Searex Educatorsguide.Pdf

A WORD FROM THE FILMMAKERS

“After intense research and discussions “‘Sea Rex: Journey to a Prehistoric with various specialists, we came to the World’ is the perfect symbiosis of realization five years ago that there was entertainment and scientific content. astonishingly little information available This film is very much my childhood “ on the marine reptiles that lived, in part, dreams come true: I get to see these at the same time as the dinosaurs. That animals that I've studied for years is tremendously surprising given just come to life right before my eyes. how fascinating these animals are with They are not just incredibly realistic their size, ability for predation, longevity but also entirely scientifically and perfect adaptation to the marine accurate in terms of their morphology and respective environment. We very carefully selected actions in the film. This Educators’ Guide is an invaluable the reptiles featured in the film and chose tool not only for teachers but for everyone, and is a the dominant marine reptile groups of perfect complement to the screening of the film.” the time to represent each of the periods of the Mesozoic era: ichthyosaurs in the Dr. Nathalie Bardet, Main Scientific Advisor Triassic, plesiosaurs in the Jurassic and CNRS/National Museum of Natural History mosasaurs in the Cretaceous. We hope that educators and students alike will be entertained while also learning about the This Educators’ and Activities Guide was written by prehistoric underwater world and its Drs. Stéphane Jouve and Peggy Vincent in collaboration with inhabitants, which most people know so Dr. Nathalie Bardet, CNRS/National Museum of Natural History. little about in comparison with their Edited by Julien Bollée and Alexandra Body. terrestrial cousins, the dinosaurs.” Illustrations by Karine Sampol & Stéphane Jouve for 3D Entertainment Distribution. Scientific Advisors: Pascal Vuong & Ronan Chapalain Dr. Olivier C. Rieppel, Rowe Family Curator, The Field Museum, Chicago (IL) Writers and Directors Dr. Ryosuke Motani, Professor, University of California, Davis (CA) Dr. Zulma Gasparini, Paleontologist, La Plata Museum/CONICET, La Plata (Argentina) Dr. Benjamin Kear, Paleontologist, La Trobe University, Melbourne (Australia) Special Thanks to: François Mantello, Pascal Vuong, Ronan Chapalain, Catherine Vuong, Dr. Elisabeth Mantello and Sylvain Grain. Designed by malderagraphistes. ” Produced and Published by 3D Entertainment Distribution. NOTE TO EDUCATORS AND TEACHERS

very student instinctively believes in an unchanged Earth and Additional educational resources and activities are available online life in their current forms. The extreme length of geological from the official film website www.SeaRex-theFilm.com, including a time and the transformation of species are difficult notions companion booklet, “The Cast of ‘Sea Rex: Journey to a Prehistoric Eto comprehend. The film “Sea Rex: Journey to a Prehistoric World” World’”. This 40-page PDF document provides information on each of presents the opportunity to address, in accordance with the US national the marine reptile, flying reptile and dinosaur species you will encounter educational standards in Biology and Earth Sciences, the history of in the film through some of its most salient characteristics, such as life and evolution through visually-stunning and compelling images. the meaning of its name, classification, the period during which it lived, geographic distribution, size, diet and other interesting details. The “Sea Rex: Journey to a Prehistoric World” Educators’ & Activities Guide is divided into three units which explore subjects included in the Life and Earth Sciences curricula: “What are Marine IN BRIEF Reptiles?”, “What is Paleontology?” and “Biological Crisis!” Each [] unit begins with key information on the particular topic to help you set a context for the activities, which are designed to be easily UNIT I “What are Marine Reptiles?” integrated into your lessons and are applicable for all student grades includes activities involving morphology, characteristics, and from elementary age through to university (1-2; 3-5; 6-8; and 9-12). adaptations. These activities provide the basis for teaching the mechanism and logic of classification. They are a great way The hands-on activities proposed in the guide can be undertaken for students to see the evolution in classification and species at various times in relation to your students’ viewing of the film relationships, in this case based on marine reptiles. to provide strong interactivity. The activities included in Unit I are specifically designed to be completed prior to viewing the film as a UNIT II “What is Paleontology?” preparation and to allow students to become familiar with the knowledge touches on general knowledge of fossils and evolution. It developed while watching the film. The 2nd and 3rd unit activities focuses primarily on the techniques used in paleontology and can be carried out before or following the film screening. the relationships between fossils and geological processes.

UNIT III “Biological Crisis!” deals with the evolution of species throughout time and the occurrence of biological crises. SEA [a large body of salt water] REX [Latin word meaning King]

[ABOUT THE FILM] “Sea Rex: Journey to a Prehistoric World” takes students 200 million years back in time to the Mesozoic era for a wondrous adventure across the Triassic, Jurassic and Cretaceous periods with larger-than-life underwater creatures. With their daunting size and natural abilities, marine reptiles ruled the ancient depths before dinosaurs conquered the earth. In the company of a young imaginative A poster featuring the various species seen in the film and woman and a scientist from the past, they will explore a a geologic time scale is included in each printed copy of little-known universe and meet fascinating animals such as the Educators’ & Activities Guide. It can also be downloaded the powerful Liopleurodon, the long-necked Elasmosaurus, from the official film website www.SeaRex-theFilm.com the “eye lizard” Ophthalmosaurus and the gigantic Shonisaurus. Thanks to state-of-the-art 3D CG images, see You will find a glossary detailing the scientific terms used in science come alive in a unique and entertaining manner. the Educators & Activities Guide at the end of this document, following Unit III.

Any questions and/or comments? Please contact us at [email protected]

This publication may be reproduced by teachers and educators for classroom use.

This publication may not be reproduced for storage in a retrieval system, or transmitted in any form by any means – electronic, mechanical, recording – without the prior permission of the publisher. Reproduction of these materials for commercial resale is strictly prohibited. 3 SEA REX: JOURNEY TO A PREHISTORIC WORLD © 2010 3D Entertainment Distribution Ltd. All rights reserved CURRICULUM

NATIONAL SCIENCE EDUCATION STANDARDS

Activity Grade Objectives Pages

Unit I - What are Marine Reptiles? Teeth and food 1-2 Students learn to infer what animals eat from the shape of their teeth. 20/21 A postcard from the Cretaceous 3-5 Students learn that some organisms have completely disappeared and others resembled those alive today. 22/23 What a fossil! 6-8 Students learn to establish a relationship with morphological characters. 24/25 Fossils and clocks! 9-12 Students learn how molecular clocks combined with fossil records are used to date the divergence between organisms. 26/27

Unit II - What is Paleontology? What is a fossil? 1-2 Students debate and propose experiments to answer this question: what is a fossil? 38 Sedimentation and fossils 3-5 Students learn moving water erodes landforms and the sediments bury dead organisms to become fossils. 39 How can fossils help date sediments? 6-8 Students learn how fossils help to date geologic layers. 40/41 What do you know about marine reptiles? 9-12 Students answer a quiz on marine reptiles and evolution. 42/43

Unit III - What a crisis! Which animal, which environment? 1-2 Students learn that different animals inhabit different types of environments and have external features related to these. 48/49 Paleo-food chain perturbation 3-5 Students learn that living organisms depend on one another and on their environment for survival. 50/51 Crisis? Did you say crisis? Not for everybody… 6-8 Students learn that the history of life has been disrupted by major catastrophic events. 52/53 Diversity in crisis... 9-12 Students learn how to analyze fossil evidence with regard to biological diversity and mass extinction. 54/55

POSTER INSIDE

Download this educational poster for classroom use featuring "The Cast of 'Sea Rex'" and Earth's Geological Time Scale at www.SeaRex-theFilm.com One complimentary copy inside each printed guide.

UNIT I - WHAT ARE MARINE REPTILES? 1.1. What are Marine Reptiles? ...... 6 1.1.1. Are marine reptiles dinosaurs? ...... 6 1.1.2. How to classify marine reptiles ...... 7 1.1.2.a. How to classify the living world...... 7 1.1.2.b. The history and classification of marine reptiles...... 8 1.1.2.c. Some marine sauropsids ...... 11 1.1.3. Their morphology...... 17 1.1.3.a. Diverse morphologies, diverse swimming styles...... 17 1.1.3.b. Teeth, skulls and diets ...... 18 1.1.3.c. Nares and breath...... 18 1.1.3.d. Reproduction ...... 19 1.2. Activities ...... 20

UNIT II - WHAT IS PALEONTOLOGY? 2.1. What is Paleontology? ...... 28 2.1.1. What is a fossil? ...... 28 2.1.1.a. How old is the Earth?...... 28 2.1.1.b. Time in Geology ...... 28 2.1.1.c. From burial to excavation ...... 29 2.1.1.d. Various kinds of fossils ...... 30 2.1.1.e. Tectonic plates and faunal distribution ...... 30 2.1.2. Paleontology and evolution history...... 31 2.1.2.a. Ancient discoveries and the Middle Ages...... 31 2.1.2.b. 17th century and the beginning of the Natural Sciences ...... 32 2.1.3. What is evolution? ...... 34 2.1.3.a. Organisms renew themselves over time ...... 34 2.1.3.b. How are characteristics transmitted? ...... 34 2.1.3.c. Natural selection ...... 34 2.1.4. The job of a paleontologist...... 36 2.1.4.a. What does it entail?...... 36 2.1.4.b. Discovery, excavation and preparation...... 36 2.1.4.c. Study ...... 37 2.1.4.d. Knowledge transmission and curatorial work ...... 37 2.1.4.e. How to become a paleontologist...... 37 2.2. Activities ...... 38

UNIT III - WHAT A CRISIS! 3.1. What a crisis! ...... 44 3.1.1. What is a biological crisis? ...... 44 3.1.2. Has this happened before? ...... 44 3.1.2.a. End Ordovician (445 MYA) ...... 44 3.1.2.b. End Devonian (360 MYA) ...... 44 3.1.2.c. Permo-Triassic crisis ...... 44 3.1.2.d. Triassic-Jurassic crisis ...... 45 3.1.3. The Cretaceous-Tertiary crisis ...... 46 3.1.3.a. What happened? ...... 46 3.1.3.b. Who disappeared? Who survived? ...... 47 3.1.4. And now? ...... 47 3.2. Activities ...... 48

Table of Illustrations & Additional Online Resources...... 56 Glossary ...... 57

1.1.1 ARE MARINE REPTILES DINOSAURS?

nlike the Cenozoic Era, which was dominated by mammals, They are exclusively terrestrial reptiles, and none were known to inhabit the Mesozoic Era was the age of reptiles (or more scientifically, marine or aquatic environments. Even if they were mainly found in the of sauropsids, see below). During this period, these animals same period of time as the dinosaurs, animals usually named “marine Upervaded all environments, with pterosaurs in the air, dinosaurs on reptiles” belong to various groups, and thus do not form a homogeneous land, and several groups of marine reptiles in the seas. As all of these group in classification. All these groups are more or less distant relatives creatures often reached large sizes, they are frequently all considered of dinosaurs. Today, reptiles are particularly scarce in marine environ- dinosaurs. But nothing could be farther from the truth. Dinosaurs form ments, being mostly represented by marine turtles and snakes, as well a biological group identified by several unique morphological charac- as by less-strictly marine animals, such as the salt water crocodile teristics, such as the head of a femur with a distinct neck and ball. (Crocodylus porosus), the marine iguana (Amblyrhynchus cristatus), and the water monitor lizard (Varanus salvator). [WHY IS “REPTILE” A PHYLOGENETICALLY INCORRECT GROUP?]

[fig. 1.a] A PARAPHYLETIC GROUP

Amniotes

Synapsids "Reptiles" Sauropsids

Mammals "Mammal-likereptiles" Turtles Monitor Crocodiles Birds b lizards

c a

The paraphyletic group Reptilia includes an ancestor (a) and some of its descendants, whereas the monophyletic groups Amniota, Sauropsida and Synapsida (grey boxes), each includes an ancestor (a, b and c) and all of its descendants.

In early classifications, groups were defined on the basis As such, the group Reptilia includes the common ancestor of extant animals (e.g., mammals, reptiles, birds, fishes) of monitor lizards, turtles, crocodiles, and mammals, and their anatomy. An animal could not belong to several but only a few of its descendants, excluding birds and groups. Reptiles, Reptilia, were originally described as mammals (dashed line, Fig.1.a). Reptilia is thus considered creeping animals and included lizards, turtles, and crocodiles, a paraphyletic group. To form a monophyletic group (based but did not include birds and mammals that formed distinct on an ancestor and all of its descendants), the only kind groups. Subsequently, mammal-like reptiles (a fossil group) of group recognized in the phylogenetic classification, were included in Reptilia (Reptiles, Fig. 1.a). Even though birds and mammals should be considered reptiles. This crocodiles, birds, turtles, mammals and mammal-like reptiles does not correspond to the original definition of Reptilia, share a common ancestor (Fig. 1.b), mammal-like reptiles are and therefore, this term should be abandoned. more closely related to mammals, while crocodiles are more closely related to birds than to turtles.

1.1.2 HOW TO CLASSIFY MARINE REPTILES 1.1.2.a HOW TO CLASSIFY THE LIVING WORLD

he classification of organisms is based on the relationships This characteristic thus defines a monophyletic group – a group they have amongst themselves: this is known as phylogenetic of organisms that descended from a common ancestor – named classification. These relationships are established by the Sauropsida (Fig 1.b.). Other shared characteristics define more inclu- creationT of a phylogenetic tree (a tree of relationships). To construct sive groups such as Diapsida (presence of dorsal and lateral apertures this tree, the morphological characteristics of the organisms are on the skull). The result is a tree, where the species are connected compared. For example, the presence of an aperture on the ventral side by their hypothetical common ancestors. In this classification, only of the skull is observed in turtles, monitor lizards, crocodiles, and monophyletic groups are considered. As a result, the classification primitive birds; however, it is absent in mammals and mammal-like reptiles. traces and follows the history of life and its evolution along with The presence of this aperture is a shared characteristic inherited from the history of the transformation of morphological characteristics. a common ancestor in which this trait appeared for the first time.

