Understanding the Regulatory Dynamic of the Two-Component Systems, Plrsr and Bvgas, During Bordetella Colonization of the Mammalian Respiratory Tract
UNDERSTANDING THE REGULATORY DYNAMIC OF THE TWO-COMPONENT SYSTEMS, PLRSR AND BVGAS, DURING BORDETELLA COLONIZATION OF THE MAMMALIAN RESPIRATORY TRACT
Mary Ashley Sobran
A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Microbiology and Immunology in the School of Medicine.
Chapel Hill 2019
Approved by:
Peggy A. Cotter
Rita Tamayo
Robert B. Bourret
Miriam Braunstein
Brian Conlon © 2019 Mary Ashley Sobran ALL RIGHTS RESERVED
ii ABSTRACT
Mary Ashley Sobran: Understanding the Regulatory Dynamic of the Two-Component Systems, PlrSR and BvgAS, During Bordetella Colonization of the Mammalian Respiratory Tract (Under the direction of Peggy A. Cotter)
Pertussis is a severe respiratory disease caused by the bacterium Bordetella pertussis.
Despite high vaccination coverage, the number of pertussis cases has rebounded in recent years.
To combat this disease, more efficacious vaccines and improved knowledge of Bordetella virulence is critical. Bacteria often use two-component systems (TCSs) to coordinate essential cellular processes in response to the diverse environments they encounter. In B. pertussis and the closely related subspecies B. bronchiseptica, the TCS, BvgAS, controls the expression of almost all known virulence factor-encoding genes and is considered the main virulence regulatory system. Recently, another TCS, PlrSR, was identified that is also required for Bordetella infection within the lower respiratory tract (LRT). However, why PlrSR is important for colonization is unknown. Using engineered strains of B. bronchiseptica and genetic reporters, we demonstrated that PlrS is required for the maintenance of BvgAS activity in the lungs of mice, indicating that PlrSR, along with BvgAS, coordinates virulence specifically in the LRT.
Moreover, our data indicate that PlrSR may regulate genes that are required for persistence in the
LRT independent of BvgAS. Importantly, these genes and their corresponding proteins may serve as new vaccine components or therapeutic targets. We have also shown that the Per-Arnt-
Sim (PAS) domain of BvgS is required for BvgS inactivation in the absence of PlrS, indicating that the PAS domain is important for the PlrSR-BvgAS connection and functions as an independent signaling domain. Based on published data and our findings, we hypothesize that
iii PlrSR controls the expression of high-affinity cytochrome oxidases (HACOs) that are required for bacterial respiration and maintenance of BvgAS activity in the LRT. We have demonstrated that two of four HACOs contribute to LRT colonization. However, BvgAS activity is unaffected by the loss of these HACOs and it is unknown if PlrSR regulates the expression of any HACO encoding genes. Together, this work provides a more detailed understanding of the coordinated regulation imposed by PlrSR and BvgAS to promote Bordetella survival within the mammalian host.
iv To my family. Thank you for all your support along the way.
v TABLE OF CONTENTS
LIST OF TABLES ...... xi
LIST OF FIGURES ...... xii
LIST OF ABBREVIATIONS ...... xiv
CHAPTER 1. INTRODUCTION ...... 1
Introduction ...... 1
Current pertussis vaccines fail to protect individuals from Bordetella pertussis colonization and pertussis disease ...... 1
Despite high rates of vaccination, pertussis remains a burden in the United States and throughout the world ...... 2
The progression of pertussis disease is most severe in young patients and can last for many months ...... 2
Bordetella pertussis produces many essential virulence factors during human infection ...... 3
The complex, two-component phosphorelay system, BvgAS, is essential for Bordetella colonization of the mammalian host and is considered the master regulator of virulence ...... 4
Although the importance of BvgAS for Bordetella virulence has been well established, the contributions of other two-component systems to bacterial survival and virulence in the mammalian host is less understood ...... 6
PlrSR is a newly identified putative two-component system required for B. bronchiseptica colonization of the lower respiratory tract in rats ...... 7
Research Objective ...... 7
REFERENCES ...... 9
CHAPTER 2. THE BORDETELLA PLRSR REGULATORY SYSTEM CONTROLS BVGAS ACTIVITY AND VIRULENCE IN THE LOWER RESPIRATORY TRACT ...... 15
vi Introduction ...... 15
Results ...... 18
PlrS is required for enhanced BvgAS-dependent virulence-associated phenotypes in response to elevated CO2 concentrations ...... 18
PlrS likely affects BvgAS-dependent phenotypes via PlrR ...... 18
B. bronchiseptica lacking plrS modulate to the Bvg– phase within the lower respiratory tract ...... 20
B. bronchiseptica lacking plrS fail to activate BvgAS within the lower respiratory tract ...... 22
PlrS is required for B. bronchiseptica persistence in the lower respiratory tract, independent of its effects on BvgAS activity ...... 23
PlrS is required for survival and persistence of B. pertussis in the lower respiratory tract ...... 24
Discussion ...... 25
Materials and Methods ...... 29
Growth media and bacterial strains ...... 29
Construction of cloning plasmids and bacterial strains ...... 30
In vitro adherence assays ...... 31
Macrophage cytotoxicity assays ...... 31
Bacterial adherence to J774 cells and in response to being cultured in media with decreased pH ...... 32
Evaluation of B. bronchiseptica bvgAS transcription in vitro ...... 32
Evaluation of B. bronchiseptica promoter activity in vitro ...... 33
Bacterial colonization of the mouse respiratory tract ...... 33
Evaluation of B. bronchiseptica phenotypic phase transition in vivo ...... 34
Ethics statement ...... 34
Statistical analysis ...... 35
Figures and Tables ...... 36
vii REFERENCES ...... 47
CHAPTER 3. THE BVGS PAS DOMAIN: AN INDEPENDENT SENSORY PERCEPTION MODULE IN THE BORDETELLA BRONCHISEPTICA BVGAS PHOSPHORELAY ...... 53
Introduction ...... 53
Results ...... 57
Mutants used in this study ...... 57
Contribution of the PAS domain in regulating BvgS activity in vitro ...... 57
Characterization of pGFLIP-PflaA and pBam reporters in BvgS PAS domain mutants in vitro ...... 60
The PAS domain is not required for BvgS kinase activity in the LRT in PlrSWT bacteria...... 62
The C607S substitution hinders BvgS kinase activity and bacterial colonization in the lower respiratory tract (LRT) of mice ...... 62
A role for the BvgS PAS domain is revealed in the absence of PlrS in the LRT ...... 63
Discussion ...... 65
Materials and Methods ...... 69
Bacterial strains, plasmids, and growth conditions ...... 69
Construction of B. bronchiseptica BvgS PAS domain mutant strains ...... 70
Construction of PptxA-gfp and PfhaB-gfp transcriptional reporters ...... 71
Transcription of PptxA-gfp and PfhaB-gfp reporters in vitro ...... 71
Characterization of pGFLIP-PflaA and pBam reporters in vitro ...... 72
Evaluation of B. bronchiseptica modulation in vivo ...... 73
Ethics statement ...... 73
Statistical analysis ...... 74
Figures and Tables ...... 75
REFERENCES ...... 83
viii CHAPTER 4. TWO HIGH AFFINITY CYTOCHROME OXIDASES ARE REQUIRED FOR MAXIMAL COLONIZATION OF THE MAMMALIAN LOWER RESPIRATORY TRACT BY BORDETELLA BRONCHISEPTICA ...... 87
Introduction ...... 87
Results ...... 91
High-affinity cytochrome oxidase loci are differentially regulated in ambient air in vitro ...... 91
B. bronchiseptica requires high-affinity cytochrome oxidases to robustly colonize the mammalian lower respiratory tract ...... 92
Maintenance of BvgAS kinase activity does not depend on bd-type cytochrome oxidases in vivo ...... 93
Although required for robust colonization in vivo, the BB4012- BB4011 (cydAB3) promoter is inactive during colonization of the murine respiratory tract ...... 94
Discussion ...... 95
Materials and Methods ...... 98
Bacterial strains, plasmids, and growth conditions ...... 98
Construction of high-affinity cytochrome oxidase lacZ transcriptional reporters ...... 99
Transcriptional analysis of high-affinity cytochrome oxidase encoding genes in vitro ...... 99
Construction of B. bronchiseptica high-affinity cytochrome oxidase deletion strains ...... 100
Bacterial colonization of the mouse respiratory tract ...... 101
Evaluation of B. bronchiseptica modulation in vivo ...... 101
Construction of pGFLIP-PcydAB3 reporter ...... 102
Evaluation of cydAB3 expression in vivo ...... 102
Ethics statement ...... 103
Statistical analysis ...... 103
ix Figures and Tables ...... 104
REFERENCES ...... 111
CHAPTER 5. DISCUSSION ...... 117
x LIST OF TABLES
Table 2.S1. Bacterial Strains and Plasmids Used in this Study ...... 46
Table 3.S1. Bacterial Strains and Plasmids Used in this Study ...... 81
Table 3.S2. Primers Used in this Study ...... 82
Table 4.S1. Bacterial Strains and Plasmids Used in this Study ...... 109
Table 4.S2. Primers Used in this Study ...... 110
xi LIST OF FIGURES
Figure 2.1. PlrS is required for Bvg-dependent phenotypes in 5% CO2 growth conditions...... 36
Figure 2.2. Overexpression of a phosphomimetic plrR allele rescues the ΔplrS L2 cell adherence defect...... 37
Figure 2.3. Without PlrS, B. bronchiseptica modulates to the Bvg– phase in the lower respiratory tract...... 38
Figure 2.4. PlrS is required for persistence of B. bronchiseptica in the LRT independent of BvgAS activity...... 39
Figure 2.5. PlrS is required for the persistence of Bordetella pertussis in the lower respiratory tract...... 40
Figure 2.6. PlrSR and BvgAS work in tandem to regulate gene expression required for Bordetella persistence in the lower respiratory tract...... 41
Figure 2.S1. Bacterial adherence to macrophage-like murine J774 cells...... 42
Figure 2.S2. Increased adherence of wild-type B. bronchiseptica to L2 lung epithelial cells does not result from bacteria responding to lowered pH of the growth media...... 42
Figure 2.S3. PlrS does not transcriptionally regulate the expression of the bvgAS in vitro...... 43
Figure 2.S4. In vitro analysis of wild type and ΔplrS modulation using the plasmid reporters pGFLIP-flaA and pBam...... 43
Figure 2.S5. In vitro analysis of wild type and ΔplrS phase transition using the plasmid reporter pGFLIP-ptxA...... 44
Figure 2.S6. A constitutively-active bvgS mutation does not prevent rapid clearance of a ΔplrS strain in the lower respiratory tract...... 44
Figure 2.S7. In vitro modulation of constitutively-active bvgS strains using the plasmid reporters pGFLIP-flaA and pBam...... 45
Figure 3.1. The sensor kinase, BvgS, has a unique PAS domain, which may play a role in signal perception...... 75
Figure 3.2. In B. bronchiseptica, the PAS domain influences BvgS kinase activity and sensitivity to chemical modulation in vitro...... 76
Figure 3.3. The PAS domain is important for BvgS inactivation in response to known modulatory chemicals in vitro...... 77
xii Figure 3.4. A conserved cysteine residue in the PAS domain is important for maintaining BvgS kinase activity during respiratory tract colonization of mice...... 78
Figure 3.5. The PAS domain is required for BvgS modulation in response to PlrSR dysfunction during LRT colonization...... 79
Figure 3.S1. The PAS domain of BvgS may sense an activating or inactivating signal in the LRT...... 80
Figure 4.1. In vitro, BvgS influences the expression of high affinity cytochrome oxidase encoding genes in B. bronchiseptica...... 104
Figure 4.2. Two bd-type high-affinity cytochrome oxidases contribute to B. bronchiseptica colonization of the trachea in mice...... 105
Figure 4.3. Without high-affinity cytochrome oxidases B. bronchiseptica is significantly attenuated for colonization of the trachea and LRT in mice...... 106
Figure 4.4. Maintenance of BvgS kinase activity does not require bd-type high- affinity cytochrome oxidases during respiratory tract colonization of mice...... 107
Figure 4.5. The cydAB3 promoter is not active during respiratory tract colonization...... 108
xiii LIST OF ABBREVIATIONS
L microliters
-ME Mercaptoethanol aa amino acid
BG Bordet-Gengou
Bvg+ Bvg-plus phase
Bvg– Bvg-minus phase
Bvgi Bvg-intermediate phase cfu colony forming units
DAP diaminopimelic acid
DTaP Diphtheria, Tetanus, Acellular Pertussis vaccine
FHA filamentous hemagglutinin
FIM fimbriae
Gm gentamicin
HACOs high affinity cytochrome oxidases
HK histidine kinase
Hpt histidine phospho-transfer domain
HTH helix-turn-helix
Km kanamycin
LACOs low affinity cytochrome oxidases
LB lysogeny broth
LCPs large colony phenotypes
xiv LCVs large colony variants
LDH lactate dehydrogenase
LRT lower respiratory tract
MgSO4 magnesium sulfate
MOI multiplicity of infection
NA nicotinic acid
NC nasal cavity
PAS Per-Arnt-Sim
PBS phosphate-buffered saline
PDC PhoP-DcuS-CitA
PfhaB fhaB promoter
PptxA ptxA promoter
PRN pertactin
REC receiver
ROS reactive oxygen species
SD standard deviation
Sm streptomycin
SpcR spectinomycin-resistant
SS Stainer-Scholte
T1 Time 1
T2 Time 2
T3SS type three secretion system
xv TCS two-component system
TM transmembrane
VFT venus fly-trap vags vir-activated genes vrgs vir-repressed genes
WT wild-type
xvi CHAPTER 1. INTRODUCTION
Introduction
Current pertussis vaccines fail to protect individuals from Bordetella pertussis colonization and pertussis disease
Pertussis is a highly contagious and severe respiratory disease caused by the bacterium
Bordetella pertussis (1). Despite high rates of vaccination, pertussis has reemerged as an urgent public health threat (2). During the late 1940s, a whole cell pertussis vaccine was introduced that dramatically reduced the incidence of pertussis (3). However, due to concerns over safety, the whole cell vaccine was replaced with an acellular pertussis vaccine. The current acellular vaccine contains only purified bacterial proteins and inactivated toxins, which serve as critical virulence factors for the bacteria. Since the transition from the whole cell to the acellular vaccine, the number of pertussis cases has rebounded. Studies have shown that the immunity generated by the current acellular vaccine is less robust and wanes faster compared to the immunity generated by pertussis infection or the whole cell vaccine (4–6). As a result, the number of cases of pertussis reported in adolescence and young adults has increased (2). Recent studies using a baboon infection model demonstrate that although the acellular and whole cell vaccines provide protection against overt disease, they fail to prevent colonization of Bordetella within the respiratory tract (7). Moreover, animals immunized with the acellular vaccine were still able to transmit Bordetella to naïve animals (7–10). If true for human disease, current vaccination strategies may be inadvertently increasing the reservoir of Bordetella pertussis in the population, consequently putting unimmunized individuals, particularly infants, at elevated risk for infection.
