2008). Tight junction biogenesis during early development. Biochimica et Biophysica Acta (BBA)-Biomembranes 1778, 717-728. Eckert, J. J., McCallum, A., Mears, A., Rumsby, M. G., Cameron, I. T. and Fleming, T. P. (2004). Specific PKC isoforms regulate blastocoel formation during mouse preimplantation development. Developmental biology 274, 384-401. Edgar, B. A. and Orr-Weaver, T. L. (2001). Endoreplication cell cycles: more for less. Cell 105, 297-306. Edwards, L. J., Williams, D. A. and Gardner, D. K. (1998). Intracellular pH of the mouse preimplantation embryo: amino acids act as buffers of intracellular pH. Human Reproduction 13, 3441-3448. Edwards, R. (1965). Maturation in vitro of mouse, sheep, cow, pig, rhesus monkey and human ovarian oocytes. Nature 208, 349-351. Edwards, R. and Gates, A. (1959). Timing of the stages of the maturation divisions, ovulation, fertilization and the first cleavage of eggs of adult mice treated with gonadotrophins. Journal of Endocrinology 18, 292-304. Eggert, U. S., Mitchison, T. J. and Field, C. M. (2006). Animal cytokinesis: from parts list to mechanisms. Annu. Rev. Biochem. 75, 543-566. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498. Endoh, K., Mochida, K., Ogonuki, N., Ohkawa, M., Shinmen, A., Ito, M., Kashiwazaki, N. and Ogura, A. (2007). The developmental ability of vitrified oocytes from different mouse strains assessed by parthenogenetic activation and intracytoplasmic sperm injection. Journal of Reproduction and Development 53, 1199-1206. Engelbert, D., Schnerch, D., Baumgarten, A. and Wäsch, R. (2007). The ubiquitin ligase APCCdh1 is required to maintain genome integrity in primary human cells. Oncogene 27, 907- 917. Epifano, O., Liang, L., Familari, M., Moos, M. and Dean, J. (1995). Coordinate expression of the three zona pellucida genes during mouse oogenesis. Development 121, 1947-1956. Eppig, J. (1989). The participation of cyclic adenosine monophosphate (cAMP) in the regulation of meiotic maturation of oocytes in the laboratory mouse. Journal of reproduction and fertility. Supplement 38, 3-8. Eppig, J., Chesnel, F., Hirao, Y., O'Brien, M., Pendola, F., Watanabe, S. and Wigglesworth, K. (1997). Oocyte control of granulosa cell development: how and why. Human reproduction (Oxford, England) 12, 127-132. Eppig, J. J. (1991). Intercommunication between mammalian oocytes and companion somatic cells. BioEssays 13, 569-574.

Page | ‐ 201 ‐

References

Eppig, J. J. (1996). Coordination of nuclear and cytoplasmic oocyte maturation in eutherian mammals. Reproduction, fertility and development 8, 485-489. Erbach, G. T., Lawitts, J. A., Papaioannou, V. E. and Biggers, J. D. (1994). Differential growth of the mouse preimplantation embryo in chemically defined media. Biology of reproduction 50, 1027-1033. Evsikov, A. V., Graber, J. H., Brockman, J. M., Hampl, A., Holbrook, A. E., Singh, P., Eppig, J. J., Solter, D. and Knowles, B. B. (2006). Cracking the egg: molecular dynamics and evolutionary aspects of the transition from the fully grown oocyte to embryo. Genes & development 20, 2713-2727. Fay, D. S., Keenan, S. and Han, M. (2002). Fzr-1 and lin-35/Rb function redundantly to control cell proliferation in C. elegans as revealed by a nonbiased synthetic screen. Genes & development 16, 503-517. Fillingham, J., Keogh, M. C. and Krogan, N. J. (2006). H2AX and its role in DNA double- strand break repair. Biochemistry and cell biology 84, 568-577. Fire, A., Xu, S. Q., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811. Fissore, R., Jackson, K. and Kiessling, A. (1989). Mouse zygote development in culture medium without protein in the presence of ethylenediaminetetraacetic acid. Biology of reproduction 41, 835-841. FitzHarris, G. (2009). A shift from kinesin 5-dependent metaphase spindle function during preimplantation development in mouse. Development 136, 2111-2119. FitzHarris, G., Marangos, P. and Carroll, J. (2007). Changes in endoplasmic reticulum structure during mouse oocyte maturation are controlled by the cytoskeleton and cytoplasmic dynein. Developmental biology 305, 133-144. Fitzpatrick, S. L., Sindoni, D. M., Shughrue, P. J., Lane, M. V., Merchenthaler, I. J. and Frail, D. E. (1998). Expression of growth differentiation factor-9 messenger ribonucleic acid in ovarian and nonovarian rodent and human tissues. Endocrinology 139, 2571-2578. Flach, G., Johnson, M., Braude, P., Taylor, R. and Bolton, V. (1982). The transition from maternal to embryonic control in the 2-cell mouse embryo. The EMBO journal 1, 681-686. Fleming, A. D. and Yanagimachi, R. (1982). Fertile life of acrosome‐reacted guinea pig spermatozoa. Journal of Experimental Zoology 220, 109-115. Fleming, T., Pickering, S., Qasim, F. and Maro, B. (1986). The generation of cell surface polarity in mouse 8-cell blastomeres: the role of cortical microfilaments analysed using cytochalasin D. Journal of embryology and experimental morphology 95, 169-191. Fleming, T. P. (1987). A quantitative analysis of cell allocation to trophectoderm and inner cell mass in the mouse blastocyst. Developmental biology 119, 520-531. Fleming, T. P. and Johnson, M. H. (1988). From egg to epithelium. Annual review of cell biology 4, 459-485. Fleming, T. P., McConnell, J., Johnson, M. H. and Stevenson, B. R. (1989). Development of tight junctions de novo in the mouse early embryo: control of assembly of the tight junction- specific protein, ZO-1. The Journal of cell biology 108, 1407-1418.

Page | ‐ 202 ‐

References

Fleming, T. P., Papenbrock, T., Fesenko, I., Hausen, P. and Sheth, B. (2000). Assembly of tight junctions during early vertebrate development. In Seminars in cell & developmental biology, vol. 11 (ed., pp. 291-299: Elsevier. Fleming, T. P., Sheth, B. and Fesenko, I. (2001). Cell adhesion in the preimplantation mammalian embryo and its role in trophectoderm differentiation and blastocyst morphogenesis. Front Biosci 6, D1000-D1007. Floyd, S., Pines, J. and Lindon, C. (2008). APC/CCdh1 Targets Aurora Kinase to Control Reorganization of the Mitotic Spindle at Anaphase. Current Biology 18, 1649-1658. Fu, D., Calvo, J. A. and Samson, L. D. (2012). Balancing repair and tolerance of DNA damage caused by alkylating agents. Nature Reviews Cancer 12, 104-120. Fuhrmann, G., Chung, A. C. K., Jackson, K. J., Hummelke, G., Baniahmad, A., Sutter, J., Sylvester, I., Schöler, H. R. and Cooney, A. J. (2001). Mouse germline restriction of Oct4 expression by germ cell nuclear factor. Developmental cell 1, 377-387. Fulka, H., Mrazek, M., Tepla, O. and Fulka Jr, J. (2004). DNA methylation pattern in human zygotes and developing embryos. Reproduction 128, 703-708. Gaddum‐Rosse, P., Blandau, R., Langley, L. and Sato, K. (1982). Sperm tail entry into the mouse egg in vitro. Gamete research 6, 215-223. Gallin, W. J., Edelman, G. M. and Cunningham, B. A. (1983). Characterization of L-CAM, a major cell adhesion molecule from embryonic liver cells. Proceedings of the National Academy of Sciences 80, 1038-1042. Gao, S., Czirr, E., Chung, Y. G., Han, Z. and Latham, K. E. (2004). Genetic variation in oocyte phenotype revealed through parthenogenesis and cloning: correlation with differences in pronuclear epigenetic modification. Biology of reproduction 70, 1162-1170. García-Higuera, I., Manchado, E., Dubus, P., Cañamero, M., Méndez, J., Moreno, S. and Malumbres, M. (2008). Genomic stability and tumour suppression by the APC/C cofactor Cdh1. Nature cell biology 10, 802-811. Gardner, D. and Leese, H. (1986). Non-invasive measurement of nutrient uptake by single cultured pre-implantation mouse embryos. Human Reproduction 1, 25-27. Gardner, D. and Leese, H. (1988). The role of glucose and pyruvate transport in regulating nutrient utilization by preimplantation mouse embryos. Development 104, 423-429. Gardner, D. and Leese, H. (1990). Concentrations of nutrients in mouse oviduct fluid and their effects on embryo development and metabolism in vitro. Journal of reproduction and fertility 88, 361-368. Gardner, D. K. (1998). Changes in requirements and utilization of nutrients during mammalian preimplantation embryo development and their significance in embryo culture. Theriogenology 49, 83-102. Gardner, D. K. and Lane, M. (1993). Amino acids and ammonium regulate mouse embryo development in culture. Biology of reproduction 48, 377-385. Gardner, D. K. and Lane, M. (1996). Fertilization and early embryology: Alleviation of the ‘2-cell block’and development to the blastocyst of CF1 mouse embryos: role of amino acids, EDTA and physical parameters. Human Reproduction 11, 2703-2712. Gardner, D. K., Lane, M., Spitzer, A. and Batt, P. A. (1994). Enhanced rates of cleavage and development for sheep zygotes cultured to the blastocyst stage in vitro in the absence of serum

Page | ‐ 203 ‐

References

and somatic cells: amino acids, vitamins, and culturing embryos in groups stimulate development. Biology of reproduction 50, 390-400. Gardner, D. K. and Leese, H. J. (1993). Assessment of embryo metabolism and viability. Handbook of in vitro fertilization, 195-211. Ghoshal, K., Datta, J., Majumder, S., Bai, S., Kutay, H., Motiwala, T. and Jacob, S. T. (2005). 5-Aza-deoxycytidine induces selective degradation of DNA methyltransferase 1 by a proteasomal pathway that requires the KEN box, bromo-adjacent homology domain, and nuclear localization signal. Molecular and cellular biology 25, 4727-4741. Gibb, C., Poronnik, P., Day, M. and Cook, D. (1997). Control of cytosolic pH in two-cell mouse embryos: roles of H (+)-lactate cotransport and Na+/H+ exchange. American Journal of Physiology-Cell Physiology 273, C404-C419. Gieffers, C., Peters, B. H., Kramer, E. R., Dotti, C. G. and Peters, J. M. (1999). Expression of the CDH1-associated form of the anaphase-promoting complex in postmitotic neurons. Proceedings of the National Academy of Sciences 96, 11317-11322. Ginsburg, M., Snow, M. and McLaren, A. (1990). Primordial germ cells in the mouse embryo during gastrulation. Development 110, 521-528. Gittens, J. E. I., Mhawi, A. A., Lidington, D., Ouellette, Y. and Kidder, G. M. (2003). Functional analysis of gap junctions in ovarian granulosa cells: distinct role for connexin43 in early stages of folliculogenesis. American Journal of Physiology-Cell Physiology 284, C880- C887. Glotzer, M., Murray, A. W. and Kirschner, M. W. (1991). Cyclin is degraded by the ubiquitin pathway. Nature 349, 132-138. Goddard, M. J. and Pratt, H. P. M. (1983). Control of events during early cleavage of the mouse embryo: an analysis of the ‘2-cell block’. Journal of embryology and experimental morphology 73, 111-133. Gómez, R., Valdeolmillos, A., Parra, M. T., Viera, A., Carreiro, C., Roncal, F., Rufas, J. S., Barbero, J. L. and Suja, J. A. (2007). Mammalian SGO2 appears at the inner centromere domain and redistributes depending on tension across centromeres during meiosis II and mitosis. EMBO reports 8, 173-180. Gorr, I. H., Boos, D. and Stemmann, O. (2005). Mutual inhibition of separase and Cdk1 by two-step complex formation. Molecular cell 19, 135-141. Gotoh, T., Villa, L., Capelluto, D. and Finkielstein, C. (2011). Regulatory pathways coordinating cell cycle progression in early Xenopus development. Cell Cycle in Development, 171-199. Goval, J. J., Cauwenberge, A. and Alexandre, H. (2000). Respective roles of protein tyrosine kinases and protein kinases C in the upregulation of β‐catenin distribution, and compaction in mouse preimplantation embryos: a pharmacological approach. Biology of the Cell 92, 513-526. Grosskortenhaus, R. and Sprenger, F. (2002). Rca1 Inhibits APC-Cdh1/ Fzr1 and Is Required to Prevent Cyclin Degradation in G2. Developmental cell 2, 29-40. Gruber, S., Haering, C. H. and Nasmyth, K. (2003). Chromosomal cohesin forms a ring. Cell 112, 765-778. Gu, H., Marth, J. D., Orban, P. C., Mossmann, H. and Rajewsky, K. (1994). Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting. Science 265, 103-106.

Page | ‐ 204 ‐

References

Guo, W., Shang, F., Liu, Q., Urim, L., Zhang, M. and Taylor, A. (2006). Ubiquitin– proteasome pathway function is required for lens cell proliferation and differentiation. Investigative ophthalmology & visual science 47, 2569-2575. Gutierrez, G. J., Tsuji, T., Chen, M., Jiang, W. and Ronai, Z. A. (2010). Interplay between Cdh1 and JNK activity during the cell cycle. Nature cell biology 12, 686-695. Gwatkin, R. (1966). Amino acid requirements for attachment and outgrowth of the mouse blastocyst in vitro. Journal of Cellular Physiology 68, 335-343. Hached, K., Xie, S. Z., Buffin, E., Cladière, D., Rachez, C., Sacras, M., Sorger, P. K. and Wassmann, K. (2011). Mps1 at kinetochores is essential for female mouse meiosis I. Development 138, 2261-2271. Hadi, T., Hammer, M. A., Algire, C., Richards, T. and Baltz, J. M. (2005). Similar effects of osmolarity, glucose, and phosphate on cleavage past the 2-cell stage in mouse embryos from outbred and F1 hybrid females. Biology of reproduction 72, 179-187. Hagting, A., Den Elzen, N., Vodermaier, H. C., Waizenegger, I. C., Peters, J. M. and Pines, J. (2002). Human securin proteolysis is controlled by the spindle checkpoint and reveals when the APC/C switches from activation by Cdc20 to Cdh1. The Journal of cell biology 157, 1125- 1137. Hallows, K. R. and Knauf, P. A. (1994). Principles of cell volume regulation. Cellular and molecular physiology of cell volume regulation, 3-29. Hamatani, T., Carter, M. G., Sharov, A. A. and Ko, M. S. H. (2004). Dynamics of global gene expression changes during mouse preimplantation development. Developmental cell 6, 117-131. Hamilton, A. J. and Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950-952. Han, S. J. and Conti, M. (2006). New pathways from PKA to the Cdc2/cyclin B complex in oocytes: Wee1B as a potential PKA substrate. Cell Cycle 5, 227-231. Handyside, A. (1978). Time of commitment of inside cells isolated from preimplantation mouse embryos. Journal of embryology and experimental morphology 45, 37-53. Handyside, A. H. (1980). Distribution of antibody-and lectin-binding sites on dissociated blastomeres from mouse morulae: evidence for polarization at compaction. Journal of embryology and experimental morphology 60, 99-116. Harding, E., Gibb, C., Johnson, M., Cook, D. and Day, M. (2002). Developmental changes in the management of acid loads during preimplantation mouse development. Biology of reproduction 67, 1419-1429. Hardy, K. (1999). Apoptosis in the human embryo. Reviews of reproduction 4, 125-134. Hardy, K., Spanos, S., Becker, D., Iannelli, P., Winston, R. and Stark, J. (2001). From cell death to embryo arrest: mathematical models of human preimplantation embryo development. Proceedings of the National Academy of Sciences 98, 1655-1660. Harlow, G. M. and Quinn, P. (1982). Development of preimplantation mouse embryos in vivo and in vitro. Australian journal of biological sciences 35, 187-194. Harper, J. W., Burton, J. L. and Solomon, M. J. (2002). The anaphase-promoting complex: it's not just for mitosis any more. Genes & development 16, 2179-2206.

