DOCSLIB.ORG

Comparison of Phenacoccus Solenopsis Specimens from Different Regions of Pakistan Using COI Molecular Barcoding (Hemiptera: Pseudococcidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comparison of Phenacoccus Solenopsis Specimens from Different Regions of Pakistan Using COI Molecular Barcoding (Hemiptera: Pseudococcidae) Comparison of Phenacoccus solenopsis specimens from different regions of Pakistan using COI molecular barcoding (Hemiptera: Pseudococcidae) Article (Accepted Version) Badshah, Hayat, Ullah, Farman, Zada, Hayat, Zeb, Qamar, Shah, Ruidar A, Calatayud, Paul- André and Crickmore, Neil (2017) Comparison of Phenacoccus solenopsis specimens from different regions of Pakistan using COI molecular barcoding (Hemiptera: Pseudococcidae). Annales de la Societe Entomologique de France, 53 (6). pp. 374-378. ISSN 0037-9271 This version is available from Sussex Research Online: http://sro.sussex.ac.uk/id/eprint/69889/ This document is made available in accordance with publisher policies and may differ from the published version or from the version of record. If you wish to cite this item you are advised to consult the publisher’s version. Please see the URL above for details on accessing the published version. Copyright and reuse: Sussex Research Online is a digital repository of the research output of the University. Copyright and all moral rights to the version of the paper presented here belong to the individual author(s) and/or other copyright owners. To the extent reasonable and practicable, the material made available in SRO has been checked for eligibility before being made available. Copies of full text items generally can be reproduced, displayed or performed and given to third parties in any format or medium for personal research or study, educational, or not-for-profit purposes without prior permission or charge, provided that the authors, title and full bibliographic details are credited, a hyperlink and/or URL is given for the original metadata page and the content is not changed in any way. http://sro.sussex.ac.uk 1 Comparison of Phenacoccus solenopsis specimens from different 2 regions of Pakistan using COI molecular barcoding. 3 Hayat Badshah1, Farman Ullah2, Hayat Zada2, Qamar Zeb1, Ruidar A. Shah1, Paul- 4 André Calatayud3, 4 & Neil Crickmore5* 5 1Entomology Section, Agricultural research Institute Tarnab (24330), Peshawar, Pakistan, 6 2Department of Plant Protection, The University of Agriculture, Peshawar, Pakistan, 3UMR 7 EGCE (Evolution, Génome, Comportement, Ecologie), CNRS-IRD-Univ. Paris-Sud, IDEEV, 8 Université Paris-Saclay, Gif-sur-Yvette Cedex, France, 4IRD c/o icipe P.O. Box 30772- 9 00100, Nairobi, Kenya, 5School of Life Sciences, University of Sussex, Brighton, UK. 10 11 12 *Correspondence: Neil Crickmore, School of Life Sciences, University of Sussex, Brighton, 13 UK, BN1 9QG. E-mail [email protected] 14 15 16 Keywords: Cotton pest, pest management, mealybug, Pseudococcidae, biological control 17 18 19 Summary. Because correct identification of insects is crucial for pest management involving 20 chemical or biological control agents, we have used a molecular approach to identify and 21 characterize specimens of the cotton pest Phenacoccus solenopsis Tinsley (Sternorrhyncha: 22 Pseudococcidae) present in different regions of Pakistan. The specimens were analyzed 23 through DNA sequence analysis of their mitochondrial COI (mtCOI) gene using an improved 24 procedure that could distinguish between the pest and its associated parasitoid. Our analysis 25 showed no variation among the mealybug specimens from different geographical locations of 26 Pakistan and confirmed that this is the same species and haplotype that is infesting cotton 27 plants in other parts of Asia. This information will assist in the development of biological 28 control programs against P. solenopsis in Pakistan and other Asian countries. 