Liopleurodon - Plesiosaurs

[]ANCESTOR? DID YOU SAY ANCESTOR? The fossilization of an animal is a rare event, which even Scientifically, the placement of an identified ancestor on to be possible requires many conditions be met. The a lineage does not make any sense: how can we prove resulting fossil record provides a partial picture of the that one particular fossil species is really the direct history of life. If we compare the tree of life to an actual ancestor of another, and not an extinct lineage closely tree, only some of its buds, leaves, and fragments of related to this ancestor? Thus, the phylogenetic branches that have been scattered here and there are classification does not trace the relationships between fossilized, and only a portion of them have been discove- ancestors and descendants, but relative relationships: all red by paleontologists. There is low probability of finding ancestors remain hypothetical. Turtles are more closely fossils that would allow the reconstruction of a complete related to birds than to mammals because they possess branch. As for the real tree, there is low probability of a derived feature that they inherited from a close finding the direct ancestor of any one species. ancestor, which mammals do not bear. A species can be considered a sister species in relationship to another one. Also see figure [fig. 2.b] "From Life to Fossil".

1.1.2.b THE HISTORY AND CLASSIFICATION OF MARINE REPTILES

he classification of reptiles has greatly evolved since the first The nothosaurs were semiaquatic forms with elongated bodies and attempts to reconstruct phylogenetic relationships among necks and web-footed limbs; they were closely related to plesiosaurs. vertebrates. The word reptile (Reptilia), although still widely Like the placodont, they did not survive the end of the Triassic. Tused in popular language, is no longer used by scientists and has been A strange middle Triassic reptile, the prolacertiform Tanystropheus, replaced by the term sauropsid (Sauropsida) (Fig. 1.a). still remains a mystery to paleontologists. It had a rigid neck longer than its body and tail together, but its limbs were not particularly The sauropsids are divided into three main groups: the testudines, the adapted to a marine environment. While its lifestyle remains lepidosauromorphs, and the archosauromorphs (Fig. 1.b). obscure, it has only been found in marine sediments, suggesting a marine habitat and a fish-eating preference. The testudines include all turtles (terrestrial and marine forms), whereas the lepidosauromorphs include the ichthyosaurs, squamates The oldest ichthyosaurs are from the Lower Triassic. They had (mosasaurs, snakes, lizards), and sauropterygians (placodonts, nothosaurs, long, slender bodies and tails, and were highly dependent on nearshore plesiosaurs). Prolacertiforms and archosaurs (crocodyliforms, pterosaurs environments. The Middle Triassic forms were stockier, had fin-shaped and dinosaurs) form the archosauromorphs group. limbs, a dorsal fin and a shorter tail with a dorsal lobe like that of a fish, indicating increased adaptation to open-sea environments. Marine reptiles (or marine sauropsids), unlike dinosaurs, do not The Late Triassic is characterized by strong disturbances of the marine form a homogeneous group. They are comprised of distantly related environment. A huge marine regression reduced the nearshore animals that descended from terrestrial sauropsids and became environments, and led to a progressive extinction of many forms independently adapted to marine environments. They include animals dependent on this ecosystem, such as nothosaurs and placodonts. such as sea turtles, several crocodyliform groups (the crocodyliforms Probably due to the adaptation to the open sea of numerous forms include the extant crocodiles), mosasaurs, ichthyosaurs, and of the group, ichthyosaurs survived these environmental changes. sauropterygians (nothosaurs, placodonts, and plesiosaurs). Ichthyosaurs dominated marine environments throughout the Triassic and Early Jurassic, but their diversity drastically decreased during The first marine reptile was probably Mesosaurus, a small Permian the Late Jurassic, becoming scarce during the Early Cretaceous. The animal nearly 1 foot long (30 centimeters) found in South Africa and cause of their extinction at the beginning of the Upper Cretaceous Brazil. It is a particularly significant animal as its presence on two about 90 mya remains a mystery. continents, which are presently far from each other, presents a strong argument to support the continental drift theory (see section 2.1.1). The first known plesiosaurs are from the Latest Triassic. Together with thalattosuchian crocodyliforms, they became dominant marine Apart from this Permian occurrence, most marine reptiles are found predators during the Middle Jurassic. Plesiosaurs had a massive body, in Mesozoic strata (251-65 mya). The Triassic, the first Mesozoic period, short tail and large paddle-shaped limbs. They were large animals, is a key period of tetrapod evolution, as numerous major groups appeared whose size ranged from 7 to 65 ft, and are divided into two groups: on land, such as dinosaurs, pterosaurs, turtles, crocodyliforms, and the plesiosauroids, with a long neck and small head, and the mammals; whereas marine reptiles began to rule the seas. Placodonts, pliosaurs, with a short neck and long head. The pliosaur group nothosaurs and ichthyosaurs (three lepidosauromorphs) are the three included animals of various shapes that probably had different diets. main groups to diversify during the Triassic. Pliosaurs with long snouts and sharp elongated teeth were presumably fish-eaters, while those with short, robust snouts and massive teeth, Placodonts, whose name means “tablet teeth” due to their flat and such as Liopleurodon, possibly ate other marine vertebrates. tough teeth, were medium-sized animals (2 m / 6.5 ft) and are Plesiosauroids, such as Elasmosaurus, with their long, thin teeth, considered to be close relatives of nothosaurs and plesiosaurs. The ate fish and cephalopods. Plesiosaurs completely disappeared most primitive forms resemble the marine iguana, while the more recent during the Cretaceous-Tertiary (K/T) crisis. forms, such as Placochelys, have more superficial similarities with marine turtles (though they are not closely related), with dorsal and ventral armor formed by bony plates and semi paddle-shaped limbs.

Shonisaurus - Ichthyosaurs

[fig. 1.b] HISTORY AND RELATIONSHIPS OF MARINE REPTILES

Phylogenetic tree of the sauropsids, showing postulated Marine reptile names are in bold, their known fossil record is phylogenetic relationships of the main groups. depicted horizontally, whereas their relative abundance through time is represented by the thickness of this line. The crosses represent the extinction of the group.

rocodyliforms form a large group that includes modern-day Mosasaurs form a group of marine reptiles that appeared during crocodiles and many fossil forms with diverse morphologies. the Late Cretaceous (90 mya). They are closely related to the extant They appeared at the end of the Triassic and, while modern snakes and varanid lizards, and possessed an anguilliform body shape Cspecies are all semiaquatic animals, they have inhabited many kinds with paddle-shaped limbs. Mosasaurs and sharks were the dominant of environments throughout their history. predators of the end of the Cretaceous. Mosasaurs, including small nearshore piscivorous animals, large-sized predators such as At the beginning of the Jurassic, a group of marine crocodyliforms, Prognathodon, and shell-crushers such as Globidens, conquered the the thalattosuchians, appeared. The first thalattosuchians were likely seas and all ecological niches. They disappeared during the K/T crisis, nearshore animals, but a fully aquatic group of thalattosuchians, the together with plesiosaurs, non-avian dinosaurs and pterosaurs. metriorhynchids, appeared during the Middle Jurassic (170-160 mya). Their morphology, with paddle-like limbs, fish-shaped tip of the tail Marine turtles originated, like all marine reptiles, from terrestrial and an absence of armor scutes, is strongly adapted to marine life. forms. The oldest and most primitive turtle known is Odontochelys, Most were likely piscivorous, but one of the last members of this from the beginning of the Late Triassic of China. It had a reduced group, Dakosaurus (nicknamed “Godzilla”), with its strong crenulated dorsal carapace, a strong ventral plastron, and numerous teeth. While teeth, apparently preyed on large vertebrates. Odontochelys had limbs that resemble those of extant freshwater turtles, it appears to have lived in marine or deltaic environments. Other Two groups of crocodyliforms, the dyrosaurids and crocodilians, marine turtles appeared during the Late Jurassic and Early Cretaceous. appeared during the Late Cretaceous. Even though the dyrosaurids Turtles are divided into two groups: the cryptodires (their neck retracts were much less morphologically adapted to marine environments than in a vertical plane) and the pleurodires (their neck retracts in a metriorhynchids, most are found in marine sediments. Some crocodilians, horizontal plane). Among them, three groups adapted independently and in particular the forms closely related to the extant garial, are also to marine environments during the Mesozoic. present in marine environments. Even though they were poorly represented during the Late Cretaceous, dyrosaurids and crocodylians did not seem to suffer from the K/T crisis. Rather, they benefited from the disappearance of large marine reptiles, such as plesiosaurs and mosasaurs, to disperse and diversify.

Dakosaurus - Crocodyliforms

Download the companion booklet, "The Cast of Sea Rex", Plesiochelyidae and Chelonioidea (the group including all living marine at: www.SeaRex-theFilm.com. The 40-page document provides turtles), which are both cryptodire, adapted to marine environments information on each of the marine reptile-, flying reptile- and during the Late Jurassic and Early Cretaceous, respectively. In addition, dinosaur species you will encounter in the film and details a few species of Podocnemidoidae, a group of pleurodire, invaded the their most salient characteristics, such as the meaning of its seas during the Early Cretaceous. Their shell, as those of extant marine name, classification, the period during which it lived, geographic species, was often lighter than that of terrestrial forms. distribution, size, diet and other interesting details. Chelonioidea was the only group that developed true paddle-shaped limbs and invaded the pelagic realm. The extant leatherback turtle is related to this group. The largest known species is the Late Cretaceous (75-65 mya) species Archelon, which reached a size of 4- 4.5 m / 13-14.7 ft and weighed 2.2 tons / 4500 lbs.

Marine turtles were particularly diversified during the Late Cretaceous. Their high diversity during the Paleocene suggests that, as crocodyliforms, marine turtles were little impacted by the K/T crisis.

1.1.2.c SOME MARINE SAUROPSIDS

[ALLOPLEURON]

Name meaning: “different pleural plates.” Classification: Anapsida, Testudines, Cryptodira, Cheloniidae. Age: Late Cretaceous (Maastrichtian, 71-65 MYA). Geographic distribution: Belgium, The Netherlands. Total length: more than 2.5 m / 8 ft. Weight: estimated up to 500 kg / 1100 lbs. Diet: marine plants. [fig. 1.d] ALLOPLEURON - SKULL

Details: Allopleuron is a large turtle whose size is comparable to the leatherback turtle (2.5-2.7 m, 500-800 kg; 8-9 ft, 1100-1760 lbs). It appears frequently in sediments of the Late Cretaceous near Maastricht, The Netherlands. Some carapaces exhibit characteristic bite marks, which were likely produced by mosasaurs.

[fig. 1.c] ALLOPLEURON - SKELETON Premaxillary Naris Orbit bones

Pectoral girdle

The reconstructed skull of Allopleuron in dorsal and lateral view.

Apertures

The reconstructed skeleton of Allopleuron in ventral view.

[MOSASAURUS]

[fig. 1.f] MOSASAURUS - SKULL

Name meaning: “the Meuse River lizard”. Premaxillary bone Classification: Squamata, Mosasauridae, Mosasaurinae. Age: Late Cretaceous (Campanian-Maastrichtian, 84-65 MYA). Geographic distribution: North America, Europe, Middle East, North Africa. Skull length: up to about 1 m / 3 ft. Total length: about 15 m / 49 ft. Diet: cephalopods, fishes, marine reptiles.

Details: Mosasaurus is the first mosasaur described and one Teeth on the palate of the largest representatives of the group. The first near complete Mosasaurus skull was found between 1770 and 1774 Pineal foramen near Maastricht, The Netherlands. These remains were first considered to be of a crocodile. Historically, these fossils played an important role in the emergence of Paleontology and the development of the concept of extinction by the French anatomist Georges Cuvier.

Premaxillary bone Supratemporal Naris Orbit fenestra

[fig. 1.e] MOSASAURUS - SKELETON

Pectoral girdle Pelvic girdle The reconstructed skull of Mosasaurus in ventral, dorsal and lateral view. Note that the premaxillary bones are fused (only one premaxillary bone). The reconstructed skeleton of Mosasaurus in lateral view.

[OPHTHALMOSAURUS]

[fig. 1.h] OPHTHALMOSAURUS - SKULL Name meaning: “eye lizard.” Classification: Ichthyopterygia, Ophthalmosauria, Ophthalmosauridae. Pineal foramen Age: Late Middle Jurassic-Upper Jurassic (Callovian-Tithonian, 165-145 MYA). Geographic distribution: Wyoming, USA; United Kingdom, France, Russia. Total Length: About 5 m / 16 ft. Diet: fishes, squid and mollusks.

Details: Ophthalmosaurus possessed unusually large eyes relative to their head size (10 cm / 4 in. in diameter). These enormous eyes suggest that Ophthalmosaurus was adapted Premaxillary bones Supratemporal for low-light environments and likely used its eyes to locate Naris Orbit fenestra prey in the darkness of the ocean’s depths.

The reconstructed skull of Ophthalmosaurus in dorsal and lateral view.

[fig. 1.g] OPHTHALMOSAURUS - SKELETON

Pectoral girdle Pelvic girdle

The reconstructed skeleton of Ophthalmosaurus in lateral view.

[PLACOCHELYS]

Name meaning:“flat-plate turtle.” Classification: Sauropterygia, Placodontia, Cyamodontoidea, Placochelyidae. Age: Upper Triassic (Carnian, 229-216 MYA). Geographic distribution: Hungary. Skull length: 15 cm / 0.5 ft. Total length: 90 cm / 3 ft. Weight: unknown. [fig. 1.j] PLACOCHELYS - SKULL Diet: shellfish. Pineal foramen Details: contrary to most other placodonts, Placochelys do not have teeth on the anterior part of their jaws. It probably used its sharp rostrum to probe the muddy substrate and seize invertebrate prey in shallow marine environments.

[fig. 1.i] PLACOCHELYS - SKELETON Naris Supratemporal Premaxillary fenestra bones Orbit

The reconstructed skeleton of Placochelys in dorsal view. The reconstructed skull of Placochelys The pectoral and pelvic girdles cannot be seen on the in dorsal and lateral view. figure, but they are thin and elongated bones.