Page | ‐ 205 ‐

References

Hashimoto, N., Watanabe, N., Furuta, Y., Tamemoto, H., Sagata, N., Yokoyama, M., Okazaki, K., Nagayoshi, M., Takedat, N. and Ikawatll, Y. (1994). Parthenogenetic activation of oocytes in c-mos-deficient mice. Nature 370, 68-71. Hauf, S., Roitinger, E., Koch, B., Dittrich, C. M., Mechtler, K. and Peters, J. M. (2005). Dissociation of cohesin from chromosome arms and loss of arm cohesion during early mitosis depends on phosphorylation of SA2. PLoS biology 3, e69. Hauf, S., Waizenegger, I. C. and Peters, J. M. (2001). Cohesin cleavage by separase required for anaphase and cytokinesis in human cells. Science 293, 1320-1323. Henery, C. and Kaufman, M. (1992). Cleavage rate of haploid and diploid parthenogenetic mouse embryos during the preimplantation period. Molecular Reproduction and Development 31, 258-263. Henery, C. C., Miranda, M., Wiekowski, M., Wilmut, I. and DePamphilis, M. L. (1995). Repression of gene expression at the beginning of mouse development. Developmental biology 169, 448-460. Hennet, T., Hagen, F. K., Tabak, L. A. and Marth, J. D. (1995). T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination. Proceedings of the National Academy of Sciences 92, 12070-12074. Herbert, M., Levasseur, M., Homer, H., Yallop, K., Murdoch, A. and McDougall, A. (2003). Homologue disjunction in mouse oocytes requires proteolysis of securin and cyclin B1. Nature cell biology 5, 1023-1025. Hershko, A. and Ciechanover, A. (1998). The ubiquitin system. Annual review of biochemistry 67, 425-479. Hershko, A., Heller, H., Elias, S. and Ciechanover, A. (1983). Components of ubiquitin- protein ligase system. Resolution, affinity purification, and role in protein breakdown. Journal of Biological Chemistry 258, 8206-8214. Herzog, F., Primorac, I., Dube, P., Lenart, P., Sander, B., Mechtler, K., Stark, H. and Peters, J. M. (2009). Structure of the anaphase-promoting complex/cyclosome interacting with a mitotic checkpoint complex. Science 323, 1477-1481. Hirao, Y., Miyano, T. and Kato, S. (1993). Acquisition of maturational competence in in vitro grown mouse oocytes. Journal of Experimental Zoology 267, 543-547. Ho, Y., Wigglesworth, K., Eppig, J. J. and Schultz, R. M. (1995). Preimplantation development of mouse embryos in KSOM: augmentation by amino acids and analysis of gene expression. Molecular Reproduction and Development 41, 232-238. Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annual review of genetics 30, 405-439. Hogan, B. and Tilly, R. (1978). In vitro development of inner cell masses isolated immunosurgically from mouse blastocysts II. Inner cell masses from 3· 5-to 4· 0-day pc blastocysts. Journal of embryology and experimental morphology 45, 107-121. Holt, J. E., Lane, S. I. R., Jennings, P., García-Higuera, I., Moreno, S. and Jones, K. T. (2012). APCFZR1 prevents non-disjunction in mouse oocytes by controlling meiotic spindle assembly timing. Molecular biology of the cell 23, 3970-3981. Holt, J. E., Tran, S. M. T., Stewart, J. L., Minahan, K., García-Higuera, I., Moreno, S. and Jones, K. T. (2011). The APC/C activator FZR1 coordinates the timing of meiotic resumption during prophase I arrest in mammalian oocytes. Development 138, 905-913.

Page | ‐ 206 ‐

References

Homa, S. T. and Swann, K. (1994). Fertilization and early embryology: A cytosolic sperm factor triggers calcium oscillations and membrane hyperpolarizations in human oocytes. Human Reproduction 9, 2356-2361. Homer, H., Gui, L. and Carroll, J. (2009). A spindle assembly checkpoint protein functions in prophase I arrest and prometaphase progression. Science 326, 991-994. Homer, H. A., McDougal, A., Levasseur, M. and Herbert, M. (2005). Restaging the spindle assembly checkpoint in female mammalian meiosis I. Cell Cycle 4, 650-653. Hong, K. U., Park, Y. S., Seong, Y. S., Kang, D., Bae, C. D. and Park, J. (2007). Functional importance of the anaphase-promoting complex-Cdh1-mediated degradation of TMAP/CKAP2 in regulation of spindle function and cytokinesis. Molecular and cellular biology 27, 3667-3681. Hoshi, M. and Toyoda, Y. (1985). Effect of EDTA on the preimplantation development of mouse embryos fertilized in vitro. Japanese Journal of Zootechnical Science 56, 931-937. Howell, C., Bestor, T., Ding, F., Latham, K., Mertineit, C., Trasler, J. and Chaillet, J. (2001). Genomic Imprinting Disrupted by a Maternal Effect Mutation in the Dnmt1 Gene. Cell 104, 829-838. Howlett, S. K. and Bolton, V. N. (1985). Sequence and regulation of morphological and molecular events during the first cell cycle of mouse embryogenesis. Journal of embryology and experimental morphology 87, 175-206. Hoyt, M. A. (2000). Exit from mitosis: spindle pole power. Cell 102, 267-270. Hsieh, A. C., Bo, R., Manola, J., Vazquez, F., Bare, O., Khvorova, A., Scaringe, S. and Sellers, W. R. (2004). A library of siRNA duplexes targeting the phosphoinositide 3‐kinase pathway: determinants of gene silencing for use in cell‐based screens. Nucleic acids research 32, 893-901. Hsu, J. Y., Reimann, J. D. R., Sørensen, C. S., Lukas, J. and Jackson, P. K. (2002). E2F- dependent accumulation of hEmi1 regulates S phase entry by inhibiting APCCdh1. Nature cell biology 4, 358-366. Hyafil, F., Babinet, C. and Jacob, F. (1981). Cell-cell interactions in early embryogenesis: a molecular approach to the role of calcium. Cell 26, 447-454. Hyafil, F., Morello, D., Babinet, C. and Jacob, F. (1980). A cell surface glycoprotein involved in the compaction of embryonal carcinoma cells and cleavage stage embryos. Cell 21, 927-934. Hyslop, L. A., Nixon, V. L., Levasseur, M., Chapman, F., Chiba, K., McDougall, A., Venables, J. P., Elliott, D. J. and Jones, K. T. (2004). Ca2+-promoted cyclin B1 degradation in mouse oocytes requires the establishment of a metaphase arrest. Developmental biology 269, 206-219. Ickowicz, D., Finkelstein, M. and Breitbart, H. (2012). Mechanism of sperm capacitation and the acrosome reaction: role of protein kinases. Asian Journal of Andrology 14, 816-821. Irniger, S. and Nasmyth, K. (1997). The anaphase-promoting complex is required in G1 arrested yeast cells to inhibit B-type cyclin accumulation and to prevent uncontrolled entry into S-phase. Journal of cell science 110, 1523-1531. Itoh, M., Sasaki, H., Furuse, M., Ozaki, H., Kita, T. and Tsukita, S. (2001). Junctional adhesion molecule (JAM) binds to PAR-3 a possible mechanism for the recruitment of PAR-3 to tight junctions. The Journal of cell biology 154, 491-498.

Page | ‐ 207 ‐

References

Izumi, Y., Hirose, T., Tamai, Y., Hirai, S., Nagashima, Y., Fujimoto, T., Tabuse, Y., Kemphues, K. J. and Ohno, S. (1998). An atypical PKC directly associates and colocalizes at the epithelial tight junction with ASIP, a mammalian homologue of Caenorhabditis elegans polarity protein PAR-3. The Journal of cell biology 143, 95-106. Jacobs, H., Richter, D., Venkatesh, T. and Lehner, C. (2002). Completion of Mitosis Requires Neither fzr/rap nor fzr2, a Male Germline-Specific Drosophila Cdh1 Homolog. Current Biology 12, 1435-1441. Jaspersen, S. L., Charles, J. F. and Morgan, D. O. (1999). Inhibitory phosphorylation of the APC regulator Hct1 is controlled by the kinase Cdc28 and the phosphatase Cdc14. Current Biology 9, 227-236. Joberty, G., Petersen, C., Gao, L. and Macara, I. G. (2000). The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nature cell biology 2, 531-539. John, D. P. and Kiessling, A. A. (1988). Improved pronuclear mouse embryo development over an extended pH range in Ham's F-10 medium without protein. Fertility and sterility 49, 150-155. Johnson, M. H. and Day, M. L. (2000). Egg timers: how is developmental time measured in the early vertebrate embryo? BioEssays 22, 57-63. Johnson, M. H. and Maro, B. (1986). Time and space in the mouse early embryo: a cell biological approach to cell diversification. Experimental Approaches to Mammalian Embryonic Development, 35-65. Johnson, M. H., Maro, B. and Takeichi, M. (1986). The role of cell adhesion in the synchronization and orientation of polarization in 8-cell mouse blastomeres. Journal of embryology and experimental morphology 93, 239-255. Johnson, M. H. and McConnell, J. M. L. (2004). Lineage allocation and cell polarity during mouse embryogenesis. In Seminars in cell & developmental biology, vol. 15 (ed., pp. 583-597: Elsevier. Johnson, M. H. and Ziomek, C. A. (1981). The foundation of two distinct cell lineages within the mouse morula. Cell 24, 71-80. Johnson, M. H. and Ziomek, C. A. (1983). Cell interactions influence the fate of mouse blastomeres undergoing the transition from the 16-to the 32-cell stage. Developmental biology 95, 211-218. Jones, K. (2011). Anaphase-promoting complex control in female mouse meiosis. Cell Cycle in Development 53, 343-363. Jones, K. T. (1998). Ca2+ oscillations in the activation of the egg and development of the embryo in mammals. Int. J. Dev. Biol 42, 1-10. Jones, K. T., Carroll, J., Merriman, J. A., Whittingham, D. G. and Kono, T. (1995). Repetitive sperm-induced Ca2+ transients in mouse oocytes are cell cycle dependent. Development 121, 3259-3266. Jordan, M. A., Thrower, D. and Wilson, L. (1992). Effects of vinblastine, podophyllotoxin and nocodazole on mitotic spindles. Implications for the role of microtubule dynamics in mitosis. Journal of cell science 102, 401-416. Juan, F., Sumara, I., Hirota, T., Hauf, S., Gerlich, D., de la Torre, C., Ellenberg, J., Peters, J. M. and de Maeztu, C. R. (2004). Regulation of sister chromatid cohesion between chromosome arms. Current Biology 14, 1187-1193.

Page | ‐ 208 ‐

References

Juneja, S. C., Barr, K. J., Enders, G. C. and Kidder, G. M. (1999). Defects in the germ line and gonads of mice lacking connexin43. Biology of reproduction 60, 1263-1270. Kabir, N., Yamamura, H., Takagishi, Y., Inouye, M., Oda, S. I. and Hidaka, H. (1996). Regulation of preimplantation development of mouse embryos: Effects of inhibition of myosin light‐chain kinase, a Ca2+/calmodulin‐dependent enzyme. Journal of Experimental Zoology 274, 101-110. Kamjoo, M., Brison, D. R. and Kimber, S. J. (2002). Apoptosis in the preimplantation mouse embryo: effect of strain difference and in vitro culture. Molecular Reproduction and Development 61, 67-77. Karakaidos, P., Taraviras, S., Vassiliou, L. V., Zacharatos, P., Kastrinakis, N. G., Kougiou, D., Kouloukoussa, M., Nishitani, H., Papavassiliou, A. G. and Lygerou, Z. (2004). Overexpression of the replication licensing regulators hCdt1 and hCdc6 characterizes a subset of non-small-cell lung carcinomas: synergistic effect with mutant p53 on tumor growth and chromosomal instability—evidence of E2F-1 transcriptional control over hCdt1. The American journal of pathology 165, 1351-1365. Kastan, M. B. and Bartek, J. (2004). Cell-cycle checkpoints and cancer. Nature 432, 316-323. Ke, P. Y., Kuo, Y. Y., Hu, C. M. and Chang, Z. F. (2005). Control of dTTP pool size by anaphase promoting complex/cyclosome is essential for the maintenance of genetic stability. Genes & development 19, 1920-1933. Kelly, S. J. (2005). Studies of the developmental potential of 4‐and 8‐cell stage mouse blastomeres. Journal of Experimental Zoology 200, 365-376. Kennerdell, J. R. and Carthew, R. W. (1998). Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95, 1017-1026. Ketting, R. F., Fischer, S. E. J., Bernstein, E., Sijen, T., Hannon, G. J. and Plasterk, R. H. A. (2001). Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes & development 15, 2654-2659. Ketting, R. F., Haverkamp, T. H. A., van Luenen, H. G. A. M. and Plasterk, R. H. A. (1999). mut-7 of C. elegans, Required for Transposon Silencing and RNA Interference, Is a Homolog of Werner Syndrome Helicase and RNaseD. Cell 99, 133-141. Khang, I., Sonn, S., Park, J. H., Rhee, K., Park, D. and Kim, K. (2005). Expression of epithin in mouse preimplantation development: Its functional role in compaction. Developmental biology 281, 134-144. Khodjakov, A., Copenagle, L., Gordon, M. B., Compton, D. A. and Kapoor, T. M. (2003). Minus-end capture of preformed kinetochore fibers contributes to spindle morphogenesis. The Journal of cell biology 160, 671-683. Khosla, S., Dean, W., Brown, D., Reik, W. and Feil, R. (2001). Culture of preimplantation mouse embryos affects fetal development and the expression of imprinted genes. Biology of reproduction 64, 918-926. Kidder, G. M. and McLachlin, J. R. (1985). Timing of transcription and protein synthesis underlying morphogenesis in preimplantation mouse embryos. Developmental biology 112, 265-275. Kidder, G. M. and Mhawi, A. A. (2002). Gap junctions and ovarian folliculogenesis. Reproduction 123, 613-620.