29 30 Résumé. Comparaison des spécimens de Phenacoccus solenopsis de différentes régions 31 du Pakistan utilisant le barcoding moléculaire COI. Parce que l'identification correcte des 32 insectes est cruciale pour la gestion des ravageurs par des agents chimiques ou biologiques, 33 nous avons utilisé une approche moléculaire pour identifier et caractériser des spécimens du 34 ravageur du coton Phenacoccus solenopsis Tinsley (Sternorrhyncha: Pseudococcidae) 35 présents dans différentes régions du Pakistan. Les échantillons ont été analysés par analyse de 36 la séquence d'ADN de leur gène mitochondrial COI (mtCOI) en utilisant une procédure 37 améliorée qui permet la distinction du ravageur et de son parasitoïde associé. Notre analyse 38 n'a montré aucune variation entre les spécimens de cochenilles de différentes localisations 39 géographiques du Pakistan et confirme qu'il s'agit de la même espèce et de l'haplotype qui 40 infeste des plants de coton dans d'autres pays d'Asie. Ces informations vont aider à 41 l'élaboration d'un programme de lutte biologique contre P. solenopsis au Pakistan et dans 42 d'autres pays d'Asie. 43 INTRODUCTION 44 The mealybug Phenacoccus solenopsis Tinsley (Sternorrhyncha: Pseudococcidae) is a highly 45 polyphagous pest, feeding on more than 154 plant species including fruits, vegetables, crops 46 and ornamentals in Pakistan (Arif et al. 2009). It was first described by Tinsley in 1898, 47 while Wang et al. (2009) reviewed its distribution and suggested that it is native of the US. Its 48 first record from outside of the US mainland was from Hawaii in 1966 (Kumashiro et al. 49 2001) and then in Asia from 2000 onward (Hodgson et al. 2008). In Pakistan, it was detected 50 for the first time in 2005 (Abbas et al. 2008; Muhammad 2007). It is a major risk to cotton, 51 vegetables and fruits causing enormous losses worldwide (779.43 US$/ha) and has reduced 52 average seed cotton yield by 44% (Dhawan et al. 2007). During 2005, in the cotton producing 53 belt of Pakistan (Punjab and Sindh provinces), 60,700 ha from a 3,237,485 ha crop were 54 seriously damaged by P. solenopsis and a 14% loss of the crop was reported. In 2007, almost 55 40% damage, equivalent to 3.1 million bales of cotton in the Punjab, was reported (Mahmood 56 et al. 2011; Kakakhel 2007). In India, P. solenopsis damage in 2007 was estimated at 57 US$400,000–500,000 and an even more severe attack was reported in 2008-2009 (Dutt 2007; 58 Nagrare et al. 2009). In addition to the direct losses that the insects can cause by sucking the 59 phloem sap, its feeding secretions (honeydew) cause additional losses to the plants by 60 disturbing their photosynthetic activity and inducing fungal contaminations (Arif et al. 2012; 61 Babar et al. 2013). 62 This species was observed to have considerable morphological variation which, along with 63 the presence of abundant mealy waxes, led to misidentifications (Thomas & Ramamurthy 64 2008). Hodgson et al. (2008) reported that this morphological variation might be induced by 65 environmental factors. But Singh et al. (2012) suggested that the wide host range of this pest 66 might facilitate the occurrence of new biotypes, which may render it difficult to control the 67 pest. Being able to identify different genetic variants of P. solenopsis could therefore 68 potentially facilitate bespoke control procedures. 69 Various molecular markers have been used as tools to differentiate insect species and to study 70 the evolutionary relationships among multiple species (Mowry & Barbour 2004; Gariepy et 71 al. 2007). The most common genes used for insect species/subspecies differentiation have 72 been cytochrome oxidase I and II (COI and COII) of mitochondrial DNA (Ashfaq et al. 2010; 73 Li et al. 2005). More recently, the COI sequence has been established as a reference gene for 74 species identification and classification through DNA barcoding (Miller 2007; Linares et al. 75 2009). Saccaggi et al. (2008) differentiated three mealybug species on the basis of COI gene 76 sequence. 