Thus, more efficacious vaccines are needed.
1 Despite high rates of vaccination, pertussis remains a burden in the United States and throughout the world
In the Unites States, five doses of the pertussis vaccine (DTap) are recommended for all individuals by the age of seven and booster doses are recommended for adolescence and adults
(11). Vaccination is also recommended for women during every pregnancy and breastfeeding is encouraged in hopes of transferring maternal immunity to infants, who are more at risk for fatal infections (12). In 2017, the median acellular pertussis vaccination coverage in the United States was 95.1%, almost 10% above the global average (13–15). However, approximately 19,000 cases of pertussis were still reported, including 13 pertussis-associated deaths. Each year since the 1990s, the total number of pertussis cases has steadily increased, and multiple outbreaks have been reported across the country. Worldwide, the burden of pertussis is even greater with approximately 144,000 incidence of pertussis and 90,000 deaths resulting from pertussis infection reported in 2017 alone (14, 15).
The progression of pertussis disease is most severe in young patients and can last for many months
Pertussis illness can manifest as a range of symptoms from mild upper respiratory tract disease to severe, persistent, and progressive coughing that can continue for weeks or months (1,
16). Following infection, progression of the disease can be categorized into three consecutive stages: the catarrhal stage, paroxysmal stage, and convalescent stage. During the catarrhal stage, which can last 1-2 weeks, symptoms are often mild and mistaken for those of a common cold, such as malaise, sore throat, nasal congestion, rhinorrhea, sneezing, and mild progressive dry cough. As a consequence, it often is not until the second stage of disease that pertussis is diagnosed. In the paroxysmal stage, patients often experience intense periods of severe coughing accompanied by inspiratory whoops. This symptom is the classic sign of pertussis and is the
2 reason for its alternative name, ‘Whooping Cough’. Other symptoms associated with this stage are cyanosis, eye proptosis, tongue protrusion, salivation, and thick oral mucus production. The paroxysmal stage is the longest in the progression of pertussis and can often last for two months.
For younger patients, this stage is often the most dangerous due to the development of severe pulmonary hypertension and hypoxia due to apnea, which can lead to respiratory failure or death
(16, 17). Hospitalization is required for severe cases at this stage. Convalescence is the final stage of pertussis disease and can be characterized by a decrease in coughing spams severity, duration, and frequency, however, mild coughing can last up to an additional 6 weeks. Moreover, individuals are more susceptible to secondary viral infections, which can cause a relapse of severe respiratory symptoms (1). Overall, pertussis disease progression and recovery can last many months making the burden of this disease immense.
Bordetella pertussis produces many essential virulence factors during human infection
Many virulence factors are required for successful colonization of B. pertussis in the human respiratory tract. Primarily these include several surface exposed and secreted factors, such as adhesins and toxins (18, 19). The primary adhesins, filamentous hemagglutinin (FHA) and fimbriae (FIM), are required for tracheal colonization and help to facilitate localization and adherence of the bacteria to the large airways, specifically the tracheal epithelium surface (18,
20–22). Similarly, pertactin (PRN), a member of the classical autotransporter family of outer membrane proteins, has also been implicated as being important for bacterial adherence to ciliated epithelium (18, 23). Various toxins secreted by Bordetella are also essential for robust tracheal colonization and can disrupt the immune system response allowing the bacteria to evade phagocytosis and other bactericidal insults during infection. The most well studied of these toxins include pertussis toxin (PT), an ADP-ribosylating AB5-type toxin that induces
3 lymphocytosis during infection (18, 24–26), adenylate cyclase toxin (ACT), a calmodulin- dependent RTX family toxin with dual adenylate cyclase and hemolysin activity (18, 27–29), and a type three secretion system (T3SS), which injects into host cells toxin effector proteins that are capable of inducing necrotic cell death and dampening the immune response in the lungs
(30–34). Current formulations of the acellular vaccine used in the United States contain a combination of purified FHA, FIM, inactivated PT, and PRN (35). B. bronchiseptica, a closely related sub-species to B. pertussis that can infect a broad range of mammalian hosts, also produces a very similar, often functionally complementary, set of virulence factors that are essential for infection, except for PT (18, 19, 36, 37). In fact, due to its ability to naturally to infect pigs, rabbits, rats, and mice, the importance of many virulence factors has been evaluated using B. bronchiseptica and natural host animal models (22, 23, 33, 38).
The complex, two-component phosphorelay system, BvgAS, is essential for Bordetella colonization of the mammalian host and is considered the master regulator of virulence
All known protein virulence factor-encoding genes, including those encoding proteins present in current acellular vaccines, are regulated at the level of transcription by the two- component system (TCS) BvgAS (39–42). The activity of this system is essential for bacterial colonization, persistence, and infection within the respiratory tract of the mammalian host and as such, BvgAS is considered the master regulator of Bordetella virulence (41, 43–47). This is true for both B. pertussis and B. bronchiseptica, which produce functionally interchangeable BvgAS systems (48).
The BvgAS system is composed of two proteins. BvgS is a membrane localized, polydomain, His-Asp-His sensor kinase that phosphorylates its cognate DNA-binding response regulator, BvgA (42, 49–51). BvgS contains two periplasmic N-terminal sensory perception, venus flytrap domains, which are followed by a transmembrane domain, a cytoplasmically-
4 located Per-Arnt-Sim (PAS) domain, a histidine kinase (HK) domain, a receiver (REC) domain, and finally a histidine phospho-transfer (Hpt) domain. When BvgS is activated, protein dimers undergo autophosphorylation at histidine residue 729 in the HK domain (51). The resulting phosphoryl group is subsequently transferred down the protein to conserved aspartic acid and histidine residues in the REC and Hpt domains, respectively. The Hpt domain then trans- phosphorylates BvgA at aspartic acid residue 54 within the response regulators REC domain.
Once phosphorylated, BvgA~P can dimerize and bind DNA via its C-terminal helix-turn-helix
(HTH) domain to promote or repress gene expression (51–56). The BvgAS phosphorelay can also be reversed, however, and BvgS can dephosphorylate BvgA~P and inactivate the regulator protein (57). When BvgS dephosphorylates BvgA~P, the Hpt domain removes the phosphoryl group from BvgA, which then gets transferred to the REC domain of BvgS. The phosphoryl group is then donated to water to form inorganic phosphate.
Due to the complex domain structure and function of BvgAS, this system has the ability to control the expression of four distinct classes of genes and three distinct phenotypic phases of the bacteria (18, 39, 41, 43, 44, 46, 53). When Bordetella are grown at 37˚C in the laboratory on
Bordet-Gengou (BG) agar or in Stainer-Scholte (SS) broth, BvgS acts as a kinase, resulting in high levels of BvgA~P, and the bacteria express Bvg+ phase (58, 59). This phase is characterized by maximal expression of genes that are transcriptionally activated by BvgA~P, termed virulence activated genes or vags (Class 1 and 2 genes), and by maximal repression of virulence repressed genes or vrgs (Class 4 genes) (39, 46). All known virulence factor encoding genes are maximally expressed during the Bvg+ phase, including bvgAS. When BvgS acts as a phosphatase, resulting in low levels of BvgA~P, the bacteria express Bvg– phase; virulence gene expression is repressed, and vrgs are derepressed. In B. bronchiseptica, genes encoding flagella
5 are expressed in Bvg– phase and this phase, in B. bronchiseptica specifically, has been hypothesized to be important for bacterial survival in environments outside of a mammalian host
(46, 60, 61). Bordetella express the Bvg– phase in vitro when grown in the presence of millimolar concentrations of nicotinic acid (NA) or magnesium sulfate (MgSO4) (62–64). When
BvgS is partially active, generating intermediate levels of BvgA~P in the cell, the Bvgi phase is expressed (44, 52, 65). This phase is characterized by maximal expression of intermediate phase genes (Class 3 genes), such as bipA, repression of vrgs, and the expression of vags with high affinity BvgA~P promoter binding sites. Vags with high affinity BvgA~P promoters, termed
‘early’ BvgA-activated genes or Class 2 genes, are expressed upon initial activation of BvgS (52,
53, 55, 66) and once the level of BvgA~P has sufficiently accumulated in the cell, ‘late’ BvgA activated genes, or Class 1 genes, with low affinity BvgA~P promoter binding sites are activated.
Despite our knowledge of how to manipulate BvgAS activity in vitro, the true signals that influence BvgS activity in nature are unknown.
