A Comparison and Combination of Plastid Atpb and Rbcl Gene Sequences for Inferring Phylogenetic Relationships Within Orchidaceae Kenneth M
Total Page：16
File Type：pdf, Size：1020Kb
Aliso: A Journal of Systematic and Evolutionary Botany Volume 22 | Issue 1 Article 36 2006 A Comparison and Combination of Plastid atpB and rbcL Gene Sequences for Inferring Phylogenetic Relationships within Orchidaceae Kenneth M. Cameron New York Botanical Garden Follow this and additional works at: http://scholarship.claremont.edu/aliso Part of the Botany Commons Recommended Citation Cameron, Kenneth M. (2006) "A Comparison and Combination of Plastid atpB and rbcL Gene Sequences for Inferring Phylogenetic Relationships within Orchidaceae," Aliso: A Journal of Systematic and Evolutionary Botany: Vol. 22: Iss. 1, Article 36. Available at: http://scholarship.claremont.edu/aliso/vol22/iss1/36 MONOCOTS Comparative Biology and Evolution Excluding Poales Aliso 22, pp. 447-464 © 2006, Rancho Santa Ana Botanic Garden A COMPARISON AND COMBINATION OF PLASTID atpB AND rbcL GENE SEQUENCES FOR INFERRING PHYLOGENETIC RELATIONSHIPS WITHIN ORCHIDACEAE KENNETH M. CAMERON The Lewis B. and Dorothy Cullman Program for Molecular Systematics Studies, The New York Botanical Garden, Bronx, New York 10458-5126, USA ([email protected]) ABSTRACT Parsimony analyses of DNA sequences from the plastid genes atpB and rbcL were completed for 173 species of Orchidaceae (representing 150 different genera) and nine genera from outgroup families in Asparagales. The atpB tree topology is similar to the rbcL tree, although the atpB data contain less homoplasy and provide greater jackknife support than rbcL alone. In combination, the two-gene tree recovers five monophyletic clades corresponding to subfamilies within Orchidaceae, and fully resolves them with moderate to high jackknife support as follows: Epidendroideae are sister to Orchidoideae, followed by Cypripedioideae, then Vanilloideae, and with Apostasioideae sister to the entire family. Although this two-gene hypothesis of orchid phylogeny is an improvement over all single-gene studies published to date, there is still no consensus as to how all the tribes of Epidendroideae are related to one another. Nevertheless, these new topologies help to clarify some of the anomalous results recovered when rbcL was previously analyzed alone, and demonstrate the value of continued plastid gene se quencing within Orchidaceae. Key words: atpB, DNA, evolution, molecular, Orchidaceae, phylogeny, plastid, rbcL, systematics. INTRODUCTION matK by Freudenstein et al. 2004), but only the mitochon drial nadl b-e intron published by Freudenstein et a!. (2000) Orchidaceae are distributed throughout the world, and are and Freudenstein and Chase (200 1) have considered enough by far the largest family of monocotyledons, with more than taxa (ca. 100) to adequately depict higher level orchid re 750 genera and 30,000 species currently recognized. This im lationships. Unfortunately, the level of sequence variation mense diversity of taxa coupled with the complexity of orchid exhibited in the mitochondrial nadlb-c intron was also in flowers presents a great challenge to plant systematists con sufficient for addressing relationships much below the rank cerned with phylogeny reconstruction and classification (At of subfamily or tribe. wood 1986). For this reason, molecular sequence data have Since no clear consensus has been reached regarding re been a boon to orchidologists, since it allows for large lationships among the subfamilies, tribes, or subtribes of Or amounts of data to be generated for many taxa, and with chidaceae, a return to the plastid genome as a source of new relatively minimal cost, time expenditure, and difficulty. phylogenetic information is warranted and justified given the The first published molecular phylogeny for Orchidaceae well-known advantages of working with chloroplast DNA. employed plastid rbcL sequences from 33 orchids plus 62 These have been discussed previously by Palmer et al. other lilioid monocots (Chase et al. 1994). Although limited (1988), Clegg and Zurawski ( 1992), Olmstead and Palmer in taxon sampling, that study showed that the neottioid or (1994 ), among others, and include unilateral inheritance, nu chids are polyphyletic, and thus implied that the orchids merous copies per cell, ease of amplification and sequencing, might be divided best into five subfamilial lineages: the absence in animals and fungi, etc. Although there are a num apostasioid and cypripedioid orchids (each sometimes treat ber of plastid loci that could have been chosen, atpB was ed as distinct families), orchidoids (including the diurid and sequenced to complement the previously published rbcL spiranthoid orchids), and epidendroids (including the neot data of Cameron et a!. ( 1999) since its utility for