77 Ashfaq et al. (2010) identified P. solenopsis in Pakistan through DNA sequencing using 78 partial nucleotide sequences of nuclear (elongation factor-1α, ribosomal DNA subunits 18S 79 and 28S) and mitochondrial (COI) genes. PCR-RFLP analysis using three different 80 endonucleases did not show any polymorphisms in individuals collected from various host 81 plants and geographical locations of the Punjab and Sindh districts of Pakistan, indicating that 82 the use of one gene sequence, such as COI, could be enough to identify other mealybug 83 specimens in Pakistan. 84 In this context, since there is little information on the genetic variability of P. solenopsis in 85 other regions of Pakistan (Ashfaq et al. 2010), in this study we have augmented the existing 86 molecular dataset of mitochondrial COI gene sequences with those of P. solenopsis from four 87 different, and previously unsampled, regions of Pakistan. 88 89 90 MATERIALS AND METHODS 91 Specimen collection and DNA extraction/amplification 92 Phenacoccus solenopsis females were collected from four different regions of Pakistan 93 (Table 1). From each region, about 20 cm of infested shoots from five different plants of the 94 species listed in the table were collected and brought to the laboratory. The mealybugs were 95 removed from the shoots using a camel hair brush, and a total of one hundred mealybug 96 females from each location were separated, identified and confirmed to be Phenacoccus 97 solenopsis Tinsley using the taxonomic keys of Hodgson et al. (2008). For each locality, fifty 98 mealybug females were preserved in 95% alcohol for future use. For the molecular analyses, 99 eight females from a given preserved sample were put in a 5ml glass pestle and crushed with 100 a mortar (Wheaton-USA). DNA was extracted using the Qiagen DNeasy Blood & Tissue kit. 101 Total genomic DNA was preserved at –20 °C. We first used primers previously published 102 from other Pseudococcids to amplify by PCR an 877 fragment of the COI gene (C1J2195: 103 TTGATTYTTTGGTCATCCAGAAGT and TL2N3014: 104 TCCAATGCACTAATCTGCCATATTA) (Ashfaq et al. 2010). The PCR conditions used 105 were: initial denaturation at 94°C for 120 sec, 35 cycles of 94°C for 30 seconds, annealing 106 48°C for 90 seconds, extension at 72°C for 120 seconds and then a final extension at 72°C for 107 5 minutes.
Load more

Recommended publications
  • ISSN NO: 2639-3166 Phenacoccus Solenopsis A. Arizonensis P
    Freely Available Online JOURNAL OF AGRONOMY RESEARCH ISSN NO: 2639-3166 Research Article DOI: 10.14302/issn.2639-3166.jar-19-2858 Effectiveness of Endoparsitoid Wasp Aenasius Arizonensis (Girault) as a Successful Bio-Control of Cotton Mealy Bug, Phenacoccus Solenopsis Tinsley, in Khartoum State, Sudan. Nawal Ahmed Mohamed1, Awad KhalafAlla Taha2 , Abubaker Haroun Mohamed Adam3,* 1Ministry of Agriculture, Animal Wealth and Irrigation, Khartoum State, Sudan 2Department of Plant Protection, College of Agricultural Studies - Shambat, Sudan University of Science and Technology, Sudan 3Department of Crop Science, College of Agriculture, University of Bahri, AlKadaru, Sudan. Abstract The objective of this study was to evaluate the effectiveness of endophagous Encyrtid parasitic wasp Aenasius arizonensis (Girault) (Hymenoptera, Chalcidoidea), as a natural enemy for controlling the Mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae). Where a Randomized Complete Block Design (RCBD) was adopted. Both, field survey and Laboratory experiments were conducted to study some biological characteristics of the parasitoid A. arizonensis. The results of field study revealed that, the parasitioid was available most of the year, and was highly effective on adults and last larval instar of the mealy bug, P. Solenopsis, with a total percentage of parasitism of 31.26%. While the laboratory results showed that, the duration from oviposition to adult emergence were similar for both male and female. Longevity of male was 23± 2.33 days and female 23.37±1.89 days. Mean daily fecundity in terms of number of Parasitized hosts / female / day ranged from 20 to 24. The sex ratio was 1:1.6 for the male and female in the progeny.