Although the importance of BvgAS for Bordetella virulence has been well established, the contributions of other two-component systems to bacterial survival and virulence in the mammalian host is less understood
BvgS kinase activity and thus the Bvg+ phase is essential for Bordetella infection (44, 46,
47, 50, 67, 68). Without BvgS (∆bvgS), bacteria express Bvg– phase and are rapidly cleared from the upper and lower (LRT) respiratory tract. Experiments with phase-locked and ectopic expression mutants have led to the conclusion that BvgAS is both necessary and sufficient for bacterial survival in the host (46, 68). Due to the importance of the BvgAS for Bordetella pathogenesis, great efforts have been made to characterize the mechanism of signal transduction and regulon of this system. As a consequence, however, little is known about how the other,
6 approximately 20, putative two-component system encoded in the genome contribute to
Bordetella gene regulation and pathogenesis.
PlrSR is a newly identified putative two-component system required for B. bronchiseptica colonization of the lower respiratory tract in rats
Recently, another putative TCS has been identified that is required for Bordetella persistence, specifically within the LRT (38). This system is composed of a putative sensor kinase, PlrS, and a DNA binding response regulator, PlrR. The genes encoding PlrSR are highly conserved among pathogenic Bordetella and are 99% homologous between B. pertussis and B. bronchiseptica, suggesting the importance of this system for Bordetella gene regulation. In a rat model of colonization, B. bronchiseptica containing mutations predicted to abrogate PlrS kinase activity is rapidly cleared from the LRT similar to ∆bvgS mutants (38). Attempts to delete plrR have been unsuccessful, suggesting that PlrR is essential (at least under standard laboratory growth conditions). In addition, our collaborators have observed an increase in BvgAS- dependent virulence factor production in B. bronchiseptica when grown with 5% CO2 depends on plrS, suggesting that PlrS influences BvgAS activity (69). However, the contribution of the
PlrSR system to Bordetella colonization of the mammalian host is currently unknown.
Research Objective
For this dissertation, my objective was to understand why the putative PlrSR two- component system is essential for Bordetella colonization and survival specifically within the mammalian lower respiratory tract. In Chapter 2, we demonstrate that PlrS is required for the maintenance of BvgAS activity in the lungs of mice, indicating that PlrSR, and not BvgAS, coordinates virulence specifically in the LRT. Moreover, our data indicate that PlrSR may regulate genes that are required for persistence in the LRT independent of BvgAS. We also show, in Chapter 3, that the Per-Arnt-Sim (PAS) domain of BvgS is required for BvgS
7 inactivation in the absence of PlrS in the LRT, indicating that the PAS domain is important for the PlrSR-BvgAS connection and functions as an independent signaling domain. In Chapter 4, we hypothesize that PlrSR controls the expression of high-affinity cytochrome oxidases
(HACOs) that are required for bacterial respiration and maintenance of BvgAS activity in the
LRT. We demonstrate that two of four HACOs contribute to LRT colonization. However,
BvgAS activity is unaffected by the loss of these HACOs and it is unknown if PlrSR regulates the expression of any HACO encoding genes. Overall, this body of work contributes to the understanding of Bordetella virulence in mammalian hosts.
8 REFERENCES
1. Kilgore PE, Salim AM, Zervos MJ, Schmitt H-J (2016) Pertussis: Microbiology, Disease, Treatment, and Prevention. Clinical Microbiology Review 29:449–486.
2. Cherry JD (2012) Epidemic Pertussis in 2012 — The Resurgence of a Vaccine- Preventable Disease. New England Journal of Medicine 367:785–787.
3. Cherry JD (2019) The 112-Year Odyssey of Pertussis and Pertussis Vaccines-Mistakes Made and Implications for the Future. Journal of the Pediatric Infectious Disease Society piz005, https://doi.org/10.1093/jpids/piz005
4. Warfel JM, Edwards KM (2015) Pertussis vaccines and the challenge of inducing durable immunity. Current Opinion in Immunology 35:48–54.
5. Witt MA, Katz PH, Witt DJ (2012) Unexpectedly Limited Durability of Immunity Following Acellular Pertussis Vaccination in Preadolescents in a North American Outbreak. Clinical Infectious Diseases 54:1730–1735.
6. Edwards KM, Berbers GA (2014) Immune Responses to Pertussis Vaccines and Disease. The Journal of Infectious Diseases 209:S10–S15.
7. Warfel JM, Zimmerman LI, Merkel TJ (2014) Acellular pertussis vaccines protect against disease but fail to prevent infection and transmission in a nonhuman primate model. Proceedings of the National Academy of Sciences of the United States of America 111:787–792.
8. Trainor EA, Nicholson TL, Merkel TJ (2015) Bordetella pertussis transmission. Pathogens and Disease 73:ftv068.
9. Zimmerman LI, Papin JF, Warfel J, Wolf RF, Kosanke SD, Merkel TJ (2018) Histopathology of Bordetella pertussis in the Baboon Model. Infection and Immunity 86:e00511-18.
10. Pinto MV, Merkel TJ (2017) Pertussis disease and transmission and host responses: insights from the baboon model of pertussis. The Journal of Infection 74:S114–S119.
11. Vaccines Help Protect against Whooping Cough | CDC. (2019, January 15). Retrieved June 11, 2019 from https://www.cdc.gov/pertussis/vaccines.html.
12. Mazzilli S, Tavoschi L, Lopalco P (2018) Tdap vaccination during pregnancy to protect newborns from pertussis infection. Annali di igiene: medicina preventia e di comunita 30:346–363.
13. 2017 Final Pertussis Surveillance Report | CDC (2018, December). Retrieved June 11, 2019 from https://www.cdc.gov/pertussis/downloads/pertuss-surv-report-2017.pdf.
9 14. VanderEnde K, Gacic-Dobo M, Diallo MS, Conklin LM, Wallace AS (2018) Global Routine Vaccination Coverage - 2017. MMWR Morbidity and Mortally Weekly Report 67:1261–1264.
15. Pertussis | WHO (2018, November 06). Retrieved June 11, 2019, from https://www.who.int/immunization/monitoring_surveillance/burden/vpd/surveillance_type /passive/pertussis/en/.
16. Mattoo S, Cherry JD (2005) Molecular Pathogenesis, Epidemiology, and Clinical Manifestations of Respiratory Infections Due to Bordetella pertussis and Other Bordetella Subspecies. Clinical Microbiology Reviews 18:326–382.
17. Vittucci A, Vennarucci V, Grandin A, Russo C, Lancella L, Tozzi A, Bartuli A, Villani A (2016) Pertussis in infants: an underestimated disease. BMC Infectious Diseases 16:414.
18. Melvin JA, Scheller EV, Miller JF, Cotter PA (2014) Bordetella pertussis pathogenesis: current and future challenges. Nature Reviews Microbiolgy 12:nrmicro3235.
19. Mattoo S, Foreman-Wykert A, Cotter P, Miller J (2001) Mechanisms of Bordetella pathogenesis. Frontiers in Bioscience: a Journal and Virtual Library 6:E168-86.
20. Cotter P, Yuk M, Mattoo S, Akerley B, Boschwitz J, Relman D, Miller J (1998) Filamentous hemagglutinin of Bordetella bronchiseptica is required for efficient establishment of tracheal colonization. Infection and Immunity 66:5921–9.
21. Scheller EV, Cotter PA (2015) Bordetella filamentous hemagglutinin and fimbriae: critical adhesins with unrealized vaccine potential. Pathogens and Disease 73:ftv079.
22. Scheller EV, Melvin JA, Sheets AJ, Cotter PA (2015) Cooperative Roles for Fimbria and Filamentous Hemagglutinin in Bordetella Adherence and Immune Modulation. Mbio 6:e00500-15.
23. Nicholson TL, Brockmeier SL, Loving CL (2009) Contribution of Bordetella bronchiseptica Filamentous Hemagglutinin and Pertactin to Respiratory Disease in Swine. Infection and Immunity 77:2136–2146.
24. Carbonetti NH (2016) Pertussis leukocytosis: mechanisms, clinical relevance and treatment. Pathogens and Disease 74:ftw087.
25. Carbonetti NH (2015) Contribution of pertussis toxin to the pathogenesis of pertussis disease. Pathogens and Disease 73:ftv073.
26. Connelly CE, Sun Y, Carbonetti NH (2012) Pertussis Toxin Exacerbates and Prolongs Airway Inflammatory Responses during Bordetella pertussis Infection. Infection and Immunity 80:4317–4332.
10 27. Cannella SE, Enguéné V, Davi M, Malosse C, Pérez A, Chamot-Rooke J, Vachette P, Durand D, Ladant D, Chenal A (2017) Stability, structural and functional properties of a monomeric, calcium–loaded adenylate cyclase toxin, CyaA, from Bordetella pertussis. Scientific Reports-uk 7:42065.
28. Ahmad J, Cerny O, Linhartova I, Masin J, Osicka R, Sebo P. 2016. cAMP signalling of Bordetella adenylate cyclase toxin through the SHP‐1 phosphatase activates the BimEL‐ Bax pro‐apoptotic cascade in phagocytes. Cell Microbiol 18:384–398. 29. Masin J, Osicka R, Bumba L, Sebo P (2015) Bordetella adenylate cyclase toxin: a unique combination of a pore-forming moiety with a cell-invading adenylate cyclase enzyme. Pathogens and Disease 73:ftv075.
30. Abe A, Nishimura R, Kuwae A (2017) Bordetella effector BopN is translocated into host cells via its N‐terminal residues. Microbiology and Immunology 61:206–214.
31. Kuwae A, Momose F, Nagamatsu K, Suyama Y, Abe A (2016) BteA Secreted from the Bordetella bronchiseptica Type III Secetion System Induces Necrosis through an Actin Cytoskeleton Signaling Pathway and Inhibits Phagocytosis by Macrophages. PLoS One 11:e0148387.
32. Ahuja U, Shokeen B, Cheng N, Cho Y, Blum C, Coppola G, Miller JF (2016) Differential regulation of type III secretion and virulence genes in Bordetella pertussis and Bordetella bronchiseptica by a secreted anti-σ factor. Proceedings of the National Academy of Sciences of the United States of America 113:2341–2348.
33. Nicholson TL, Brockmeier SL, Loving CL, Register KB, Kehrli ME, Shore SM (2014) The Bordetella bronchiseptica Type III Secretion System Is Required for Persistence and Disease Severity but Not Transmission in Swine. Infection and Immunity 82:1092–1103.
34. Yuk M, Harvill ET, Cotter PA, Miller JF (2000) Modulation of host immune responses, induction of apoptosis and inhibition of NF‐κB activation by the Bordetella type III secretion system. Molecular Microbiology 35:991–1004.
35. Diphtheria, Tetanus, and Whooping Cough Vaccination | What You Should Know | CDC (2018, December 17). Retrieved June 11, 2019, from https://www.cdc.gov/vaccines/vpd/dtap-tdap-td/public/index.html.
36. Diavatopoulos DA, Cummings CA, houls L, Brinig MM, Relman DA, Mooi FR (2005) Bordetella pertussis, the Causative Agent of Whooping Cough, Evolved from a Distinct, Human-Associated Lineage of B. bronchiseptica. PLoS Pathogens 1:e45.
11 37. Parkhill J, Sebaihia M, Preston A, Murphy LD, Thomson N, Harris DE, Holden MT, Churcher CM, Bentley SD, Mungall KL, Cerdeño-Tárraga AM, Temple L, James K, Harris B, Quail MA, Achtman M, Atkin R, Baker S, Basham D, Bason N, Cherevach I, Chillingworth T, Collins M, Cronin A, Davis P, Doggett J, Feltwell T, Goble A, Hamlin N, Hauser H, Holroyd S, Jagels K, Leather S, Moule S, Norberczak H, O’Neil S, Ormond D, Price C, Rabbinowitsch E, Rutter S, Sanders M, Saunders D, Seeger K, Sharp S, Simmonds M, Skelton J, Squares R, Squares S, Stevens K, Unwin L, Whitehead S, Barrell BG, Maskell DJ (2003) Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nature Genetics 35:ng1227.
