DOCSLIB.ORG

Design of Gene Editing Assays

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Design of Gene Editing Assays ) ( (51) International Patent Classification: 92121 (US). MAHAJAN, Sudipta; 11Lowe Circle, Fram¬ C07D 403/12 (2006.01) A61K 31/5377 (2006.01) ingham, MA 01701 (US). C07D 413/12 (2006.01) A61K 31/5386 (2006.01) (74) Agent: ALI, Bashir, M. et al. ; Brinks Gilson & Lione, P.o. A61P 35/00 (2006.01) Cl 2N 15/10 (2006.01) Box 110285, Research Triangle Park, NC 27709 (US). A61K 31/506 (2006.01) (81) Designated States (unless otherwise indicated, for every (21) International Application Number: kind of national protection av ailable) . AE, AG, AL, AM, PCT/US20 19/0 13783 AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, (22) International Filing Date: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, 16 January 2019 (16.01.2019) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, (25) Filing Language: English KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (26) Publication Language: English MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (30) Priority Data: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 62/618,598 17 January 2018 (17.01.2018) US TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (71) Applicant: VERTEX PHARMACEUTICALS INCOR¬ (84) Designated States (unless otherwise indicated, for every PORATED [US/US]; 50 Northern Avenue, Boston, MA kind of regional protection available) . ARIPO (BW, GH, 02210 (US). GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (72) Inventors: WEINBERG, Marc, Saul; 436 Brenna Court, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, Encinitas, CA 92024 (US). D'ASTOLFO, Diego, Sebas¬ TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, tian; 5167 Renaissance Avenue, Unit E, San Diego, CA EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, (54) Title: DNA-PK INHIBITORS Design of Gene Editing Assays 1 T rget Gene - Selected ( Identification of Active sgRNA target sites (57) Abstract: The present invention relates to compounds useful as inhibitors of DNA-PK. The invention also provides pharmaceuti¬ cally acceptable compositions comprising said compounds and methods of using the compositions in the treatment of various diseases, conditions, or disorders. [Continued on nextpage] ||| ||||| ||||| ||||| |||| 11| ||| ||||| ||||| ||||| ||||| ||||| |||| limn nil nil nil Declarations under Rule 4.17: as to applicant's entitlement to apply for and be granted a patent (Rule 4.17(H)) as to the applicant's entitlement to claim the priority of the earlier application (Rule 4.17(iii)) Published: with international search report (Art. 21(3)) with sequence listing part of description (Rule 5.2(a)) DNA-PK INHIBITORS RELATED APPLICATIONS [0001] This application claims the benefit of .S . Provisional Application No. S 62/618,598, filed January 17, 2018, which is incorporated by reference herein in its entirety. SEQUENCE LISTING [0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on January 15, 2019, is named 14390-686 Sequence listing_ST25.txt and is 8 KB in size. TECHNICAL FIELD OF THE INVENTION [0003] The present invention relates to compounds useful as inhibitors of DNA- dependent protein kinase (DNA-PK). The invention also provides pharmaceutically acceptable compositions comprising the compounds of the invention and methods of using the compositions in the treatment of cancer, and for increasing genome editing efficiency by administering a DNA-PK inhibitor and a genome editing system to a cell(s). BACKGROUND OF THE INVENTION [0004] Ionizing radiation (IR) induces a variety of DNA damage of which double strand breaks (DSBs) are the most cytotoxic. These DSBs can lead to cell death via apoptosis and/or mitotic catastrophe if not rapidly and completely repaired. In addition to IR, certain chemotherapeutic agents including topoisomerase II inhibitors, bleomycin, and doxorubicin also cause DSBs. These DNA lesions trigger a complex set of signals through the DNA damage response network that function to repair the damaged DNA and maintain cell viability and genomic stability. In mammalian cells, the predominant repair pathway for DSBs is the Non-Homologous End Joining Pathway (NHEJ). This pathway functions regardless of the phase of the cell cycle and does not require a template to re-ligate the broken DNA ends. NHEJ requires coordination of many proteins and signaling pathways. The core NHEJ machinery consists of the Ku70/80 heterodimer and the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs or DNA-PK), which together comprise the active DNA- PK enzyme complex. DNA-PKcs is a member of the phosphatidylinositol 3-kinase- related kinase (PIKK) family of serine/threonine protein kinases that also includes ataxia telangiectasia mutated (ATM), ataxia