    [Show full text]
  • The Cotton Mealybug Phenacoccus Solenopsis Tinsley (Hemiptera: Pseudococcidae) As a New Insect Pest on Tomato Plants in Egypt
    JOURNAL OF PLANT PROTECTION RESEARCH Vol. 55, No. 1 (2015) DOI: 10.1515/jppr-2015-0007 The cotton mealybug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) as a new insect pest on tomato plants in Egypt Samah Sayed Ibrahim1, Fatma Abdelhalim Moharum1, Nesreen Mohamed Abd El-Ghany2* 1 Plant Protection Research Institute, Agricultural Research Center, 7 Nadi El-Seid St., Dokki, Giza, Egypt 2 Pests and Plant Protection Department, National Research Centre, 33 El-Bohouth St., Dokki, Giza 12622, Egypt Received: September 10, 2014 Accepted: February 4, 2015 Abstract: Recently, the mealybug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) was recorded as a new pest on tomato plants (Lycopersicon esculentum Mill) growing in Egypt. The mealybugs specimens were collected from tomato plants in the Qalyoubia governorate during summer season of 2014. The mealybug was identified as P. solenopsis based on the morphological characters and taxonomic key of this species. This study represents the first record of P. solenopsis as a new insect pest attacking tomato plants in Egypt. Key words: Lycopersicon esculentum, mealybug, Phenacoccus solenopsis Introduction was originally described from the USA in 1898. Until In less than a century, tomato (Lycopersicon esculentum 1992, this insect was known only in the USA, where it Mill) (Family: Solanaceae) has become a major world was widespread (Ben-Dov 2004). Phenacoccus solenopsis food crop. Today, tomatoes are grown commercially in was reported in Central America, the Caribbean, and Ec- 159 countries. The major producers of tomatoes, in 2009 uador (Fuchs et al. 1991; Williams and Granara de Willink were China, the United States, India, Turkey, Egypt, Italy, 1992).
    [Show full text]
  • Effects of Nitrogen Fertilization on the Life History of the Madeira Mealybug
    Clemson University TigerPrints All Theses Theses 12-2015 Effects of Nitrogen Fertilization on the Life History of the Madeira Mealybug (Phenacoccus madeirensis) and the Molecular Composition of its Host Plant Stephanie Alliene Rhodes Clemson University Follow this and additional works at: https://tigerprints.clemson.edu/all_theses Recommended Citation Rhodes, Stephanie Alliene, "Effects of Nitrogen Fertilization on the Life History of the Madeira Mealybug (Phenacoccus madeirensis) and the Molecular Composition of its Host Plant" (2015). All Theses. 2584. https://tigerprints.clemson.edu/all_theses/2584 This Thesis is brought to you for free and open access by the Theses at TigerPrints. It has been accepted for inclusion in All Theses by an authorized administrator of TigerPrints. For more information, please contact [email protected]. EFFECTS OF NITROGEN FERTILIZATION ON THE LIFE HISTORY OF THE MADEIRA MEALYBUG (PHENACOCCUS MADEIRENSIS) AND THE MOLECULAR COMPOSITION OF ITS HOST PLANT A Thesis Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Master of Science Entomology by Stephanie Alliene Rhodes December 2015 Accepted by: Dr. Juang-Horng Chong, Committee Co-Chair Dr .Matthew Turnbull, Committee Co-Chair Dr. Peter Adler Dr. Dara Park ABSTRACT The aim of this study was to investigate how different nitrogen fertilization rates of host-plants influence the development, fecundity, and nutritional status of a pest insect, the Madeira mealybug (Phenococcus madeirensis Green, Hemiptera: Psuedococcidae). This study evaluated the effects of nitrogen fertilization (0, 75, 150 and 300 ppm N) on the growth, % nitrogen, % carbon, lipid, and protein contents of basil plants (Ocimum basilicum L., Lamiaceae), and the subsequent impacts of host-plant nutritional status on the life history and total lipid and protein contents of the Madeira mealybug.