Page | ‐ 209 ‐

References

Kim, N. H., Uhm, S. J., Ju, J. Y., Lee, H. T. and Chung, K. S. (1997). Blastocoele formation and cell allocation to the inner cell mass and trophectoderm in haploid and diploid pig parthenotes developing in vitro. Zygote 5, 365-370. Kim, S. H., Li, Z. and Sacks, D. B. (2000). E-cadherin-mediated cell-cell attachment activates Cdc42. Journal of Biological Chemistry 275, 36999-37005. Kimura, Y., Yanagimachi, R., Kuretake, S., Bortkiewicz, H., Perry, A. and Yanagimachi, H. (1998). Analysis of mouse oocyte activation suggests the involvement of sperm perinuclear material. Biology of reproduction 58, 1407-1415. King, R. W., Deshaies, R. J., Peters, J. M. and Kirschner, M. W. (1996). How proteolysis drives the cell cycle. Science 274, 1652-1659. Kirschner, M., Newport, J. and Gerhart, J. (1985). The timing of early developmental events in Xenopus. Trends in Genetics 1, 41-47. Kitagawa, R., Law, E., Tang, L. and Rose, A. M. (2002). The Cdc20 Homolog, FZY-1, and Its Interacting Protein, IFY-1, Are Required for Proper Chromosome Segregation in Caenorhabditis elegans. Current Biology 12, 2118-2123. Kitajima, T. S., Sakuno, T., Ishiguro, K., Iemura, S., Natsume, T., Kawashima, S. A. and Watanabe, Y. (2006). Shugoshin collaborates with protein phosphatase 2A to protect cohesin. Nature 441, 46-52. Kitamura, K., Maekawa, H. and Shimoda, C. (1998). Fission yeast Ste9, a homolog of Hct1/Cdh1 and Fizzy-related, is a novel negative regulator of cell cycle progression during G1- phase. Molecular biology of the cell 9, 1065-1080. Kline, D. (1996). Activation of the mouse egg. Theriogenology 45, 81-90. Kline, D. and Kline, J. T. (1992). Repetitive calcium transients and the role of calcium in exocytosis and cell cycle activation in the mouse egg. Developmental biology 149, 80-89. Klotz, C., Dabauvalle, M. C., Paintrand, M., Weber, T., Bornens, M. and Karsenti, E. (1990). Parthenogenesis in Xenopus eggs requires centrosomal integrity. The Journal of cell biology 110, 405-415. Kobayakawa, Y. and Kubota, H. Y. (1981). Temporal pattern of cleavage and the onset of gastrulation in amphibian embryos developed from eggs with the reduced cytoplasm. Journal of embryology and experimental morphology 62, 83-94. Konishi, Y., Stegmüller, J., Matsuda, T., Bonni, S. and Bonni, A. (2004). Cdh1-APC controls axonal growth and patterning in the mammalian brain. Science 303, 1026-1030. Kono, T., Jones, K. T., Bos-Mikich, A., Whittingham, D. G. and Carroll, J. (1996). A cell cycle-associated change in Ca2+ releasing activity leads to the generation of Ca2+ transients in mouse embryos during the first mitotic division. The Journal of cell biology 132, 915-923. Kotani, S., Tanaka, H., Yasuda, H. and Todokoro, K. (1999). Regulation of APC activity by phosphorylation and regulatory factors. The Journal of cell biology 146, 791-800. Kouchi, Z., Fukami, K., Shikano, T., Oda, S., Nakamura, Y., Takenawa, T. and Miyazaki, S. (2004). Recombinant phospholipase Cζ has high Ca2+ sensitivity and induces Ca2+ oscillations in mouse eggs. Journal of Biological Chemistry 279, 10408-10412. Koutsourakis, M., Langeveld, A., Patient, R., Beddington, R. and Grosveld, F. (1999). The transcription factor GATA6 is essential for early extraembryonic development. Development 126, 723-732.

Page | ‐ 210 ‐

References

Kramer, E. R., Scheuringer, N., Podtelejnikov, A. V., Mann, M. and Peters, J. M. (2000). Mitotic regulation of the APC activator proteins CDC20 and CDH1. Molecular biology of the cell 11, 1555-1569. Kreiss, P., Mailhe, P., Scherman, D., Pitard, B., Cameron, B., Rangara, R., Aguerre- Charriol, O., Airiau, M. and Crouzet, J. (1999). Plasmid DNA size does not affect the physicochemical properties of lipoplexes but modulates gene transfer efficiency. Nucleic acids research 27, 3792-3798. Krishna, M. and Generoso, W. M. (1977). Timing of sperm penetration, pronuclear formation, pronuclear DNA synthesis, and first cleavage in naturally ovulated mouse eggs. Journal of Experimental Zoology 202, 245-252. Kubiak, J., Weber, M., De Pennart, H., Winston, N. and Maro, B. (1993). The metaphase II arrest in mouse oocytes is controlled through microtubule-dependent destruction of cyclin B in the presence of CSF. The EMBO journal 12, 3773-3778. Kubiak, J. Z. (1991). Cell cycle-dependent behavior of microtubules in hybrids of mouse oocytes and blastomeres. Int J Dev Biol 35, 421-427. Kubiak, J. Z., Ciemerych, M. A., Hupalowska, A., Sikora-Polaczek, M. and Polanski, Z. (2008). On the transition from the meiotic to mitotic cell cycle during early mouse development. International Journal of Developmental Biology 52, 201-217. Kudo, N. R., Wassmann, K., Anger, M., Schuh, M., Wirth, K. G., Xu, H., Helmhart, W., Kudo, H., Mckay, M. and Maro, B. (2006). Resolution of chiasmata in oocytes requires separase-mediated proteolysis. Cell 126, 135-146. Kulukian, A., Han, J. S. and Cleveland, D. W. (2009). Unattached kinetochores catalyze production of an anaphase inhibitor that requires a Mad2 template to prime Cdc20 for BubR1 binding. Developmental cell 16, 105-117. Kumar, M. S., Lu, J., Mercer, K. L., Golub, T. R. and Jacks, T. (2007). Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nature genetics 39, 673-677. Kuo, C. T., Morrisey, E. E., Anandappa, R., Sigrist, K., Lu, M. M., Parmacek, M. S., Soudais, C. and Leiden, J. M. (1997). GATA4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes & development 11, 1048-1060. Lagos-Quintana, M., Rauhut, R., Lendeckel, W. and Tuschl, T. (2001). Identification of novel genes coding for small expressed RNAs. Science 294, 853-858. Lan, Z. J., Gu, P., Xu, X. and Cooney, A. J. (2003a). Expression of the orphan nuclear receptor, germ cell nuclear factor, in mouse gonads and preimplantation embryos. Biology of reproduction 68, 282-289. Lan, Z. J., Gu, P., Xu, X., Jackson, K. J., DeMayo, F. J., O'Malley, B. W. and Cooney, A. J. (2003b). GCNF-dependent repression of BMP-15 and GDF-9 mediates gamete regulation of female fertility. The EMBO journal 22, 4070-4081. Lan, Z. J., Xu, X. and Cooney, A. J. (2004). Differential oocyte-specific expression of Cre recombinase activity in GDF-9-iCre, Zp3cre, and Msx2Cre transgenic mice. Biology of reproduction 71, 1469-1474. Lane, M., Baltz, J. M. and Bavister, B. D. (1998). Regulation of Intracellular pH in Hamster Preimplantation Embryos by the Sodium Hydrogen (Na+/H+) Antiporter. Biology of reproduction 59, 1483-1490.

Page | ‐ 211 ‐

References

Lane, M. and Gardner, D. (1994). Increase in postimplantation development of cultured mouse embryos by amino acids and induction of fetal retardation and exencephaly by ammonium ions. Journal of reproduction and fertility 102, 305-312. Lane, M. and Gardner, D. K. (1992). Effect of incubation volume and embryo density on the development and viability of mouse embryos in vitro. Human Reproduction 7, 558-562. Lane, M. and Gardner, D. K. (2007). Embryo culture medium: which is the best? Best Practice & Research Clinical Obstetrics & Gynaecology 21, 83-100. Larman, M. G., Sheehan, C. B. and Gardner, D. K. (2006). Calcium-free vitrification reduces cryoprotectant-induced zona pellucida hardening and increases fertilization rates in mouse oocytes. Reproduction 131, 53-61. Latham, K. E. (1994). Strain-specific differences in mouse oocytes and their contributions to epigenetic inheritance. Development 120, 3419-3426. Latham, K. E., Garrels, J. I., Chang, C. and Solter, D. (1991). Quantitative analysis of protein synthesis in mouse embryos. I. Extensive reprogramming at the one-and two-cell stages. Development 112, 921-932. Latham, K. E. and Rambhatla, L. (1995). Expression of X‐linked genes in androgenetic, gynogenetic, and normal mouse preimplantation embryos. Developmental genetics 17, 212-222. Latham, K. E. and Sapienza, C. (1998). Localization of genes encoding egg modifiers of paternal genome function to mouse chromosomes one and two. Development 125, 929-935. Latham, K. E. and Schultz, R. M. (2001). Embryonic genome activation. Frontiers in Bioscience 6, D748-759. Latham, K. E. and Solter, D. (1991). Effect of egg composition on the developmental capacity of androgenetic mouse embryos. Development 113, 561-568. Latham, K. E., Solter, D. and Schultz, R. M. (1992). Acquisition of a transcriptionally permissive state during the 1-cell stage of mouse embryogenesis. Developmental biology 149, 457-462. Lawitts, J. and Biggers, J. (1991). Optimization of mouse embryo culture media using simplex methods. Journal of reproduction and fertility 91, 543-556. Lawitts, J. and Biggers, J. D. (1992). Joint effects of sodium chloride, glutamine, and glucose in mouse preimplantation embryo culture media. Molecular Reproduction and Development 31, 189-194. Lawitts, J. A. and Biggers, J. D. (1993). Culture of preimplantation embryos. Methods in enzymology 225, 153-164. Lee, H. J., Caldwell, H. K., Macbeth, A. H., Tolu, S. G. and Young, W. S. (2008). A conditional knockout mouse line of the oxytocin receptor. Endocrinology 149, 3256-3263. Lee, J., Kitajima, T. S., Tanno, Y., Yoshida, K., Morita, T., Miyano, T., Miyake, M. and Watanabe, Y. (2007). Unified mode of centromeric protection by shugoshin in mammalian oocytes and somatic cells. Nature cell biology 10, 42-52. Lee, L. A. and Orr-Weaver, T. L. (2003). Regulation of cell cycles in Drosophila development: intrinsic and extrinsic cues. Annual review of genetics 37, 545-578. Lee, Y., Kim, M., Han, J., Yeom, K. H., Lee, S., Baek, S. H. and Kim, V. N. (2004). MicroRNA genes are transcribed by RNA polymerase II. The EMBO journal 23, 4051-4060.

Page | ‐ 212 ‐

References

Leese, H. and Barton, A. M. (1984). Pyruvate and glucose uptake by mouse ova and preimplantation embryos. Journal of reproduction and fertility 72, 9-13. Lehtonen, E. and Badley, R. (1980). Localization of cytoskeletal proteins in preimplantation mouse embryos. Journal of embryology and experimental morphology 55, 211-225. Lemaire, P., Garrett, N. and Gurdon, J. (1995). Expression cloning of Siamois, a xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell 81, 85-94. Lessman, C. A. and Huver, C. W. (1981). Quantification of fertilization-induced gamete changes and sperm entry without egg activation in a teleost egg. Developmental biology 84, 218-224. Levey, I. L., Stull, G. and Brinster, R. (1978). Poly (A) and synthesis of polyadenylated RNA in the preimplantation mouse embryo. Developmental biology 64, 140-148. Levy, J. B., Johnson, M. H., Goodall, H. and Maro, B. (1986). The timing of compaction: control of a major developmental transition in mouse early embryogenesis. Journal of embryology and experimental morphology 95, 213-237. Lewis, W. H. and Wright, E. S. (1935). On the early development of the mouse egg: Carnegie Institution. Li, L., Zheng, P. and Dean, J. (2010). Maternal control of early mouse development. Development 137, 859-870. Li, M., Shin, Y. H., Hou, L., Huang, X., Wei, Z., Klann, E. and Zhang, P. (2008). The adaptor protein of the anaphase promoting complex Cdh1 is essential in maintaining replicative lifespan and in learning and memory. Nature cell biology 10, 1083-1089. Li, M., York, J. P. and Zhang, P. (2007a). Loss of Cdc20 causes a securin-dependent metaphase arrest in two-cell mouse embryos. Molecular and cellular biology 27, 3481-3488. Li, W., Wu, G. and Wan, Y. (2007b). The dual effects of Cdh1/APC in myogenesis. The FASEB Journal 21, 3606-3617. Lillie, F. R. (1919). Problems of fertilization: The University of Chicago press. Lim, H., Goh, P. and Surana, U. (1998). Cdc20 is essential for the cyclosome-mediated proteolysis of both Pds1 and Clb2 during M phase in budding yeast. Current Biology 8, 231-234. Lindeman, R. E. and Pelegri, F. (2012). Localized Products of futile cycle/lrmp Promote Centrosome-Nucleus Attachment in the Zebrafish Zygote. Current Biology 22, 843-851. Lindon, C. and Pines, J. (2004). Ordered proteolysis in anaphase inactivates Plk1 to contribute to proper mitotic exit in human cells. The Journal of cell biology 164, 233-241. Listovsky, T., Oren, Y. S., Yudkovsky, Y., Mahbubani, H. M., Weiss, A. M., Lebendiker, M. and Brandeis, M. (2004). Mammalian Cdh1/Fzr mediates its own degradation. The EMBO journal 23, 1619-1626. Littlepage, L. E. and Ruderman, J. V. (2002). Identification of a new APC/C recognition domain, the A box, which is required for the Cdh1-dependent destruction of the kinase Aurora- A during mitotic exit. Genes & development 16, 2274-2285. Liu, C., Litscher, E. S., Mortillo, S., Sakai, Y., Kinloch, R. A., Stewart, C. L. and Wassarman, P. M. (1996). Targeted disruption of the mZP3 gene results in production of eggs lacking a zona pellucida and infertility in female mice. Proceedings of the National Academy of Sciences of the United States of America 93, 5431-5436.

Page | ‐ 213 ‐

References

Liu, L., Rajareddy, S., Reddy, P., Du, C., Jagarlamudi, K., Shen, Y., Gunnarsson, D., Selstam, G., Boman, K. and Liu, K. (2007). Infertility caused by retardation of follicular development in mice with oocyte-specific expression of Foxo3a. Development 134, 199-209. Liu, L., Trimarchi, J. R. and Keefe, D. L. (2002). Haploidy but not parthenogenetic activation leads to increased incidence of apoptosis in mouse embryos. Biology of reproduction 66, 204- 210. Liu, Q., Shang, F., Zhang, X., Li, W. and Taylor, A. (2006). Expression of K6W-ubiquitin inhibits proliferation of human lens epithelial cells. Molecular Vision 12, 931-936. Liu, W., Li, W., Fujita, T., Yang, Q. and Wan, Y. (2008). Proteolysis of CDH1 enhances susceptibility to UV radiation-induced apoptosis. Carcinogenesis 29, 263-272. Liu, Z. and Foote, R. (1995). Effects of amino acids on the development of in-vitro matured/in-vitro fertilization bovine embryos in a simple protein-free medium. Human Reproduction 10, 2985-2991. Liyanage, M., Colemanz, A., Ferguson-Smiths, M. A. and Schrockl, E. (1996). Multicolour spectral karyotyping of mouse chromosomes. Nature genetics 14, 312-315. Llano, E., Gómez, R., Gutiérrez-Caballero, C., Herrán, Y., Sánchez-Martín, M., Vázquez- Quiñones, L., Hernández, T., De Álava, E., Cuadrado, A. and Barbero, J. L. (2008). Shugoshin-2 is essential for the completion of meiosis but not for mitotic cell division in mice. Genes & development 22, 2400-2413. Lo, C. W. and Gilula, N. B. (1979). Gap junctional communication in the preimplantation mouse embryo. Cell 18, 399-409. Loh, K. M. and Lim, B. (2011). A precarious balance: pluripotency factors as lineage specifiers. Cell stem cell 8, 363-369. Loh, Y. H., Wu, Q., Chew, J. L., Vega, V. B., Zhang, W., Chen, X., Bourque, G., George, J., Leong, B. and Liu, J. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nature genetics 38, 431-440. Lohmann, J. U., Endl, I. and Bosch, T. C. G. (1999). Silencing of developmental genes in Hydra. Developmental biology 214, 211-214. Longo, F. J. (1973). Fertilization: a comparative ultrastructural review. Biology of reproduction 9, 149-215. Longo, F. J. and Anderson, E. (1968). The fine structure of pronuclear development and fusion in the sea urchin, Arbacia punctulata. The Journal of cell biology 39, 339-368. Lorca, T., Castro, A., Martinez, A. M., Vigneron, S., Morin, N., Sigrist, S., Lehner, C., Dorée, M. and Labbé, J. C. (1998). Fizzy is required for activation of the APC/cyclosome in Xenopus egg extracts. The EMBO journal 17, 3565-3575. Loutradis, D., John, D. and Kiessling, A. (1987). Hypoxanthine causes a 2-cell block in random-bred mouse embryos. Biology of reproduction 37, 311-316. Lu, Q., Smith, G. D., Chen, D. Y., Yang, Z., Han, Z. M., Schatten, H. and Sun, Q. Y. (2001). Phosphorylation of mitogen-activated protein kinase is regulated by protein kinase C, cyclic 3′, 5′-adenosine monophosphate, and protein phosphatase modulators during meiosis resumption in rat oocytes. Biology of reproduction 64, 1444-1450. Lukas, C., Sørensen, C. S., Kramer, E., Santoni-Rugiu, E., Lindeneg, C., Peters, J. M., Bartek, J. and Lukas, J. (1999). Accumulation of cyclin B1 requires E2F and cyclin-A- dependent rearrangement of the anaphase-promoting complex. Nature 401, 815-818. Page | ‐ 214 ‐