[NOTHOSAURUS]

Name meaning: “false lizard.” Classification: Sauropterygia, Eosauropterygia, Nothosauroidea, Nothosauridae. Age: Middle to Upper Triassic (Anisian-Carnian, 246–216 MYA). Geographic distribution: China, Israel, Italy, Germany, Romania, Spain, Switzerland, The Netherlands, Tunisia. Skull length: 12 to 75 cm / 5 to 30 in. Total length: up to 3 m / 10 ft. Diet: fishes.

Details: the Nothosaurus skeleton seems much more suited for [fig. 1.l] NOTHOSAURUS - SKULL locomotion in water than on land, so it probably spent most of its time in water though terrestrial locomotion was possible. Pineal foramen

Premaxillary [fig. 1.k] NOTHOSAURUS - SKELETON bones Supratemporal Naris Orbit fenestra

Pectoral girdle Pelvic girdle

The reconstructed skull of Nothosaurus The reconstructed skeleton of a nothosaurid in ventral view. in dorsal and lateral view.

[ELASMOSAURUS]

Name meaning: “plate lizard.” Classification: Sauropterygia, Eosauropterygia, Plesiosauroidea, Elasmosauridae. Age: Upper Cretaceous (Lower Campanian, 84-80 MYA). Geographic distribution: Kansas, USA. Skull length: about 60 cm / 2 ft. Total length: up to 14m / 46 ft. Diet: soft-bodied prey: crustaceans, cephalopods and small fishes. [fig. 1.n] ELASMOSAURUS - SKELETON

Details: Elasmosaurus has the longest neck of all plesiosaurs and is also the vertebrate with the highest number of cervical vertebrae with 72. However, paleontologists do not know how exactly it used its very long neck. Elasmosaurids were the last members of the plesiosaurs and disappeared during the K/T biological crisis, with dinosaurs and mosasaurs.

[fig. 1.m] ELASMOSAURUS - SKULL

Pineal foramen

Pectoral girdle

Premaxillary Supratemporal Gastralia bones fenestra Naris Orbit

Pelvic girdle

The reconstructed skull of an elasmosaurid The reconstructed skeleton of in dorsal and lateral view. Elasmosaurus in ventral view.

1.1.3 THEIR MORPHOLOGY

1.1.3.a DIVERSE MORPHOLOGIES, DIVERSE SWIMMING STYLES.

quatic adaptation of terrestrial animals requires strong morphological and physiological modifications. Examples of [fig. 1.o] SWIMMING STYLES these changes include: an increase or decrease in bone density, Atransformation of the limbs and sense organs, and even a total modification The arrows indicate the movement of the general body shape to facilitate movement in water. of the body while swimming

These adaptations are generally more limited in nearshore forms, and more prominent in open-sea forms, as can be observed today in various marine mammals (seals and whales). The nothosaurs had strong limbs and were capable of living both on land and in the sea, whereas the more transformed ichthyosaurs, with their fish-like tails and paddle- shaped limbs, were fully marine forms.

Many marine reptiles used their tail to swim, and several styles are THUNNIFORM : defined according to the relative stability of their body. Anguilliform Only the tail fin moves swimmers undulate their entire body, while thunniform swimmers move only the posterior part of their tail; the subcarangiform and carangiform swimmers are intermediate styles (Fig 1.o). Mosasaurs, nothosaurs, most crocodyliforms, as well as early forms of ichthyosaurs (such as Mixosaurus) possess long, slender bodies and tails and were thus probably anguilliform or subcarangiform swimmers. CARANGIFORM : Undulation of the tail The last forms of ichthyosaurs, such as Ophthalmosaurus, with their compact bodies and fish-shaped tails resembling living tuna, were probably fast swimmers. Their shape allowed for energy-efficient swimming at a steady speed, well suited to an open-sea lifestyle.

Placodonts, turtles, and plesiosaurs used their limbs to swim. Placodonts, with their incomplete paddle shaped limbs, foraged for mollusks and crustaceans near the sea floor, and were not powerful SUBCARANGIFORM : swimmers. Even though all groups of sea turtles used their limbs to Undulation of the entire body, swim, only the Chelonioidea had completely paddle-shaped limbs, head more stable which allowed them to live in open seas. Plesiosaurs used both their forelimbs and hindlimbs, which were approximately the same size, to swim. Whether these hindlimbs and forelimbs moved alternately or in synchrony when swimming is still debated by paleontologists.

All marine reptiles have limbs that are more or less transformed. Like ANGUILLIFORM : modern dolphins, ichthyosaurs used their limbs only to maneuver Undulation of the entire body when swimming. Ichthyosaurs’ limbs underwent dramatic changes throughout their evolution to become truly paddle-shaped: the arm/leg, manus/pes, and the finger bones became shorter and shorter, eventually disk-shaped, and the number of fingers and finger bones increased. In most mosasaurs, metriorhynchid crocodyliforms and turtles, The classification of swimming styles in fishes. the digits are long and the bones of the manus are disk-shaped. In The four categories are based on the degree of plesiosaurs, as the limbs are the main locomotors, the bones of the movement of the body: anguilliform swimmers undulate their entire body, whereas thunniform manus are flat, and the number of phalanxes in each digit is high. swimmers move only the posterior part of their body with the anterior part remaining steady. As of the Cretaceous, the chelonioidean marine turtles have elongated These various categories apply to marine reptiles. phalanxes in their forelimbs, their articulations having been lost and replaced by rigid and true paddles. They swim with powerful wing-like beats of their fore-flippers, while their rear flippers do the steering.

1.1.3.b TEETH, SKULLS AND DIETS

he stomach contents, predatory traces and shape of the During each period, each type was represented by marine reptiles. teeth and skull of all known Mesozoic marine reptiles The skull shape is also related to the type of diet. Ichthyophageous forms indicate that most were probably predators. They preyed have long, slender skulls; whereas crushers and predators of large prey Tupon various animals such as cephalopods, belemnites, ammonites, have more compact skulls that increase the pressure and resistance of fishes, sharks, and other marine reptiles. their jaws. The skull of mosasaurs has several particularities. Mosasaurs’ palates were endowed with numerous posterior curved teeth, which Four main predator types have been defined according maintained the prey in the mouth. As in extant snakes, most bones in to four tooth morphologies: their skull and jaw were not fused, but rather joined together with 1) the ichthyophageous have long, thin teeth; strong ligaments, facilitating the complete ingestion of large prey. 2) large prey- and other reptile-eaters have strong, cutting teeth; 3) those with blunt teeth eat thick-shell ammonoids and clams; and 4) generalists have medium-sized sharp teeth (Fig.1.p).

[fig. 1.p] TOOTH MORPHOLOGY AND PREY PREFERENCE

Triangular diagram illustrating the range Prey preference from top to bottom: soft cephalopod, of tooth morphology corresponding to the belemnoid, fish, armored fish and thin-shell ammonoid, triangular diagram of prey preference. thick-shell ammonoid and clams, large fish and reptiles.

1.1.3.c NARES AND BREATH [OSMOREGULATION AND SALT GLANDS ] As in terrestrial mammals, sauropsids’ external nostril is located at the In marine environments, animals need to regulate their tip of the snout. In marine mammals (cetaceans), it is much more posterior, body’s salt balance. In extant marine sauropsids, their being located on the top or back of the skull, along with the blowholes. This facilitates their ability to breathe on the surface of the water. kidneys are not efficient enough to excrete all excess salt. In extant crocodiles, salt is excreted through the tongue The nostril is also located more posteriorly in several marine sauropsids: (alligators cannot do this), whereas extant and fossil mosasaurs, plesiosaurs, and ichthyosaurs. This kind of feature is a developed marine turtles have modified lachrymal glands, each being characteristic strongly related to marine environments. It is thus not somewhat larger than the brain. In metriorhynchid surprising to find it in distant animals: this is called convergence (a common crocodyliforms, the presence of salt glands anterior to feature not inherited from a common ancestor). the eyes has been noted. Though they necessarily existed in plesiosaurs, mosasaurs and ichthyosaurs, the location of these glands remains unknown.

1.1.3.d REPRODUCTION

he extant marine sauropsids such as marine turtles are oviparous This proves that ichthyosaurs gave birth to their young tail-first, just like and thus return to land, sometimes painstakingly, to lay their extant cetaceans and sirenians (Fig.1.q), with the nostrils emerging last eggs. It is difficult to determine whether fossil marine reptiles to reduce the possibility of drowning . A mosasaur specimen from Twere oviparous, viviparous, or ovoviviparous, since the reproductive Slovenia which shows several embryos indicates that mosasaurs were behavior of extinct species cannot be observed directly. Fortunately, also ovoviviparous and gave birth to their young tail first. certain findings are of help. The ichthyosaurs’ reproductive method is the best documented of all marine reptiles. Numerous fossils of females Unfortunately, no pregnant plesiosaur female has ever been discovered of various species have been found with embryos in their bodies so so their ovoviviparity can only be inferred from their body morphology. their ovoviviparity is a certainty, at least for forms from the Middle Jurassic. Their rigid body and weight probably did not enable them to move on land. A nothosaur specimen with embryos was found, however, which Besides, it is hard to imagine these animals, which are highly adapted suggests that these close relatives of the plesiosaurs were ovoviviparous. to marine environments, returning to land to lay their eggs. Several Though this discovery strongly suggests that plesiosaurs were fossils show females with a baby positioned tail first in their pelvis. ovoviviparous, further discoveries are required to determine their reproduction mode with total certainty.

[fig. 1.q] A 185-MILLION YEAR OLD FOSSIL OF AN ICHTHYOSAUR GIVING BIRTH

Note that its young is born tail first.

[DID MOSASAURS HAVE A FORKED TONGUE? ] The tongue is a soft organ that is not preserved in fossils, which makes [fig. 1.r] A MOSASAUR PALATE AND A GILA MONSTER’S TONGUE reconstructing its shape in extinct forms a challenge. In extant squamates, the Two holes for the tongue has various morphologies, from Jacobson's organ large and unforked to thin and strongly (receptors for the odor particles collected forked shapes. In modern-day squamates by the tongue) the tongue participates in chemical reception. The same was likely also the case in mosasaurs and, as they are closely related to varanids and snakes, it is Gila monster assumed that they bore forked tongues, not like snakes, but more like modern Heloderma which includes the extant A mosasaur palate and a gila monster’s tongue, which is thought to have the same shape as that seen in mosasaurs. venomous lizards Gila monster and Mexican beaded lizard.

TEETH AND FOOD

OBJECTIVES: Students learn to deduce what animals eat from the shape of their teeth.

DURATION: 1 x 30 min. + 1 x 45 min.

MATERIAL REQUIRED: Pictures of animals/skulls from section 1.1.2.c: Mosasaurus, Ophthalmosaurus, Placochelys, Nothosaurus and Elasmosaurus; and pictures of their possible diets.

ACTIVITY: Students should associate the picture of an animal and its teeth with its diet. ☛ This activity should be done in two parts: the first prior to viewing the film, and the second after viewing the film. This will help students to gather more information during the film.

PREPARATION: 1/ Before viewing the film, the teacher should ask students questions about the shape of their own teeth, and their different shapes in relation to their function.

2/ The teacher distributes a copy of the identification file for each species cited above to each student.

3/ The teacher discusses with the students what each animal could eat with its type of teeth. The students take notes on each file, with different arguments supporting their hypothesis.

4/ After viewing the film, the teacher gives the students the picture opposite of the possible diet for each animal. Students correct their sheet based on what they saw in the film. The teacher discusses and poses arguments for or against the students’ corrections. The discussion may be extended to include a comparison with extant marine animals whose photographs are provided on the film website (section: Educators/Resources/Activities/Grade1-2/Teeth and Food).

NOTE TO TEACHERS: Remind the students that these animals are found in marine environments, and cannot eat anything other than what is found in the sea. Long, thin teeth are too fragile to eat animals with strong bones (see the “Teeth, skull, and diet” section in this guide). This activity can easily be adapted for higher-level students, who can determine the animals’ diets using the triangles of “Tooth function” and “Prey preference” presented in Fig.1.p.

A POSTCARD FROM THE CRETACEOUS

OBJECTIVES: Students learn that some kinds of organisms that lived on Earth have completely disappeared, and that some of those resembled other animals that are alive today.

DURATION: 2 x 30 min.

MATERIAL REQUIRED: A copy of “A postcard from the Cretaceous” for each student.

ACTIVITY: Students try to identify groups of animals in a picture, and determine if ☛ these groups still exist today. They will individually reconsider their initial assumptions following the film screening.

PREPARATION: 1/ Before viewing the film, a copy of a “Postcard from the Cretaceous” is distributed. 2/ Students try to identify the animals (their groups), and write a caption for the image. They should determine which one is still a living group. 3/ After the film, the activity is corrected and discussed by the students.

NOTE TO TEACHERS: The “postcard” comes from the Western Interior Sea that covered the center of North America (see section 2.1.1.e). All the animals depicted were found in the Smoky Hill Chalk of Kansas from the Late Cretaceous (Coniacian- Campanian, 87-82 mya).

The “postcard” gives a good idea of the fauna living in the same place at the same time. Bear in mind that all the species presented here have disappeared, but several belong to groups which still exist today. Students should note that the bird depicted has teeth.

You can find more information on this field at: North America and the Western Interior Sea www.oceansofkansas.com during the Late Cretaceous.

WHAT A FOSSIL!

OBJECTIVES: Students learn to establish relationships based on morphological characteristics.

DURATION: 1 x 30 min. + 1 x 45 min.

MATERIAL REQUIRED: The unidentified fossil on the following page; the identification files for the following species: Allopleuron, Ophthalmosaurus, Mosasaurus, Placochelys, Nothosaurus, Elasmosaurus; and the following table.

ACTIVITY: Students mimic the work done by paleontologists upon finding a new ☛ fossil. This activity can be done before or after activity 2.2.c.

PREPARATION: 1/ Before the film, ask students what a paleontologist should do when he finds a new fossil. 2/ Distribute the image of the unidentified fossil, as well as the instructions and anatomical glossary included below. 3/ Students answer question 1 below. 4/ After the film, distribute a copy of the table and the identification files of the species indicated in “materials required,” above. 5/ Discuss the different morphological characteristics of the species with the students. 6/ Students complete the table and answer questions 2 and 3 below. 7/ The teacher discusses why shared characteristics exist. 8/ Students try to develop a tree diagram below the boxes, and state the characteristics shared by the animals on the tree.