telangiectasia and Rad3-related (ATR), mTOR, and four PI3K isoforms. However, while DNA-PKcs is in the same protein kinase family as ATM and ATR, these latter kinases function to repair DNA damage through the Homologous Recombination (HR) pathway and are restricted to the S and G2 phases of the cell cycle. While ATM is also recruited to sites of DSBs, ATR is recruited to sites of single stranded DNA breaks. [0005] NHEJ is thought to proceed through three key steps: recognition of the DSBs, DNA processing to remove non-ligatable ends or other forms of damage at the termini, and finally ligation of the DNA ends. Recognition of the DSB is carried out by binding of the Ku heterodimer to the ragged DNA ends followed by recruitment of two molecules of DNA-PKcs to adjacent sides of the DSB; this serves to protect the broken termini until additional processing enzymes are recruited. Recent data supports the hypothesis that DNA-PKcs phosphorylates the processing enzyme, Artemis, as well as itself to prepare the DNA ends for additional processing. In some cases DNA polymerase may be required to synthesize new ends prior to the ligation step. The auto-phosphorylation of DNA-PKcs is believed to induce a conformational change that opens the central DNA binding cavity, releases DNA-PKcs from DNA, and facilitates the ultimate religation of the DNA ends. [0006] It has been known for some time that DNA-PK" mice are hypersensitive to the effects of IR and that some non-selective small molecule inhibitors of DNA- PKcs can radiosensitize a variety of tumor cell types across a broad set of genetic backgrounds. While it is expected that inhibition of DNA-PK will radiosensitize normal cells to some extent, this has been observed to a lesser degree than with tumor cells likely due to the fact that tumor cells possess higher basal levels of endogenous replication stress and DNA damage (oncogene-induced replication stress) and DNA repair mechanisms are less efficient in tumor cells. Most importantly, an improved therapeutic window with greater sparing of normal tissue will be imparted from the combination of a DNA-PK inhibitor with recent advances in precision delivery of focused IR, including image-guide RT (IGRT) and intensity-modulated RT (IMRT). [0007] Inhibition of DNA-PK activity induces effects in both cycling and non cycling cells. This is highly significant since the majority of cells in a solid tumor are not actively replicating at any given moment, which limits the efficacy of many agents targeting the cell cycle. Equally intriguing are recent reports that suggest a strong connection between inhibition of the NHEJ pathway and the ability to kill traditionally radioresistant cancer stem cells (CSCs). It has been shown in some tumor cells that DSBs in dormant CSCs predominantly activate DNA repair through the NHEJ pathway; it is believed that CSCs are usually in the quiescent phase of the cell cycle. This may explain why half of cancer patients may experience local or distant tumor relapse despite treatment as current strategies are not able to effectively target CSCs. A DNA-PK inhibitor may have the ability to sensitize these potential metastatic progenitor cells to the effects of IR and select DSB-inducing chemotherapeutic agents. [0008] Given the involvement of DNA-PK in DNA repair processes, an application of specific DNA-PK inhibitory drugs would be to act as agents that will enhance the efficacy of both cancer chemotherapy and radiotherapy. Accordingly, it would be desirable to develop compounds useful as inhibitors of DNA-PK. [0009] In addition, precise genome targeting technologies are needed to enable systematic engineering of genetic variations. The use of genome editing systems, specifically Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)- endonuclease based genome editing technology has grown exponentially in the past few years. The type II CRISPR-Cas9 bacterial innate immune system has emerged as an effective genome editing tool for targeted modification of the human genome (Wiedenheft, B . 2012 ; Hsu, P.D. eta. 2014). Recently, CRISPR-Cpf genome editing systems have been described. CRISPR-endonuclease based genome editing is dependent, in part, upon non-homologous end joining (NHEJ) and homology directed repair (JJDR) pathways to repair DNA double strand breaks. Cellular repair mechanism favors NHEJ over JJDR. [0010] While the achievement of insertion or deletions (indels) from NHEJ is up to 70% effective in some reports, the efficiency of JJDR remains challenging, with rates at less than 1%. [0011] Accordingly, a need exists for increasing genome editing efficiency, in particular, HDR efficiency. Another application of specific DNA-PK inhibitory drugs would be to act as agents that will enhance the efficacy of genome editing systems.