38. Kaut CS, Duncan MD, Kim J, Maclaren JJ, Cochran KT, Julio SM (2011) A Novel Sensor Kinase Is Required for Bordetella bronchiseptica To Colonize the Lower Respiratory Tract. Infection and Immunity 79:3216–3228.
39. Moon K, Bonocora RP, Kim DD, Chen Q, Wade JT, Stibitz S, Hinton DM (2017) The BvgAS Regulon of Bordetella pertussis. Mbio 8:e01526-17.
40. Decker KB, James TD, Stibitz S, Hinton DM (2012) The Bordetella pertussis model of exquisite gene control by the global transcription factor BvgA. Microbiology 158:1665– 1676.
41. Kinnear SM, Marques RR, Carbonetti NH (2001) Differential Regulation of Bvg- Activated Virulence Factors Plays a Role in Bordetella pertussis Pathogenicity. Infection and Immunity 69:1983–1993.
42. Bock A, Gross R (2001) The BvgAS two-component system of Bordetella spp.: a versatile modulator of virulence gene expression. International Journal of Medical Microbiology 291:119–130.
43. Vergara-Irigaray N, Chávarri-Martínez A, Rodríguez-Cuesta J, Miller JF, Cotter PA, de Tejada G (2005) Evaluation of the Role of the Bvg Intermediate Phase in Bordetella pertussis during Experimental Respiratory Infection. Infection and Immunity 73:748–760.
44. Cotter PA, Miller JF (1997) A mutation in the Bordetella bronchiseptica bvgS gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvg‐regulated antigens. Molecular Microbiology 24:671–685.
45. Beier D, Fuchs T, Graeff-Wohlleben H, Gross R (1996) Signal transduction and virulence regulation in Bordetella pertussis. Microbiologica (Madrid, Spain) 12:185–96.
46. Cotter P, Miller J (1994) BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infection and Immunity 62:3381–90.
12 47. Merkel T, Stibitz S, Keith J, Leef M, Shahin R (1998) Contribution of regulation by the bvg locus to respiratory infection of mice by Bordetella pertussis. Infection and Immunity 66:4367–73.
48. de Tejada G, Miller JF, Cotter PA (1996) Comparative analysis of the virulence control systems of Bordetella pertussis and Bordetella bronchiseptica. Molecular Microbiology 22:895–908.
49. Uhl MA, Miller JF (1995) Bordetella pertussis BvgAS virulence control system. In Hoch J, Silhavy T (ed). Two-component signal transduction. American Society for Microbiology. 333-349. 10.1128/9781555818319.ch21.
50. Cotter PA, Jones AM (2003) Phosphorelay control of virulence gene expression in Bordetella. Trends in Microbiology 11:367–373.
51. Uhl M, Miller J (1994) Autophosphorylation and phosphotransfer in the Bordetella pertussis BvgAS signal transduction cascade. Proceedings of the National Academy of Sciences of the United States of America 91:1163–1167.
52. Williams CL, Boucher PE, Stibitz S, Cotter PA (2005) BvgA functions as both an activator and a repressor to control Bvgi phase expression of bipA in Bordetella pertussis. Molecular Microbiology 56:175–188.
53. Jones AM, Boucher PE, Williams CL, Stibitz S, Cotter PA (2005) Role of BvgA phosphorylation and DNA binding affinity in control of Bvg‐mediated phenotypic phase transition in Bordetella pertussis. Molecular Microbiology 58:700–713.
54. Perraud A-L, Rippe K, Bantscheff M, Glocker M, Lucassen M, Jung K, Sebald W, Weiss V, Gross R (2000) Dimerization of signaling modules of the EvgAS and BvgAS phosphorelay systems. Biochimica et Biophysica Acta.1478:341–354.
55. Zu T, Manetti R, Rappuoli R, Scarlato V (1996) Differential binding of BvgA to two classes of virulence genes of Bordetella pertussis directs promoter selectivity by RNA polymerase. Molecular Microbiology 21:557–565.
56. Steffen P, Goyard S, Ullmann A (1996) Phosphorylated BvgA is sufficient for transcriptional activation of virulence-regulated genes in Bordetella pertussis. The EMBO Journal 15:102–9.
57. Uhl AM, Miller JF (1996) Central Role of the BvgS Receiver as a Phosphorylated Intermediate in a Complex Two-component Phosphorelay. The Journal of Biological Chemistry 271:33176–33180.
58. Stainer D, Scholte M (1970) A Simple Chemically Defined Medium for the Production of Phase I Bordetella pertussis. Microbiology 63:211–220.
13 59. Hulbert RR, Cotter PA (2009) Current Protocols in Microbiology. Current Protocols in Microbiology Chapter 4:4B.1.1-4B.1.9.
60. Akerley B, Monack D, Falkow S, Miller J (1992) The bvgAS locus negatively controls motility and synthesis of flagella in Bordetella bronchiseptica. Journal of Bacteriology 174:980–990.
61. Taylor-Mulneix DL, Bendor L, Linz B, Rivera I, Ryman VE, Dewan KK, Wagner SM, Wilson EF, Hilburger LJ, Cuff LE, West CM, Harvill ET (2017) Bordetella bronchiseptica exploits the complex life cycle of Dictyostelium discoideum as an amplifying transmission vector. PLoS Biology 15:e2000420.
62. Dupré E, Lesne E, Guérin J, Lensink MF, Verger A, de Ruyck J, Brysbaert G, Vezin H, Locht C, Antoine R, Jacob-Dubuisson F (2015) Signal Transduction by BvgS Sensor Kinase Binding of modulator nicotinate affects the conformation and dynamics of the entire periplasmic moiety. The Journal of Biological Chemistry 290:23307–23319.
63. Prugnola A, Aricò B, Manetti R, Rappuoli R, Scarlato V (1995) Response of the bvg regulon of Bordetella pertussis to different temperatures and short-term temperature shifts. Microbiology 141:2529–2534.
64. Scarlato V, Rappuoli R (1991) Differential response of the bvg virulence regulon of Bordetella pertussis to MgSO4 modulation. Journal of Bacteriology 173:7401–7404.
65. Stockbauer KE, Fuchslocher B, Miller JF, Cotter PA (2001) Identification and characterization of BipA, a Bordetella Bvg‐intermediate phase protein. Molecular Microbiology 39:65–78.
66. Scarlato V, Prugnola A, Aricó B, Rappuoli R (1990) Positive transcriptional feedback at the bvg locus controls expression of virulence factors in Bordetella pertussis. Proceedings of the National Academy of Sciences of the United States of America 87:6753–6757.
67. Miller J, Johnson S, Black W, Beattie D, Mekalanos J, Falkow S (1992) Constitutive sensory transduction mutations in the Bordetella pertussis bvgS gene. Journal of Bacteriology 174:970–979.
68. Akerley BJ, Cotter PA, Miller JF (1995) Ectopic expression of the flagellar regulon alters development of the Bordetella-host interaction. Cell 80:611–620.
69. Hester SE, Lui M, Nicholson T, Nowacki D, Harvill ET (2012) Identification of a CO2 Responsive Regulon in Bordetella. PLoS One 7:e47635.
14 CHAPTER 2. THE BORDETELLA PLRSR REGULATORY SYSTEM CONTROLS BVGAS ACTIVITY AND VIRULENCE IN THE LOWER RESPIRATORY TRACT1
Introduction
Caused by the human-specific, Gram-negative bacterium Bordetella pertussis, whooping cough (aka pertussis) is reemerging in the United States and other developed countries despite high vaccine coverage (1, 2). Increased incidence in recent years coincides with the switch to acellular vaccines, which induce immunity that is less durable than that induced by whole cell vaccines or by infection with B. pertussis (3-5) . Although closely related to B. pertussis,
Bordetella bronchiseptica infects nearly all mammals and typically causes more chronic, long- term respiratory infections (6). Despite these differences, B. pertussis and B. bronchiseptica produce a nearly identical set of virulence factors that includes adhesins, such as filamentous hemagglutinin (FHA) and fimbriae (FIM), and toxins, such as adenylate cyclase toxin (ACT) and a Type III Secretion System (T3SS) (2).
The BvgAS phosphorelay-type two component regulatory system (TCS) is considered the
‘master virulence control system’ in Bordetella. BvgAS differentially regulates (either directly or indirectly) hundreds of genes and at least three distinct phenotypic phases (7, 8). The Bvg+ phase occurs when the bacteria are grown at 37°C in Stainer-Scholte (SS) broth or on Bordet-Gengou
1 This chapter previously appeared as an article in PNAS. The original citation is as follows: M. Ashley Bone, Aaron J. Wilk, Andrew I. Perault, Sara A. Marlatt, Erich V. Scheller, Rebecca Anthouard, Qing Chen, Scott Stibitz, Peggy A. Cotter, Steven M. Julio. “Bordetella PlrSR regulatory system controls BvgAS activity and virulence in the lower respiratory tract” PNAS. 2017 Feb 21;114 (8) E1519-E1527; DOI:10.1073/pnas.1609565114. MAB contributed to this manuscript by assisting in the design, performance, and analysis of all research represented in figures 3-5, S4 and S7. MAB compiled and formatted all figures and tables, wrote the results and methods sections associated with figures 3-5, S4 and S7, helped to edit all other sections of the manuscript, and assisted in addressing reviewers’ comments for resubmission.
15 (BG)-blood agar and correlates with BvgAS activity. The Bvg+ phase is characterized by expression of all currently known protein virulence factor-encoding genes (referred to collectively as vags) and lack of expression of BvgAS-repressed genes (called vrgs), which includes those encoding flagella in B. bronchiseptica. The Bvg– phase occurs when the bacteria are grown at ≤26°C or when millimolar concentrations of MgSO4 or nicotinic acid are added to the growth medium (referred to as ‘modulating conditions’). The Bvg– phase is characterized by expression of vrg loci and lack of expression of vags. The Bvg-intermediate (Bvgi) phase occurs at intermediate temperatures or in the presence of low concentrations of MgSO4 or nicotinic acid
(9). It is characterized by expression of vags that contain high affinity BvgA binding sites at their promoters (such as fhaB, encoding FHA, fimBCD, encoding the FIM biogenesis proteins, and bvgAS itself), lack of expression of vags with low-affinity BvgA binding sites (such as cyaABDE, encoding ACT and ptxA-E, encoding pertussis toxin), lack of expression of vrgs, and maximal expression of bipA, which encodes an outer membrane protein of unknown function (9-
11). Although BvgAS activity is altered by temperature, MgSO4 and nicotinic acid in vitro, the true signals it senses in nature are unknown.
B. pertussis and B. bronchiseptica strains containing loss-of-function mutations in bvgAS are avirulent, while strains containing mutations that render BvgAS active even under modulating conditions in vitro are indistinguishable from wild-type bacteria in their ability to cause respiratory tract infections (12-14). Characterization of antibody responses following infection and analyses using recombination-based reporters of gene expression indicate that modulation to the Bvg– phase does not occur during infection (12, 15, 16). Studies with strains that produce Bvg– phase factors ectopically in the Bvg+ phase have demonstrated the importance of BvgAS-mediated repression of gene expression in vivo (14, 17). Taken together, these results
16 have been interpreted to indicate that the Bvg+ phase is both necessary and sufficient for the development of respiratory infection by Bordetella. Moreover, these data, together with the fact that the phenotypic profile of wild-type bacteria grown at 37°C in SS medium or on BG agar
(Bvg+ phase conditions) is identical to that of mutants containing bvgS mutations that render
BvgS insensitive to modulating conditions, have led to the conclusion that these in vitro growth conditions mimic, at least to some extent, those experienced by the bacteria in the respiratory tract.