References

Lukas, J., Lukas, C. and Bartek, J. (2011). More than just a focus: The chromatin response to DNA damage and its role in genome integrity maintenance. Nature cell biology 13, 1161-1169. Luthardt, F. and Donahuc, R. (1973). Pronuclear DNA synthesis in mouse eggs: An autoradiographic study. Experimental cell research 82, 143-151. Ma, J., Zeng, F., Schultz, R. M. and Tseng, H. (2006). Basonuclin: a novel mammalian maternal-effect gene. Development 133, 2053-2062. Madgwick, S., Nixon, V. L., Chang, H. Y., Herbert, M., Levasseur, M. and Jones, K. T. (2004). Maintenance of sister chromatid attachment in mouse eggs through maturation- promoting factor activity. Developmental biology 275, 68-81. Magnani, L. and Cabot, R. A. (2008). In vitro and in vivo derived porcine embryos possess similar, but not identical, patterns of Oct4, Nanog, and Sox2 mRNA expression during cleavage development. Molecular Reproduction and Development 75, 1726-1735. Magnuson, T., Demsey, A. and Stackpole, C. W. (1977). Characterization of intercellular junctions in the preimplantation mouse embryo by freeze-fracture and thin-section electron microscopy. Developmental biology 61, 252-261. Malmanche, N., Owen, S., Gegick, S., Steffensen, S., Tomkiel, J. and Sunkel, C. (2007). Drosophila BubR1 is essential for meiotic sister-chromatid cohesion and maintenance of synaptonemal complex. Current Biology 17, 1489-1497. Malumbres, M. and Barbacid, M. (2001). To cycle or not to cycle: a critical decision in cancer. Nature Reviews. Cancer. 1, 222-231. Malumbres, M. and Barbacid, M. (2009). Cell cycle, CDKs and cancer: a changing paradigm. Nature Reviews Cancer 9, 153-166. Manchado, E., Guillamot, M., de Cárcer, G., Eguren, M., Trickey, M., García-Higuera, I., Moreno, S., Yamano, H., Cañamero, M. and Malumbres, M. (2010). Targeting mitotic exit leads to tumor regression in vivo: modulation by Cdk1, Mastl, and the PP2A/B55α, δ phosphatase. Cancer cell 18, 641-654. Marangos, P., FitzHarris, G. and Carroll, J. (2003). Ca2+ oscillations at fertilization in mammals are regulated by the formation of pronuclei. Development 130, 1461-1472. Marangos, P., Verschuren, E. W., Chen, R., Jackson, P. K. and Carroll, J. (2007). Prophase I arrest and progression to metaphase I in mouse oocytes are controlled by Emi1-dependent regulation of APCCdh1. The Journal of cell biology 176, 65-75. Maro, B., Johnson, M., Pickering, S. and Flach, G. (1984). Changes in actin distribution during fertilization of the mouse egg. Journal of embryology and experimental morphology 81, 211-237. Maro, B., Johnson, M. H., Webb, M. and Flach, G. (1986). Mechanism of polar body formation in the mouse oocyte: an interaction between the chromosomes, the cytoskeleton and the plasma membrane. Journal of embryology and experimental morphology 92, 11-32. Maro, B. and Verlhac, M. H. (2002). Polar body formation: new rules for asymmetric divisions. Nature cell biology 4, E281-E283. Marshall, L. A., Chin, N., Baribault, H. and Kassner, P. D. (2007). Significant gene content variation characterizes the genomes of inbred mouse strains. Genome Research 17, 1743-1754. Martínez-Balbás, M. A., Dey, A., Rabindran, S. K., Ozato, K. and Wu, C. (1995). Displacement of sequence-specific transcription factors from mitotic chromatin. Cell 83, 29-38.

Page | ‐ 215 ‐

References

Marumoto, T., Zhang, D. and Saya, H. (2005). Aurora-A—a guardian of poles. Nature Reviews Cancer 5, 42-50. Matten, W., Daar, I. and Vande Woude, G. F. (1994). Protein kinase A acts at multiple points to inhibit Xenopus oocyte maturation. Molecular and cellular biology 14, 4419-4426. Matzuk, M. M., Burns, K. H., Viveiros, M. M. and Eppig, J. J. (2002). Intercellular communication in the mammalian ovary: oocytes carry the conversation. Science 296, 2178- 2180. McGarry, T. J. and Kirschner, M. W. (1998). Geminin, an inhibitor of DNA replication, is degraded during mitosis. Cell 93, 1043-1053. McGuinness, B. E., Anger, M., Kouznetsova, A., Gil-Bernabé, A. M., Helmhart, W., Kudo, N. R., Wuensche, A., Taylor, S., Hoog, C. and Novak, B. (2009). Regulation of APC/C activity in oocytes by a Bub1-dependent spindle assembly checkpoint. Current Biology 19, 369- 380. McKenzie, B. E. and Kenney, R. M. (1973). In vitro culture of bovine embryos. American journal of veterinary research 34, 1271. Mehlmann, L. M. (2005). Stops and starts in mammalian oocytes: recent advances in understanding the regulation of meiotic arrest and oocyte maturation. Reproduction 130, 791- 799. Mehta, T. and Kiessling, A. (1990). Development potential of mouse embryos conceived in vitro and cultured in ethylenediaminetetraacetic acid with or without amino acids or serum. Biology of reproduction 43, 600-606. Meijer, L., Arion, D., Golsteyn, R., Pines, J., Brizuela, L., Hunt, T. and Beach, D. (1989a). Cyclin is a component of the sea urchin egg M-phase specific histone H1 kinase. The EMBO journal 8, 2275-2282. Meijer, L., Dostmann, W., Genieser, H., Butt, E. and Jastorff, B. (1989b). Starfish oocyte maturation: evidence for a cyclic AMP-dependent inhibitory pathway. Developmental biology 133, 58-66. Menezo, Y. J. R. (1972). Amino constituents of tubal and uterine fluids of the estrous ewe: comparison with blood serum and ram seminal fluid: Basel Press, New York. Miller, J. and Schultz, G. (1987). Amino acid content of preimplantation rabbit embryos and fluids of the reproductive tract. Biology of reproduction 36, 125-129. Miller, J. J., Summers, M. K., Hansen, D. V., Nachury, M. V., Lehman, N. L., Loktev, A. and Jackson, P. K. (2006). Emi1 stably binds and inhibits the anaphase-promoting complex/cyclosome as a pseudosubstrate inhibitor. Genes & development 20, 2410-2420. Mimms, S. (2005). CDKs promote DNA replication origin licensing in human cells by protecting Cdc6 from APC/C-dependent proteolysis. Cell 122, 915-926. Minshull, J., Blow, J. J. and Hunt, T. (1989). Translation of cyclin mRNA is necessary for extracts of activated xenopus eggs to enter mitosis. Cell 56, 947-956. Misquitta, L. and Paterson, B. M. (1999). Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): a role for nautilus in embryonic somatic muscle formation. Proceedings of the National Academy of Sciences 96, 1451-1456. Mitra, J. and Schultz, R. M. (1996). Regulation of the acquisition of meiotic competence in the mouse: changes in the subcellular localization of cdc2, cyclin B1, cdc25C and wee1, and in the concentration of these proteins and their transcripts. Journal of cell science 109, 2407-2415. Page | ‐ 216 ‐

References

Mittwoch, U. (1978). Parthenogenesis. Journal of medical genetics 15, 165-181. Miyazaki, S., Shirakawa, H., Nakada, K. and Honda, Y. (1993). Essential Role of the Inositol 1, 4, 5-Trisphosphate Receptor/Ca2+ Release Channel in Ca2+ Waves and Ca2+ Oscillations at Fertilization of Mammalian Eggs. Developmental biology 158, 62-78. Miyoshi, K., Abeydeera, L., Okuda, K. and Niwa, K. (1995). Effects of osmolarity and amino acids in a chemically defined medium on development of rat one-cell embryos. Journal of reproduction and fertility 103, 27-32. Molls, M., Zamboglou, N. and Streffer, C. (1983). A comparison of the cell kinetics of preimplantation mouse embryos from two different mouse strains. Cell and tissue kinetics 16, 277- 283. Monk, M., Boubelik, M. and Lehnert, S. (1987). Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development 99, 371-382. Montgomery, M. K., Xu, S. Q. and Fire, A. (1998). RNA as a target of double-stranded RNA- mediated genetic interference in Caenorhabditis elegans. Proceedings of the National Academy of Sciences 95, 15502-15507. Moore, G. (1975). The RNA polymerase activity of the preimplantation mouse embryo. Journal of embryology and experimental morphology 34, 291-298. Moore, G. and Lintern-Moore, S. (1978). Transcription of the mouse oocyte genome. Biology of reproduction 18, 865-870. Morgan, D. O. (1997). Cyclin-dependent kinases: engines, clocks, and microprocessors. Annual review of cell and developmental biology 13, 261-291. Morgan, D. O. (1999). Regulation of the APC and the exit from mitosis. Nature cell biology 1, E47-E53. Morrisey, E. E., Tang, Z., Sigrist, K., Lu, M. M., Jiang, F., Ip, H. S. and Parmacek, M. S. (1998). GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo. Genes & development 12, 3579-3590. Moses, R. M. and Kline, D. (1995). Release of mouse eggs from metaphase arrest by protein synthesis inhibition in the absence of a calcium signal or microtubule assembly. Molecular Reproduction and Development 41, 264-273. Moses, R. M. and Masui, Y. (1994). Enhancement of mouse egg activation by the kinase inhibitor, 6‐dimethylaminopurine (6‐DMAP). Journal of Experimental Zoology 270, 211- 218. Muggleton-Harris, A., Whittingham, D. G. and Wilson, L. (1982). Cytoplasmic control of preimplantation development in vitro in the mouse. Nature 299, 460-462. Murray, A. (1995). Cyclin ubiquitination: the destructive end of mitosis. Cell 81, 149-152. Musacchio, A. and Salmon, E. D. (2007). The spindle-assembly checkpoint in space and time. Nature Reviews Molecular Cell Biology 8, 379-393. Nakao, K., Nakagata, N. and Katsuki, M. (1997). Simple and efficient vitrification procedure for cryopreservation of mouse embryos. Experimental animals 46, 231-234. Narbonne-Reveau, K., Senger, S., Pal, M., Herr, A., Richardson, H. E., Asano, M., Deak, P. and Lilly, M. A. (2008). APC/CFzr/Cdh1 promotes cell cycle progression during the Drosophila endocycle. Development 135, 1451-1461.

Page | ‐ 217 ‐

References

Nasmyth, K. (2005). How might cohesin hold sister chromatids together? Philosophical Transactions of the Royal Society B: Biological Sciences 360, 483-496. Nasr-Esfahani, M., Winston, N. and Johnson, M. (1992). Effects of glucose, glutamine, ethylenediaminetetraacetic acid and oxygen tension on the concentration of reactive oxygen species and on development of the mouse preimplantation embryo in vitro. Journal of reproduction and fertility 96, 219-231. Navarro, P. A. A. S., Liu, L., Trimarchi, J. R., Ferriani, R. A. and Keefe, D. L. (2005). Noninvasive imaging of spindle dynamics during mammalian oocyte activation. Fertility and sterility 83, 1197-1205. Newport, J. and Kirschner, M. (1982a). A major developmental transition in early Xenopus embryos: I. characterization and timing of cellular changes at the midblastula stage. Cell 30, 675-686. Newport, J. and Kirschner, M. (1982b). A major developmental transition in early Xenopus embryos: II. Control of the onset of transcription. Cell 30, 687-696. Ngô, H., Tschudi, C., Gull, K. and Ullu, E. (1998). Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proceedings of the National Academy of Sciences 95, 14687-14692. Nguyen, P. A., Ishihara, K., Wühr, M. and Mitchison, T. J. (2012). Pronuclear Migration: No Attachment? No Union, but a Futile Cycle! Current Biology 22, R409-R411. Nigg, E. A. (2001). Mitotic kinases as regulators of cell division and its checkpoints. Nature Reviews Molecular Cell Biology 2, 21-32. Nilsson, J., Yekezare, M., Minshull, J. and Pines, J. (2008). The APC/C maintains the spindle assembly checkpoint by targeting Cdc20 for destruction. Nature cell biology 10, 1411-1420. Nishioka, N., Inoue, K.-i., Adachi, K., Kiyonari, H., Ota, M., Ralston, A., Yabuta, N., Hirahara, S., Stephenson, R. O. and Ogonuki, N. (2009). The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Developmental cell 16, 398-410. Nishioka, N., Yamamoto, S., Kiyonari, H., Sato, H., Sawada, A., Ota, M., Nakao, K. and Sasaki, H. (2008). Tead4 is required for specification of trophectoderm in pre-implantation mouse embryos. Mechanisms of Development 125, 270-283. Niwa, H., Toyooka, Y., Shimosato, D., Strumpf, D., Takahashi, K., Yagi, R. and Rossant, J. (2005). Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123, 917-930. Nixon, V. L., Levasseur, M., McDougall, A. and Jones, K. T. (2002). Ca2+ Oscillations Promote APC/C-Dependent Cyclin B1 Degradation during Metaphase Arrest and Completion of Meiosis in Fertilizing Mouse Eggs. Current Biology 12, 746-750. Nowling, T., Desler, M., Kuszynski, C. and Rizzino, A. (2002). Transfection of embryonal carcinoma cells at high efficiency using liposome ‐ mediated transfection. Molecular Reproduction and Development 63, 309-317. O'neill, C. (1998). Autocrine mediators are required to act on the embryo by the 2-cell stage to promote normal development and survival of mouse preimplantation embryos in vitro. Biology of reproduction 58, 1303-1309.

