Different Immune Regulatory Potential of Lactobacillus Plantarum And
Total Page：16
File Type：pdf, Size：1020Kb
J. Microbiol. Biotechnol. (2014), 24(12), 1629–1635 http://dx.doi.org/10.4014/jmb.1406.06062 Research Article Review jmb Different Immune Regulatory Potential of Lactobacillus plantarum and Lactobacillus sakei Isolated from Kimchi Yi-Fan Hong1,2, Hangeun Kim1,3, Hye Rim Kim1, Min Geun Gim1, and Dae Kyun Chung1,2,3* 1Graduate School of Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin 446-701, Republic of Korea 2Skin Biotechnology Center, Kyung Hee University, Yongin 449-701, Republic of Korea 3RNA Inc., #308 College of Life Science, Kyung Hee University, Yongin 449-701, Republic of Korea Received: June 23, 2014 Revised: July 23, 2014 It is known that lactic acid bacteria (LAB) have many beneficial health effects, including anti- Accepted: August 4, 2014 oxidative activity and immune regulation. In this study, the immune regulatory effects of First published online Lactobacillus sakei and Lactobacillus plantarum, which are found in different types of kimchi, August 11, 2014 were evaluated. L. sakei and its lipoteichoic acid (LTA) have greater immune stimulating *Corresponding author potential in IL-12, IFN-γ, and TNF-α production as compared with L. plantarum in an in vitro Phone: +82-31-888-6170; condition. On the other hand, L. plantarum is assumed to repress the Th1 immune response in Fax: +82-31-888-6173; E-mail: [email protected] murine experiments. After being injected with LPS, L. plantarum-fed mice maintained a healthier state, and the level of TNF-α in their blood was lower than in other bacterial strain- fed mice and in the LPS-only control mice. Additionally, IL-12 production was significantly decreased and the production of IL-4 was greatly increased in the splenocytes from L. plantarum-fed mice. Further experiments revealed that the pre-injection of purified LTA from L. plantarum (pLTA), L. sakei (sLTA), and S. aureus (aLTA) decreased TNF-α and IL-4 production in LPS-injected mice. Mouse IL-12, however, was significantly increased by aLTA pre-injection. In conclusion, the L. sakei and L. plantarum strains have immune regulation effects, but the effects differ in cytokine production and the regulatory effects of the Th1/Th2 immune response. pISSN 1017-7825, eISSN 1738-8872 Copyright© 2014 by Keywords: Lactobacillus plantarum, Lactobacillus sakei, kimchi, cytokine, lipoteichoic acid, immune The Korean Society for Microbiology regulation and Biotechnology Introduction nutrition” [15]. LAB, including members of the Lactobacillus genus, are members of the commensal microorganisms of Numerous reports have demonstrated the beneficial the gastrointestinal tract of humans and mammals and are effects of lactic acid bacteria (LAB). Such effects include generally recognized as probiotics [9, 17]. anti-oxidative effects, antitumor effects, maintenance of the It is widely believed that intestinal LAB play an important normal flora of the digestive tract, prevention of enteritis, role in promoting the health of the host, including the and regulation of immune responses, among others [26]. modulation of immune responses [1, 13, 15]. One potential Currently, the effects of LAB on the immune system have function of LAB is their involvement in the development been well studied. Most of the immune responses induced and maintenance of homeostasis in the intestine-associated by LAB are innate immune responses that execute immune immune system [1, 31]. It has been shown that peptidoglycan reactions before the adapted immune response is activated. and other cell wall components of LAB may play a Innate immune responses transmit various signals that significant role in stimulating immunocompetent cells in instruct the adapted immune system to activate [22]. Probiotics the intestinal tract [1, 2, 7, 15]. Intestinal LAB, including are defined as “living microorganisms, which on ingestion in various species of Lactobacillus, interact regularly with certain numbers, exert health benefits beyond inherent basic intestinal cells, which include antigen-presenting cells and December 2014 ⎪ Vol. 24⎪ No. 12 1630 Hong et al. intestinal epithelial cells [16, 27, 32]. It has been reported Purification of LTA that lactobacilli may moderate allergic reactions by LTA was prepared from the Lactobacillus strains and Staphylococcus maintaining the balance between Th1 and Th2 responses aureus using the methods detailed by Han et al. [12]. Harvested [1, 11, 23]. This balance is thought to be maintained by cells were broken up by sonication. The sonicated cells were specialized subsets of T-regulatory (Treg) cells that produce extracted with n-butanol, and LTA was first purified using hydrophobic interaction chromatography with an Octyl-Sepharose suppressive cytokines, such as interleukin (IL)-10 and CL-4B column. For further purification, DEAE Sepharose ion- transforming growth factor (TGF)-β [8, 24]. exchange column chromatography was performed. Purified LTAs To date, most studies have focused on the immunomodulatory were stored by freeze-drying. effects