FOR STUDENTS: Instructions 1/ Write and add captions to the fossil image. Describe it: the shape of its limbs, its body, etc. What animal could it be? Why? 2/ After the film, complete the table, checking each feature on the list to see if it is present in the corresponding species. 3/ Complete the boxes, and draw conclusions on the relationships of the new fossil. To which group did the new fossil belong? Develop the tree below the boxes, and state the characteristics shared by the animals on the tree.

Anatomical glossary Pineal foramen: a single small hole in the center of the skull, beneath the orbits. Supratemporal fenestra: two apertures on each side of the skull, posterior to the orbits. Premaxillary bone: the anterior-most bone of the skull, forming the tip of the snout. There are two premaxillary bones forming each side of the tip snout. Pectoral and pelvic girdles: the bones that join the limbs in bodies; in humans, the pectoral girdle is formed by the collarbone and the shoulder blade (scapula), while the pelvic girdle is formed by the pelvis. Gastralia: the bones in the belly area (also called “abdominal ribs”).

NOTE TO TEACHERS: Students should discuss the criteria for classification (e.g. animals behaving in the same way, living in the same place, lacking specific elements such as invertebrates, etc.) in order to finally classify the animals in relation to what they have (morphological characteristics). The teacher should guide the conversation toward the concept of nest-boxes (students spontaneously form independent boxes) and to discovering why some characteristics are shared by different animals.

1 WRITE AND ADD CAPTIONS

2 COMPLETE THE TABLE

Allopleuron OphthalmosaurusMosasaurus Placochelys Nothosaurus ElasmosaurusNew fossil 1 Only one coronoid bone on the mandible

2 Nares located posteriorly, and not at the tip of the snout

3 Presence of a pineal foramen

4 Presence of supratemporal fenestrae

5 Supratemporal fenestra longer than the orbit

6 Supratemporal fenestra at least twice as long as the orbit

7 5 teeth on the premaxillary bone

8 Long neck with more than 10 cervical vertebrae

9 Very long anterior and posterior paddle-shaped limbs and of nearly the same length

10 Pectoral and pelvic girdles in form of large plates

3 COMPLETE THE BOXES

One coronoid

Allopleuron

FOSSILS AND CLOCKS!

OBJECTIVES: Students learn how molecular clocks, combined with evidence from fossil records, can help determine how long ago various groups of organisms diverged evolutionarily from others.

DURATION: 60 min

MATERIAL REQUIRED: The tables on the following page.

ACTIVITY: Students work in groups, provide a report to their teacher, and present their work to the whole class. Each group is given an unknown fossil, which they are asked to identify and propose a classification for along with several other species and groups, including living species. ☛ The molecular clocks are calculated by the students from DNA sequences, and they should use these to estimate how long ago the groups diverged as a result. All the information, such as the morphological characteristics they may use to build tree relationships and anatomical comparisons, is provided in the educational section of the film website.

PREPARATION: 1/ Students work in groups. 2/ Distribute the instructions (provided below) for the exercise. 3/ Discuss with students what molecular clocks are, and how they can be used with fossils. 4/ Students will find all the necessary information on the film website. 5/ Students have at least three weeks to draft a short report on fossil classification, and to provide a tree diagram calibrated with molecular clocks.

INSTRUCTIONS FOR STUDENTS: Phylogenetic analysis 1/ Download images of the fossils to be studied 2/ The fossils allow you to know the age of divergence between several at www.SeaRex-theFilm.com groups (see table). For example, the existence of fossils more closely 2/ Choose a fossil from the “New Fossil” list. related to Varanus, 125 million years in age, suggests a divergence with 3/ Write and add captions to the figure of the fossil. Iguana groups previous to this date, i.e. 130 million years ago. 4/ Complete the Features/Species Tables. Download "The Cast of With these ages, calculate the ratio of the sequence divergence with the Sea Rex" at www.SeaRex-theFilm.com which provides you all known age for Emydura/Lepidochelys, Varanus/Iguana, and Alligator/Corvus, necessary information to help you complete the table and complete the table. This is the calibration of that particular molecular 5/ Using this completed table, develop the phylogenetic relationships. clock (you will have obtained the rate of sequence change in both Insert the names of the groups at the level of divergences. Which group lineages; assuming that these rates of evolution are equal for both does the new fossil belong to? lineages, divide this rate by two to obtain the rate for one lineage). 3/ Assuming that the rate of evolution is equal in all sauropsid Calibration lineages, calculate the estimated age of divergence between 1/ To calibrate a molecular clock, the rate of divergence for a period Varanus/Alligator and Varanus/Emydura. of time for common DNA sequences should be calculated. To do this, 4/ Draw the phylogenetic tree diagram you obtained in the first part short sequences are provided below. Count the number of differences calibrated with the result of the molecular clocks on a geologic scale. between the sequences for these pairs of species: Emydura/Lepidochelys, 5/ Collect information on the group your new fossil belongs to, such Varanus/Iguana, Alligator/Corvus, Varanus/Alligator, Varanus/Emydura; as its history, evolution, etc., and write the results of your work in a and reproduce them in the table. Calculate the percentage of divergence short report that you will present to the class. between each pair of species, and complete the table.

NOTE TO TEACHERS: Calibration: Number of differences: 20, 18, 30, 34, 39; Sequence Phylogenetic analysis: Note that the left and right premaxillary bones divergence: 25% (20 x 100/80), 22.5%, 37.5%, 42.5%, 48.75%; are fused in mosasaurs (Mosasaurus) and birds (Corvus). This Ratio: 0.17 (Sequence divergence/Age of divergence=25/150), 0.17, morphologic characteristic, which has been acquired independently 0.15; Age of divergence: Varanus/Alligator: 265.6 mya (42.5/0.16), in both groups, is known as convergence. Varanus/Emydura: 304.7 mya.

FEATURES TABLE EmyduraLepidochelysMosasaurusVaranusIguana TeleosaurusAlligatorAllosaurusCorvus New fossil 1 Only one coronoid bone in the mandible

2 Body enclosed in a shell

3 Presence of a shell with numerous apertures

4 Presence of supratemporal fenestrae

5 Presence of a pineal foramen

6 Fused premaxillae (one premaxilla)

7 Elongated naris reaches at least 25% of the skull length

8 Two rows of teeth on the palate

9 Presence of a mandibular fenestra

10 Presence of dorsal osteoderms

11 Posterior limbs vertically oriented

DNA SEQUENCE ALIGNMENTS 121 Emydura ACTAGCAACGGATACCATAG GTATATCTAGGCTACATTGT Lepidochelys ACTAACAAAGGACGCCGTAG GTACGTCTTGGCAACATTGA Varanus CATAACAAAGCACGCAGTAG GCGCGTATTGACAACCTTGA Iguana CAAAACACAGCACTCAGTCG GCGGCTATTGACACTGTTGA Alligator CATCCAAAACCAAACCTAAG GCGTCCATTCAATACAATGA Corvus CATAACAAGGCAAGCCGAGG GCGAAAATTCACCAAACTGA 41 61 Emydura TAGCTTACCGATAGTACTGG TGACTCTAGAATGCCTAGTC Lepidochelys TCGCGTCGGGATAGTACTGG TGAATATAGACTGCCTCATC Varanus TCGCGTCGGGACGACGCTGG TGAATATCTACTAAATCATC Iguana TCGAGTCGGGGGGAAACCAG TGCCTATCTACTAAATCATC Alligator TAACGATTGGACGGGGCAGC TGAACCTCTGGAATACCATA Corvus TAAAAACCGCCCGGGACAGC TGTTCCTCAACAATCAAATA

SPECIES TABLE

Number of Sequence Age of divergence Ratio differences divergence Emydura/Lepidochelys % 150 million years Varanus/Iguana % 130 million years

Alligator/Corvus % 252 million years Varanus/Alligator % million years Varanus/Emydura % million years

2.1.1 WHAT IS A FOSSIL?

2.1.1.a HOW OLD IS THE EARTH? The Earth is approximately 4.5 billion years old. Unfortunately, its age cannot be calculated directly from its rock materials, since erosion and [fig. 2.a] GEOLOGICAL TIME SCALE tectonic activities have completely destroyed its earliest surface. The oldest rocks found date from about 3.8 billion years ago: the Earth, then, must be at least as old as these rocks. To complete this information, scientists study material from other planets and meteorites, assuming that all planets and other solid bodies present in the Solar System were formed at the same time and that their age is the same.

Scientists do not know precisely when life appeared on Earth. The oldest known fossils are about 3.5 billion years old, but the earliest ones are scarce and hardly identifiable. Complex organisms with hard parts that are more likely to be preserved only became common during the Cambrian Period (about 600 mya).

2.1.1.b TIME IN GEOLOGY eologists classify rock strata according to a “geological time scale”. The rocks found in each stratum were formed in a certain geological period and are named accordingly. The time scale Gproduced by scientists divides Earth’s history into major units, with the oldest rocks usually at the very bottom. Its history is divided into eras: Achaean, Proterozoic, Paleozoic, Mesozoic and Cenozoic, and each era is subdivided into periods. For example, the Mesozoic Era is divided into three periods – Triassic, Jurassic and Cretaceous – and the start date for each period is given in “millions of years ago” (mya). Each of these periods is also divided into several smaller parts named “stages”. Two main methods are used to establish this time scale: radiometric dating and stratigraphic dating.

The radiometric method provides relatively precise absolute ages for the rocks researched by measuring the amount of weakly radioactive elements naturally present in igneous rocks. It is based on a comparison between the observed abundance of a naturally occurring radioactive element and its decay, which in turn produces another element (for example, the disintegration of Potassium40 into Argon40) in a known period of time called “half-life”. Using this method, a precise date of the formation of the element can be determined. However, this method can generally only be applied to igneous rocks, such as volcanic ash or lava, and cannot be applied to fossil-bearing sediments that do not contain freshly formed volcanic material.

As most fossil-bearing sedimentary strata are devoid of any volcanic material, geologists also use fossils to assign an age to sedimentary rock. This method, known as stratigraphic dating, is based on the assumption that fossil specimens of the same species lived at the same time. Each stratum (layer of limestone, mudstone and sandstone) includes fossils of organisms that were alive when the stratum was formed. Finding similar fossil species on different continents makes it possible to correlate the ages of rock strata around the world. As this method only gives the relative age of the rocks, determining the absolute age of any given sedimentary rock requires locating and dating (with MYA: Million Years Ago radiometry) intercalated volcanic ash within sedimentary strata.

2.1.1.c FROM BURIAL TO EXCAVATION

ossils are the remains of ancient living organisms buried in These conditions are most often encountered in aquatic environments sediments (mainly mud and sand), and preserved through such as oceans, rivers or lakes, where water may carry large quantities natural processes. Fossilization is a very slow process that can of sediment. The remains of ancient living organisms, buried under Ftake up to several thousands of years. Organisms usually decay rapidly thick layers of sediment, are transformed into stony fossils (minerals after their death, but sometimes their remains may be partially preserved invade the bone or woody cell spaces, converting the remains into in rocks as fossils. For fossilization to even be possible, numerous stone). Most of the time, only the hard parts of organisms are preserved. conditions must be met. As such, it is an exceptional event, and only low rates of dead animals are fossilized. However, sometimes exceptional environmental conditions may lead soft tissue such as skin, feathers, or even internal organs like intestines The main conditions required for fossilization to take place are: an to be preserved. Millions of years later, earth movements and erosion absence of scavengers and bottom current for bone dispersal, a rapid (rain, frost and running water) can bring the fossil to the surface, burying process and water with an anoxic bottom, which reduces the where it may eventually be found by a scientist or a lucky collector. presence of micro-organisms that destroy soft tissue and bones.

[fig. 2.b] FROM LIFE TO FOSSIL

1 2

Death Decay and burial The plesiosaur reaches the end of its life and dies. After several weeks the plesiosaur is partially decomposed. Its body sinks to the seafloor. The soft body parts decay and rot very soon after death. The hard body parts, such as bones, are all that remains. The marine reptile can only become a fossil if it is rapidly covered over by sediment.

3 4

Sediment accumulation and permineralization Uplift, erosion and exposure Over time the skeleton is gradually buried deeper by accumulating Many millions of years pass and the rock remains buried deep sediment. Slowly, the weight of the sediment compacts the within the bedrock. However, tectonic forces may uplift the underlying areas, pressing the grains together, driving excess water bedrocks, raising it above sea level and exposing it to erosion. out, depositing minerals in the pores, and ultimately turning the soft Gradually, the exposed rock is stripped away until eventually sediment to hard rock. Minerals contained within the water-saturated the top of the plesiosaur's skull is visible at the surface. sediment replace the original minerals in the skeleton through a process called permineralization.

2.1.1.d VARIOUS KINDS OF FOSSILS

he most frequent fossils are mineralized body parts such as • Plants: they are also found as leaves, trunk portions, seeds, fossil shells, teeth, calcareous or siliciferous biological constructions prints, or sometimes as carbonaceous deposits. Their large accumulation and bones, but there are in fact numerous types of fossils: is responsible for the origin of coal and hydrocarbons. T • Prints: footprints provide particularly important data on the locomotion • Microfossils: some micro-organisms such as foraminifers, ostracods of extinct forms (bipedalism, speed, etc.). and calcareous algae have an external or internal skeleton. Their • Coprolites: these are fossilized animal dejections. In certain cases, accumulation on the ocean floor can produce calcareous rock of they make it possible to study the diet of extinct animals. great thickness (such as limestone and chalk). • Eggs: the eggshell can be preserved but if the associated embryos • Shell, biological constructions: some mollusks have an internal or are not preserved, it is often difficult to attribute an egg to a particular an external shell that can eventually be preserved. Shell fossils are some species or group. When the embryo is preserved, it is particularly of the most frequent. Bacteria, sponges, cnidarians or other micro- significant for our understanding of the development of extinct groups. organisms can create constructions and reefs that are often preserved. • Organs, skin, feathers, scales, and fur: the non-mineralized parts • Teeth: as the most mineralized part of the vertebrate body, teeth are rarely fossilized but skin, feathers and fur prints are occasionally are the most frequent fossilized vertebrate remains. The cartilaginous preserved. The presence of a dorsal fin in ichthyosaurs, or early feathers skeleton of the chondrichtyans (sharks and skates) is less mineralized in theropod dinosaurs, was established by well-preserved soft tissues. than the bony skeleton of osteichthyan fishes; sharks are thus often • Pollen: when preserved, it is an excellent indicator of the paleoclimate. known by their teeth, frequently their only preserved remains. Small • Amber: amber is fossilized tree resin. Occasionally insects and animals with fragile bones, such as the first mammals, are also often exceptionally small vertebrates are trapped in this resin and only known by their teeth. preserved as incrusted parts of the amber. • Bones: most of the bones found are isolated remains. Contrary to what most people believe, discoveries of complete skeletons are rare.