Page | ‐ 218 ‐

References

O'neill, G., Rolfe, L. and Kaufman, M. (1991). Developmental potential and chromosome constitution of strontium ‐ induced mouse parthenogenones. Molecular Reproduction and Development 30, 214-219. Ogou, S. I., Okada, T. and Takeichi, M. (1982). Cleavage stage mouse embryos share a common cell adhesion system with teratocarcinoma cells. Developmental biology 92, 521-528. Olds, P., Stern, S. and Biggers, J. (1973). Chemical estimates of the RNA and DNA contents of the early mouse embryo. Journal of Experimental Zoology 186, 39-45. Osada, T., Ogino, H., Hino, T., Ichinose, S., Nakamura, K., Omori, A., Noce, T. and Masutani, M. (2010). PolyADP-ribosylation is required for pronuclear fusion during postfertilization in mice. PLoS One 5, e12526. Otaegui, P., O'neill, G. and Wilmut, I. (1999). Parthenogenetic activation of mouse oocytes by exposure to strontium as a source of cytoplasts for nuclear transfer. Cloning 1, 111-117. Ozil, J. P. (1990). The parthenogenetic development of rabbit oocytes after repetitive pulsatile electrical stimulation. Development 109, 117-127. Ozil, J. P. (1998). Role of calcium oscillations in mammalian egg activation: experimental approach. Biophysical chemistry 72, 141-152. Ozolek, J. A. and Castro, C. A. (2011). Teratomas Derived from Embryonic Stem Cells as Models for Embryonic Development, Disease, and Tumorigenesis. Intech open science 13, 231- 258. Page, R. L., Canseco, R. S., Russell, C. G., Johnson, J. L., Velander, W. H. and Gwazdauskas, F. C. (1995). Transgene detection during early murine embryonic development after pronuclear microinjection. Transgenic research 4, 12-17. Pesin, J. A. and Orr-Weaver, T. L. (2008). Regulation of APC/C activators in mitosis and meiosis. Annual review of cell and developmental biology 24, 475-499. Peters, J. M. (2002). The Anaphase-Promoting Complex-Proteolysis in Mitosis and Beyond. Molecular cell 9, 931-944. Peters, J. M. (2006). The anaphase promoting complex/cyclosome: a machine designed to destroy. Nature Reviews Molecular Cell Biology 7, 644-656. Peters, J. M., Tedeschi, A. and Schmitz, J. (2008). The cohesin complex and its roles in chromosome biology. Genes & development 22, 3089-3114. Petersen, B. O., Wagener, C., Marinoni, F., Kramer, E. R., Melixetian, M., Denchi, E. L., Gieffers, C., Matteucci, C., Peters, J. M. and Helin, K. (2000). Cell cycle–and cell growth– regulated proteolysis of mammalian CDC6 is dependent on APC–CDH1. Genes & development 14, 2330-2343. Petzoldt, U., Hoppe, P. C. and Illmensee, K. (1980). Protein synthesis in enuleated fertilized and unfertilized mouse eggs. Development Genes and Evolution 189, 215-219. Pey, R., Vial, C., Schatten, G. and Hafner, M. (1998). Increase of intracellular Ca2+ and relocation of E-cadherin during experimental decompaction of mouse embryos. Proceedings of the National Academy of Sciences 95, 12977-12982. Peyriéras, N., Hyafil, F., Louvard, D., Ploegh, H. L. and Jacob, F. (1983). Uvomorulin: a nonintegral membrane protein of early mouse embryo. Proceedings of the National Academy of Sciences 80, 6274-6277. Pfleger, C. M. and Kirschner, M. W. (2000). The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1. Genes & development 14, 655-665. Page | ‐ 219 ‐

References

Pfleger, C. M., Salic, A., Lee, E. and Kirschner, M. W. (2001). Inhibition of Cdh1–APC by the MAD2-related protein MAD2L2: a novel mechanism for regulating Cdh1. Genes & development 15, 1759-1764. Philpott, A. and Yew, P. R. (2008). The Xenopus cell cycle: an overview. Molecular biotechnology 39, 9-19. Pierce, G., Stevens, L. and Nakane, P. (1967). Ultrastructural analysis of the early development of teratocarcinomas. Journal of the National Cancer Institute 39, 755-773. Piko, L. and Clegg, K. B. (1982). Quantitative changes in total RNA, total poly (A), and ribosomes in early mouse embryos. Developmental biology 89, 362-378. Pines, J. (2006). Mitosis: a matter of getting rid of the right protein at the right time. Trends in cell biology 16, 55-63. Pines, J. (2011). Cubism and the cell cycle: the many faces of the APC/C. Nature Reviews Molecular Cell Biology 12, 427-438. Pirino, G., Wescott, M. P. and Donovan, P. J. (2009). Protein kinase A regulates resumption of meiosis by phosphorylation of Cdc25B in mammalian oocytes. Cell Cycle 8, 665-670. Plachta, N., Bollenbach, T., Pease, S., Fraser, S. E. and Pantazis, P. (2011). Oct4 kinetics predict cell lineage patterning in the early mammalian embryo. Nature cell biology 13, 117-123. Prieto, I., Pezzi, N., Buesa, J. M., Kremer, L., Barthelemy, I., Carreiro, C., Roncal, F., Martínez, A., Gómez, L. and Fernández, R. (2002). STAG2 and Rad21 mammalian mitotic cohesins are implicated in meiosis. EMBO reports 3, 543-550. Prieto, I., Tease, C., Pezzi, N., Buesa, J. M., Ortega, S., Kremer, L., Martinez, A., Martínez-A, C., Hultén, M. A. and Barbero, J. L. (2004). Cohesin component dynamics during meiotic prophase I in mammalian oocytes. Chromosome Research 12, 197-213. Prinz, S., Hwang, E. S., Visintin, R. and Amon, A. (1998). The regulation of Cdc20 proteolysis reveals a role for the APC components Cdc23 and Cdc27 during S phase and early mitosis. Current biology 8, 750-760. Qiao, X., Zhang, L., Gamper, A. M., Fujita, T. and Wan, Y. (2010). APC/C-Cdh1: from cell cycle to cellular differentiation and genomic integrity. Cell Cycle 9, 3904-3912. Raff, J. W., Jeffers, K. and Huang, J. (2002). The roles of Fzy/Cdc20 and Fzr/Cdh1 in regulating the destruction of cyclin B in space and time. The Journal of cell biology 157, 1139- 1149. Rajkovic, A. and Matzuk, M. M. (2002). Functional analysis of oocyte-expressed genes using transgenic models. Molecular and cellular endocrinology 187, 5-9. Ralston, A., Cox, B. J., Nishioka, N., Sasaki, H., Chea, E., Rugg-Gunn, P., Guo, G., Robson, P., Draper, J. S. and Rossant, J. (2010). Gata3 regulates trophoblast development downstream of Tead4 and in parallel to Cdx2. Development 137, 395-403. Ralston, A. and Rossant, J. (2008). Cdx2 acts downstream of cell polarization to cell- autonomously promote trophectoderm fate in the early mouse embryo. Developmental biology 313, 614-629. Rankin, T., Familari, M., Lee, E., Ginsberg, A., Dwyer, N., Blanchette-Mackie, J., Drago, J., Westphal, H. and Dean, J. (1996). Mice homozygous for an insertional mutation in the Zp3 gene lack a zona pellucida and are infertile. Development 122, 2903-2910. Rankin, T., Talbot, P., Lee, E. and Dean, J. (1999). Abnormal zonae pellucidae in mice lacking ZP1 result in early embryonic loss. Development 126, 3847-3855. Page | ‐ 220 ‐

References

Rao, P. H., Cigudosa, J. C., Ning, Y., Calasanz, M. J., Iida, S., Tagawa, S., Michaeli, J., Klein, B., Dalla-Favera, R. and Jhanwar, S. C. (1998). Multicolor spectral karyotyping identifies new recurring breakpoints and translocations in multiple myeloma. Blood 92, 1743- 1748. Rape, M. and Kirschner, M. W. (2004). Autonomous regulation of the anaphase-promoting complex couples mitosis to S-phase entry. Nature 432, 588-595. Reddy, S., Rape, M., Margansky, W. and Kirschner, M. (2007). Ubiquitination by the anaphase-promoting complex drives spindle checkpoint inactivation. Nature 446, 921-925. Reeve, W. (1981). Cytoplasmic polarity develops at compaction in rat and mouse embryos. Journal of embryology and experimental morphology 62, 351-367. Reeve, W. and Ziomek, C. (1981). Distribution of microvilli on dissociated blastomeres from mouse embryos: evidence for surface polarization at compaction. Journal of embryology and experimental morphology 62, 339-350. Reid, A. T., Lord, T., Stanger, S. J., Roman, S. D., McCluskey, A., Robinson, P. J., Aitken, R. J. and Nixon, B. (2012). Dynamin regulates specific membrane fusion events necessary for acrosomal exocytosis in mouse spermatozoa. Journal of Biological Chemistry 287, 37659- 37672. Reik, W., Romer, I., Barton, S. C., Surani, M. A., Howlett, S. K. and Klose, J. (1993). Adult phenotype in the mouse can be affected by epigenetic events in the early embryo. Development 119, 933-942. Reimann, J. D. R., Freed, E., Hsu, J. Y., Kramer, E. R., Peters, J. M. and Jackson, P. K. (2001a). Emi1 is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Cell 105, 645-656. Reimann, J. D. R., Gardner, B. E., Margottin-Goguet, F. and Jackson, P. K. (2001b). Emi1 regulates the anaphase-promoting complex by a different mechanism than Mad2 proteins. Genes & development 15, 3278-3285. Reinsch, S. and Karsenti, E. (1997). Movement of nuclei along microtubules in Xenopus egg extracts. Current Biology 7, 211-214. Reis, A., Chang, H. Y., Levasseur, M. and Jones, K. T. (2006). APCcdh1 activity in mouse oocytes prevents entry into the first meiotic division. Nature cell biology 8, 539-540. Reis, A., Madgwick, S., Chang, H. Y., Nabti, I., Levasseur, M. and Jones, K. T. (2007). Prometaphase APCcdh1 activity prevents non-disjunction in mammalian oocytes. Nature cell biology 9, 1192-1198. Revenkova, E. and Jessberger, R. (2005). Keeping sister chromatids together: cohesins in meiosis. Reproduction 130, 783-790. Richards, J., Fitzpatrick, S. L., Clemens, J. W., Morris, J. K., Alliston, T. and Sirois, J. (1995). Ovarian cell differentiation: a cascade of multiple hormones, cellular signals, and regulated genes. Recent progress in hormone research 50, 223-254. Richards, J. and Hedin, L. (1988). Molecular aspects of hormone action in ovarian follicular development, ovulation, and luteinization. Annual review of physiology 50, 441-463. Richards, J. A. S. (1980). Maturation of ovarian follicles: actions and interactions of pituitary and ovarian hormones on follicular cell differentiation. Physiological reviews 60, 51-89. Richards, J. A. S. (2001). Perspective: the ovarian follicle—a perspective in 2001. Endocrinology 142, 2184-2193. Page | ‐ 221 ‐

References

Richards, J. A. S., Russell, D. L., Robker, R. L., Dajee, M. and Alliston, T. N. (1998). Molecular mechanisms of ovulation and luteinization. Molecular and cellular endocrinology 145, 47-54. Riedel, C. G., Katis, V. L., Katou, Y., Mori, S., Itoh, T., Helmhart, W., Gálová, M., Petronczki, M., Gregan, J. and Cetin, B. (2006). Protein phosphatase 2A protects centromeric sister chromatid cohesion during meiosis I. Nature 441, 53-61. Rinaudo, P. and Schultz, R. M. (2004). Effects of embryo culture on global pattern of gene expression in preimplantation mouse embryos. Reproduction 128, 301-311. Rivera, R. M., Stein, P., Weaver, J. R., Mager, J., Schultz, R. M. and Bartolomei, M. S. (2008). Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development. Human molecular genetics 17, 1-14. Roemer, I., Reik, W., Dean, W. and Klose, J. (1997). Epigenetic inheritance in the mouse. Current Biology 7, 277-280. Rogers, N., Halet, G., Piao, Y., Carroll, J., Ko, M. and Swann, K. (2006). The absence of a Ca2+ signal during mouse egg activation can affect parthenogenetic preimplantation development, gene expression patterns, and blastocyst quality. Reproduction 132, 45-57. Rose‐Hellekant, T. and Bavister, B. (1996). Roles of protein kinase A and C in spontaneous maturation and in forskolin or 3‐isobutyl‐1‐methylxanthine maintained meiotic arrest of bovine oocytes. Molecular Reproduction and Development 44, 241-249. Rossant, J., Chazaud, C. and Yamanaka, Y. (2003). Lineage allocation and asymmetries in the early mouse embryo. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 358, 1341-1349. Rossant, J. and Vijh, K. (1980). Ability of outside cells from preimplantation mouse embryos to form inner cell mass derivatives. Developmental biology 76, 475-482. Rothfels, K. and Siminovitch, L. (1958). An air-drying technique for flattening chromosomes in mammalian cells grown in vitro. Biotechnic & Histochemistry 33, 73-77. Roure, A., Rothbächer, U., Robin, F., Kalmar, E., Ferone, G., Lamy, C., Missero, C., Mueller, F. and Lemaire, P. (2007). A multicassette Gateway vector set for high throughput and comparative analyses in Ciona and vertebrate embryos. PLoS One 2, e916. Ruchaud, S., Carmena, M. and Earnshaw, W. C. (2007). Chromosomal passengers: conducting cell division. Nature Reviews Molecular Cell Biology 8, 798-812. Runft, L. L., Jaffe, L. A. and Mehlmann, L. M. (2002). Egg activation at fertilization: where it all begins. Developmental biology 245, 237-254. Sagata, N. (1996). Meiotic metaphase arrest in animal oocytes: its mechanisms and biological significance. Trends in cell biology 6, 22-28. Sakai, T., Johnson, K. J., Murozono, M., Sakai, K., Magnuson, M. A., Wieloch, T., Cronberg, T., Isshiki, A., Erickson, H. P. and Fassler, R. (2001). Plasma fibronectin supports neuronal survival and reduces brain injury following transient focal cerebral ischemia but is not essential for skin-wound healing and hemostasis. Nature medicine 7, 324-330. Sánchez Alvarado, A. and Newmark, P. A. (1999). Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proceedings of the National Academy of Sciences 96, 5049. Sapienza, C., Paquette, J., Tran, T. H. and Peterson, A. (1989). Epigenetic and genetic factors affect transgene methylation imprinting. Development 107, 165-168. Page | ‐ 222 ‐

References

Sauer, B. and Henderson, N. (1989). Cre-stimulated recombination at loxP-containing DNA sequences placed into the mammalian genome. Nucleic acids research 17, 147-161. Saunders, C. M., Larman, M. G., Parrington, J., Cox, L. J., Royse, J., Blayney, L. M., Swann, K. and Lai, F. A. (2002). PLC zeta: a sperm-specific trigger of Ca2+ oscillations in eggs and embryo development. Science Signalling 129, 3533-3544. Schabronath, J. and Gärtner, K. (1988). Paternal influence on timing of pronuclear DNA synthesis in naturally ovulated and fertilized mouse eggs. Biology of reproduction 38, 744-749. Schaeffer, V., Althauser, C., Shcherbata, H. R., Deng, W. M. and Ruohola-Baker, H. (2004). Notch-Dependent Fizzy-Related/Hec1/Cdh1 Expression Is Required for the Mitotic-to- Endocycle Transition in Drosophila Follicle Cells. Current Biology 14, 630-636. Schatten, G. (1982). Motility during fertilization. International review of cytology 79, 59-163. Schatten, G. (1994). The centrosome and its mode of inheritance: the reduction of the centrosome during gametogenesis and its restoration during fertilization. Developmental biology 165, 299-335. Schatten, G., Simerly, C. and Schatten, H. (1985). Microtubule configurations during fertilization, mitosis, and early development in the mouse and the requirement for egg microtubule-mediated motility during mammalian fertilization. Proceedings of the National Academy of Sciences 82, 4152-4156. Schatten, H., Schatten, G., Mazia, D., Balczon, R. and Simerly, C. (1986). Behavior of centrosomes during fertilization and cell division in mouse oocytes and in sea urchin eggs. Proceedings of the National Academy of Sciences 83, 105-109. Schindler, K. and Schultz, R. M. (2009). CDC14B acts through FZR1 (CDH1) to prevent meiotic maturation of mouse oocytes. Biology of reproduction 80, 795-803. Schröck, E., Veldman, T., Padilla-Nash, H., Ning, Y., Spurbeck, J., Jalal, S., Shaffer, L. G., Papenhausen, P., Kozma, C. and Phelan, M. C. (1997). Spectral karyotyping refines cytogenetic diagnostics of constitutional chromosomal abnormalities. Human genetics 101, 255- 262. Schuh, M. and Ellenberg, J. (2007). Self-organization of MTOCs replaces centrosome function during acentrosomal spindle assembly in live mouse oocytes. Cell 130, 484-498. Schultz, G., Kaye, P., McKay, D. and Johnson, M. (1981). Endogenous amino acid pool sizes in mouse eggs and preimplantation embryos. Journal of reproduction and fertility 61, 387-393. Schultz, R. M. (2002). The molecular foundations of the maternal to zygotic transition in the preimplantation embryo. Human Reproduction Update 8, 323-331. Schultz, R. M. (2005). Regulation of zygotic gene activation in the mouse. BioEssays 15, 531- 538. Schultz, R. M., Montgomery, R. R. and Belanoff, J. R. (1983). Regulation of mouse oocyte meiotic maturation: implication of a decrease in oocyte cAMP and protein dephosphorylation in commitment to resume meiosis. Developmental biology 97, 264-273. Schwab, M., Lutum, A. S. and Seufert, W. (1997). Yeast Hct1 is a regulator of Clb2 cyclin proteolysis. Cell 90, 683-693. Scott, L. and Whittingham, D. G. (1998). Influence of genetic background and media components on the development of mouse embryos in vitro. Molecular Reproduction and Development 43, 336-346.