of viable LAB; however, we investigated those of heat-killed LAB in this study. Heat-killed LAB have the Animals advantages of allowing a longer product shelf life and Female 7- to 8-week-old BALB/c mice were bred and raised easier storage and transport. Studies have demonstrated under conventional conditions at the Kyung Hee University that LAB can effectively stimulate the production of IL-12 Biocenter. They were housed in individual cages at 23 ± 3°C, and and interferon (IFN)-γ and modulate immune responses in offered feed and water ad libitum. The Institutional Animal Care mice and humans [23, 30]. Many bacterial strains have been and Use Committee of Kyung Hee University approved this study. discovered, but most bacterial strains are isolated from Material Administration to Mice milk and industrial meat products. There are very few Mice were each fed freeze-dried heat-killed bacterial cells probiotic bacterial strains isolated from vegetable matter. (5 mg/day with 1% skim milk), which were dissolved in 200 µl of The traditional Korean fermented food kimchi is rich in sterilized water for 2 weeks before the experiments were vegetable matter and probiotic bacterial strains [20]. performed. Mice were injected with 10 mg/kg LPS (Sigma, USA) Several LAB strains have been isolated from kimchi, but and their sera were collected 24 h after LPS injection. Mice there are few reports investigating their functional effects were injected with 20µg of ovalbumin (OVA) dissolved 5:5 in [4, 21]. Our study focused on the immune characteristics of phosphate-buffered saline (PBS) and an alum solution (Sigma), two Lactobacillus strains that inhabit kimchi, Lactobacillus sakei 1 week after the sera were collected to detect and measure levels and L. plantarum. L. sakei was isolated from a commercial of immunoglobulin. The mice were sacrificed to obtain their splenocytes after 2 weeks of treatment. Korean kimchi during the course of this experiment. L. plantarum was discovered during our previous work on Preparation of Spleen Cell Suspensions the anti-inflammatory potency of L. plantarum LTA [18, 19]. Spleens were removed aseptically from the mice and placed This study focused on the influence of L. plantarum and individually into 5.0 ml of complete RPMI-1640 medium. Single L. sakei in murine models under in vivo conditions. cell suspensions were prepared by chopping the spleens into small pieces with sterile scissors and then forcing the spleen tissue up and down through a 1.0 ml syringe. The resulting suspension Materials and Methods was then transferred to a tube containing 5.0 ml of complete RPMI-1640 and centrifuged at 4°C at 1,500 rpm for 10 min. The Bacterial Strains and Culture Conditions cell pellet was resuspended in 0.8 ml of ammonium-chloride- L. sakei was isolated from the Korean traditional food kimchi, potassium lysis buffer and incubated for 1 min. After washing and the strain was confirmed by 16S rRNA/16S-23S rRNA IRS twice in complete RPMI-1640, the cells were adjusted to a final gene sequencing. The following primers (Bioneer, Korea) were concentration of 2 × 106 cells/ml in complete RPMI-1640. used to amplify the 16S rRNA and 16S-23S rRNA IRS genes: 16s forward (AGTTGATCCTGGCTC), 16S reverse (ACCTTGTTA Enzyme-Linked Immunosorbent Assay (ELISA) CGACTT) [28]; and IRS forward (TGCGGCTGGATCACCTCC TNF-α, IL-12, and IL-4 were measured using ELISA kits (R&D TT), IRS reverse (GGTTCTTTTCACCTTTCCCTC) [6]. The resultant Systems, MN, USA) and immunoglobulins were also detected PCR products were sequenced (Bionics, Korea) for phylogenetic using ELISA kits (BD, USA). To measure OVA-specific IgE, we analysis. L. sakei, L. rhamnosus GG (KCTC 5033), and L. plantarum used the method detailed by Sato et al. [29]. Standard serum for (ACTCBAA-793) were cultured in Man, Rogosa, and Sharpe comparison was obtained from mice immunized three times with (MRS) broth (Difco, USA). Staphylococcus aureus (KCTC 1621) was 20 µg of OVA and the alum solution. Standard serum was cultured in Brain Heart Infusion (BHI) broth (Difco). The cells considered to contain 100% of each immunoglobulin. were harvested by centrifugation at 5,000 ×g for 10 min and then washed three times with sterile saline solution to purify lipoteichoic Statistical Analysis acid (LTA), which was then freeze dried. All experiments were performed at least three times. The data J. Microbiol. Biotechnol. Immune Regulatory Potential of Lactobacillus Species 1631 shown are representative results of the means ± SD of triplicate kimchi, mouse splenocytes were treated with heat-killed experiments. Differences were considered statistically significant L. sakei and L. plantarum. We observed that both L. sakei and when the p value was <0.05. L. plantarum induced the secretion of proinflammatory cytokines. Mouse IL-12 was significantly increased by Results L. sakei (1 × 106 and 1 × 107 cells), whereas L. plantarum moderately increased these levels (Fig. 1A). Both L. sakei Cytokine Production in Splenocytes Due to Lactobacillus and L. plantarum also increased mouse IFN-γ, and the Strains induction of IFN-γ by L.