2.1.1.e TECTONIC PLATES AND FAUNAL DISTRIBUTION

The world has not always resembled the world of today. As the As the sea level was higher than it is today, the central part of North continents are constantly in motion due to the action of plate tectonics, America was covered by a large sea called the Western Interior the appearance of the Earth changes very gradually. Earth's surface is Seaway, which was linked to the Gulf of Mexico in the south and the made up of a series of large plates (like pieces of a giant puzzle). Hudson Bay and Beaufort Sea in the north. The constantly changing These plates move steadily in slow motion, traveling a few centimeters geography of the world drove the evolution of both marine and in a year. When two plates collide, they can either form mountain terrestrial faunas. As marine reptiles can disperse around the world ranges or one can slide beneath the other. This creates areas of more easily, the same genera can be found in Europe, Africa (Tethys intense earthquakes. When the plates move apart, molten mantle Ocean) and in South and North America (Western Interior Seaway, rocks rise between them, causing the sea floor to spread outwards. Pacific, Atlantic). However, terrestrial faunas have generally evolved independently on isolated continents, so that very different species About 250 million years ago, at the beginning of the Triassic period, and genera are found on each continent. all continental plates were joined together and formed a supercontinent (almost all land surfaces were joined together) that is now known as When examining a world map, one can imagine how today's continents Pangaea. The east of Pangaea was separated by an ocean called the might once have fit together to form the ancient continent of Pangaea. Tethys Ocean. At the beginning of the Jurassic period, approximately The faunal distribution of the past was largely controlled by the position 200 million years ago, Pangaea started to split apart into two large of the continents and oceans. As such, terrestrial and marine faunas land masses: Laurasia in the north (North America, Europe, Asia) provided strong support for the continental drift theory. Mesosaurus and Gondwanaland in the south (South America, Africa, India, was a small Permian marine sauropsid whose fossils are found in South Australia, Antarctica). The Tethys connected to the Pacific through Africa and Brazil. Since this animal was too small to cross the large the opening of the Central Atlantic Ocean. The South Atlantic South Atlantic Ocean, scientists deduced that Africa and South America Ocean then opened during the Cretaceous. were still joined together during the Permian period (320-280 mya).

[fig. 2.c] MESOSAURUS AND THE CONTINENTAL DRIFT

Africa South America

The complementarity of the geographic distribution of the small Permian marine reptile Mesosaurus in South Africa and Brazil was one of the arguments that German scientist Alfred Wegener (1880 - 1930) used to support his continental drift theory in 1912.

2.1.2 PALEONTOLOGY AND EVOLUTION HISTORY

he existence of fossils has been known for a long time, but their real origins remained mysterious until the end of the 18th century. Throughout the history of biology and paleontology there were not one but several theories of evolution in competition, yet only T one currently remains: the neo-Darwinian theory of evolution. 2.1.2.a ANCIENT DISCOVERIES AND THE MIDDLE AGES

Traces of fossils have been found in French prehistoric sites, where The Chinese scientist Shen Kuo (1031-1095) was the first to propose they were used as ornaments. During Antiquity, several Greek a hypothesis about the formation of the Earth and the seas based on philosophers mentioned the observation of fossils. Anaximander his observation of fossils. From marine fossils found in strata, he deduced (610-547 BC) deduced the existence of ancient seas that had been that the Earth was remodeled by the sedimentation of mud, and the “burned” by the sun by the presence of shells in mountains. Aristotle, erosion of mountains. He also proposed the first paleoclimatic obser- Theophrastus, Pythagoras and Herodotus also tentatively considered vation, with the presence of fossil bamboo in a location where the the presence of ancient seas based upon fossils. Pliny the Elder climate was not suitable to the plant’s survival, and suggested that imagined that fossil shark teeth had fallen from the sky or the moon, the climate was different during ancient times. and named them “glossoptera” (tongue stone). He was also the first to name fossils “ostracites” (oyster-shaped) and “spongites” (sponge-shaped). In Europe, fossils are considered petrified living forms or natural artifacts (Agricola, 1494-1555; Martin Lister, 1638-1712). During the 17th century, fossils were recognized as ancient living forms [fig. 2.d] ANCIENT DISCOVERIES with the belief that all the forms disappeared at the same time as the biblical deluge. Science and fossils were recognized in relation to religion until the 18th century. The natural world was considered to be unchanged and ordered according to the will of the Creator.

A fossil depicted on a Greek vase (560-540 B.C.). Note that the monster emerges from the cave and has a sclerotic eye ring.

2.1.2.b THE 17TH CENTURY AND THE BEGINNING OF THE NATURAL SCIENCES

n the 16th-17th centuries, cabinets of curiosities appeared The study of fossils strongly modified the perception of the history of in Europe, and aristocrats, some merchants and early life. Due to the succession of different fossil faunas, Georges Cuvier “scientists” created collections in the form of primitive considered that the history of life was impacted by dramatic events; Imuseums. These collections were often heteroclite, assembling intense catastrophes that cause numerous species to become extinct. fossils, animals, plants, minerals, etc. Between these brutal “revolutions,” new populations appear through migrations. This theory is named Jean Marchant (1650?-1678) [fig. 2.e] FIRST “MUSEUMS” “catastrophism”. The discovery was the director of the Jardin du of the extinct large mosasaur Roi in Paris and in 1617 suggested confirmed his view (see box). that plant species from the same genus could have a common Jean-Baptiste Lamarck (1744-1829) origin. He was likely the first to did not consider the existence of ever consider “anomalies” (the these “revolutions,” but suggested word and concept of mutation that environmental modifications was unknown) as a possible origin cause morphological transforma- for the transformation of species. tions, which are transmitted to descendants. To explain the Benoist de Maillet (1656-1738) continuity between some fossils considered that the transformation and extant forms, he suggests a of a species was caused by transformation of species over hereditary modifications (1748). time. Three main points are He supposed that life was born in developed in Lamarck’s theory: the oceans, which were present the inheritance of acquired traits; everywhere, and that their with- the function creates the organ; drawal forced certain animals to and life becomes more complex. adapt to life on land. Humans would In his theory, the use or non-use therefore have had their origin in Doctor Ole Worm’s (1588-1654) cabinet of curiosities of an organ due to environmental these animals, and thus in fishes! in Copenhagen (Denmark). conditions causes the development or decline of this organ, which The first person to really work is transmitted to descendants. on animal heredity was Pierre Louis Moreau de Maupertuis (1698- The inheritance of acquired traits is a particularly important concept, 1759). He suggested a transformation of species based on “anoma- one that endured until the end of the 19th century. lies” (mutations) and individual morphological variations that appeared randomly in nature, which could be transmitted to descendants. Even though previous scientists had seen the presence of an He stated the first hypothesis on the transformation of species in evolution of the species, none could explain its mechanisms. 1754 as follows: “…how could the multiplication of the most dissimilar Charles Darwin provided an explanation with his theory of natural species have sprung from just two individuals? They would owe their selection (1859). Darwin’s arguments were developed as follows: origin to some fortuitous productions in which the elementary parts (reproductive particles) have not preserved the order they had in 1/ organisms vary (within the same species, individuals vary; this is their mother and father: each degree of error would have produced the intra-specific variability); a new species: with the increase of divergence came the infinite animal diversity we see today; it will maybe increase with time.” For 2/ the variations can be transmitted to descendants, and can be selected this author, all animals would originate from the same ancestor. by humans (this is artificial selection, used by horticulturists and cattle- breeders; humans modify the composition of the species cultivated or bred); Progress also came from the study of animal development. Karl Ernst von Bear (1792-1876) studied embryology and considered that the first 3/ the environment creates a natural selection (more individuals that periods of development were similar in numerous groups, yet their can survive with the available natural resources are born; individuals morphology diverged quickly afterwards. This demonstrated a common are thus in competition with one another for survival; within the varia- origin for the organisms. It wasn’t until 1778 that a fossil was recognized tion in species, those that for some reason have an advantage due to as being from an extinct species, by the French naturalist Georges the environment, leave more descendants than other variations); Buffon (1707-1788). This “first fossil” is the American mastodon, Mammut americanum, which earlier had frequently been thought to 4/ at the species level, natural selection produces a transformation belong to “giants”, and was described as a “lost species” by Buffon. of the species (the inheritable feature of advantaged individuals becomes dominant in the population).

The next step of progression in the knowledge of evolutionary A new species appears suddenly through a single mutation: this is mechanisms occurred thanks to the discovery of genetics. known as saltationism. De Vries rejected the role of natural selection in the appearance of new species. In 1865, the botanist Johann Gregor Mendel (1822-1884) proved the inheritability of morphological characteristics with his work on the pea After 1910, advances in the genetics of populations and study of fruit plant. Later, in 1883, August Weissmann (1834-1914) definitively flies provided a new synthesis of the “neo-Darwinian” theory of evolution: rejected Lamarck’s theory of the inheritance of acquired traits, and, in mutations happen randomly; evolution is defined as the modification 1901, Hugo de Vries (1848-1935) suggested the concept of genes, of frequency of these mutations under the effects of natural selection. and introduced the terms gene and mutation in the theory of evolution.

[GEORGES CUVIER (1769-1832) ]

Paleontology was really born with Georges Cuvier. He popularized comparative anatomy, a science comparing the anatomy of species, and used it to study fossils in the light of extant species to determine their classification. He used this method with the first marine reptile ever described: a mosasaur found in Maastricht (the Netherlands) and confiscated by the French revolutionary army. He compared the anatomy of its skull with extant forms, and in 1808 proved for the first time the existence of extinct giant reptiles, sixteen years before the first description of a dinosaur by William Buckland in 1824.

[]MARY ANNING (1799-1847)

In England, during the same period, Mary Anning (1799-1847) discovered the first complete fossil of an ichthyosaur (1810). She was twelve years old, and collected fossils to sell them and support her family. Her next two major discoveries, in 1828, were a complete plesiosaur skeleton, and the first pterosaur found outside of Germany. Some months before her death, she was appointed honorary member of the Geological Society of London, and thus became the first female member of this prestigious society despite the fact that only men were permitted.

2.1.3 WHAT IS EVOLUTION?

2.1.3.a ORGANISMS RENEW THEMSELVES OVER TIME

he study of fossil records shows that organisms renew themselves Through these crises, numerous species, and sometimes complete over time: the life of a species has, on average, a one million groups, disappear simultaneously and somewhat abruptly. It is often year time frame. Species appear and disappear continually, difficult to assess the length of a crisis; what appeared as a sudden Tmainly through local or regional environmental, geographical and occurrence in a fossil record, could have taken thousands or millions climatic variations, or simply because of their replacement by another of years. These crises are followed by an explosion of diversity. The rival species. More general modifications, however, regularly disrupt new groups that appear are not unrelated to those from the previous their life, causing crises of greater or lesser severity. period, but are often marginal groups.

2.1.3.b HOW ARE CHARACTERISTICS TRANSMITTED?

The morphology of individuals, and thus their genetic characteristics, which are not strictly identical (i.e., variations), enables evolution to occur. Mutations are the first driving force of evolution.

They appear randomly in the genetic material of an organism and, as they are coded in the genome, can be transmitted to descendants. These mutations can affect organisms in their anatomy, morphology, physiology, behavior, etc.

2.1.3.c NATURAL SELECTION

The second driving force of evolution is natural selection. Mutations Stephen Jay Gould and Niles Eldredge developed and completed can be beneficial, harmful or neutral for organisms. Individuals who the theory with the concept of punctuated equilibrium to explain the undergo helpful mutations survive better than others, reproduce presence of apparently stable species during long periods of time, more and gradually become the majority. How a mutation is beneficial, punctuated by the sudden appearance of a new species (speciation) harmful or neutral can depend on environmental and external conditions. in their fossil record. If the stable period is interpreted as a period of Most mutations are neutral, but can become helpful or harmful if the equilibrium between the species and its environment, speciation environmental conditions or other kinds of pressures vary. occurs from small populations that are separated during a period of time from their original population (by a new mountain range, forest, For example, the mutation that caused DDT resistance in mosquitoes was lake, new environment, or migration). neutral and appeared only by chance. Individuals with this mutation were rare, but with the general use of DDT, only individuals who underwent The small population, isolated from the original one, can evolve inde- this mutation survived, rapidly becoming the majority. Successive pendently and faster, changing genetically and morphologically to selection and addition of numerous mutations can lead to a new species. become a new species. When it extends its territory or is again in contact with the original species, the new species may replace it. In If the environmental variation is too drastic, or if the beneficial mutation the geologic timescale this replacement seems to be sudden. If is not present in the population, the progressive selection cannot during the stable period the species seems unchanged, this does not occur, and the population (or species) disappears. Moreover, a mutation mean that it did not evolve. In fossils, only bones or shells are seen, is helpful at a period of time within a particular environment, but can and these are dictated by only 5 percent of an animal genome; the be harmful later, due to a variation in this environment. other 95 percent can evolve without being detected in fossils.

Hazard/natural selection accompanies evolution: generation after generation, selection embraces various viable solutions in relation to morphological, functional, phylogenetical and environmental constraints.

[fig. 2.f] NATURAL SELECTION

1 2

Variation within the species (intraspecific variability). Differential reproduction. For example, some mosquitos are DDT-resistant (grey mosquitos). In this example, non DDT-resistant mosquitos are killed or survive to reproduce less often than DDT-resistant mosquitos do.