    [Show full text]
  • Biology, Predatory Activity and Peoples'perceptions Towards Apefly
    The Nelson Mandela AFrican Institution of Science and Technology NM-AIST Repository https://dspace.mm-aist.ac.tz Life sciences and Bio-engineering PhD Theses and Dissertations [LiSBE] 2020-05 Biology, predatory activity and peoples’perceptions towards apefly (spalgis spp.) in Tanzania Nasari, Sayuni P. https://dspace.nm-aist.ac.tz/handle/20.500.12479/927 Provided with love from The Nelson Mandela African Institution of Science and Technology BIOLOGY, PREDATORY ACTIVITY AND PEOPLES’ PERCEPTIONS TOWARDS APEFLY (Spalgis spp.) IN TANZANIA Sayuni P. Nasari A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Life Sciences of the Nelson Mandela African Institution of Science and Technology Arusha, Tanzania May, 2020 ABSTRACT In June 2017, farmers in central and northern Tanzania reported the occurrence of what they called an unusual insect with a human-like facial appearance that they referred to as “Kidudu-mtu.” The reports prompted the need to assess the identity and occurrence of the insect in Tanzania. This research was conducted between March and August 2018 in Iringa, Morogoro, Shinyanga, Geita and Arusha regions. A total of 89 people in the study regions were purposely interviewed to determine their knowledge, perceptions and reactions towards the insect. Insect samples were collected and submitted to the Tropical Pesticide Research Institute (TPRI) for preliminary identification and toxicity test. Molecular identification was done at the Nelson Mandela African Institution of Science and Technology (NM-AIST) laboratory. The insect’s predatory activity against the papaya mealybug (Paracoccus marginatus Williams and Granara de Willink) was assessed at Tanzania Agricultural Research Institute (TARI) Tengeru.
    [Show full text]
  • Impact of Ecological Conditions on Biology of Cotton Mealy Bug, Phenacoccus Solenopsis (Hemiptera: Pseudococcidae) in Laboratory
    Pakistan J. Zool., vol. 44 (3), pp. 685-690, 2012. Impact of Ecological Conditions on Biology of Cotton Mealy Bug, Phenacoccus solenopsis (Hemiptera: Pseudococcidae) in Laboratory Asifa Hameed,1 Muhammad Asif Aziz2 * and Ghulam Mustafa Aheer3 1Cotton Research Station, Multan. 2Department of Entomology, PMAS-Arid Agriculture University, Murree Road, Rawalpindi 3 Entomological Research Institute, Faisalabad Abstract.- Effect of temperature and relative humidity on the life history of the cotton mealy bug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) was investigated in the laboratory. P. solenopsis was able to complete its life cycle at 20, 25, 30 and 35±1°C and 70, 65, 60 and 40±5% RH, respectively. Egg hatching period decreased from 32±0.22 to 0.57±0.15 hours from 20 to 40°C. But at 40°C, the male specimens were unable to pupate and the female specimens despite comparatively very short life span were unable to produce eggs. The highest fecundity was observed at 20°C with each female producing an average of 232.65±2.19 eggs. Development time from egg to adult was the longest for male at 20°C. Increasing temperature and decreasing relative humidity had profound effect on the longevity of the females whereas longevity of males was less affected. Ability of the P. solenopsis to develop and reproduce successfully at 20 to 35±1°C and 70 to 40±5% RH suggests that the pest can develop and build up its populations in different ecological zones within this temperature range. Key words: Development, relative humidity, Phenacoccus solenopsis, cotton mealy bug. INTRODUCTION encourages its development.
    [Show full text]
  • GISP Prevention and Management of Invasive Alien Species
    GISP Global Invasive Species Programme Ministry of Tourism, Environment United States Government and Natural Resources Republic of Zambia Prevention and Management of Invasive Alien Species Proceedings of a Workshop on Forging Cooperation throughout Southern Africa 10-12 June 2002 Lusaka, Zambia Edited by Ian A.W. Macdonald, Jamie K. Reaser, Chris Bright, Laurie E. Neville, Geoffrey W. Howard, Sean T. Murphy, and Guy Preston This report is a product of a workshop entitled Prevention and Management of Invasive Alien Species: Forging Cooperation throughout Southern Africa, held by the Global Invasive Species Programme (GISP) in Lusaka, Zambia on 10-12 June 2002. It was sponsored by the U.S. Department of State, Bureau of Oceans and International Environmental Affairs (OESI). In-kind assistance was provided by the U.S. Environmental Protection Agency. Administrative and logistical assistance was provided by IUCN Zambia, the Scientific Committee on Problems of the Environment (SCOPE), and the U.S. National Fish and Wildlife Foundation (NFWF), as well as all Steering Committee members. The Smithsonian Institution National Museum of Natural History and National Botanical Institute, South Africa kindly provided support during report production. The editors thank Dr Phoebe Barnard of the GISP Secretariat for very extensive work to finalize the report. The workshop was co-chaired by the Governments of the Republic of Zambia and the United States of America, and by the Global Invasive Species Programme. Members of the Steering Committee included: Mr Lubinda Aongola (Ministry of Tourism, Environment and Natural Resources, Zambia), Mr Troy Fitrell (U.S. Embassy - Lusaka, Zambia), Mr Geoffrey W. Howard (GISP Executive Board, IUCN Regional Office for Eastern Africa), Ms Eileen Imbwae (Permanent Secretary, Ministry of Tourism, Environment and Natural Resources, Zambia), Mr Mario Merida (U.S.