In a survey of putative two component regulatory systems in B. bronchiseptica, we discovered a gene (BB0264) predicted to encode an NtrY-like sensor kinase that is essential for
B. bronchiseptica to colonize the trachea of rats following low-dose, low-volume intranasal inoculation and to persist in the lungs of mice following high-dose, large-volume intranasal inoculation (18). We named BB0264 plrS, for persistence in the lower respiratory tract sensor.
Subsequently, Hester et al. reported the identification of a CO2 responsive regulon in Bordetella.
They hypothesized the existence of a CO2 responsive regulator and suggested that increased CO2 may be sensed by the bacteria as a cue indicating their localization in the lower respiratory tract
(LRT) (19). Here, we show that plrS is required for increased virulence factor production in response to CO2, and that plrS is required for BvgAS to be fully active in the LRT. We also show that plrS is required for persistence in the LRT even when BvgAS is constitutively active, indicating that although BvgAS is necessary in vivo, it is not sufficient. Moreover, our data suggest the existence of genes that are expressed only in the LRT that encode previously unknown virulence factors, which may serve as new therapeutic or diagnostic targets and/or vaccine components.
17 Results
PlrS is required for enhanced BvgAS-dependent virulence-associated phenotypes in response to elevated CO2 concentrations
BvgAS-regulated virulence-associated phenotypes include adherence to epithelial cells and macrophages, which is mediated by FHA (20, 21), hemolysis on blood-containing agar, which is mediated by ACT (22), and toxicity to various eukaryotic cell types in culture, which is mediated by the T3SS (23). All of these phenotypes were enhanced when wild-type (WT) B. bronchiseptica was grown at 37°C in 5% CO2 compared to growth at 37°C in ambient air (Fig.
2.1, Fig. 2.S1, and (19)). These virulence-associated phenotypes did not increase in response to
5% CO2 in the ∆plrS mutant, indicating that PlrS is required for this effect. The effect was not due to acidification of the growth medium because acidification alone, without increased CO2, did not result in increased adherence (Fig. 2.S2). These results suggest the possibility of a functional interaction between PlrS and BvgAS.
PlrS likely affects BvgAS-dependent phenotypes via PlrR
A putative response regulator, which we are naming PlrR, is encoded immediately 3’ to plrS. Attempts to disrupt or delete plrR (BB0265) were unsuccessful, suggesting plrR is essential for cell viability under the growth conditions tested. As an alternate approach to determine if
PlrS and PlrR function as a cognate TCS, we delivered a plrR allele (plrRD52E) encoding a PlrR protein in which the predicted site of phosphorylation, Asp52, was replaced with Glu, a predicted phosphomimetic (24), to the attTn7 site in WT, ∆plrS, and ∆bvgS (which harbors a deletion in bvgS) B. bronchiseptica. When grown in 5% CO2, the level of adherence of the ∆plrS strain expressing plrRD52E to L2 cells was as high as that of WT B. bronchiseptica (and WT expressing plrRD52E), demonstrating that the plrRD52E allele could complement a ∆plrS mutation and, therefore, that PlrS likely affects BvgAS-dependent virulence-associated phenotypes via PlrR
18 (Fig. 2.2). Increased adherence in the WT and ∆plrS strains expressing plrRD52E in bacteria grown in ambient air is also consistent with the D52E substitution functioning as a phosphomimetic, rendering PlrR constitutively active (Fig. 2.2). Lack of adherence by the ∆bvgS
D52E strain with and without the plrR allele in the presence or absence of 5% CO2 confirms that bvgS is required for adherence to host cells and that PlrRD52E does not induce a BvgAS- independent adherence activity (Fig. 2.2). These data provide evidence (but do not prove) that
PlrS and PlrR function as a canonical TCS, and that increased adherence in response to CO2 is mediated by PlrS via PlrR. However, these data do not rule out the possibility that BvgA and
PlrR interact synergistically to affect expression of some genes or that PlrS directly interacts with
BvgS while also affecting the phosphorylation state of PlrR.
Positive autoregulation of the bvgAS operon is well-documented (25-28). Nonetheless, to determine if PlrS affects BvgAS activity by controlling bvgAS transcription, we introduced a
PbvgA-gfp transcriptional reporter into the attTn7 site of WT and ∆plrS B. bronchiseptica and measured GFP activity in bacteria grown at 37°C with and without 5% CO2. Under all conditions tested, the levels of GFP, and therefore the expression of bvgAS, was not significantly different between WT and the ∆plrS strains (Fig. 2.S3). GFP levels in the ∆bvgS strain reflect activity from the bvgA P2 promoter, which is expressed at a low level under Bvg– phase conditions
(providing the cell with a low amount of BvgAS so that it can respond, via positive autoregulation, when Bvg+ phase conditions are encountered) (29). This low level expression of
PbvgA was not affected by the ∆plrS mutation. Together, these data suggest that PlrS, via PlrR, exerts its effects on BvgAS activity post-transcriptionally.
19 B. bronchiseptica lacking plrS modulate to the Bvg– phase within the lower respiratory tract
Based on the functional link between PlrS and BvgAS (Fig. 2.1) and the similarly rapid clearance of B. bronchiseptica ∆plrS and ∆bvgS mutants from the LRT of mice (13, 18), we hypothesized that PlrS may influence BvgAS activity within the host. To test this hypothesis, we used two reporter systems developed in our lab. pGFLIP contains a recombinase-based reporter system, similar to RIVET (15). Expression of flp, encoding FLP recombinase, results in excision of gfp and nptII (encoding kanamycin resistance, Kmr) genes located between FLP recombinase target (FRT) sites and conversion of the bacteria from GFP+ and Kmr to GFP– and Kms. In
– – pGFLIP-flaA, the Bvg phase-specific PflaA promoter is located 5’ to flp and conversion to GFP
(and Kms) indicates that the bacteria have expressed the Bvg– phase at some point during the experiment.
By contrast with pGFLIP, which reports on the history of the bacteria, the pBAM plasmid reports on the status of the bacteria at the time of plating (29). The pBAM plasmid integrates within the bvgAS promoter region and causes the P2 promoter to be expressed at a lower-than- normal level such that, when bacteria are growing under Bvg– phase conditions, the amount of
BvgAS in a small proportion of cells in the population (~5%) is below the threshold required for positive autoregulation, “trapping” these cells in the Bvg– phase (29). When WT B. bronchiseptica containing the pBAM plasmid are grown under Bvg– phase conditions and then plated onto BG-blood agar and incubated at 37°C (Bvg+ phase conditions), the “trapped” bacteria yield colonies that are larger, flatter, and less hemolytic than colonies formed by Bvg+ phase bacteria because these colonies contain ~5% phenotypically Bvg– phase bacteria (as the colony grows, ~95% of the daughter cells produce enough BvgAS to convert to the Bvg+ phase, while
~5% remain phenotypically Bvg– phase). We previously referred to these colonies, which are easily scored by simple visual inspection, as large colony variants (LCVs) (29). However,
20 because these colonies result from phenotypic bistability and not a genetic change, it is more appropriate to refer to them as large colony phenotypes (LCPs), which we will do henceforth.
While all LCPs result from a founder bacterium that was Bvg– phase at the time of plating, ~95% of bacteria that contain pBAM and are Bvg– phase at the time of plating form typical Bvg+ phase-appearing (non-LCP) colonies (29). Hence, although the presence of LCPs indicates that bacteria have modulated to the Bvg– phase, it vastly underestimates the number of bacteria that are Bvg– phase at the time of plating.
+ When grown at 37°C without addition of MgSO4 to the medium (Bvg phase conditions), wild-type and ∆plrS strains containing both reporter systems maintained GFP fluorescence and no LCPs formed (Fig. 2.S4A and 2.S4B), indicating that neither strain modulated to the Bvg– phase. When switched from Bvg+ phase growth conditions to Bvg– phase growth conditions, both strains lost GFP fluorescence and a small proportion of LCPs formed after 24 hours (Fig. 2.S4A and 2.S4B). Both reporters, therefore, can accurately report that the bacteria modulated to the
Bvg– phase and ∆plrS mutants modulate to a similar extent as wild-type bacteria when grown in vitro.
Following intranasal inoculation of BALB/cJ mice, the numbers of colony forming units
(cfu) recovered from the nasal cavities and lungs of wild-type and ΔplrS strains containing the reporters were similar to cfu recovered of the parental strains (without reporters), indicating that the reporters do not influence virulence (Fig. 2.3A). The proportion of GFP– and LCP cfu recovered from the nasal cavities was extremely low for both strains, indicating that the bacteria did not modulate to the Bvg– phase at this site (Fig. 2.3B and 2.3C). The proportion of GFP– and
LCP cfu recovered from the lungs of mice inoculated with wild-type bacteria was also extremely low. By contrast, 40-80% of the cfu recovered from the lungs of mice inoculated with the ∆plrS
21 strain had lost GFP fluorescence and 10-80% formed LCPs by day 1 post-inoculation (Fig. 2.3B and 2.3C), indicating that a majority of these bacteria had modulated to the Bvg– phase and that a majority of these bacteria were in the Bvg– phase at the time of recovery from the lungs. These findings demonstrate that in strains lacking plrS, the BvgAS phosphorelay fails to remain active specifically within the LRT. Moreover, the fact that 10-80% of the bacteria recovered from the lungs formed LCPs (i.e., much more than 5%) indicates that the physiology of ∆plrS bacteria in the LRT is substantially different from the physiology of ∆plrS bacteria that have modulated to
– the Bvg phase in vitro by chemical modulators such as MgSO4 (see discussion).
B. bronchiseptica lacking plrS fail to activate BvgAS within the lower respiratory tract
To determine if BvgAS can transition from an inactive (Bvg– phase) to an active (Bvg+ phase) state in the absence of PlrS activity within the LRT, we inoculated mice with wild-type and ∆plrS mutants containing a pGFLIP reporter in which the Bvg+ phase-specific ptxA promoter from B. pertussis was cloned 5’ to flp. Both wild-type and ∆plrS strains activated the ptxA promoter when switched from Bvg– phase to Bvg+ phase growth conditions in vitro (Fig. 2.S5).
Similar to what has been shown in B. bronchiseptica and B. pertussis previously (15, 16), 100% of the bacteria recovered from both the nasal cavity and the lungs of mice inoculated with Bvg–
+ phase wild-type bacteria activated PptxA and therefore transitioned to Bvg phase within 24 hours post-inoculation (Fig. 2.3D and 2.3E). By contrast, although all of the cfu recovered from the nasal cavities of mice inoculated with the ∆plrS strain were GFP– by 24 hours post-inoculation, only ~80% of those recovered from the lungs were GFP– (Fig. 2.3D and 2.3E). While, based on this reporter, only a seemingly small proportion of the ∆plrS mutants failed to switch to the Bvg+ phase in vivo, it is important to note that the numbers of cfu of the ∆plrS mutant recovered from the lungs at days 1 and 3 post-inoculation were ~0.5 and 2 logs lower than the numbers initially
22 present (day 0). It is impossible to determine if the bacteria cleared from the lungs at these time points had lost GFP. However, if they remained GFP+ (indicating that they did not switch to the
Bvg+ phase) then the proportion of ∆plrS bacteria that had transitioned to the Bvg+ phase in the
LRT would in fact be far less than 1%. Together, our data indicate that full activation and maintenance of BvgAS activity in the LRT requires PlrS.
PlrS is required for B. bronchiseptica persistence in the lower respiratory tract, independent of its effects on BvgAS activity
Lack of production of BvgAS-dependent virulence factors could be the reason that plrS mutants are cleared rapidly from the LRT. To test this hypothesis, we introduced the bvgS-C3 mutation, which encodes a BvgS protein that is active even under modulating conditions in vitro
(12), into the plrS mutant, and compared this ∆plrS-bvgSc strain with the bvgSc mutant in vitro and in vivo. Like the bvgSc strain, the ∆plrS-bvgSc strain formed small, domed, hemolytic
+ – colonies characteristic of the Bvg phase on BG-blood agar containing 50 mM MgSO4 (i.e., Bvg phase conditions), indicating that BvgAS was constitutively active in the absence of plrS in vitro.