Page | ‐ 223 ‐

References

Seah, M., Holt, J. E., García-Higuera, I., Moreno, S. and Jones, K. T. (2012a). The Anaphase-Promoting Complex activator Fizzy-Related-1 (FZR1) is essential for the mitotic divisions of early mammalian embryos but not for the completion of female meiosis. In Society of Reproductive Biology, (ed., pp. 53. Cairns, Gold Coast, Australia. Seah, M., Holt, J. E., García-Higuera, I., Moreno, S. and Jones, K. T. (2012b). The Anaphase-Promoting Complex activator Fizzy-Related-1 (FZR1) is involved in the establishment of a single mitotic spindle in 1-cell embryos and in the mitotic divisions of early mammalian embryos. Journal of cell science Ahead of print. Seki, A. and Fang, G. (2007). CKAP2 is a spindle-associated protein degraded by APC/C- Cdh1 during mitotic exit. Journal of Biological Chemistry 282, 15103-15113. Shen, S., Tobery, C. E. and Rose, M. D. (2009). Prm3p is a pheromone-induced peripheral nuclear envelope protein required for yeast nuclear fusion. Molecular biology of the cell 20, 2438-2450. Sheth, B., Fesenko, I., Collins, J. E., Moran, B., Wild, A. E., Anderson, J. M. and Fleming, T. P. (1997). Tight junction assembly during mouse blastocyst formation is regulated by late expression of ZO-1 alpha+ isoform. Development 124, 2027-2037. Shibata, H., Toyama, K., Shioya, H., Ito, M., Hirota, M., Hasegawa, S., Matsumoto, H., Takano, H., Akiyama, T. and Toyoshima, K. (1997). Rapid colorectal adenoma formation initiated by conditional targeting of the Apc gene. Science 278, 120-123. Shirayama, M., Tóth, A., Gálová, M. and Nasmyth, K. (1999). APCCdc20 promotes exit from mitosis by destroying the anaphase inhibitor Pds1 and cyclin Clb5. Nature 402, 203-207. Shirayama, M., Zachariae, W., Ciosk, R. and Nasmyth, K. (1998). The Polo-like kinase Cdc5p and the WD-repeat protein Cdc20p/fizzy are regulators and substrates of the anaphase promoting complex in Saccharomyces cerevisiae. The EMBO journal 17, 1336-1349. Shirayoshi, Y., Okada, T. and Takeichi, M. (1983). The calcium-dependent cell-cell adhesion system regulates inner cell mass formation and cell surface polarization in early mouse development. Cell 35, 631-638. Shire, J. and Whitten, W. (1980). Genetic variation in the timing of first cleavage in mice: effect of maternal genotype. Biology of reproduction 23, 369-376. Shou, W., Seol, J. H., Shevchenko, A., Baskerville, C., Moazed, D., Chen, Z., Jang, J., Charbonneau, H. and Deshaies, R. J. (1999). Exit from mitosis is triggered by Tem1- dependent release of the protein phosphatase Cdc14 from nucleolar RENT complex. Cell 97, 233-244. Shui, J. W. and Tan, T. H. (2004). Germline transmission and efficient DNA recombination in mouse embryonic stem cells mediated by adenoviral‐Cre transduction. Genesis 39, 217-223. Sigl, R., Wandke, C., Rauch, V., Kirk, J., Hunt, T. and Geley, S. (2009). Loss of the mammalian APC/C activator FZR1 shortens G1 and lengthens S phase but has little effect on exit from mitosis. Journal of cell science 122, 4208-4217. Sigrist, S. and Lehner, C. (1997). Drosophila fizzy-related down-regulates mitotic cyclins and is required for cell proliferation arrest and entry into endocycles. Cell 90, 671. Silva, J., Nichols, J., Theunissen, T. W., Guo, G., van Oosten, A. L., Barrandon, O., Wray, J., Yamanaka, S., Chambers, I. and Smith, A. (2009). Nanog is the gateway to the pluripotent ground state. Cell 138, 722-737. Simerly, C., Wu, G. J., Zoran, S., Ord, T., Rawlins, R., Jones, J., Navara, C., Gerrity, M., Rinehart, J. and Binor, Z. (1995). The paternal inheritance of the centrosome, the cell's Page | ‐ 224 ‐

References

microtubule-organizing center, in humans, and the implications for infertility. Nature medicine 1, 47-52. Simon, A. M., Goodenough, D. A., Li, E. and Paul, D. L. (1997). Female infertility in mice lacking connexin 37. Nature 385, 525-529. Singer, J., Roberts-Ems, J., Luthardt, F. W. and Riggs, A. D. (1979). Methylation of DNA in mouse early embryos, teratocarcinoma cells an adult tissues of mouse and rabbit. Nucleic acids research 7, 2369-2385. Skaar, J. R. and Pagano, M. (2008). Cdh1: a master G0/G1 regulator. Nature cell biology 10, 755-757. Smith, R. and Johnson, M. (1986). Analysis of the third and fourth cell cycles of mouse early development. Journal of reproduction and fertility 76, 393-399. Smith, R. K. W. and Johnson, M. H. (1985). DNA replication and compaction in the cleaving embryo of the mouse. Journal of embryology and experimental morphology 89, 133-148. Smith, Z. D., Chan, M. M., Mikkelsen, T. S., Gu, H., Gnirke, A., Regev, A. and Meissner, A. (2012). A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature 484, 339. Solc, P., Schultz, R. M. and Motlik, J. (2010). Prophase I arrest and progression to metaphase I in mouse oocytes: comparison of resumption of meiosis and recovery from G2-arrest in somatic cells. Molecular human reproduction 16, 654-664. Solter, D., Damjanov, I. and Koprowski, H. (1975). Embryo-derived teratoma: a model system in developmental and tumor biology, vol. 2 (ed., pp. 243. Sorensen, C. S., Lukas, C., Kramer, E. R., Peters, J. M., Bartek, J. and Lukas, J. (2000). Nonperiodic activity of the human anaphase-promoting complex–Cdh1 ubiquitin ligase results in continuous DNA synthesis uncoupled from mitosis. Molecular and cellular biology 20, 7613- 7623. Sorensen, R. A. and Wassarman, P. M. (1976). Relationship between growth and meiotic maturation of the mouse oocyte. Developmental biology 50, 531-536. Soyal, S. M., Amleh, A. and Dean, J. (2000). FIGalpha, a germ cell-specific transcription factor required for ovarian follicle formation. Development 127, 4645-4654. Speese, S. D., Trotta, N., Rodesch, C. K., Aravamudan, B. and Broadie, K. (2003). The ubiquitin proteasome system acutely regulates presynaptic protein turnover and synaptic efficacy. Current Biology 13, 899-910. Spindle, A. I. (1978). Trophoblast regeneration by inner cell masses isolated from cultured mouse embryos. Journal of Experimental Zoology 203, 483-489. Spindle, A. I. and Pedersen, R. A. (1973). Hatching, attachment, and outgrowth of mouse blastocysts in vitro: fixed nitrogen requirements. Journal of Experimental Zoology 186, 305-318. Spruck, C. H., de Miguel, M. P., Smith, A. P. L., Ryan, A., Stein, P., Schultz, R. M., Lincoln, A. J., Donovan, P. J. and Reed, S. I. (2003). Requirement of Cks2 for the first metaphase/anaphase transition of mammalian meiosis. Science 300, 647-650. Steeves, C. L. and Baltz, J. M. (2005). Regulation of intracellular glycine as an organic osmolyte in early preimplantation mouse embryos. Journal of Cellular Physiology 204, 273-279. Steeves, C. L., Hammer, M. A., Walker, G. B., Rae, D., Stewart, N. A. and Baltz, J. M. (2003). The glycine neurotransmitter transporter GLYT1 is an organic osmolyte transporter

Page | ‐ 225 ‐

References

regulating cell volume in cleavage-stage embryos. Proceedings of the National Academy of Sciences 100, 13982-13987. Stegmeier, F., Rape, M., Draviam, V. M., Nalepa, G., Sowa, M. E., Ang, X. L., Mcdonald Iii, E. R., Li, M. Z., Hannon, G. J. and Sorger, P. K. (2007). Anaphase initiation is regulated by antagonistic ubiquitination and deubiquitination activities. Nature 446, 876-881. Stemmann, O., Boos, D. and Gorr, I. H. (2005). Rephrasing anaphase: separase FEARs shugoshin. Chromosoma 113, 409-417. Stemmann, O., Zou, H., Gerber, S. A., Gygi, S. P. and Kirschner, M. W. (2001). Dual inhibition of sister chromatid separation at metaphase. Cell 107, 715-726. Stevens, L. C. (1970). The development of transplantable teratocarcinomas from intratesticular grafts of pre-and postimplantation mouse embryos. Developmental biology 21, 364-382. Stewart, S. and Fang, G. (2005). Anaphase-promoting complex/cyclosome controls the stability of TPX2 during mitotic exit. Molecular and cellular biology 25, 10516-10527. Streffer, C., Beuningen, D., Molls, M., Zamboglou, N. and Schulz, S. (1980). Kinetics of cell proliferation in the pre-implanted mouse embryo in vivo and in vitro. Cell Proliferation 13, 135-143. Stricker, S. A. (1999). Comparative biology of calcium signaling during fertilization and egg activation in animals. Developmental biology 211, 157-176. Strickland, S. and Mahdavi, V. (1978). The induction of differentiation in teratocarcinoma stem cells by retinoic acid. Cell 15, 393-403. Strome, S. and Wood, W. B. (1983). Generation of asymmetry and segregation of germ-line granules in early C. elegans embryos. Cell 35, 15-25. Stroschein, S. L., Bonni, S., Wrana, J. L. and Luo, K. (2001). Smad3 recruits the anaphase- promoting complex for ubiquitination and degradation of SnoN. Genes & development 15, 2822-2836. Strumpf, D., Mao, C. A., Yamanaka, Y., Ralston, A., Chawengsaksophak, K., Beck, F. and Rossant, J. (2005). Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 132, 2093-2102. Su, Y. Q., Sugiura, K. and Eppig, J. J. (2009). Mouse oocyte control of granulosa cell development and function: paracrine regulation of cumulus cell metabolism. In Seminars in reproductive medicine, vol. 27 (ed., pp. 32: NIH Public Access. Su, Y. Q., Sugiura, K., Woo, Y., Wigglesworth, K., Kamdar, S., Affourtit, J. and Eppig, J. J. (2007). Selective degradation of transcripts during meiotic maturation of mouse oocytes. Developmental biology 302, 104-117. Sudo, T., Ota, Y., Kotani, S., Nakao, M., Takami, Y., Takeda, S. and Saya, H. (2001). Activation of Cdh1-dependent APC is required for G1 cell cycle arrest and DNA damage- induced G2 checkpoint in vertebrate cells. The EMBO journal 20, 6499-6508. Sui, G., Soohoo, C., Gay, F., Shi, Y. and Forrester, W. C. (2002). A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proceedings of the National Academy of Sciences 99, 5515-5520. Sumara, I., Giménez-Abián, J. F., Gerlich, D., Hirota, T., Kraft, C., de la Torre, C., Ellenberg, J. and Peters, J. M. (2004). Roles of polo-like kinase 1 in the assembly of functional mitotic spindles. Current Biology 14, 1712-1722.

Page | ‐ 226 ‐

References

Summers, M. C., Bhatnagar, P. R., Lawitts, J. A. and Biggers, J. D. (1995). Fertilization in vitro of mouse ova from inbred and outbred strains: complete preimplantation embryo development in glucose-supplemented KSOM. Biology of reproduction 53, 431-437. Sun, Q. Y., Miao, Y. L. and Schatten, H. (2009). Towards a new understanding on the regulation of mammalian oocyte meiosis resumption. Cell Cycle 8, 2741-2747. Sun, X., Lewandoski, M., Meyers, E. N., Liu, Y. H., Maxson, R. E. and Martin, G. R. (2000). Conditional inactivation of Fgf4 reveals complexity of signalling during limb bud development. Nature genetics 25, 83-86. Surani, M. A., Kothary, R., Allen, N. D., Singh, P. B., Fundele, R., Ferguson-Smith, A. C. and Barton, S. C. (1990). Genome imprinting and development in the mouse. Development 108, 89-98. Suwińska, A., Czołowska, R., Ozdzeński, W. and Tarkowski, A. (2008). Blastomeres of the mouse embryo lose totipotency after the fifth cleavage division: expression of Cdx2 and Oct4 and developmental potential of inner and outer blastomeres of 16-and 32-cell embryos. Developmental biology 322, 133-144. Suzuki, A., Yamanaka, T., Hirose, T., Manabe, N., Mizuno, K., Shimizu, M., Akimoto, K., Izumi, Y., Ohnishi, T. and Ohno, S. (2001). Atypical protein kinase C is involved in the evolutionarily conserved par protein complex and plays a critical role in establishing epithelia- specific junctional structures. The Journal of cell biology 152, 1183-1196. Suzuki, O., Asano, T., Yamamoto, Y., Takano, K. and Koura, M. (1996). Development in vitro of preimplantation embryos from 55 mouse strains. Reproduction, fertility and development 8, 975-980. Swann, K. (1990). A cytosolic sperm factor stimulates repetitive calcium increases and mimics fertilization in hamster eggs. Development 110, 1295-1302. Swann, K. (1996). Soluble sperm factors and Ca2+ release in eggs at fertilization. Reviews of reproduction 1, 33-39. Swann, K. and Ozil, J. P. (1994). Dynamics of the calcium signal that triggers mammalian egg activation. International review of cytology 152, 183-222. Szalai, G., LaRue, A. and Watson, D. (2006). Molecular mechanisms of megakaryopoiesis. Cellular and molecular life sciences 63, 2460-2476. Szollosi, D., Calarco, P. and Donahue, R. (1972). Absence of centrioles in the first and second meiotic spindles of mouse oocytes. Journal of cell science 11, 521-541. Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J., Grishok, A., Timmons, L., Fire, A. and Mello, C. C. (1999). The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99, 123-132. Tachibana, K., Hara, M., Hattori, Y. and Kishimoto, T. (2008). Cyclin B-cdk1 controls pronuclear union in interphase. Current Biology 18, 1308-1313. Tadros, W., Goldman, A. L., Babak, T., Menzies, F., Vardy, L., Orr-Weaver, T., Hughes, T. R., Westwood, J. T., Smibert, C. A. and Lipshitz, H. D. (2007). SMAUG is a major regulator of maternal mRNA destabilization in Drosophila and its translation is activated by the PAN GU kinase. Developmental cell 12, 143-155. Takahashi, Y. and First, N. (1992). In vitro development of bovine one-cell embryos: influence of glucose, lactate, pyruvate, amino acids and vitamins. Theriogenology 37, 963-978.