    [Show full text]
  • On Cotton by Aenasius Bambawalei Hayat (Hymenoptera: Encyrtidae)
    J. Biol. Control, 23(4): 457–460, 2009 Research Note Natural parasitization of Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) on cotton by Aenasius bambawalei Hayat (Hymenoptera: Encyrtidae) RISHI KUMAR, K. R. KRANTHI, D. MONGA and S. L. JAT Central Institute for Cotton Research, Regional Station, Sirsa 125055, Haryana, India. E-mail: [email protected] ABSTRACT: Studies were conducted during 2007 and 2008 over a considerable geographical area under cotton cultivation for finding potential natural enemies of Phenacoccus solenopsis Tinsley. In July 2008, large numbers of mummifiedP. solenopsis along with healthy mealybugs were observed on heavily infested cotton crop at Central Institute for Cotton Research, Regional Station, Sirsa (Haryana) due to parasitization by Aenasius bambawalei Hayat, a potential bioagent of P. solenopsis. The parasitoid completed its life cycle on the mealybug leaving the mummified body along with the exit hole behind. The parasitization efficiency of the parasitoid from field collected mealybugs was 57.2 per cent (range 46-64%) whereas under laboratory condition, it was 60.6 per cent (45-74%). As biological control is a supplement to chemical control, the adverse effect of commonly used insecticides on cotton on the efficiency of this parasitoid was studied and monocrotophos was recorded as the most deleterious (57.52% reduction in parasitization). Spinosad and spirotetramet were found to cause the least reduction in parasitization. KEY WORDS: Aenasius bambawalei, insecticidal intervention, parasitoid, parasitization, Phenacoccus solenopsis In 2005, an invasive species of mealybug, Phenacoccus congregation of individuals, protection of late age nymphs solenopsis Tinsley (Hemiptera: Pseudococcidae) was found and adults by loose, cottony waxy substance secreted by the causing serious damage to cotton in Punjab and Sindh mealybugs and oviposition in waxy ovisacs act as barriers provinces of Pakistan (Hodgson et al., 2008).
    [Show full text]
  • Les Entomophages Inféodés À La Cochenille Du Manioc
    I' AnnlsSoc. ent. Fr. (N. S.) 16 ([l), 1980,509 a 515 LESENTOMOPHAGES INFÉODÉS A LACOCHENILLE DU MANIOC, PHENACOCCUS MANIHOTI [HOLM. COCCOIDEAPSEUDOCOCCIDAE] EN RÉPUBLIQUE POPULAIRE DU CONGO i I) LES COMPOSANTES DE L'ENTOMOCOENOSE ! ET LEURS INTER-RELATIONS PAR Gérard FABRES(*) & Daniele ~~ATILE-FERRERO(**) (i) (*) O.R.S.T.O.M., Laboratoire d'Entomologie Appliquée, B.P. 181, RPC - Brazzaville. (**) MuséumNational d'Histoire Naturelle, Laboratoire d'Entomologie, 45, ruede Buffon, F-75005 Paris. SUMMARY The occurence of several predators, parasites and hyper-parasites is reported and their relationship is studiedin detail. A new species of thegenus Anagyrus is recorded.Several Coccinellids (Esochomus flaviventris, E. concavus,Hyperaspis senegalensis hottentotta), Cecidomyiids (Coccodiplosiscitri, Dicrodiplosis sp.), Lycaenid(Spalgis lemolea)and Anthocorid(Cardiasthetus esiguw)are involved in thenatural regulation of thepest population. Hyperparasites (Xyphigasterpseudococci, Homalotylusflaminius, Prochiloneurus pulchellus) have been foundattacking Anagyrus, Exochomw and Coccodiplosis species. An additionalEncyrtid (Cheiloneuruscyanonotus) developsupon the hyperparasite Homalotylus. Data are given on the dynamics of the entomophagous insect populations, the time of their intervention, the rate of parasitism and predatism. RfiSUMfi La présence de nombreus prédateurs, parasites et hyperparasites est signalée. Les rela- tions qu'ils entretiennentau sein 'de la biocoenose sont définies. Une nouvelle espèce d'Encyrtidae appartenant au genre Anagyrus
    [Show full text]
  • Fabiana Soares Cariri Lopes.Pdf