In vivo, the ∆plrS-bvgSc strain colonized and persisted in the nasal cavity similarly to the bvgSc and ΔplrS strains (Fig. 2.S6). However, the ∆plrS-bvgSc strain was cleared from the lungs as rapidly as the ∆plrS mutant (Fig 2.S6), indicating that the ∆plrS mutation is epistatic to the bvgS-
C3 mutation with regard to persistence in the LRT.
To investigate BvgAS activity in the ∆plrS-bvgSc strain, we used our pGFLIP-flaA and pBAM reporters. None of the bvgSc or ∆plrS-bvgSc colonies containing these reporters were
– GFP or displayed the LCP phenotype after growth in medium containing 50 mM MgSO4 (Fig.
2.S7), indicating their insensitivity to modulating conditions in vitro. Numbers of cfu of each strain recovered from the nasal cavities and lungs of BALB/cJ mice were similar to those of the strains lacking the pGFLIP-flaA and pBAM reporters (Fig. 2.4A). Additionally, very few, if any,
23 GFP– or LCP colonies were recovered from the nasal cavity for any strain, indicating that no bacteria had modulated to the Bvg– phase in the nasal cavity (Fig. 2.4B and 2.4C). As expected, a significant proportion of GFP– colonies and LCPs were recovered from the lungs of mice inoculated with the ∆plrS mutant on days 1 and 3, consistent with our previous results (Fig. 2.4B and 2.4C). By contrast, no GFP– or LCP colonies were recovered from the lungs of mice inoculated with the bvgSc or ∆plrS-bvgSc mutants (Fig. 2.4B and 2.4C), indicating that neither strain modulated to the Bvg– phase in the LRT. Therefore, modulation to the Bvg– phase and lack of BvgAS-activated virulence factors is not the only reason that ∆plrS mutants fail to persist in the LRT. These data indicate that PlrS is required for bacterial persistence in the LRT even when BvgAS remains active, likely because PlrR (presumably phosphorylated PlrR, PlrR~P) activates expression of one or more genes encoding proteins that are required in this environment or because PlrR~P represses expression of one or more genes that encode proteins that are detrimental to survival in this environment.
PlrS is required for survival and persistence of B. pertussis in the lower respiratory tract
The plrSR locus is highly conserved (≥99% identical) among all strains of the classic bordetellae (B. pertussis, B. bronchiseptica and B. parapertussis). We constructed a derivative of
B. pertussis strain BP536 with a large in-frame deletion mutation in plrS and compared it with wild-type BP536 in BALB/cJ mice. Both strains colonized the nasal cavity at similar levels, and were cleared from this site by day 3 post-inoculation (Fig. 2.5). However, while approximately
103 cfu of BP536 were recovered from the lungs on days 1 and 3 post inoculation, significantly fewer BP536ΔplrS cfu were recovered from this site at these time points (Fig. 2.5). These data indicate that similar to B. bronchiseptica, plrS is required for the survival and persistence of B. pertussis specifically in the lower respiratory tract.
24 Discussion
BvgAS has been considered the master virulence regulator in Bordetella since its identification in 1983 (30) and demonstration of its penetrance by subsequent mutagenesis and genome-wide analyses (8, 31, 32). Our new data indicate, however, that in the LRT, BvgAS activity depends on PlrS, likely via the activity of PlrR. Moreover, PlrS(R) is required for bacterial survival in the LRT even when BvgS is rendered constitutively active, strongly suggesting that one or more PlrSR-dependent, BvgAS-independent genes (or genes that require both PlrSR and BvgAS) is required for bacterial survival at this site. PlrS(R) is therefore at least as important for Bordetella virulence as BvgAS.
Why is PlrS(R) required for bacterial persistence in the LRT? PlrSR belongs to the NtYX family of TCS. NtrY family proteins, including PlrS, are predicted to contain three transmembrane domains at their N-termini, followed by a periplasmically-located PhoP-DcuS-
CitA (PDC) domain, another transmembrane domain, then cytoplasmically-located HAMP, Per-
Arnt-Sim (PAS) and HisKA-type histidine kinase domains (Fig 2.6). NtrY of Brucella abortus has been shown to bind heme via its PAS domain and to function as a redox sensor, becoming active as a kinase in response to anaerobiosis (33). NtrX family response regulators contain N- terminal receiver and C-terminal DNA binding domains. In Neisseria gonorrhoeae and
Rhodobacter capsulatus, the ntrX genes are required for induction of high-affinity cytochrome oxidases, which are required for bacterial growth under low oxygen conditions (34). Our data indicate that PlrS is required specifically in the LRT, an environment that is low in oxygen and high in CO2. Although we have been unable to delete plrR in vitro, our experiments using
PlrRD52E indicate that PlrS affects BvgAS-dependent phenotypes in vitro via PlrR (providing evidence that PlrS and PlrR function as a TCS). It seems likely that PlrS functions through PlrR in vivo as well. By analogy with the few other NtrYX family members that have been studied so
25 far, we hypothesize that PlrS senses low oxygen (and perhaps increased CO2) in the LRT, phosphorylates PlrR, and that PlrR~P activates expression of one or more of the high-affinity cytochrome oxidase-encoding loci present in B. bronchiseptica (and B. pertussis) (35), allowing the bacteria to respire in this environment (Fig. 2.6). We note, however, that NtrY family members, including PlrS, contain HisKA-type DHp domains with ExxN motifs that suggest that these proteins possess both kinase and phosphatase activities (36-38). Although our data suggest that PlrS may function to phosphorylate PlrR in vitro, especially in 5% CO2, the contributions of its predicted kinase and phosphatase activities in vivo cannot be predicted from our current data.
We are currently investigating the role of PlrS activities in vitro and in vivo.
Why is PlrS(R) required for BvgAS activity in the LRT? Positive autoregulation by
BvgAS has been well-characterized (25-28, 39) and we showed here that bvgAS expression in
c both ambient air and 5% CO2 is not dependent on plrS. Our experiments with the bvgS mutant further indicate that bvgAS expression is not dependent on PlrS(R) in vivo because BvgAS in the
∆plrS-bvgSc strain, which contains a single nucleotide substitution in bvgS, rendering the BvgS protein constitutively active, was active in the LRT. If bvgAS transcription required PlrSR, the
∆plrS mutation would be epistatic to the bvgS-C3 mutation. Our data therefore rule out the possibility that PlrS(R) controls BvgAS activity by controlling bvgAS transcription. We hypothesize that instead, PlrSR controls expression of one or more genes that encode proteins required for BvgS activity specifically in the LRT. BvgS contains three predicted signal-sensing domains; two periplasmically-located venus fly-trap (VFT) domains and a cytoplasmically- located PAS domain (40, 41). While the VFT domains appear to convert BvgS into a phosphatase that dephosphorylates BvgA in response to modulating conditions (i.e., MgSO4 or nicotinic acid) (42-44), a role for the PAS domain has not been established. However,
26 biochemical analyses using the cytoplasmic portion of BvgS suggested that the redox state of ubiquinone could affect BvgS kinase activity (45). PlrSR-dependent production of high-affinity cytochrome oxidases would both allow electron transport-coupled oxidative phosphorylation to occur in the LRT, which is required for both ATP production (and hence cell viability), and prevent the accumulation of reduced ubiquinone, which could inactivate BvgS. This model is consistent with that proposed for the ArcB protein of Escherichia coli, which is activated by low oxygen conditions (46, 47). If true, this model would predict that a role for the PAS domain in sensing signals in vitro may have been missed because the activity of low-affinity (high efficiency) cytochrome oxidases present under all of the conditions tested would keep reduced ubiquinone levels at a minimum. These low-affinity cytochrome oxidases are also likely present and sufficient for respiration in the URT, making BvgS activity and bacterial survival at this site independent of PlrS.
Why was the proportion of LCPs recovered from the lungs of mice inoculated with the
∆plrS strain so much higher than the proportion obtained after switching the bacteria from Bvg– phase conditions to Bvg+ phase conditions in vitro? Our previous studies showed that the reason that ~5% of bacteria containing the pBAM plasmid integrated at the bvgAS promoter region form
LCPs when shifted from Bvg– phase conditions to Bvg+ phase conditions in vitro, is that activity of the P2 promoter in this strain is decreased such that ~5% of the bacteria have BvgAS levels below the threshold required to respond to Bvg+ phase conditions when they are encountered. It appeared, therefore, that the maximum proportion of LCPs that would form from a population of pBAM-containing bacteria in which 100% of the bacteria had modulated to the Bvg– phase was about 5%. We were surprised, therefore, to find that the proportion of LCPs formed after recovery of the ∆plrS mutant from the lungs of mice was up to 80%. Given that the activity of the P2
27 promoter is already extremely low, it seems unlikely that P2 promoter activity in the ∆plrS mutant is substantially lower in the LRT than under Bvg– phase conditions in vitro. A more likely possibility is that the physiology of the ∆plrS mutant in the LRT is substantially different from the physiology of the ∆plrS mutant growing under Bvg– phase conditions in vitro (and from WT bacteria in the LRT, which do not modulate to the Bvg– phase), and that this altered physiology prevents or delays BvgS from reactivating upon exposure to Bvg+ phase conditions in vitro. If
PlrS(R) controls expression of cytochrome oxidases in the LRT, and if BvgS is sensitive to the redox state of ubiquinone, then BvgS would be inactive in a plrS mutant in the LRT and would not become active again until cytochrome oxidase activity reached levels sufficient to reoxidize ubiquinone pools, which, in the case of a plrS mutant, could require expression of genes encoding low-affinity cytochrome oxidases, translation of proteins, and assembly of enzymatic complexes in the membrane after the bacteria are shifted to Bvg+ phase conditions in ambient air. This delay could account for the substantially higher proportions of LCPs formed by the plrS mutant recovered from the LRT compared to the proportion formed after growth in vitro.
Disproving the long-held paradigm that the Bvg+ phase is sufficient for respiratory infection and evidence that virulence factors that require PlrS(R) independently of (or codependently with) BvgAS exist are important results from a translational medicine perspective. B. bronchiseptica and B. pertussis are sufficiently closely related to be considered members of the same species (35), and several vags have been shown to be functionally interchangeable (48-51). As in B. bronchiseptica, a B. pertussis plrS mutant was defective in persistence in the LRT. Our model for the role of PlrSR during infection based on studies with B. bronchiseptica is therefore likely to apply to B. pertussis as well. In addition to mounting evidence that acellular and whole cell vaccines provide suboptimal protection that is less durable
28 than that induced by infection with B. pertussis, recent data from studies with baboons indicate that although both vaccines protect against disease, neither protects against colonization (52).
Moreover, baboons vaccinated with an acellular vaccine and then challenged with B. pertussis were able to transmit the disease to naïve animals, even though they exhibited no signs of illness
(52). The fact that infection induces a mixed Th1/Th17-type immune response and acellular vaccines induce a strong Th2-type immune response (4, 53-56) suggests that reformulation of acellular vaccines with adjuvants to induce a Th1/Th17 response is a reasonable approach to controlling the reemergence of pertussis. However, the phenomenon of epitope-linked suppression would likely render such vaccines ineffective in individuals previously vaccinated with acellular vaccines and perhaps also in those vaccinated with whole cell vaccines, which are prepared from in vitro grown bacteria. Inclusion of antigens not present in previous vaccines would avoid this problem. The existence of virulence factors that are produced only in the host during infection, as suggested by our data, is significant from this translational medicine perspective. Antigens that are produced only during infection could also be important diagnostically as a means to distinguish individuals who have been vaccinated from those who have been infected. Finally, PlrSR itself, and factors it controls, may be exploitable as therapeutic targets.