3 4

Heredity. Result. The surviving DDT-resistant mosquitos have DDT-resistant The more advantageous trait, DDT resistance,which allows the baby mosquitos because this particularity has a genetic basis. mosquitos to have more offspring, becomes more common in the population. If this process continues, eventually all individuals in the population will be DDT-resistant.

DDT (dichlorodiphenyltrichloroethane) was created as the first of the modern insecticides early in World War II. Now banned in many countries, it was initially used with great effect to combat malaria, typhus, and the other insect-borne human diseases among both military and civilian populations.

[]THE CONCEPT OF “ADAPTATION” The concept of adaptation is often misunderstood. All morphological traits are not necessarily adaptive. They Organisms do not really adapt to new circumstances as can be the result of physical constraints (the selection in if it were an active and conscious choice; in general, a Darwin’s finches concerns the size of the beak but, in mutation that increases the chances of an organism’s order to bear a large beak, their heads and thus their survival of an environmental variation does not appear bodies must be larger; a modification in one part of the due to this selective pressure. Instead, it is selected in the body can induce other modifications in the body); or the population where this mutation was present by chance result and remains of an organism’s history (the phrenic (this must be balanced, as recent research suggests there nerve that controls the diaphragm in humans does not go is an increase of mutations in stressor conditions, increasing through the vertebrae;it comes directly from the base of the chances of appearance of a mutation, and thus the skull. This complex passage is inherited from osteichthyan of beneficial mutations in bacteria and cells). fish ancestors, where the gills are close to the skull).

2.1.4 THE JOB OF A PALEONTOLOGIST

2.1.4.a WHAT DOES IT ENTAIL?

aleontology is the study of fossilized remains (any fossils: plants Most people think that paleontologists spend the majority of their or animals) found in geological formations. Our knowledge of past time in the field searching for or collecting fossils. Although fossil life on our planet is the result of more than 200 years of collection is undoubtedly essential for further study, professional Ppaleontological research. Professional paleontologists may specialize paleontologists usually spend most of their time in museums or in one specific field, for example in the study of fossilized plant remains universities studying and describing their discoveries. Additionally, (paleobotanist), micro-organisms (micropaleontologist) or animals paleontologists may spend a large amount of their time teaching possessing backbones (vertebrate paleontologists, like Drs. Bardet, students, as well as preserving fossils in good condition and writing pro- Gasparini, Kear, Motani and Rieppel, who are portrayed in the movie), jects for funding, as fieldwork generally involves large teams working which include dinosaurs and marine reptiles. Some use fossil records to over several weeks and thus requires considerable financial support. reconstruct the biology, diversity and evolution of the fossil groups studied and, therefore, mainly concentrate on anatomical aspects of the fossils.

Other paleontologists may focus on the age of sedimentary rocks or ancient climate conditions, and will therefore use collections of fossilized plants or animals to narrow down the age of rocks (biostratigraphy) or characterize past environmental conditions (paleoenvironments).

2.1.4.b DISCOVERY, EXCAVATION AND PREPARATION

Fossil discovery is often the result of chance and a large number The hunter carefully digs out the rock around the fossil so that part of specimens kept in museum and university collections have been of the sediment pod encompassing the fossil is conserved. Bones are found by “lucky” amateur collectors. Paleontologists do not search sometimes covered by tissue or paper before being enclosed in plaster. for fossils randomly; they usually concentrate their exploration on Once the plaster has dried, the fossil-bearing block is removed form localized areas. How do they choose the areas? Paleontologists the surrounding rock and brought to the laboratory for further search for fossils where sedimentary rocks are exposed and thus preparation and cleaning by lab specialists. easily accessible (quarries, mines, building excavations, deserts, sea cliffs, etc.). They first use geological maps to locate the appropriate Tiny fossil teeth, bones and invertebrates are easy to remove and rocks that may contain fossils. In order to find Mesozoic marine transport to the laboratory. Collecting and transporting large fossils reptiles, for instance, paleontologists focus their research on marine such as large mosasaur bones require special skills. As fossil bones are sedimentary rocks of the Triassic, Jurassic or Cretaceous age. The considerably heavier than the original bones, packaging and transport subsequent fieldwork entails prospecting for new locations. Fossil using motorized vehicles and, in some cases, aircrafts is often required hunters patiently survey the sedimentary rock, inspecting fossil for larger specimens. In the laboratory, the first step is to clean the fragments exposed on the ground’s surface. Only after successful fossils and remove them from their surrounding protective plaster prospecting work will fossil hunters start digging. and rock matrix. Technicians and paleontologists then use a cleaning tool (engraver, awl, brush, etc.) or chemical solutions (acetic or formic Sedimentary rocks are usually very hard, and scientists have to use acid) to meticulously remove the entire matrix rock from the fossil. appropriate instruments to dig. Most of the time, hammers, chisels, Damaged fossils collected in several pieces are then reassembled. punches and trowels are much more helpful than brushes. Fossil hunting requires patience and tenacity. Scientific expeditions do not Finally, fragile fossils are consolidated with diluted glue or covered often lead to major discoveries: partial or complete skeletons are very with resin. The study of microfossils requires microscopic observation, rarely found. Geolocalization and the precise sedimentary succession so micropaleontologists have to crush the rock sample with a in which fossils have been found are recorded in the field and are mortar, then apply some of the powder to a slide to inspect it under useful for further comparison. Once discovered, fossils need to be a microscope. In all cases, cleaning and repairing fossils takes a long excavated. This is a delicate operation, as fossils are very fragile. time and requires the special skills of professionals. Most of the time, fossils are not entirely removed from the rock.

2.1.4.c STUDY

ubsequent to preparation, the study of newly discovered specimens The information gathered from the study of fossils is then shared with other begins. Paleontologists usually spend thousands of hours in their lab researchers around the world. Scientists publish articles in scientific journals studying specimens. They examine, identify (bones are most often where they present their research. They describe all the available details Sbroken and incomplete), measure, photograph, describe, and run multiple concerning the fossils or assemblages of fossils: age, size, anatomical ` tests on the fossils found, as well as compare them with fossils found in description, taphonomical aspects, etc. different paleontological collections. Methods and techniques for studying fossils are constantly improving. As such, paleontologists have a large array These articles are read by various peers from different countries and may of available techniques. Some examples include: comparative anatomy, become the basis for further work. For example, scientists can potentially computer modeling of locomotion and soft-tissue reconstruction. These provide data on the evolutionary relationships of organisms using the investigations usually lead to new questions and help elaborate diverse subdivisions of the field of paleontology, which in turn leads to hypotheses about evolution or paleobiology. a deeper understanding of actual biodiversity.

2.1.4.d KNOWLEDGE TRANSMISSION AND CURATORIAL WORK

Transmission of knowledge to the public or to students is an essential Fossil displays in museums are often just a fraction of the fossils the and important part of the job, so most paleontologists also spend a great museum owns in its collections. The majority of specimens is often amount of their time carrying out university or museum responsibilities. fragmentary or not particularly spectacular, and is therefore kept in storage. Museums may create plaster molds of important discoveries Professional paleontologists may work in museums. They carry out for further exchange with other institutions, hence increasing the their own research and teach and lecture on exhibits. Fossils are great variety of specimens in exhibitions. attractions in natural history museums and some, like vertebrates, require expert anatomists who know how to reconstruct and mount Professional paleontologists can also be college and university them appropriately. Complete skeletons are scarcely found and fossils professors. Most work in geology or biology departments, where are always very fragile, so nowadays most specimens in museum they usually teach general geology courses or evolutionary biology exhibitions are plastic casts. In this way, a life-size reconstruction of in addition to paleontology. the entire specimen can give an impression of how it may have looked.

2.1.4.e HOW TO BECOME A PALEONTOLOGIST

In order to become a paleontologist, undergraduate students need a strong background in sciences and must learn both biology and geology. It should be noted that young PhD graduates in paleontology are not assured to get the job they want; interesting positions rarely become available. Professional paleontologists generally work for museums or universities, and are responsible for collections, teaching, exhibitions and research. A small number of paleontologists also work for government surveys or oil companies.

WHAT IS A FOSSIL?

OBJECTIVES: Students debate and propose theories and experiments to answer this question: “What is a fossil?”

DURATION: 2 x 45 min.

MATERIAL REQUIRED: Plaster of Paris, shell, leaf or chicken bone, oil, wax.

ACTIVITY: When dealing with fossils, students wonder about their origin and formation. ☛ In the present activity they propose hypotheses and experiments to test these.

PREPARATION: 1/ Ask students “what is a fossil?” 2/ Students propose several hypotheses: a print, bones transformed within a rock, bones that “sink” in the rock, etc. 3/ They propose experiments to test them.

Students can work in groups, each group doing one experiment.

SEVERAL EXPERIMENTS ARE PROPOSED HERE:

Prints: 1/ With plaster of Paris in a large bowl, students dip a leaf in and take it out. 2/ They can insert a shell in the plaster, and break it once it is dry: the “fossil” print is found on the plaster. The same experiment can be carried out with potter’s clay. 3/ Shape wax like an animal using a stick or similar shaping tool, and then insert it in wet plaster (not too deep). When it is dry, heat the plaster slowly to melt the wax (to represent the decomposition of the organism). You can insert a new material (e.g. potter’s clay) in the hole to represent the replacement of the organism by new minerals. Break up the plaster.

Students propose a conclusion for their experiments, and state how these allow them to explain the origin of the fossils.

SEDIMENTATION AND FOSSILS

OBJECTIVES: Students learn that moving water erodes landforms, and that sediments bury dead organisms, which become fossils.

DURATION: 2 x 45 min.

MATERIAL REQUIRED: Soil, large bowl, spray bottle, water, fish food (daphnia).

ACTIVITY: Students observe how animals are buried in sediments, ☛ and where these sediments come from.

PREPARATION: 1/ Discuss the origin of fossils and how organism remains can be found in rocks with students. 2/ Discuss where the sediments come from. 3/ Propose an experiment. 4/ In a large bowl, create a “mountain” of potter’s clay filling the bowl halfway. 5/ Pour in a small amount of water, slowly, to fill the other half. 6/ Place a small shell in the water (it should not be too light). 7/ Spray water on the “mountain”. 8/ The erosion in the water causes sediment to cover the “dead animal”. 9/ Explain that animal cadavers, particularly those of micro-organisms in calcareous rock, are another source of sediment. 10/ Sprinkle the fish food (daphnia) on the surface of the water and spray it to demonstrate its death (the daphnia should sink). 11/ You can wait several days for the water to evaporate, and see the new “fossiliferous rock”.

HOW CAN FOSSILS HELP DATE SEDIMENTS?

OBJECTIVES: Students learn how fossils help date geologic layers.

DURATION: 40 min.

MATERIAL REQUIRED: A copy of the stratigraphic fossils, on the following page to be distributed to each student; and a copy of the specimen from Activity 1.2 “What a fossil!” (p. 25) to be dated by each student.

ACTIVITY: Students are asked to mimic the work of a paleontologist when finding ☛ an unidentified fossil; and date its stratigraphic layers using a collection of fossils from known periods.

PREPARATION: 1/ Talk with students about how a geologic layer can be dated. 2/ The teacher can introduce radioactive dating, explaining how this method cannot be applied to sedimentary layers. It can only be used with volcanic and metamorphic layers intercalated with sediment. 3/ Distribute the copy of the fossil to be dated (see Activity 1.2), the stratigraphic fossils and the stratigraphic scale on the following page. 4/ The first fossil is presented as newly found, unknown before, discovered in a layer of an unknown age with several other fossils. These other fossils have already been identified and are known in other layers of known ages. 5/ Ask how the other fossils can help determine the age of the new fossil. 6/ Students answer the question. 7/ Eventually students can try to determine which animal seen in the movie seems to be closely related to the new fossil (based on anatomical characteristics). This part can be replaced by Activity 1.2 “What a fossil!” (p. 25)

INSTRUCTIONS FOR STUDENTS: The fossil presented here is a newly found, unknown fossil, just discovered in a layer of unknown age. Fortunately, it has been found together with other fossils. These are identified, and they are known in other layers of known ages.

Trace the stratigraphic period for each fossil on the geologic scale and use the result to figure out the age of the layer and, therefore, of the new fossil.

NOTE TO TEACHERS: This activity can be done before or after Activity 1.2 “What a fossil!” (p. 25) The unknown fossil, as well as the stratigraphic fossils, is found in the Smoky Hill Chalk (Kansas), but the stratigraphic distributions provided herein are not real; they are designed to facilitate the educational objective of the exercise.

STRATIGRAPHIC FOSSILS

Clams (bivalves)

10 cm / 3.9 in 10 cm / 3.9 in

Cladoceramus undulatoplicatus Volviceramus grandis Platyceramus platinus Late Turonian-Early Maastrichtian Late Coniacian-Middle Campanian Late Coniacian-Early Campanian 90-69 Mya 87-76 Mya 87-82 Mya

Cephalopods Microfossils

Belemnites Ammonites Foraminifera

10 cm / 3.9 in 10μm

Tusoteuthis longa Placenticeras meeki Heterohelix globulosa Hastigerinella watersi Late Cenomanian - Late Turonian - Early Coniacian - Late Turonian - Late Santonian Late Santonian Late Santonian Late Santonian 95-84 Mya 91-84 Mya 89-83 Mya 90-83 Mya

TIME SCALE Million Years Ago 100 95 90 85 80 75 70 65

Cenomanian Turonian Coniacian Santonian Campanian Maastrichtian LATE CRETACEOUS

WHAT DO YOU KNOW ABOUT MARINE REPTILES?

OBJECTIVES: Students provide answers to a quiz on marine reptiles and their evolution, and correct their answers after seeing the movie.

DURATION: : 2 x 25 min

MATERIAL REQUIRED: The quiz on the following page.

ACTIVITY: This activity may be started before seeing the film to prepare the students ☛ and allow them to gather more information during the viewing.

PREPARATION: 1/ Distribute a copy of the quiz to each student. 2/ They complete it. 3/ See “Sea Rex: Journey to a Prehistoric World”. 4/ They can correct their quiz. 5/ Discuss and correct the quiz with the students in the classroom.