Page | ‐ 227 ‐

References

Tam, P. and Snow, M. (1981). Proliferation and migration of primordial germ cells during compensatory growth in mouse embryos. Journal of embryology and experimental morphology 64, 133-147. Tanaka, S. and Diffley, J. F. X. (2002). Deregulated G1-cyclin expression induces genomic instability by preventing efficient pre-RC formation. Genes & development 16, 2639-2649. Tanaka, S., Kunath, T., Hadjantonakis, A. K., Nagy, A. and Rossant, J. (1998). Promotion of trophoblast stem cell proliferation by FGF4. Science 282, 2072-2075. Tarkowski, A. K. and Wróblewska, J. (1967). Development of blastomeres of mouse eggs isolated at the 4-and 8-cell stage. Journal of embryology and experimental morphology 18, 155- 180. Tashiro, F., Kanai-Azuma, M., Miyazaki, S., Kato, M., Tanaka, T., Toyoda, S., Yamato, E., Kawakami, H., Miyazaki, T. and Miyazaki, J. I. (2010). Maternal-effect gene Ces5/Ooep/Moep19/Floped is essential for oocyte cytoplasmic lattice formation and embryonic development at the maternal-zygotic stage transition. Genes to Cells 15, 813-828. Taylor, C., Lawrence, Y., Kingsland, C., Biljan, M. and Cuthbertson, K. (1993). Fertilization and early embryology: Oscillations in intracellular free calcium induced by spermatozoa in human oocytes at fertilization. Human Reproduction 8, 2174-2179. Taylor, S. and Peters, J. M. (2008). Polo and Aurora kinases—lessons derived from chemical biology. Current opinion in cell biology 20, 77-84. Telford, N. A., Watson, A. J. and Schultz, G. A. (1990). Transition from maternal to embryonic control in early mammalian development: a comparison of several species. Molecular Reproduction and Development 26, 90-100. Terret, M. E., Wassmann, K., Waizenegger, I., Maro, B., Peters, J. M. and Verlhac, M. H. (2003). The meiosis I-to-meiosis II transition in mouse oocytes requires separase activity. Current Biology 13, 1797-1802. Terry, R. W., Kwee, L., Scott Baldwin, H. and Labow, M. A. (1997). Cre-mediated generation of a VCAM-1 null allele in transgenic mice. Transgenic research 6, 349-356. Thompson, J., Simpson, A., Pugh, P. and Tervit, H. (1992). Requirement for glucose during in vitro culture of sheep preimplantation embryos. Molecular Reproduction and Development 31, 253-257. Thouas, G. A., Trounson, A. O., Wolvetang, E. J. and Jones, G. M. (2004). Mitochondrial dysfunction in mouse oocytes results in preimplantation embryo arrest in vitro. Biology of reproduction 71, 1936-1942. Threadgill, D. W., Hunter, K. W. and Williams, R. W. (2002). Genetic dissection of complex and quantitative traits: from fantasy to reality via a community effort. Mammalian genome 13, 175-178. Tong, Z. B., Gold, L., Pfeifer, K. E., Dorward, H., Lee, E., Bondy, C. A., Dean, J. and Nelson, L. M. (2000). Mater, a maternal effect gene required for early embryonic development in mice. Nature genetics 26, 267. Törnell, J., Brännström, M., Magnusson, C. and Billig, H. (1990). Effects of follicle stimulating hormone and purines on rat oocyte maturation. Molecular Reproduction and Development 27, 254-260. Total, R. (2006). Multi-miRNA hairpin method that improves gene knockdown efficiency and provides linked multi-gene knockdown. BioTechniques 41, 59-63.

Page | ‐ 228 ‐

References

Tucker, J. D. and Preston, R. J. (1996). Chromosome aberrations, micronuclei, aneuploidy, sister chromatid exchanges, and cancer risk assessment. Mutation Research/Reviews in Genetic Toxicology 365, 147-159. Tutt, A., Gabriel, A., Bertwistle, D., Connor, F., Paterson, H., Peacock, J., Ross, G. and Ashworth, A. (1999). Absence of Brca2 causes genome instability by chromosome breakage and loss associated with centrosome amplification. Current Biology 9, 1107-1110. Ubbels, G. A., Hara, K., Koster, C. and Kirschner, M. (1983). Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs. Journal of embryology and experimental morphology 77, 15-37. Ueno, K., Hiramoto, Y., Hayashi, S. and Kondoh, H. (2008). Introduction and Expression of Recombinant β-Galactosidase Genes in Cleavage Stage Mouse Embryos. Development, growth & differentiation 30, 61-73. Uhlmann, F., Lottspeich, F. and Nasmyth, K. (1999). Sister-chromatid separation at anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400, 37-42. Uhlmann, F., Wernic, D., Poupart, M. A., Koonin, E. V. and Nasmyth, K. (2000). Cleavage of cohesin by the CD clan protease separin triggers anaphase in yeast. Cell 103, 375-386. Ullah, Z., Kohn, M. J., Yagi, R., Vassilev, L. T. and DePamphilis, M. L. (2008). Differentiation of trophoblast stem cells into giant cells is triggered by p57/Kip2 inhibition of CDK1 activity. Genes & development 22, 3024-3036. Ullrich, M. and Schuh, K. (2009). Gene trap: knockout on the fast lane. Methods Molecular Biology (Clifton, N.J.) 561, 145-159. Valdimarsson, G. and Kidder, G. M. (1995). Temporal control of gap junction assembly in preimplantation mouse embryos. Journal of cell science 108, 1715-1722. Valencia-Sanchez, M. A., Liu, J., Hannon, G. J. and Parker, R. (2006). Control of translation and mRNA degradation by miRNAs and siRNAs. Genes & development 20, 515-524. van Blerkom, J., Barton, S. C. and Johnson, M. H. (1976). Molecular differentiation in the preimplantation mouse embryo. Nature 259, 319-321. Van Winkle, L. J., Haghighat, N. and Campione, A. L. (2005). Glycine protects preimplantation mouse conceptuses from a detrimental effect on development of the inorganic ions in oviductal fluid. Journal of Experimental Zoology 253, 215-219. Varani, S. and Matzuk, M. (2002). Phenotypic effects of knockout of oocyte-specific genes. In Ernst Schering research foundation workshop, vol. 41 (ed., pp. 63-79. Varshavsky, A. (1997). The ubiquitin system. Trends in biochemical sciences 22, 383-387. Verlhac, M. H., Lefebvre, C., Guillaud, P., Rassinier, P. and Maro, B. (2000). Asymmetric division in mouse oocytes: with or without Mos. Current Biology 10, 1303-1306. Verma, R., Peters, N. R., D'Onofrio, M., Tochtrop, G. P., Sakamoto, K. M., Varadan, R., Zhang, M., Coffino, P., Fushman, D. and Deshaies, R. J. (2004). Ubistatins inhibit proteasome-dependent degradation by binding the ubiquitin chain. Science 306, 117-120. Vestweber, D., Gossler, A., Boller, K. and Kemler, R. (1987). Expression and distribution of cell adhesion molecule uvomorulin in mouse preimplantation embryos. Developmental biology 124, 451-456. Vinot, S., Le, T., Ohno, S., Pawson, T., Maro, B. and Louvet-Vallée, S. (2005). Asymmetric distribution of PAR proteins in the mouse embryo begins at the 8-cell stage during compaction. Developmental biology 282, 307-319. Page | ‐ 229 ‐

References

Visintin, R., Prinz, S. and Amon, A. (1997). CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis. Science 278, 460-463. Waizenegger, I. C., Hauf, S., Meinke, A. and Peters, J. M. (2000). Two distinct pathways remove mammalian cohesin from chromosome arms in prophase and from centromeres in anaphase. Cell 103, 399-410. Wan, Y., Liu, X. and Kirschner, M. W. (2001). The anaphase-promoting complex mediates TGF-β signaling by targeting SnoN for destruction. Molecular cell 8, 1027-1039. Wang, L., Wang, Z. B., Zhang, X., FitzHarris, G., Baltz, J. M., Sun, Q. Y. and Liu, X. J. (2008). Brefeldin A disrupts asymmetric spindle positioning in mouse oocytes. Developmental biology 313, 155-166. Wang, Q. T., Piotrowska, K., Ciemerych, M. A., Milenkovic, L., Scott, M. P., Davis, R. W. and Zernicka-Goetz, M. (2004). A genome-wide study of gene activity reveals developmental signaling pathways in the preimplantation mouse embryo. Developmental cell 6, 133-144. Wargelius, A., Ellingsen, S. and Fjose, A. (1999). Double-stranded RNA induces specific developmental defects in zebrafish embryos. Biochemical and Biophysical Research Communications 263, 156-161. Warner, C. M., Cao, W., Exley, G. E., McElhinny, A. S., Alikani, M., Cohen, J., Scott, R. T. and Brenner, C. A. (1998). Genetic regulation of egg and embryo survival. Human Reproduction 13, 178-190. Wäsch, R. and Cross, F. R. (2002). APC-dependent proteolysis of the mitotic cyclin Clb2 is essential for mitotic exit. Nature 418, 556-562. Wäsch, R. and Engelbert, D. (2005). Anaphase-promoting complex-dependent proteolysis of cell cycle regulators and genomic instability of cancer cells. Oncogene 24, 1-10. Wäsch, R., Robbins, J. A. and Cross, F. R. (2009). The emerging role of APC/CCdh1 in controlling differentiation, genomic stability and tumor suppression. Oncogene 29, 1-10. Wassarman, P. M. and Fujiwara, K. (1978). Immunofluorescent anti-tubulin staining of spindles during meiotic maturation of mouse oocytes in vitro. Journal of cell science 29, 171. Wassarman, P. M. and Kinloch, R. A. (1992). Gene expression during oogenesis in mice. Mutation Research/Reviews in Genetic Toxicology 296, 3-15. Wassarman, P. M. and Place, O. G. L. L. (1999). Mammalian Fertilization: Review Molecular Aspects of Gamete Adhesion, Exocytosis, and Fusion. Cell 96, 175-183. Wassmann, K., Niault, T. and Maro, B. (2003). Metaphase I arrest upon activation of the Mad2-dependent spindle checkpoint in mouse oocytes. Current Biology 13, 1596-1608. Weber, M., Möller, K., Welzeck, M. and Schorr, J. (1995). Short technical reports. Effects of lipopolysaccharide on transfection efficiency in eukaryotic cells. BioTechniques 19, 930-940. Wei, L., Liang, X. W., Zhang, Q. H., Li, M., Yuan, J., Li, S., Sun, S. C., Ouyang, Y. C., Schatten, H. and Sun, Q. Y. (2010). BubR1 is a spindle assembly checkpoint protein regulating meiotic cell cycle progression of mouse oocyte. Cell Cycle 9, 1112-1121. Wei, W., Ayad, N. G., Wan, Y., Zhang, G. J., Kirschner, M. W. and Kaelin, W. G. (2004). Degradation of the SCF component Skp2 in cell-cycle phase G1 by the anaphase-promoting complex. Nature 428, 194-198. Whitten, W. (1957). Culture of tubal ova. Nature 179, 1081-1082.

Page | ‐ 230 ‐

References

Whitten, W. and Biggers, J. (1968). Complete development in vitro of the pre-implantation stages of the mouse in a simple chemically defined medium. Journal of reproduction and fertility 17, 399-401. Whittingham, D. (1971). Culture of mouse ova. Journal of reproduction and fertility. Supplement 14, 7-21. Whittingham, D. (1975). Fertilization, early development and storage of mammalian ova in vitro. In The Early Development of Mammals. The Second Symposium of the British Society for Developmental Biology. Cambridge University Press, Cambridge, UK, (ed., pp. 1-24. Wianny, F. and Zernicka-Goetz, M. (2000). Specific interference with gene function by double-stranded RNA in early mouse development. Nature cell biology 2, 70-75. Wiebusch, L. and Hagemeier, C. (2010). p53-and p21-dependent premature APC/C–Cdh1 activation in G2 is part of the long-term response to genotoxic stress. Oncogene 29, 3477-3489. Wiekowski, M., Miranda, M. and DePamphilis, M. L. (1991). Regulation of gene expression in preimplantation mouse embryos: effects of the zygotic clock and the first mitosis on promoter and enhancer activities. Developmental biology 147, 403-414. Winkel, G. K., Ferguson, J. E., Takeichi, M. and Nuccitelli, R. (1990). Activation of protein kinase C triggers premature compaction in the four-cell stage mouse embryo. Developmental biology 138, 1-15. Winkler, C., Vielkind, J. R. and Schartl, M. (1991). Transient expression of foreign DNA during embryonic and larval development of the medaka fish (Oryzias latipes). Molecular and General Genetics: MGG 226, 129-140. Wirth, K. G., Ricci, R., Giménez-Abián, J. F., Taghybeeglu, S., Kudo, N. R., Jochum, W., Vasseur-Cognet, M. and Nasmyth, K. (2004). Loss of the anaphase-promoting complex in quiescent cells causes unscheduled hepatocyte proliferation. Genes & development 18, 88-98. Wohlschlegel, J. A., Dwyer, B. T., Dhar, S. K., Cvetic, C., Walter, J. C. and Dutta, A. (2000). Inhibition of eukaryotic DNA replication by geminin binding to Cdt1. Science 290, 2309-2312. Wu, G., Glickstein, S., Liu, W., Fujita, T., Li, W., Yang, Q., Duvoisin, R. and Wan, Y. (2007). The anaphase-promoting complex coordinates initiation of lens differentiation. Molecular biology of the cell 18, 1018-1029. Wu, X., Viveiros, M. M., Eppig, J. J., Bai, Y., Fitzpatrick, S. L. and Matzuk, M. M. (2003). Zygote arrest 1 (Zar1) is a novel maternal-effect gene critical for the oocyte-to-embryo transition. Nature genetics 33, 187-191. Yagi, R., Kohn, M. J., Karavanova, I., Kaneko, K. J., Vullhorst, D., DePamphilis, M. L. and Buonanno, A. (2007). Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development. Development 134, 3827-3836. Yamaguchi, S., Murakami, H. and Okayama, H. (1997). A WD repeat protein controls the cell cycle and differentiation by negatively regulating Cdc2/B-type cyclin complexes. Molecular biology of the cell 8, 2475-2486. Yamamuro, T., Kano, K. and Naito, K. (2008). Functions of FZR1 and CDC20, activators of the anaphase-promoting complex, during meiotic maturation of swine oocytes. Biology of reproduction 79, 1202-1209. Yamanaka, T., Horikoshi, Y., Suzuki, A., Sugiyama, Y., Kitamura, K., Maniwa, R., Nagai, Y., Yamashita, A., Hirose, T. and Ishikawa, H. (2001). PAR-6 regulates aPKC activity in a

Page | ‐ 231 ‐

References

novel way and mediates cell-cell contact-induced formation of the epithelial junctional complex. Genes to Cells 6, 721-731. Yan, C., Wang, P., DeMayo, J., DeMayo, F. J., Elvin, J. A., Carino, C., Prasad, S. V., Skinner, S. S., Dunbar, B. S. and Dube, J. L. (2001). Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Molecular Endocrinology 15, 854-866. Yanagi, K., Mizuno, T., You, Z. and Hanaoka, F. (2002). Mouse geminin inhibits not only Cdt1-MCM6 interactions but also a novel intrinsic Cdt1 DNA binding activity. Journal of Biological Chemistry 277, 40871-40880. Yanagimachi, R. (1989). Sperm capacitation and gamete interaction. Journal of reproduction and fertility 38, 27-33. Yanagimachi, R. (1994). Mammalian fertilization. In ‘The Physiology of Reproduction’. 2nd edn.(Eds E. Knobil and JD Neill.) pp. 189–317, (ed.: Raven Press: New York. Yao, F., Svensjö, T., Winkler, T., Lu, M., Eriksson, C. and Eriksson, E. (1998). Tetracycline repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells. Human gene therapy 9, 1939-1950. Yasuda, G. K. and Schubiger, G. (1992). Temporal regulation in the early embryo: is MBT too good to be true? Trends in Genetics 8, 124-127. Yi, R., Qin, Y., Macara, I. G. and Cullen, B. R. (2003). Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes & development 17, 3011-3016. Young, R., Sweeney, K. and Bedford, J. (1978). Uridine and guanosine incorporation by the mouse one-cell embryo. Journal of embryology and experimental morphology 44, 133-148. Yu, J., Hecht, N. B. and Schultz, R. M. (2001). Expression of MSY2 in mouse oocytes and preimplantation embryos. Biology of reproduction 65, 1260-1270. Yuan, H., Corbi, N., Basilico, C. and Dailey, L. (1995). Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes & development 9, 2635-2645. Zachariae, W. and Nasmyth, K. (1999). Whose end is destruction: cell division and the anaphase-promoting complex. Genes & development 13, 2039-2058. Zachariae, W., Schwab, M., Nasmyth, K. and Seufert, W. (1998). Control of cyclin ubiquitination by CDK-regulated binding of Hct1 to the anaphase promoting complex. Science 282, 1721-1724. Zamir, E., Kam, Z. and Yarden, A. (1997). Transcription-dependent induction of G1 phase during the zebra fish midblastula transition. Molecular and cellular biology 17, 529-536. Zeng, Y. and Cullen, B. R. (2005). Efficient processing of primary microRNA hairpins by Drosha requires flanking nonstructured RNA sequences. Journal of Biological Chemistry 280, 27595-27603. Zeng, Y., Yi, R. and Cullen, B. R. (2003). MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proceedings of the National Academy of Sciences 100, 9779-9784. Zhai, Y., Kronebusch, P. J. and Borisy, G. G. (1995). Kinetochore microtubule dynamics and the metaphase-anaphase transition. The Journal of cell biology 131, 721-734.