family level tioid and vandoid orchids). Only Vanilla Plum. ex Mill. and systematics studies has been documented for a number of Pogonia Andrews were sampled to represent the vanilloid other plant groups (Hoot et al. 1995; Savolainen et al. 2000). orchids, but this lineage showed itself to most likely repre This gene is located downstream from rbcL in the large sin sent a distinct subfamilial clade (Vanilloideae) as well. gle copy region, and encodes one of the subunits of ATP The rbcL matrix used by Chase et al. (1994) was expand synthase, an enzyme that couples proton translocation across ed substantially by Cameron et a!. (1999) to include 158 membranes during the synthesis of ATP. Furthermore, a cod ingroup and 13 outgroup taxa. Since that study contains the ing region was desired for sequencing so that issues of align greatest genus and species level sampling to date, it has re ment (i.e., character homology assessment) would be mini mained a standard to which most subsequent molecular phy mized for this diverse assemblage of taxa. logenetic studies of orchids have been compared (e.g., van MATERIALS AND METHODS den Berg et al. 2005). A handful of additional phylogenetic studies focused on the entire Orchidaceae have been pub Taxon Sampling and Gene Sequencing lished using genes other than rbcL (e.g., ndhF by Neyland Nearly complete DNA sequences for atpB (ca. 1500 base and Urbatsch 1995, 1996; 18S by Cameron and Chase 2000; pairs [bp]) were obtained from 173 species of Orchidaceae 448 Cameron ALISO (representing I 50 different genera) and nine genera from As mony criterion in PAUP* vers. 4.0b10 (Swofford 2002) with teliaceae, Blandfordiaceae, Boryaceae, Hypoxidaceae, and gaps treated as missing data, characters weighted equally, Lanariaceae to serve as outgroup taxa. In order to fill in and with DELTRAN optimization of characters onto result taxonomic gaps and to compare these data with the pub ing trees. The sequenced genera from Asteliaceae, Bland lished rbcL phylogeny of Orchidaceae (Cameron et al. fordiaceae, Boryaceae, Hypoxidaceae, and Lanariaceae were 1999), an additional 30 new sequences of rbcL were also specified as a monophyletic outgroup based on topologies completed; the remaining rbcL sequences were downloaded uncovered in broader phylogenetic studies of monocots from GenBank as indicated in Table 1. This resulted in com (Chase et al. 1995, 2000). Equally parsimonious trees were pletely congruent matrices for all 182 taxa at the generic found by executing a heuristic search of 1000 random ad level. An effort was made to sequence atpB from the same dition replicates using tree bisection and reconnection (TBR) species as previously done for rbcL (in many cases the same branch swapping, but saving only five trees per replicate in DNA aliquot was used), but this was not always possible order to discover possible "islands" of maximum parsimony (see Table 1). The entire data matrix is available from the (MP) (Maddison 1991 ). All trees obtained in the first round author upon request or can be downloaded from The New of searching were then used as starting trees for a second York Botanical Garden website at http://www.nybg.org/bscil heuristic search using the same parameters, but this time res/cullb/dna.html (May 2005). saving all shortest trees (MULTREES option in effect) until All of the newly generated sequences were produced by a MAXTREE limit of 10,000 trees was reached. Support automated methods, briefly described as follows. Most of the values for the relationships discovered by analysis of each total DNA was extracted using the FastPrep®l (Qbiogene, matrix were calculated by performing jackknife (jck) anal Inc., Carlsbad, California, USA) and glassmilk method from yses of 5000 heuristic search replicates using the TBR 2 approximately 0.5 cm dried leaf tissue, as described by branching swapping algorithm and the following settings: Struwe et al. (1998). In some cases, DNA aliquots were ob 37% deletion, emulate "jac" resampling, one random addi tained from the Royal Botanic Gardens, Kew DNA bank tion per replicate, holding one tree, and saving two trees per (see Table I). Target loci were amplified in 50 f.lL volumes replicate. Finally, a partition homogeneity test ( = incongru using standard polymerase chain reaction (PCR) protocols ence length difference [ILD] test) was conducted in PAUP* that typically included the addition of bovine serum albumin to test for incongruence between the atpB and rbcL matrices. (BSA) and betaine, which may or may not have been nec essary. The annealing temperature used to amplify both RESULTS genes was 55°C. For atpB, primers originally published by Hoot et al. (1995), herein designated "nyl72": TATGA Analysis of atpB GAATCAATCCTACTACTTCT and "nyl73": TCAGTA CACAAAGATTTAAGGTCAT, were used for amplification. The strict consensus of