Load more

Recommended publications
  • CDX4 Regulates the Progression of Neural Maturation in the Spinal Cord
    Developmental Biology 449 (2019) 132–142 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology CDX4 regulates the progression of neural maturation in the spinal cord Piyush Joshi a,b, Andrew J. Darr c, Isaac Skromne a,d,* a Department of Biology, University of Miami, 1301 Memorial Drive, Coral Gables, Florida, 33146, United States b Cancer and Blood Disorders Institute, Johns Hopkins All Children's Hospital, 600 5th St S, St. Petersburg, FL 33701, United States c Department of Health Sciences Education, University of Illinois College of Medicine, 1 Illini Drive, Peoria, IL 61605, United States d Department of Biology, University of Richmond, 138 UR Drive B322, Richmond, VA, 23173, United States ARTICLE INFO ABSTRACT Keywords: The progression of cells down different lineage pathways is a collaborative effort between networks of extra- CDX cellular signals and intracellular transcription factors. In the vertebrate spinal cord, FGF, Wnt and Retinoic Acid Neurogenesis signaling pathways regulate the progressive caudal-to-rostral maturation of neural progenitors by regulating a Spinal cord poorly understood gene regulatory network of transcription factors. We have mapped out this gene regulatory Gene regulatory network network in the chicken pre-neural tube, identifying CDX4 as a dual-function core component that simultaneously regulates gradual loss of cell potency and acquisition of differentiation states: in a caudal-to-rostral direction, CDX4 represses the early neural differentiation marker Nkx1.2 and promotes the late neural differentiation marker Pax6. Significantly, CDX4 prevents premature PAX6-dependent neural differentiation by blocking Ngn2 activation. This regulation of CDX4 over Pax6 is restricted to the rostral pre-neural tube by Retinoic Acid signaling.
    [Show full text]
  • Iron Transport Proteins: Gateways of Cellular and Systemic Iron Homeostasis
    Iron transport proteins: Gateways of cellular and systemic iron homeostasis Mitchell D. Knutson, PhD University of Florida Essential Vocabulary Fe Heme Membrane Transport DMT1 FLVCR Ferroportin HRG1 Mitoferrin Nramp1 ZIP14 Serum Transport Transferrin Transferrin receptor 1 Cytosolic Transport PCBP1, PCBP2 Timeline of identification in mammalian iron transport Year Protein Original Publications 1947 Transferrin Laurell and Ingelman, Acta Chem Scand 1959 Transferrin receptor 1 Jandl et al., J Clin Invest 1997 DMT1 Gunshin et al., Nature; Fleming et al. Nature Genet. 1999 Nramp1 Barton et al., J Leukocyt Biol 2000 Ferroportin Donovan et al., Nature; McKie et al., Cell; Abboud et al. J. Biol Chem 2004 FLVCR Quigley et al., Cell 2006 Mitoferrin Shaw et al., Nature 2006 ZIP14 Liuzzi et al., Proc Natl Acad Sci USA 2008 PCBP1, PCBP2 Shi et al., Science 2013 HRG1 White et al., Cell Metab DMT1 (SLC11A2) • Divalent metal-ion transporter-1 • Former names: Nramp2, DCT1 Fleming et al. Nat Genet, 1997; Gunshin et al., Nature 1997 • Mediates uptake of Fe2+, Mn2+, Cd2+ • H+ coupled transporter (cotransporter, symporter) • Main roles: • intestinal iron absorption Illing et al. JBC, 2012 • iron assimilation by erythroid cells DMT1 (SLC11A2) Yanatori et al. BMC Cell Biology 2010 • 4 different isoforms: 557 – 590 a.a. (hDMT1) Hubert & Hentze, PNAS, 2002 • Function similarly in iron transport • Differ in tissue/subcellular distribution and regulation • Regulated by iron: transcriptionally (via HIF2α) post-transcriptionally (via IRE) IRE = Iron-Responsive Element Enterocyte Lumen DMT1 Fe2+ Fe2+ Portal blood Enterocyte Lumen DMT1 Fe2+ Fe2+ Fe2+ Fe2+ Ferroportin Portal blood Ferroportin (SLC40A1) • Only known mammalian iron exporter Donovan et al., Nature 2000; McKie et al., Cell 2000; Abboud et al.