Materials and Methods
Growth media and bacterial strains
Escherichia coli was grown in lysogeny broth (LB) or on LB agar at 37°C. Wild-type
Bordetella bronchiseptica RB50 and Bordetella pertussis BP536 (and their mutant derivatives) were grown at 37°C on Bordet Gengou (BG) agar (Becton Dickinson Microbiology Systems) supplemented with 7.5% or 15% defibrinated sheep blood, respectively (Hardy Diagnostics,
29 Santa Maria, CA., Colorado Serum Co., Denver, CO and Hemostat, Dixon, CA) or in Stainer-
Scholte (SS) broth with SS supplement; 100 mg/ml (2,6-O-dimethyl) cyclodextrin (Heptakis) was added to B. pertussis cultures. When necessary, media were supplemented with streptomycin (Sm) (20 μg/ml), gentamicin (Gm) (30 μg/ml), kanamycin (Km) (E. coli- 50 μg/ml or B. bronchiseptica- 125 μg/ml), or diaminopimelic acid (DAP) (300 μg/ml). To visualize hemolysis on solid media, bacteria were grown in ambient or 5% CO2 conditions for 2.5 days on
BG blood agar plates and colonies were photographed with a Canon EOS 40D digital camera in the presence of both overhead lighting and backlighting.
Construction of cloning plasmids and bacterial strains
Descriptions of each strain are given in Table S1. The strain ΔplrS-bvgSc, containing the bvgS-R570H mutation and an in-frame deletion mutation in the plrS gene, was created using plasmid pMD11 (18) in an allelic exchange method that has been previously described (50). A B. bronchiseptica strain with a disruption in the bscN gene (BB1628, which encodes the ATPase for the Type III secretion system), was created by cloning a 0.34 kb internal portion of bscN into the suicide vector pEG7, producing plasmid pSJ43, which was then integrated into the native bscN locus in the chromosome. The disruption was confirmed by PCR.
A B. pertussis 536 strain containing an in-frame deletion in the plrS (BP0571) gene was constructed by a pSS4245-based allelic exchange method such that all but the first eight and last two codons of BP0571 were deleted. Two 600-basepair DNA fragments flanking the region to be deleted were generated by PCR, and to facilitate the allelic exchange, a spectinomycin-resistant
(SpcR) synthetic DNA cassette was inserted between the two PCR products to generate plasmid pQC2053. This plasmid was conjugated into BP536, to generate a ∆BP0571::spc strain, QC3729.
To replace the SpcR-marked BP0571 deletion with an unmarked, in-frame deletion, plasmid
30 pQC2027, which had been constructed by removing the SpcR DNA cassette from pQC2053, was conjugated into strain QC3729, and an in-frame BP0571 deletion that had replaced the
BP0571::spc allele was identified by screening exconjugates for a spectinomycin-sensitive phenotype following allelic exchange. One of these was chosen as BP536ΔplrS and confirmed by PCR.
Derivatives of B. bronchiseptica that contained the pGFLIP-PflaA and pGFLIP-Pptx reporters were constructed using methods previously described (15). The pBam reporter system was delivered to the bacterial chromosome via homologous recombination (29).
In vitro adherence assays
Bacterial adherence to rat lung epithelial (L2) cells was evaluated as described (21, 48).
Bacteria were cultured in either ambient air or 5% CO2 at 37° to an OD600 of approximately 1.0.
Bacteria were added to a monolayer of L2 cells (~80% confluency) at a multiplicity of infection
(MOI) of 150. Adherence was visualized by Giemsa staining and light microscopy at 1000X magnification using a Zeiss Axiostar microscope, and quantified by counting the number of adherent bacteria and total L2 cells in at least 4 microscopic fields.
Macrophage cytotoxicity assays
J774 macrophage-like cells were grown to ~60% confluency (~1.5 x 104 cells/well) in a
96-well microtiter dish. Bacteria were cultured in either ambient air or 5% CO2 to an OD600 of
~1.0, and were then added to J774 cells at an MOI of 150. The plate was spun at 1200 x g and then allowed to incubate in a tissue culture incubator for 3 hours. Macrophage cytotoxicity was quantified by measuring lactate dehydrogenase (LDH) release using Promega’s Cytotox96 Non- reactive Cytotoxicity Assay kit and a MultiskanEX plate reader (ThermoFisher Scientific,
Waltham, MA) according to the manufacturer's instructions.
31 Bacterial adherence to J774 cells and in response to being cultured in media with decreased pH
Adherence to J774A.1 (J774) murine macrophage-like cells was performed essentially as described (48). In this study, bacteria were cultured in ambient or 5% CO2 conditions to an
OD600 of approximately 1.0 and added to J774 cells (at approximately 60% confluency) at an
MOI of 200. Adherent bacteria were labeled using sera that had been collected from an RB50- infected rat, and then recognized with an anti-rat Cy3-conjugated secondary antibody. Adherence was quantified via fluorescence microscopy by counting the number of adherent bacteria and total J774 cells in at least 4 independent microscopic fields at 400X magnification. To determine the role of pH in bacterial adherence to L2 cells, the pH of Stainer-Scholte media was adjusted to
6.8, filter sterilized, and used to culture RB50 under ambient conditions. Adherence to L2 cells was performed as described in Materials and Methods.
Evaluation of B. bronchiseptica bvgAS transcription in vitro
A transcriptional PbvgA-gfp reporter was created by PCR-amplifying the bvgAS promoter
(PbvgA, 350 bp upstream of bvgA) using the forward primer 5’-
GATCCCGGGGTAGTCTGGATAA-3’ and the reverse primer 5’-
GATAAGCTTGATAAGAAGAAT-3’. The PCR product was digested and cloned into the XmaI and HindIII restriction sites of the miniTn7-kan-gfp plasmid (57). The resulting pUC-PbvgA-gfp plasmid was mated into WT, ∆plrS, ∆bvgS, and ∆bvgS∆plrS along with pTNS3, which encodes the transposase, allowing for the reporter to integrate into the attTn7 site of the B. bronchiseptica chromosome. The resulting strains were confirmed by PCR.
To determine the level of transcription at the bvgAS promoter, reporter strains were grown on BG agar with appropriate antibiotics until colonies formed. Colonies were resuspended in 1X PBS, and this suspension was used to inoculate duplicate tubes grown overnight for ~18
32 hrs in Stainer-Scholte media with streptomycin and kanamycin either at 37°C on a roller or at
37°C shaking in the presence of 5% CO2. One hundred microliters of each culture were transferred to a well of a 96-well plate, and the OD600 and GFP (excitation A485, emission
A535) were measured on a Perkin Elmer Victor3 1420 Multilabel plate reader, and GFP expression was normalized to OD600. The experiment was performed on two separate days in duplicate, and values were averaged across all replicates.
Evaluation of B. bronchiseptica promoter activity in vitro
Strains containing pGFLIP-PptxA were grown overnight in the presence of 50 mM
MgSO4. Cells were washed twice in 1x PBS with 50 mM MgSO4 to prevent the premature
+ transition to the Bvg phase and were then inoculated into fresh SS medium without MgSO4 at a concentration of 1 x 109 cfu/ml, and incubated at 37°C for 8 h. At each time point, an aliquot of cells was removed, diluted with 1x PBS containing 50 mM MgSO4, and plated on BG-blood agar also containing 50 mM MgSO4. Plates were incubated for 48 h at 37°C, and total cfu were enumerated. The percent GFP negative colonies was determined for each plate as described in
Materials and Methods.
Strains containing pGFLIP-PflaA and pBam were grown overnight in SS medium with and without 50 mM MgSO4. After incubation at 37°C for 24 h, an aliquot of cells from each experimental condition was diluted with 1x PBS and plated on BG-blood agar. Plates were incubated for 48 h at 37°C, and total cfu were enumerated. The percent GFP negative colonies was determined for each plate as described in Materials and Methods.
Bacterial colonization of the mouse respiratory tract
Six-week-old female BALB/cJ mice from Jackson Laboratories (Bar Harbor, ME) were inoculated intranasally with 7.5 x 104 cfu B. bronchiseptica or 1.0 x 105 CFU B. pertussis in
33 50μL of phosphate-buffered saline (PBS). For all time points, right lung lobes and nasal cavities were harvested, tissues were homogenized, and the number of cfu was determined by plating dilutions of tissue homogenates on BG blood agar.
Evaluation of B. bronchiseptica phenotypic phase transition in vivo
Six-week-old female BALB/cJ mice (Jackson Laboratories, Bar Harbor, ME) were inoculated intranasally with 7.5 x 104 cfu of B. bronchiseptica pGFLIP strains in 50 μL of PBS.
For experiments utilizing the pGFLIP-PptxA reporter, bacteria were cultured in media containing
– 50mM MgSO4 to maintain the bacteria in the Bvg phase prior to mouse inoculation (15). For infections using the pGFLIP-PflaA or pBam systems, bacteria were cultured at 37° in media
+ without the addition of MgSO4 to maintain bacteria in the Bvg phase prior to mouse inoculation
(15, 29). On days 0, 1, and 3 post-inoculation, right lungs were harvested, homogenized in PBS, and plated in duplicate on BG-blood agar. For strains containing the pGFLIP-PptxA system, homogenization, dilution, and plating were carried out in the presence of 50mM MgSO4. The percent GFP– colonies and percent LCP colonies were calculated by determining the ratio of
GFP– or LCP colonies to the total number of colonies isolated.
Ethics statement
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Our protocol was approved by the University of North Carolina IACUC (Protocol ID: 13-238). All animals were properly anesthetized for inoculations, monitored regularly, and euthanized when moribund. Efforts were made to minimize suffering.
34 Statistical analysis
Statistical analysis was performed using Prism 6.0 software from GraphPad Software,
Inc. Statistical significance was determined using unpaired Student’s t test. Figures were generated using Adobe Illustrator CS6 (Adobe Systems, Inc.).
35 Figures and Tables
A.
l l
e 150 ****
c ****
2
L
r
e p
100
a
i
r
e
t
c
a
b
t 50
n
e
r
e
h
d
a
# 0 WT ∆ plrS WT ∆ plrS
37 ºC 37 ºC + 5% CO2 B. WT ∆ plrS RB515
37ºC
37ºC +
5% CO2
C. * ** 80 ** **
*
y t
i 60
c
i
x
o
t o
t 40
y C
% 20
0 WT ∆ plrS∆bscN∆bvgS WT ∆ plrS∆bscN∆bvgS 37 ºC 37 ºC + 5% CO 2
Figure 2.1. PlrS is required for Bvg-dependent phenotypes in 5% CO2 growth conditions. (A) Bacterial adherence to L2 lung epithelial cells. Wild-type (WT) and ΔplrS bacteria were cultured in ambient (37°C) or 5% CO2 (37°C + 5% CO2) conditions before inoculation at an MOI of 150 onto an L2 monolayer. The number of adherent bacteria per L2 cell was enumerated by determining the average number of bacteria and L2 cells visible from four visual fields of the microscope. Error bars represent standard deviation of the mean (SD). (B) Hemolysis on blood agar media produced from WT, ΔplrS, and RB515 (an ACT null mutant) colonies under the indicated growth condition. (C) Cytotoxicity of macrophage-like J774 cells induced by WT, ΔplrS, ΔbscN (containing an insertional disruption in the gene encoding the ATPase of the Type III Secretion System), and ΔbvgS (containing a deletion in bvgS) strains, following bacterial growth under the indicated condition. Percent cytotoxicity was calculated as the ratio of lysed J774 cells resulting from bacterial inoculation to fully lysed J774 cells, and error bars represent SD. Statistical significance (t test) is indicated with * (P < 0.05), ** (P < 0.01), *** (P < 0.001) and **** (P < 0.0001).