    BIOPROSPECÇÃO, IDENTIFICAÇÃO E MANEJO DE COCHONILHAS-FARINHENTAS (HEMIPTERA: PSEUDOCOCCIDAE) E INSETOS ASSOCIADOS EM AGROECOSSISTEMAS DE VIDEIRA NO SUBMÉDIO DO VALE DO SÃO FRANCISCO por FABIANA SOARES CARIRI LOPES (Sob Orientação do Professor José Vargas de Oliveira - UFRPE) RESUMO As pragas são consideradas um dos maiores obstáculos ao desenvolvimento da cultura da videira na região do Submédio do Vale do São Francisco. A correta identificação das espécies constitui uma prática importante em programas de manejo integrado. O objetivo deste trabalho foi realizar um inventário das espécies de Pseudococcidae, plantas hospedeiras, inimigos naturais e formigas associadas às cochonilhas nesta cultura na região bem como realizar testes com produtos naturais nas espécies mais abundantes de cochonilhas-farinhentas. Os insetos e as plantas foram coletados em parreirais comerciais e encaminhados a especialistas para identificação. Os testes de mortalidade em laboratório foram realizados com os produtos Azact®, Azamax®, Matrix® e Orobor® utilizando diferentes concentrações e com as espécies de cochonilhas Planococcus citri Risso, e Maconelicoccus hirsutus (Green) (Hemiptera: Pseudococcidae). As cochonilhas- farinhentas identificadas através de análise morfológica e molecular associadas à videira foram M. hirsutus, P. citri, Phenacoccus solenospsis Tinsley e Dysmicoccus brevipes (Cockerell). Foram identificadas 12 espécies de formigas, sendo Solenopsis saevissima Smith e Dorymyrmex bicolor Wheeler 1906 as mais abundantes. Os inimigos naturais identificados foram Gyranusoidea indica Shafee, Alam & Agarwal, Anagyrus kamali Moursi, Leptomastix dactylopii Howard, Cheiloneurus i sp., Aenasius sp. (Hymenoptera: Encyrtidae), Aprostocetus sp. (Hymenoptera: Eulophidae), Dendrocerus sp. (Hymenoptera: Megaspilidae), Eurydinoteloides sp. (Hymenoptera: Pteromalidae), Hippodamia convergens Guérin-Meneville, Tenuisvalvae notata (Mulsant), Cycloneda sanguinea (L.), Eriopis connexa (Germar) e Cryptolaemus montrouzieiri Mulsant (Coleoptera: Coccinelidae).
    [Show full text]
  • Phenotypic Variation and Identification of Phenacoccus Solenopsis Tinsley (Hemiptera: Pseudococcidae) in China
    Zootaxa 3802 (1): 109–121 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3802.1.9 http://zoobank.org/urn:lsid:zoobank.org:pub:B27857E3-9162-402F-A7A0-42967080A201 Phenotypic variation and identification of Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) in China JING ZHAO1, GILLIAN W. WATSON2, YANG SUN1, YONGAN TAN1, LIUBIN XIAO1 & LIXIN BAI1, 3 1Institute of Plant Protection Room 305, Jiangsu Academy of Agricultural Sciences, Zhongling Street No.50, Nanjing 210014, China. E-mail [email protected] 2Plant Pest Diagnostic Center, California Department of Food & Agriculture, 3294 Meadowview Road, Sacramento, California 95832, U.S.A. E-mail [email protected] 3Corresponding author. E-mail: [email protected] Abstract Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) is an invasive mealybug that seriously damages cotton and other important crops. In previous studies in China, the presence of two submedian longitudinal lines of pigmented spots on the dorsum of adult females frequently has been used to identify this species. However, the present study records the occasional absence of pigmented spots in a sample from Guangxi province, China. Specimens without pigmented spots showed all the molecular and morphological characters that separate P. solenopsis from the similar species P. solani Ferris, especially the distribution of multilocular disc pores. In different geographic populations of P. solenopsis in China, mito- chondrial COI and nuclear 28SrDNA genes are very similar (99.8–100%), indicating that they are conspecific. For COI, the genetic distance between P. solenopsis and P.