    [Show full text]
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
    [Show full text]
  • Ovarian Gene Expression in the Absence of FIGLA, an Oocyte
    BMC Developmental Biology BioMed Central Research article Open Access Ovarian gene expression in the absence of FIGLA, an oocyte-specific transcription factor Saurabh Joshi*1, Holly Davies1, Lauren Porter Sims2, Shawn E Levy2 and Jurrien Dean1 Address: 1Laboratory of Cellular and Developmental Biology, NIDDK, National Institutes of Health, Bethesda, MD 20892, USA and 2Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN 37232, USA Email: Saurabh Joshi* - [email protected]; Holly Davies - [email protected]; Lauren Porter Sims - [email protected]; Shawn E Levy - [email protected]; Jurrien Dean - [email protected] * Corresponding author Published: 13 June 2007 Received: 11 December 2006 Accepted: 13 June 2007 BMC Developmental Biology 2007, 7:67 doi:10.1186/1471-213X-7-67 This article is available from: http://www.biomedcentral.com/1471-213X/7/67 © 2007 Joshi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Ovarian folliculogenesis in mammals is a complex process involving interactions between germ and somatic cells. Carefully orchestrated expression of transcription factors, cell adhesion molecules and growth factors are required for success. We have identified a germ-cell specific, basic helix-loop-helix transcription factor, FIGLA (Factor In the GermLine, Alpha) and demonstrated its involvement in two independent developmental processes: formation of the primordial follicle and coordinate expression of zona pellucida genes. Results: Taking advantage of Figla null mouse lines, we have used a combined approach of microarray and Serial Analysis of Gene Expression (SAGE) to identify potential downstream target genes.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
    The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP).
    [Show full text]
  • Cell Reprogramming Technologies for Treatment And
    CELL REPROGRAMMING TECHNOLOGIES FOR TREATMENT AND UNDERSTANDING OF GENETIC DISORDERS OF MYELIN by ANGELA MARIE LAGER Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Thesis advisor: Paul J Tesar, PhD Department of Genetics and Genome Sciences CASE WESTERN RESERVE UNIVERSITY May 2015 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Angela Marie Lager Candidate for the Doctor of Philosophy degree*. (signed) Ronald A Conlon, PhD (Committee Chair) Paul J Tesar, PhD (Advisor) Craig A Hodges, PhD Warren J Alilain, PhD (date) 31 March 2015 *We also certify that written approval has been obtained from any proprietary material contained therein. TABLE OF CONTENTS Table of Contents……………………………………………………………………….1 List of Figures……………………………………………………………………………4 Acknowledgements……………………………………………………………………..7 Abstract…………………………………………………………………………………..8 Chapter 1: Introduction and Background………………………………………..11 1.1 Overview of mammalian oligodendrocyte development in the spinal cord and myelination of the central nervous system…………………..11 1.1.1 Introduction……………………………………………………..11 1.1.2 The establishment of the neuroectoderm and ventral formation of the neural tube…………………………………..12 1.1.3 Ventral patterning of the neural tube and specification of the pMN domain in the spinal cord……………………………….15 1.1.4 Oligodendrocyte progenitor cell production through the process of gliogenesis ………………………………………..16 1.1.5 Oligodendrocyte progenitor cell to oligodendrocyte differentiation…………………………………………………...22
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Ferredoxin Reductase Is Critical for P53-Dependent Tumor Suppression Via Iron Regulatory Protein 2
    Downloaded from genesdev.cshlp.org on October 11, 2021 - Published by Cold Spring Harbor Laboratory Press Ferredoxin reductase is critical for p53- dependent tumor suppression via iron regulatory protein 2 Yanhong Zhang,1,9 Yingjuan Qian,1,2,9 Jin Zhang,1 Wensheng Yan,1 Yong-Sam Jung,1,2 Mingyi Chen,3 Eric Huang,4 Kent Lloyd,5 Yuyou Duan,6 Jian Wang,7 Gang Liu,8 and Xinbin Chen1 1Comparative Oncology Laboratory, Schools of Veterinary Medicine and Medicine, University of California at Davis, Davis, California 95616, USA; 2College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210014, China; 3Department of Pathology, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA; 4Department of Pathology, School of Medicine, University of California at Davis Health, Sacramento, California 95817, USA; 5Department of Surgery, School of Medicine, University of California at Davis Health, Sacramento, California 95817, USA; 6Department of Dermatology and Internal Medicine, University of California at Davis Health, Sacramento, California 95616, USA; 7Department of Pathology, School of Medicine, Wayne State University, Detroit, Michigan 48201 USA; 8Department of Medicine, School of Medicine, University of Alabama at Birmingham, Birmingham, Alabama 35294, USA Ferredoxin reductase (FDXR), a target of p53, modulates p53-dependent apoptosis and is necessary for steroido- genesis and biogenesis of iron–sulfur clusters. To determine the biological function of FDXR, we generated a Fdxr- deficient mouse model and found that loss of Fdxr led to embryonic lethality potentially due to iron overload in developing embryos. Interestingly, mice heterozygous in Fdxr had a short life span and were prone to spontaneous tumors and liver abnormalities, including steatosis, hepatitis, and hepatocellular carcinoma.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]