NOTE TO TEACHERS: 1/ A.True; B.False; C.False; D.False; E.False; F.True; G.False; H.False; I.False; J.False; K.False; L.True; M.True; N.True; O.False. 2/ A.c; B.c; C.a; D.a; E.b; F.a.; G.b. 3/ No, some, like ichthyosaurs, disappeared a long time before the impact, while others, like marine crocodiles and marine turtles, did survive the crisis.

1/ TRUE OR FALSE? Before the film After the film True False True False A. Marine reptiles can breathe in the air but not underwater B. Plesiosaurs still exist C. Some dinosaurs lived in the sea D. Humans and dinosaurs coexisted for some time E. Humans appeared just after the extinction of dinosaurs F. The Cenozoic is the age of mammals G. The continents have always been in their current position H. All marine reptiles returned to land to lay their eggs I. The Earth’s climate has always been the same as today J. The Jurassic is the last period of the Mesozoic era K. The great white shark is the largest shark to have ever existed on Earth L. North America was covered by sea water at the end of the Cretaceous M. There are no flying dinosaurs N. Some marine reptiles ate stones O. Ichthyosaurs are closely related to dolphins

2/ MULTIPLE CHOICE QUESTIONS

A/ Where was the first identified fossil C/ What is the age of the Earth? F/ Where did these first life of a marine reptile found? a. 4.55 billion years forms live? a. Australia b. 3.5 million years a. in the sea b. USA c. 8,000 years b. on land c. The Netherlands c. in the air D/ When did life appear on Earth? B/ What is the nationality of the a. at least 3.5 billion years ago G/ What was the first identified father of vertebrate paleontology b. 500 million years ago marine reptile? Georges Cuvier? c. 2,000 years ago a. an ichthyosaur a. American b. a mosasaur b. English E/ What did the first life forms look like? c. a plesiosaur c. French a. dinosaurs b. bacteria c. plants

3/ WRITE AN ANSWER

Did all marine reptiles disappear after the asteroid impact approximately 65 million years ago?

3.1.1 WHAT IS A BIOLOGICAL CRISIS?

“biological crisis”, also known as “mass extinction”, designates a geologically short (less than one-million-year-long) event of widespread extinction, which affects a variety of unrelated groups of animals and plants. Today, over 99 percent of species that have ever inhabited the Earth are extinct; some due to a ‘biological crisis’ but most only because of the natural course of evolution. Fossil records of life may help paleontologistsA to better understand when species became extinct and which species were most vulnerable to extinction.

3.1.2 HAS THIS HAPPENED BEFORE?

Species renew themselves over time. They constantly appear and 3.1.2.c PERMO-TRIASSIC CRISIS (251 MYA) become extinct due to local environmental or climatic disturbances. More widespread events of species renewal are periodically observed The Permian-Triassic crisis, which took place about 250 million years throughout geological time and are described as mass extinctions. ago, represents the most dramatic extinction event of all time. Life Geologists and paleontologists have identified numerous events of mass nearly disappeared entirely at that time, as about 95% of all species extinction that have affected the history of life on Earth. Though most died. Most scientists believe that this very important biological crisis of these crises had limited consequences on species diversity and are, was triggered by the conjunction of several factors, which included as such, considered “minor,” five of these extinction events, informally intense volcanism, changes in sea level, climate and oceanic circulation. known as the “Big Five,” are thought to have had really dramatic effects on species diversity. These include the following events: The most probable culprits of the crisis were huge amounts of greenhouse gases produced by the gigantic eruption of lava in Siberia at that time. These gases produced dramatic global warming, which in turn 3.1.2.a END ORDOVICIAN (445 MYA) modified oceanic and atmospheric circulation on a global scale. These profound modifications of Earth’s climate led to the extinction of both At the end of the Ordovician period, marine species experienced a marine and terrestrial species. Marine strata of this period indicate that dramatic extinction, which in fact took place in two distinct “parts”. the ocean became almost completely oxygen-depleted and was thus Most scientists believe that each of these steps was related to rapid and very inhospitable for most known forms of marine life. distinct climate changes. This period was marked by a very important cooling that made possible the extension of huge icecaps, which were located around the South Pole, to Africa. 3.1.2.d TRIASSIC-JURASSIC (199 MYA)

This first climatic event produced a significant decrease in sea levels The Triassic-Jurassic boundary, some 200 million years ago, witnessed and changes in oceanic circulation that are thought to have led to the the extinction of 76% of all species in the oceans. The extinct species extinction of numerous marine species. A few thousand years later, include both marine and terrestrial forms of plants and animals. The from a yet unidentified cause, the climate warmed abruptly and most most probable cause of this crisis was the eruption of a huge magmatic of the ice melted, leading to the extinction of the majority of species province in North Africa/North and South America, which at the time that had adapted to cooler conditions. formed a single continent. The eruption released huge amounts of poisonous and greenhouse gases, which in turn deeply affected the climate, oceanic circulation and terrestrial vegetation. 3.1.2.b END DEVONIAN (360 MYA) Note: Please see details of the fifth major crisis, The end-Devonian extinction also saw the end of numerous marine the Cretaceous-Tertiary (K/T) crisis, on the next page. species. The causes of this mass extinction are yet poorly understood, but available geological evidence indicates that major climate and sea-level changes at that time triggered an extensive and rapid decrease of ocean oxygenation. As marine life depends greatly on oxygen for its survival and development, most researchers think that these climate-related changes in ocean ventilation were the ultimate culprits of this biological crisis.

[fig. 3.a] THE BIG FIVE

Number of families

800

700

600

500

400

300

200

100

0 600 MYA 400 MYA 200 MYA 0

Vendian Ordovician Devonian Permian Jurassic Tertiary Cambrian Silurian Carboniferous Triassic Cretaceous

The evolution of biodiversity throughout time with the number of families indicated. Five major crises can be observed.

3.1.3 THE CRETACEOUS-TERTIARY CRISIS

3.1.3.a WHAT HAPPENED?

bout 65.5 million years ago, 75% of all species disappeared, including among reptiles, non-avian dinosaurs, plesiosaurs and mosasaurs. Though the ultimate causes of the crisis are Astill debated, two main culprits have been identified and are believed to have contributed to the mass extinction.

Scientists have collected abundant evidence that indicates that an asteroid of about 10 kilometers in diameter struck the Earth at the end of the Cretaceous. This impact produced a 200-km-wide crater, which is now buried below hundreds of meters of sediment in the Yucatan province in Mexico. The collision of the large asteroid also released vast quantities of dust that is now found at the K/T boundary almost everywhere on Earth. Paleontologists and geologists believe that this impact released enormous quantities of gases, dust and water. The huge amount of dust obscured the sky and inhibited plant [fig. 3.b] HYPOTHESES FOR THE K/T CRISIS photosynthesis in oceans and on continents, thus leading to the collapse of the base of the food chain. The subsequent lack of food resources led to the extinction of large herbivorous animals.

Also, the gases produced by the impact deeply altered the climate on a global scale. These dramatic changes probably led to the extinction of many plant and animal species, and disturbed both marine and terrestrial ecosystems for several years.

The end of the Cretaceous was also marked by the eruption of a gigantic magmatic province, known as the Deccan province in India, which produced a 4-km (2.5 mile) thick layer of lava. The large amount of lava created by the eruption is now exposed in India. Scientists think that this eruption produced vast quantities of gases, which probably led to strong modifications of climatic conditions on a global scale and contributed to the extermination of many species of marine and terrestrial plants. As plants constitute the base of many marine and continental food webs, the eruption could have also played a major role in the loss of species at that time.

Studies of lava flows in India indicate that the eruption began before and persisted a few thousand years after the asteroid impact, thus suggesting that the asteroid may have been the finishing blow of the K/T boundary crisis. Scientists, however, do not agree on which of the two events had more dramatic consequences on the living species of the Late Cretaceous.

How volcanism and meteor impact affected the climate and living organisms.

[fig. 3.c] IRIDIUM [fig. 3.d] CHICXULUB CRATER

Map of the Chicxulub crater (Yucatan Peninsula, Mexico). The The sediments from the K/T boundary contain high-grade crater was created 65 mya by the impact of a giant meteorite, Iridium (Ir). This element is found in asteroids. which is generally thought to be the main cause of the K/T crisis.

3.1.3.b WHO DISAPPEARED? WHO SURVIVED?

Many animals and plants disappeared both in marine and terrestrial On the other hand, food webs that were based on detritus, like those environments during the K/T crisis. Among these, non-avian dinosaurs present in rivers and lakes, were apparently less affected by these are certainly the most famous group that became extinct. However, environmental changes. This could explain why some freshwater they were not the only group of large reptiles to become extinct: in animals, like turtles and crocodiles, were apparently not severely the air, there was the simultaneous extinction of pterosaurs, a group affected by the crisis. Additionally, small animals, such as small of flying reptiles, while in the sea, plesiosaurs and mosasaurs (seen in mammals and lizards, probably had an advantage during the crisis, the movie) became extinct as well. The K/T crisis also saw the extinc- because they did not need large amounts of food to survive. In tion of many marine invertebrates, like the well-known ammonites, addition, the economical physiology of some larger animals, such which reigned over Mesozoic oceans for more than 150 million years. as terrestrial crocodyliforms, allowed them to wait for the return of normal conditions for several years. Food webs that were directly based on plants were particularly affected by the crisis. Herbivorous animals are thought to have disappeared first when their main food resources (plants on the continent and plankton in the oceans) became limited by severe changes in environmental conditions. This, in turn, limited the food available for carnivorous animals, which disappeared shortly afterwards.

3.1.4. AND NOW?

ife has undergone five major mass extinctions in the past. Additionally, fossil records suggest that the recovery of global Many scientists consider that human activities will lead to a ecosystems following past mass extinctions has required several L major biodiversity crisis, often referred to as the “sixth extinction.” thousands and even millions of years, although it is also a major Indeed, it is widely recognized that human activities (carbon dioxide period for species radiation and an increase in biodiversity. This emissions, deforestation, over exploitation of natural resources on land suggests that our presence on Earth could alter life for a very long and in the oceans, pollution, etc.) are putting intense ecological stress time, but contrary to many claims, may not completely eradicate on many continental and marine plant and animal species. Though the life on Earth; instead, it will more likely threaten our own survival as “natural” extinction rates of the past millennia are currently poorly natural resources will become scarcer. It should also be noted that documented, many studies indicate that the extinction of current species scientists do not know the numeric representation of our modern is occurring at an unprecedented rate. These studies have thus sug- biodiversity with certainty, as they consider that there are between gested that if no global conservation policy is planned and applied 3 million and 30 million living species (and perhaps more). soon, life on our planet will drastically change in the very near future. Considering this, it is very difficult to estimate to what extent current biodiversity is affected and how it compares to previous crises.

WHICH ANIMAL, WHICH ENVIRONMENT?

OBJECTIVES: Students learn that different animals inhabit various kinds of environments and have external features that help them thrive in different types of places.

DURATION: 45 min.

MATERIAL REQUIRED: the animals and pictures on the following page, scissors, glue.

ACTIVITY: Students match animals from two different periods with their corresponding ☛ environment (terrestrial/aquatic). They should explain their choices. What happened between the two periods? Some groups are new, others have disappeared.

PREPARATION: 1/ Distribute a copy of the animal images found on the following pages to each student. 2/ On a paper, students schematize the sea and the continent during the Late Cretaceous, and then do the same for the Paleocene. 3/ Explain that their figures represent the same place during two different periods of time. 4/ Students cut out each animal and glue it in the correct environment (terrestrial or marine) for each period. 5/ Students present arguments for their choices. 6/ Ask the students what the differences are in fauna between the two periods. 7/ Discuss what may have happened between these two pictures.

NOTE TO TEACHERS: All the animals in this activity were present in North America in or near the Western Interior Seaway during the Late Cretaceous (Maastrichtian) and Lower Paleocene.

NORTH AMERICAN FAUNA DURING THE LATE CRETACEOUS

Alamosaurus

Pachyrhizodus Osteopygis

Plioplatecarpus

Quetzalcoatlus

Tyrannosaurus Thoracosaurus

Didelphodon Cretolamna Avisaurus Elasmosaurus

NORTH AMERICAN FAUNA DURING THE PALEOCENE

Coryphodon Pantolambda

Osteopygis

Pachyrhizodus

Thoracosaurus

Cretolamna Titanoides Dakotornis

PALEO-FOOD CHAIN PERTURBATION

OBJECTIVES: Students learn that living organisms depend on one another and on their environment for survival.

DURATION: 40 min.

MATERIAL REQUIRED: A copy of the environment depicted on the following page for each student.

ACTIVITY: Students trace with arrows the relationships between the organisms featured in the image of a Late Cretaceous ocean. They mark the animals that disappeared at the end of ☛ the Cretaceous and, guided by their teacher, propose a hypothesis of what happened andhow the meteorite impact affected this food chain, as well as which part was directly affected.

PREPARATION: 1/ Distribute the figure to each student. 2/ They trace the relationships between the organisms shown in the figure (who eats what). 3/ They note which groups disappeared at the end of the Cretaceous. 4/ They propose a hypothesis on what could have happened. 5/ Explain the meteorite theory, and ask how it could have perturbed the food chain.

NOTE TO TEACHERS: The darkness created by the fall of the meteorite caused great damage to the phytoplankton (prevented photosynthesis) and thus affected the entire food chain that depended on them.

THE MARINE ENVIRONMENT DURING THE LATE CRETACEOUS

SUN

PHYTOPLANKTON: CO2+ENERGY ENERGY = PHYTOPLANKTON PHOTOSYNTHESIS

ZOOPLANKTON

CRISIS? DID YOU SAY CRISIS? NOT FOR EVERYBODY…

OBJECTIVES: Students learn that the history of life has been disrupted by major catastrophic events.

DURATION: 45 min.

MATERIAL REQUIRED: the figure and graph on the following page and the figure from Activity 3.2 “Paleo-food Chain Perturbation” (page 51).