Page | ‐ 232 ‐

References

Zhang, J., Tam, W. L., Tong, G. Q., Wu, Q., Chan, H. Y., Soh, B. S., Lou, Y., Yang, J., Ma, Y. and Chai, L. (2006). Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nature cell biology 8, 1114-1123. Zhang, L., Park, C. H., Wu, J., Kim, H., Liu, W., Fujita, T., Balasubramani, M., Schreiber, E. M., Wang, X. F. and Wan, Y. (2010). Proteolysis of Rad17 by Cdh1/APC regulates checkpoint termination and recovery from genotoxic stress. The EMBO journal 29, 1726-1737. Zhang, W., Poirier, L., Diaz, M. M., Bordignon, V. and Clarke, H. J. (2009). Maternally encoded stem-loop-binding protein is degraded in 2-cell mouse embryos by the co-ordinated activity of two separately regulated pathways. Developmental biology 328, 140-147. Zhang, Y., Boado, R. J. and Pardridge, W. M. (2003). In vivo knockdown of gene expression in brain cancer with intravenous RNAi in adult rats. The journal of gene medicine 5, 1039-1045. Zhao, W. and Fang, G. (2005). Anillin is a substrate of anaphase-promoting complex/cyclosome (APC/C) that controls spatial contractility of myosin during late cytokinesis. Journal of Biological Chemistry 280, 33516-33524. Zhao, Y. and Baltz, J. (1996). Bicarbonate/chloride exchange and intracellular pH throughout preimplantation mouse embryo development. American Journal of Physiology-Cell Physiology 271, C1512-C1520. Zhao, Y., Chauvet, P. J. P., Alper, S. L. and Baltz, J. M. (1995). Expression and function of bicarbonate/chloride exchangers in the preimplantation mouse embryo. Journal of Biological Chemistry 270, 24428-24434. Zhao, Y., Hegde, A. N. and Martin, K. C. (2003). The ubiquitin proteasome system functions as an inhibitory constraint on synaptic strengthening. Current Biology 13, 887-898. Zheng, P. and Dean, J. (2009). Role of Filia, a maternal effect gene, in maintaining euploidy during cleavage-stage mouse embryogenesis. Proceedings of the National Academy of Sciences 106, 7473-7478. Zhu, W. and Dutta, A. (2006). Activation of fanconi anemia pathway in cells with re- replicated DNA. Cell Cycle 5, 2306-2309. Zhu, Z. Y., Chen, D. Y., Li, J. S., Lian, L., Lei, L., Han, Z. M. and Sun, Q. Y. (2003). Rotation of meiotic spindle is controlled by microfilaments in mouse oocytes. Biology of reproduction 68, 943-946. Ziomek, C. and Johnson, M. (1980). Cell surface interaction induces polarization of mouse 8- cell blastomeres at compaction. Cell 21, 935-942. Ziomek, C., Johnson, M. and Handyside, A. (2005). The developmental potential of mouse 16-cell blastomeres. Journal of Experimental Zoology 221, 345-355. Zou, H., McGarry, T. J., Bernal, T. and Kirschner, M. W. (1999). Identification of a vertebrate sister-chromatid separation inhibitor involved in transformation and tumorigenesis. Science 285, 418-422.

Page | ‐ 233 ‐

Appendix

9. Appendices

9.1. Publication article in Journal of Cell Science

Page | ‐ 234 ‐

Appendix

Page | ‐ 235 ‐

Appendix

Page | ‐ 236 ‐

Appendix

Page | ‐ 237 ‐

Appendix

Page | ‐ 238 ‐

Appendix

Page | ‐ 239 ‐

Appendix

Page | ‐ 240 ‐

Appendix

Page | ‐ 241 ‐

Appendix

Page | ‐ 242 ‐

Appendix

Page | ‐ 243 ‐

Appendix

Page | ‐ 244 ‐

Appendix

Page | ‐ 245 ‐

Appendix

Page | ‐ 246 ‐

Appendix

Page | ‐ 247 ‐

Appendix

Page | ‐ 248 ‐

Appendix

Page | ‐ 249 ‐

Appendix

Page | ‐ 250 ‐

Appendix

Page | ‐ 251 ‐

Appendix

Page | ‐ 252 ‐

Appendix

Page | ‐ 253 ‐

Appendix

Page | ‐ 254 ‐

Appendix

Page | ‐ 255 ‐

Appendix

Page | ‐ 256 ‐

Appendix

Page | ‐ 257 ‐

Appendix

Page | ‐ 258 ‐

Appendix

9.2. Vector maps

9.2.1. pcDNA6.2-GW/EmGFP-miR plasmid map for constitutive expression of Fzr1 knockdown

Page | ‐ 259 ‐

Appendix

9.2.2. pcDNA6.2-GW/EmGFP-miR-neg control plasmid vecttoor map

Page | ‐ 260 ‐

Appendix

9.3. Culture media

All water used for media preparation was double distilled water (ddH2O) obtained from a Milli-Q water system (Milli-Q, USA) with a resistivity of at least 18.2M.cm at 25ºC. All reagents from Sigma-Aldrich, Australia unless otherwise stated.

Sterile filtering refers to solution being pushed through a syringe filter or flowed through a filtration cup membrane attached to a vacuum pump with a pore diameter of 0.2m (Nalgene/Thermo Fisher Scientific, USA).

9.3.1. M2 media

Components Final Concentration (mM)

NaCl 94.66

KCl 4.78

CaCl2.2H2O 1.71

KH2PO4 1.19

MgSO4.7H2O 1.19

NaHCO3 4.15

HEPES 20.85

Na Lactate 23.28

Na pyruvate 0.33

Glucose 5.56

BSA 4g/L

Penicilin G. K salt 0.06g/L

Streptomycin sulphate 0.05g/L

Phenol Red 0.010g/L

Page | ‐ 261 ‐

Appendix

M2 medium was made up to volume with ddH2O, adjusted to pH7.4 and to 283-289 mOsmol. Media were filtered through 0.2m membranes prior to storage at 4°C. All media were prepared fresh every 2weeks.

9.3.2. KSOM

Components Final Concentration (mM)

NaCl 95.0

KCl 2.50

CaCl2.2H2O 1.71

KH2PO4 0.35

MgSO4.7H2O 0.20

NaHCO3 25.0

Na Lactate (60%) 10.0

Na pyruvate 0.20

Glucose 0.20

BSA 1g/L

Penicilin G. K salt 0.06g/L

Streptomycin sulphate 0.05g/L

EDTA 0.01

L-Glutamine 1.00

Page | ‐ 262 ‐

Appendix

9.3.3. KSOM-AA

Components Final Concentration (mM)

NaCl 96.0

KCl 2.60

CaCl2.2H2O 1.70

KH2PO4 0.40

MgSO4.7H2O 0.20

NaHCO3 25

Na Lactate (60%) 0.11%

Na pyruvate 0.20

Glucose 0.20

BSA 3 (mg/ml)

Penicilin G. K salt 0.06 (mg/ml)

EDTA 0.01

Phenol red 0.04%

50X EAA 1ml/50ml

100X NEAA 0.5ml/50ml

Page | ‐ 263 ‐

Appendix

9.3.4. FHM

Components Final Concentration (mM)

NaCl 102

KCl 4.60

CaCl2.2H2O 2.04

KH2PO4 0.40

MgSO4.7H2O 0.20

NaHCO3 4.00

Na Lactate (60%) 0.24%

Na pyruvate 0.40

Glucose 2.80

BSA 3 (mg/ml)

Penicilin G. K salt 0.06 (mg/ml)

Phenol red 0.04%

HEPES 21

KSOM, KSOM-AA and FHM were made up to volume with ddH2O, adjusted to pH7.4 and to 256 mOsmol. Media were filtered through 0.2m membranes prior to storage at 4°C. All media were prepared fresh weekly.

Page | ‐ 264 ‐

Appendix

9.4. Hormone preparations

9.4.1. PMSG (Folligon, Intervet International, Boxmeer, The Netherlands) PMSG preparation was carried out under sterile conditions in a laminar flow hood. Lyophilized hormone bought in at 1000IU per vial, was dissolved in 20ml of sterile filtered PBS to make a final concentration of 5IU/0.1ml. Working concentration of PMSG were then aliquoted into 1ml syringes and fitted with a 25G x 5/8 inch hypodermic needle before freezing at -80ºC for storage. Hormone was warmed up gently to room temperature prior to use.

9.4.2. hCG (Chorulon, Intervet International, Boxmeer, The Netherlands) hCG preparation was performed under sterile conditions in a laminar flow hood. Lyophilized hormone bought in at 1500IU per vial, was dissolved in 30ml of sterile filtered PBS to make a final concentration of 5IU/0.1ml. Working concentration of hCG were then aliquoted and stored as previously described in Section 9.4.1. Hormone was warmed up gently to room temperature prior to use.

9.5. Buffers and solutions

9.5.1. Hyaluronidase (H4272, Sigma-Aldrich, Australia) Hyaluronidase preparation was performed under sterile conditions in a laminar flow hood. Lyophilized hormone bought in at 30mg per vial, was dissolved in 100ml of sterile filtered FHM media without BSA to make a final concentration of 300g/ml. Working concentration of enzyme was then aliquoted into 1ml or 2ml volumes before freezing at - 20ºC for storage. Enzymes was warmed up gently on a heat block to 37ºC prior to use.

9.5.2. 10X PBS Sodium chloride (NaCl) 80 g

Potassium chloride (KCl) 2 g

diSodium hydrogen orthophosphate heptahydrate (Na2HPO4-7H2O) 26.8 g

Potassium phosphate (KH2PO4) 2.4 g

Solution adjusted to pH 7.4 using 5M or 8% hydrochloric acid (HCl) and made up to

volume (1L) using ddH2O

Page | ‐ 265 ‐

Appendix

9.5.3. 25X PVP Polyvinylpyrrolidone 2.5 g

Dissolved in 10ml ddH2O. Stored in frozen at -20ºC

9.5.4. 2X PHEM buffer PIPES 3.63 g

HEPES 1.3 g

EGTA 0.76 g

Magnesium sulphate (MgSO4) 0.2 g

Adjusted to pH 7.0 using 10M Potassium Hydroxide (KOH) and made up to volume

(100ml) with ddH2O. Buffer was sterile filtered and stored in aliquots at -20°C.

9.5.5. 4% Paraformaldehyde/PHEM Paraformaldehyde (PFA) prills 1 g

1X PHEM 25 ml

5M sodium hydroxide (NaOH) for pH adjustments.

PFA prills were dissolved in PHEM on a heating stirring block at ~60°C. NaOH was added in a drop-wise manner to bring pH to approximately 7.2. The solution was then left to cool to room temperature before solution was made up to volume (25ml) with ddH2O to counter evaporation prior to sterile filtering and stored at 4°C for 2 weeks.

9.5.6. 2X Embryo lysis buffer 1.5M Tris (pH6.8) 2 ml

10% SDS 2.4 ml

100% Glycerol 6 ml

Β-mercaptoethanol 3 ml

Bromophenol blue 360 mg

Page | ‐ 266 ‐

Appendix

All reagents were mixed in a Schott Duran bottle and made up to volume (20ml) with

ddH2O. Buffer was then aliquoted and stored at -20°C.

9.5.7. Cell lysis buffer 0.375M Tris (pH6.8) 5 ml

10% SDS 2 ml

Sucrose 1 g

Milli-Q H20 3 ml

Protease inhibitor cocktail tablet 1 tab/10ml

All reagents were added into a 15ml falcon tube and mixed well till homogeneous.

9.6. Immunofluorescence

9.6.1. PBS/PVP 25X PVP buffer was diluted with PBS to make 1X PBS/PVP solution.

9.6.2. PBST and PBST/BSA (1X PBS, 0.2% Tween-20, 1% BSA) 1X PBS 10 ml

Tween-20 20 l

BSA 0.1 g

PBST was made up to contain 0.2% Tween-20 and BSA was added to PBST to obtain PBST/BSA and allowed to dissolve

9.6.3. Fixing solution (4% PFA, 1X PHEM, 1X PVP, 0.5% Triton-X) 4% PFA/PHEM 4.8 ml

25X PVP 200 l

Triton-X 25 l

Taxol (10mM) 0.5 l

Page | ‐ 267 ‐

Appendix

Only for tubulin immunohistochemistry, taxol was added into the fixing solution. Triton- X and taxol, if necessary were added and allowed to dissolve just prior to use.

9.6.4. Blocking solution (1X PBS, 0.2% Tween-20, 1% BSA, 7% goat serum)

PBST/BSA 930 l

Goat serum 70 l

9.7. Bacterial culture and growth

9.7.1. LB broth

Bacto‐Tryptone 3 g

Bacto‐Yeast extract 1.5 g

Sodium chloride (NaCl) 3 g

5M Sodium Hydroxide (NaOH) for pH adjustment.

Tryptone, yeast extract and NaCl were dissolved in 250ml of ddH2O and pH adjusted

to 7.0 using NaOH before the volume (300ml) was made up with ddH2O. The medium was then autoclaved on a liquid cycle for 20 minutes with an additional 5 minutes drying step for sterilization. Medium was then allowed to cool to ~50°C before the appropriate selection antibody was added if necessary before storing at 4°C.

9.7.2. LB plate

Bacto‐Tryptone 3 g

Bacto‐Yeast extract 1.5 g

Sodium chloride (NaCl) 3 g

Bacto‐Agar 4.5 g

5M Sodium Hydroxide (NaOH) for adjusting pH.

Tryptone, yeast extract and NaCl were dissolved in 250ml of ddH2O and pH adjusted to 7.0 using NaOH. Bacto agar was then added and volume (300ml) was made up

with ddH2O prior to autoclaving on a liquid cycle for 20 minutes with an additional 5 Page | ‐ 268 ‐

Appendix

minutes drying step for sterilization. Medium was then allowed to cool to ~50°C before the appropriate selection antibody was added, swirled gently to mix and decanted into sterile culture plates. This process was carried out in close proximity around an open flame

Page | ‐ 269 ‐