    [Show full text]
  • Muhammad Rafiq Shahid Ento
    STUDIES ON MECHANISMS OF RESISTANCE IN DIFFERENT HOST PLANTS AGAINST COTTON MEALYBUG, PHENACOCCUS SOLENOPSIS TINSLEY (HEMIPTERA: PSEUDOCOCCIDAE) By MUHAMMAD RAFIQ SHAHID Reg. No. 2000-ag-1364 M.Sc. (Hons.) Agri. Entomology A thesis submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY IN ENTOMOLOGY DEPARTMENT OF ENTOMOLOGY FACULTY OF AGRICULTURE UNIVERSITY OF AGRICULTURE, FAISALABAD (PAKISTAN) 2015 i i To, The Controller of Examinations, University of Agriculture, Faisalabad. We, the Supervisory Committee, certify that the contents and form of thesis submitted by Mr. Muhammad Rafiq Shahid, Regd. No. 2000-ag-1364 have been found satisfactory and recommend that it be processed for evaluation by the external examiner(s) for the award of Ph. D degree. SUPERVISORY COMMITTEE: CHAIRMAN: (Prof. Dr. Muhammad Jalal Arif) MEMBER: (Dr. Muhammad Dildar Gogi) MEMBER: (Prof. Dr. Nazir Javed) ii In the name of ALLAH The Most Beneficent The Most Merciful This Humble Effort is Dedicated to HOLY PROPHET HAZART MUHAMMAD (Peace Be Upon Him) The Ocean of Knowledge and The greatest reformer, My Beloved PARENTS BROTHERS, SISTERS AND MY WIFE Their hands always rose in prayer for me and are forever with me to feel the bud of their wishes and prayers, Blooming into a flower. iii DECLARATION I hereby declare that the contents of the thesis” Studies on mechanisms of resistance in different host plants against cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) are product of my own research and no part has been copied from any published source (except the references, standard mathematic or genetic models/equations/protocoals etc.).
    [Show full text]
  • Scale Insect Pests of Connecticut Trees and Ornamentals
    Dr. Hugh Smith, Dr. Richard Cowles, and Rose Hiskes Department of Entomology The Connecticut Agricultural Experiment Station 123 Huntington Street, P. O. Box 1106 New Haven, CT 06504 Phone: (203) 974-8600 Fax: (203) 974-8502 Founded in 1875 Email: [email protected] Putting science to work for society Website: www.ct.gov/caes Scale Insect Pests of Connecticut Trees and Ornamentals Scale insects are among the most difficult mealybug pests of Connecticut ornamentals pests of woody ornamentals to manage. include the taxus mealybug on yew, and the There are several types of scale insect, apple mealybug and the Comstock although the most common scale pests for mealybug, both of which attack many hosts. Connecticut growers are armored scales Common scale pests of Connecticut and (Diaspididae), soft scales (Coccidae) and their hosts are presented in Table 1. mealybugs (Pseudococcidae). Armored scales tend to be smaller (2-3 mm) than soft Life cycle. Depending on the species, scale scales (5-10 mm) and often appear as though insects can overwinter as eggs, immatures, they are part of the plant, making them or adults. Females lay eggs beneath the difficult to detect. Armored scales secrete a scale covering or in a cottony mass. Some hard covering that helps protect them from scale species have one generation per year; insecticides and natural enemies, and some species have a few or several prevents them from drying out. This generations per year. First stage immatures, covering can be pried away from the scale called crawlers, emerge from eggs in spring body with the tip of a blade or an insect pin.
    [Show full text]