ACTIVITY: Students analyze two food chain diagrams: one in marine environments and the other in freshwater. They compare the evolution of diversity in these environments ☛ during the crisis. They propose a hypothesis on how the crisis impacted these two environments in different ways.

PREPARATION: 1/ Introduce the cause of the K/T crisis to students. 2/ Distribute the figure on the following page and the figure from Activity 3.2 “Paleo-food Chain Perturbation” (page 51). 3/ Students reconstruct the food chain for both environments. 4/ They discuss the differences between the two food chains. 5/ Distribute the graph on the evolution of fish diversity in marine and freshwater environments. 6/ Students answer questions 4 and 5 below.

INSTRUCTIONS FOR STUDENTS: 1/ Using arrows, reconstruct the food chain for both environments presented here. 2/ What are the differences between the two food chains? 3/ Look at the “Evolution of fish diversity in marine and freshwater environments” graph. 4/ What are the differences in the evolution of diversity in marine and freshwater environments? 5/ Propose a hypothesis for why the impact of the crisis is different in each case.

NOTE TO TEACHERS: The darkness created by the fall of the meteorite caused great damage to the phytoplankton (prevented photosynthesis), and thus affected the entire food chain that depended on them. In freshwater environments, the base of the food chain was not phytoplankton, but detritus, which did not require direct light, so they were weakly affected by a brief decrease in light.

THE FRESHWATER ENVIRONMENT DURING THE LATE CRETACEOUS

SUN

ENERGY

Detritus (organic debris)

Decomposers (e.g. bacteria) Aquatic plants

EVOLUTION OF FISH DIVERSITY IN MARINE AND FRESHWATER ENVIRONMENTS

15 Marine fishes 10 Freshwater fishes 5

0 Campanian Maastrichtian Danian

CRETACEOUS PALEOCENE Number of families

DIVERSITY IN CRISIS...

OBJECTIVES: Students learn how to analyze fossil evidence in relation to biological diversity and mass extinction.

DURATION: 45 min.

MATERIAL REQUIRED: The tables on the following page, graph paper.

ACTIVITY: Using an information table, students trace the evolution of diversity for several marine groups during the Mesozoic and the beginning of the Paleocene. They should analyze ☛ the graph and propose a hypothesis on what happened at the end of the Cretaceous, based on what they saw in the film.

PREPARATION: 1/ Distribute the first table on the following page to each student. 2/ They answer questions 1, 2 and 3 below. 3/ Distribute the second table. 4/ They then answer questions 4 and 5.

INSTRUCTIONS FOR STUDENTS: 1/Trace the evolution of the diversity from the Late Cretaceous to the Early Eocene on three graphs: a/aquatic groups, b/terrestrial and aerial groups, c/evolution of the entire diversity. 2/Analyze the graphs: which groups disappear?; which ones survive the K/T crisis? 3/What happened with the dinosaurs at the end of the Cretaceous? 4/Using the second table, trace the evolution of the diversity for non-avian dinosaurs and for birds in the “terrestrial groups” graph. 5/Compare what happened with dinosaurs and mammals.

NOTE TO TEACHERS: As birds belong to Dinosauria, they are included as “dinosaurs” in the first table. This is why they do not disappear at the end of the Cretaceous in the first table.

TABLE 1: NUMBER OF FAMILIES DURING THE LATE CRETACOUS AND EARLY PALEOCENE

Mammals Crocodyliforms Dinosaurs Pterosaurs Sharks Marine turtles Mosasauroids Plesiosauria Ichthyosauria

Cenomanian 24195204321

Turonian 23195134321

Coniacian 24245105320

Santonian 54235165120

Campanian 178273256120

Maastrichtian 15 8 33 2 28 5 1 2 0

Danian 32740274000

Tanetian 68760304000

Ypresian 786220324000

TABLE 2

Non-Avian Dinosaurs Birds

Cenomanian 18 1 Turonian 17 2 Coniacian 19 5 Santonian 20 3 Campanian 24 3

Maastrichtian 25 8 Danian 04 Tanetian 06 Ypresian 022

[fig. 1.a] A Paraphyletic Group ...... p 6 [fig. 1.b] History and Relationships of Marine Reptiles ...... p 9 [fig. 1.c] Allopleuron - Skeleton ...... p 11 [fig. 1.d] Allopleuron - Skull ...... p 11 [fig. 1.e] Mosasaurus - Skeleton ...... p 12 [fig. 1.f] Mosasaurus - Skull ...... p 12 [fig. 1.g] Ophthalmosaurus - Skeleton ...... p 13 [fig. 1.h] Ophthalmosaurus - Skull ...... p 13 [fig. 1.i] Placochelys - Skeleton ...... p 14 [fig. 1.j] Placochelys - Skull ...... p 14 [fig. 1.k] Nothosaurus - Skeleton ...... p 15 [fig. 1.l] Nothosaurus - Skull ...... p 15 [fig. 1.m] Elasmosaurus - Skull ...... p 16 [fig. 1.n] Elasmosaurus - Skeleton ...... p 16 [fig. 1.o] Swimming Styles ...... p 17 [fig. 1.p] Tooth Morphology and Prey Preference ...... p 18 [fig. 1.q] A 185-Million-Year-Old Fossil of an Ichthyosaur Giving Birth ...... p 19 [fig. 1.r] A Mosasaur Palate and a Gila Monster’s Tongue ...... p 19 [fig. 2.a] Geological Time Scale ...... p 28 [fig. 2.b] From Life to Fossil ...... p 29 [fig. 2.c] Mesosaurus and the Continental Drift ...... p 31 [fig. 2.d] Ancient Discoveries ...... p 31 [fig. 2.e] First “Museums” ...... p 32 [fig. 2.f] Natural Selection ...... p 35 [fig. 3.a] The Big Five ...... p 45 [fig. 3.b] Hypotheses for the K/T Crisis ...... p 46 [fig. 3.c] Iridium ...... p 47 [fig. 3.d] Chicxulub Crater ...... p 47

ADDITIONAL ONLINE RESOURCES

http//www.SeaRex-theFilm.com

For more information about marine reptiles: http://www.ucmp.berkeley.edu/people/motani/ichthyo/ http://www.plesiosaur.com/ http://www.plesiosauria.com/index.html http://www.oceansofkansas.com/contents.html http://research.amnh.org/~esg/ https://www.dmr.nd.gov/ndfossil/research/articles/cooperstown/cooperstown_pierre_shale.html

For more information about Paleontology: http://www.paleoportal.org/index.php http://www.palaeos.com/Mesozoic/Mesozoic2.html#Marine_Reptiles http://www.tyrrellmuseum.com/ http://www.nhm.org/site/

For more information about marine reptile anatomy: http://courses.washington.edu/chordate/453photos/teeth_photos/specialized_teeth.htm http://evolution.berkeley.edu/

Biological crisis: A geologically short (less Fossil: The preserved remains, impression Mya: Acronym for “million years ago.” Phylogenetic tree: A branching, tree-like than one million year-long) event of widespread or trace of an organism that once lived representation showing the evolutionary extinction which affects a variety of during geological time and was preserved Natural selection: Mechanism of evolution relationships of living or fossil organisms. unrelated groups of animals and plants. in sediments or rock. proposed by Charles Darwin: 1/ natural variations occur among Pineal foramen: a single small hole in the Bipedal: Walks on two hind limbs only. Gastralia: Bones in the belly area (also individuals of the same species; center of the skull, beneath the orbits. called “abdominal ribs”). 2/ these variations can be transmitted Cabinet of Curiosities: In the 16th-17th to their descendants; Piscivorous/Ichthyophagous: centuries, these were collections of many Gastroliths: Stones that are swallowed to 3/ limited resources in natural environments Fish-eating animals kinds of natural objects (fossils, animals, help grind up food in the stomach. limit the number of individuals that can plants, etc.) and are primitive types of survive, leading to severe competition; Plankton: Small organisms inhabiting natural history museums. Genus: In classification, a group of two 4/ some of the natural variations may oceans or lakes (e.g. small algae and or several species sharing common improve the chances of survival of a animals). Catastrophism: A 19th century theory characteristics. particular individual; suggesting that successive cataclysms 5/ over successive generations, these Premaxillary bone: The anterior-most bone caused the extinctions seen in the Gondwana: A large landmass made up variations produce a transformation of the of the skull, forming the tip of the snout; geological record. of what is today South America, Africa, species thanks to this natural selection. there are two premaxillary bones forming India, Australia and Antarctica before each side of the tip snout. Cenozoic Era: The youngest of the three their separation. Neo-Darwinian theory of evolution: eras of the Phanerozoic Eon, extending A theory completing and improving the Pterosaurs: Flying reptiles that lived during from the end of the Mesozoic Era (65 mya) K/T crisis: A strong biological crisis that theory proposed by Charles Darwin. The the Mesozoic Era. Though they are closely to the present, and is characterized by marks the limit between the Cretaceous main difference with Darwin’s ideas is the related to dinosaurs, they do not belong the rule of mammals. and the Paleocene periods. Cretaceous is incorporation of genetic mechanisms to to this group. abbreviated as K (derived from the German explain variations among species and Classification: The process of arranging name “Kreidezeit”) and Tertiary as T (Tertiary their transfer to descendants. Salt gland: In marine sauropsids the kidneys things or organisms into related groups. is the historical name used for what is now are not efficient enough to excrete all salt called the Paleocene and Neogene periods). Osteoderms: Bony plates in ventral excess so supplementary glands located Comparative anatomy: The comparative or dorsal skin. near the eyes (turtles, thalattosuchians) or study of organism structures that makes Lamarckism: A theory developed by Jean- on the tongue (crocodiles) increase the it possible to determine their classification Baptiste Lamarck during the 19th century Oviparous: An animal which lays eggs. capacity to excrete salt. and history. that proposes that the anatomical features of an organism are produced by its effort Ovoviviparous: An animal in which the eggs Sauropsids: A group of organisms that Convergence: A similar morphological to respond to the physical environment. hatch inside the female genital tract so that bear several common features, such as characteristic, and often a superficial This theory can be summarized in three the young exit the mother’s body already the presence of a particular aperture in the resemblance, acquired independently main points: the inheritance of acquired alive, like mammals. palate. It includes extant animals classically by two or several species or groups which is characteristics; the function creates the considered reptiles (crocodiles, lizards, not inherited from a common ancestor, such organ; and life becomes more complex. Paddle-shaped limbs: Limbs in the shape varanids, turtles). as the wing in birds and bats or of a large and flat fin that roughly resemble paddle-shaped limbs in turtles, plesiosaurs, Laurasia: A large landmass made up of a paddle. In this case, digits cannot move Sister species: The species that is the mosasaurs and ichthyosaurs. These often what is today North America, Europe and independently. most closely related to another in terms result from similar environmental conditions. Asia before their separation. of evolutionary relationships. Paleontology: The study of ancient life Derived feature: A feature is derived in Mammal-like reptiles: Fossil animals that through fossils. Species: The fundamental category of a group comparatively to its condition look like reptiles but are more closely biological classification. A species is most in the ancestors of the group. The presence related to mammals. Mammals originated Pangaea: A large continental landmass commonly defined as a group of organisms of a fish-shaped tail in ichthyosaurs is a from these mammal-like reptiles. (supercontinent) that once comprised that can reproduce together, their derived condition compared to the sharp almost all modern continents. It existed descendant being fertile. tail of the ichthyosaurs’ ancestors. Shared Marine reptiles: A heterogeneous group during Permian and Triassic times (about derived features are inherited from a of marine animals that originated from 300 million years ago) and began to split Supratemporal fenestra: Two apertures on common ancestor and are used to infer distantly related terrestrial sauropsids at the beginning of the Jurassic (about 200 each side of the skull, posterior to the evolutionary relationships. which became independently adapted million years ago). orbits. to marine environments. Dinosaurs: A Mesozoic group of terrestrial Paraphyletic group: A group of organisms Tethys: The ocean formed by the division archosauromorphs with an erect stance. Mesozoic era: The period of time between comprising one ancestor and some but not of Pangaea into two landmasses and They also include the ancestors of modern 65.5-251 mya. The Mesozoic era includes all of its descendants. It is not considered in separated the Laurasia and Gondwanland birds, as well as birds themselves in modern the Triassic, Jurassic, and Cretaceous per- phylogenetic classification. during the Jurassic. classifications. iods and was ruled by reptiles such as dinosaurs and marine reptiles. Pectoral and pelvic girdles: the bones Vertebrates: Animals with backbones. Era: A subdivision of geological time that join the limbs in bodies. In humans, the including several periods. Monophyletic group: A group of organisms pectoral girdle is formed by the collarbone Viviparous: Animals which give live birth formed by one ancestor and all its and the shoulder blade (scapula), while to their young (developed in the mother’s Extinction: The process by which living descendants. the pelvic girdle is formed by the pelvis. body), as opposed to laying eggs. species die out of existence. The extinction of a species occurs when the last Mutation: Any change in the sequence of Period: A formal division of geological Western Interior Seaway: Name of the individual of the species dies. nucleotides of a gene. time included in an era. interior sea that covered the central part of North America during the Cretaceous. Phylogenetic classification: A method It was linked to the Gulf of Mexico in the of classification that groups organisms south and to the Hudson Bay and Beaufort according to their evolutionary relationships. Sea in the north.

This Educators’ and Activities Guide was written by Scientific Advisors: Drs. Stéphane Jouve and Peggy Vincent in collaboration with Dr. Olivier C. Rieppel, Rowe Family Curator, The Field Museum, Chicago (IL) Dr. Nathalie Bardet, CNRS/National Museum of Natural History. Dr. Ryosuke Motani, Professor, University of California, Davis (CA) Edited by Julien Bollée and Alexandra Body. Dr. Zulma Gasparini, Paleontologist, La Plata Museum/CONICET, La Plata (Argentina) Illustrations by Karine Sampol & Stéphane Jouve for 3D Entertainment Distribution. Dr. Benjamin Kear, Paleontologist, La Trobe University, Melbourne (Australia)

Special Thanks to: Designed by malderagraphistes. François Mantello, Pascal Vuong, Ronan Chapalain, Produced and Published by 3D Entertainment Distribution. Catherine Vuong, Dr. Elisabeth Mantello and Sylvain Grain.