36
Figure 2.2. Overexpression of a phosphomimetic plrR allele rescues the ΔplrS L2 cell adherence defect. (A) L2 lung epithelial cell adherence displayed by wild type (WT), ΔplrS, WT-plrRD52E (a strain isogenic to WT that produces PlrR with the phosphomimetic D52E substitution), ΔplrS-plrRD52E (ΔplrS that produces PlrR with the phosphomimetic D52E substitution), ∆bvgS and ΔbvgS-plrRD52E (ΔbvgS that produces PlrR with the phosphomimetic D52E substitution) following bacterial growth under the indicated condition. Error bars represent standard deviation of the mean. Statistical significance (t test) is indicated with **** (P < 0.0001).
37
Figure 2.3. Without PlrS, B. bronchiseptica modulates to the Bvg– phase in the lower respiratory tract. (A) Colonization of the nasal cavity (top) and right lung (bottom) for wild type (WT; filled circles) and ΔplrS (red triangles) on days 0, 1 and 3 post inoculation. Both strains contain the plasmid reporters, pGFLIP-PflaA and pBam. Female BALB/cJ mice were inoculated with 7.5 x104 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as a short horizontal bars. Homogenate from each organ was assessed to determine in vivo bacterial modulation shown in graphs B and C. (B) Percentage of GFP– bacteria recovered from the nasal cavity and right lung for WT and ΔplrS containing pGFLIP-PflaA and pBam. GFP negativity indicates bacterial modulation. (C) Percentage of large colony phenotype (LCP) producing bacteria recovered from the nasal cavity and right lung for – WT and ΔplrS containing pGFLIP-PflaA and pBam. LCPs indicate bacteria present in the Bvg phase when plated. (D) Colonization of the nasal cavity (top) and right lung (bottom) for WT (filled circles) and ΔplrS (red triangles) containing the plasmid reporter, pGFLIP-PptxA. Homogenate from each organ was assessed to determine BvgAS activation in vivo, shown in graph E. (E) Percentage of GFP– bacteria recovered from the nasal cavity (top) and right lung
(bottom) for WT and ΔplrS containing pGFLIP-PptxA. GFP negativity indicates BvgAS activation. Statistical significance (t test) is indicated with * (P < 0.05), ** (P < 0.01), *** (P < 0.001) and **** (P < 0.0001).
38
Figure 2.4. PlrS is required for persistence of B. bronchiseptica in the LRT independent of BvgAS activity. (A) Colonization of the nasal cavity (top) and right lung (bottom) B. bronchiseptica containing constitutively-active BvgS (bvgSc; black squares), ΔplrS (red triangles), and ΔplrS-bvgSc (blue squares) on days 0, 1 and 3 post inoculation. All strains contain the plasmid reporters, pGFLIP-PflaA and pBam. Female BALB/c mice were inoculated with 7.5 x104 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as a short horizontal bars. Homogenate from each organ was assessed to determine in vivo bacterial modulation shown in graphs B and C. (B) Percentage of GFP– bacteria recovered from the nasal cavity and right lung for bvgSc, ΔplrS, and ΔplrS-bvgSc containing pGFLIP-flaA and pBam. GFP negativity indicates bacterial modulation. (C) Percentage of large colony phenotype (LCP) producing bacteria recovered from the nasal cavity c c and right lung for bvgS , ΔplrS, and ΔplrS-bvgS containing pGFLIP-PflaA and pBam. LCPs indicate bacteria present in the Bvg– phase when plated. Statistical significance (t test) is indicated with * (P < 0.05), *** (P < 0.001) and **** (P < 0.0001).
39
Figure 2.5. PlrS is required for the persistence of Bordetella pertussis in the lower respiratory tract. (A) Colonization of the nasal cavity (top) and right lung (bottom) for B. pertussis strains BP536 (filled circles) and BP536ΔplrS (red diamonds) on days 0, 1 and 3 post inoculation. Female BALB/c mice were inoculated with 1.0 x105 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as a short horizontal bars. Statistical significance (t test) is indicated with ** (P < 0.01).
40
Figure 2.6. PlrSR and BvgAS work in tandem to regulate gene expression required for Bordetella persistence in the lower respiratory tract. Model of putative PlrSR and BvgAS regulatory networks in Bordetella. The sensor kinase PlrS may be sensitive to CO2 or oxygen tension, directly or indirectly, within the lower respiratory tract environment, transmitting a signal via autophosphorylation and phosphate transfer to its putative response regulator PlrR. PlrSR activates (pags) or represses (prgs), a set of genes independent of BvgAS that are required for survival of the bacteria specifically within the LRT. PlrSR may also regulate expression of a gene(s) encoding proteins required for sustained activity of BvgAS in the LRT. If BvgS receives such a signal the sensor kinase is capable of phospho-relay transmission, activating transcription of essential virulence factors (vags) and repressing transcription of Bvg– phase genes (vrgs).
41
Figure 2.S1. Bacterial adherence to macrophage-like murine J774 cells. Wild-type (WT) and ΔplrS strains were cultured under ambient (37°C) or 5% CO2 (37°C + 5% CO2) conditions and then inoculated at an MOI of 200 onto a monolayer of J774 cells. The number of adherent bacteria per J774 cell was enumerated by determining the average number of bacteria and J774 cells visible from four visual fields of the microscope, and error bars represent standard deviation of the mean. Statistical significance (t test) is indicated with *** (P < 0.001).
Figure 2.S2. Increased adherence of wild-type B. bronchiseptica to L2 lung epithelial cells does not result from bacteria responding to lowered pH of the growth media. (A) Wild-type (WT) B. bronchiseptica was cultured in Stainer-Scholte (SS) media in ambient (no CO2) or 5% CO2 (+CO2) conditions, or in ambient conditions after the media had been adjusted to pH 6.8 (pH 6.8). The pH of SS media (7.6) will decrease to 6.8 when media without bacteria is incubated under 5% CO2 conditions. Adherence to L2 cells was enumerated by determining the average number of bacteria and L2 cells visible from four visual fields of the microscope, and error bars represent standard deviation of the mean. Statistical significance (t test) is indicated with *** (P < 0.001).
42
Figure 2.S3. PlrS does not transcriptionally regulate the expression of the bvgAS in vitro. (A) WT, ∆plrS, ∆bvgS, and ∆bvgS∆plrS with the transcriptional reporter PbvgAS-gfp (the bvgAS promoter driving expression of gfp) were cultured in Stainer-Scholte media under Bvg+ phase growth conditions at 37°C with or without 5% CO2 for ~ 18 hrs with agitation. For each strain, OD600 and GFP (excitation A485, emission A535) were measured and GFP expression was normalized to OD600. The experiment was performed twice in duplicate. GFP/OD600 values were averaged across all replicates. Statistical significance (t test) is indicated with **** (P < 0.0001).
Figure 2.S4. In vitro analysis of wild type and ΔplrS modulation using the plasmid reporters pGFLIP-flaA and pBam. Wild type (WT) and ΔplrS containing pGFLIP-flaA and pBam were cultured under Bvg+ and Bvg– phase growth conditions (SS broth without and with 50 mM MgSO4, respectively) at 37°C for ~18 hrs with agitation and subsequently plated on BG-blood solid agar to enumerate the percentage of GFP negative colonies (A) and LCPs (B). GFP negativity indicates bacterial modulation and LCPs indicate bacteria present in the Bvg– phase when plated. Statistical significance (t test) is indicated with ** (P < 0.01).
43
Figure 2.S5. In vitro analysis of wild type and ΔplrS phase transition using the plasmid reporter pGFLIP-ptxA. (A) Wild-type (WT) and ΔplrS bacteria containing pGFLIP-ptxA were cultured under Bvg+ and Bvg– phase growth conditions (SS broth without and with 50mM MgSO4, respectively) at 37°C for 8 hrs with agitation. At various time points culture samples were taken and subsequently plated on BG-blood solid agar to enumerate the percentage of GFP negative colonies over time.
Figure 2.S6. A constitutively-active bvgS mutation does not prevent rapid clearance of a ΔplrS strain in the lower respiratory tract. (A) Colonization of the nasal cavity and right lung for bvgSc (black squares), ΔplrS (red triangles), and ΔplrS-bvgSc (blue squares) strains on days 0 and 3 post inoculation. Female BALB/c mice were inoculated with 7.5 x104 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as a short horizontal bars. Statistical significance (t test) is indicated with * (P < 0.05) and **** (P < 0.0001).
44
Figure 2.S7. In vitro modulation of constitutively-active bvgS strains using the plasmid reporters pGFLIP-flaA and pBam. The strains bvgSc, ΔplrS, and ΔplrS-bvgSc containing pGFLIP-flaA and pBam were cultured under Bvg+ and Bvg– phase growth conditions (SS broth without and with 50 mM MgSO4, respectively) at 37°C for ~18 hrs with agitation and subsequently plated on BG-blood solid agar to enumerate the percentage of GFP negative colonies (A) and LCPs (B). GFP negativity indicates bacterial modulation and LCPs indicate bacteria present in the Bvg– phase when plated. Statistical significance (t test) is indicated with * (P < 0.05) and ** (P < 0.01).
45 Table 2.S1. Bacterial Strains and Plasmids Used in this Study Bacterial Strain or Description Reference Plasmid E.coli Strains BRL; DH5α Molecular cloning strain Gaithersburg, MD RHO3 Conjugation strain; Kms Δasd ΔaphA, DAP auxotroph (57)
B. bronchiseptica
Strains WT Wild-type B. bronchiseptica strain RB50; Smr (12) RB50 containing an in-frame deletion in plrS removing the codons for ΔplrS (18) amino acids 5 to 198; Smr RB515 RB50ΔcyaA (51) bvgSC RB50 containing a R570H point mutation in bvgS; Smr (12) RB50 containing a R570H point mutation in bvgS and a deletion in plrS ΔplrS-bvgSC This Study removing the codons for amino acids 5 to 198; Smr RB50::pSJ23; RB50 containing a plasmid insertion mutation in bscN ΔbscN This Study (BB1628); Gmr
B. pertussis
Strains BP536 Wild-type B. pertussis strain; Smr (58) B. pertussis strain containing an in-frame deletion in plrS from residues 9 BP536ΔplrS This Study thru 768; Smr
Plasmids pSS4245-based allelic exchange vector containing a 0.8-kb DNA fragment pMD11 This study deleting the codons for amino acids 5 to 198 of plrS pUC18-based vector with PS12-gfp and nptII flanked by FRT sequences pGFLIP-PflaA (15) and flp recombinase driven by the RB50 flaA promoter; Apr Kmr* pUC18-based vector with PS12-gfp and nptII flanked by FRT sequences pGFLIP-PptxA (15) and flp recombinase driven by the BPSM ptxA promoter; Apr, Kmr* pTNS3 Tn7 transposase expression vector containing tnsABCD; Apr (57) Plasmid that integrates into the Bordetella chromosome at the bvgAS locus pBam (29) and allows for generation of LCPs; Apr, Gmr pEG7 Suicide plasmid for B. bronchiseptica; Gmr (9) pEG7-based suicide plasmid containing a B. bronchiseptica DNA fragment pSJ23 This Study from bscN (BB1628); Gmr
* Kmr only under promoter-inactive conditions
46 REFERENCES
1. Clark TA (2014) Changing pertussis epidemiology: everything old is new again. Journal of Infectious Diseases 209(7):978–981.
2. Melvin JA, Scheller EV, Miller JF, Cotter PA (2014) Bordetella pertussis pathogenesis: current and future challenges. Nature Publishing Group 12(4):274–288.
3. Plotkin SA (2013) Complex correlates of protection after vaccination. Clinical Infectious Diseases 56(10):1458–1465.
4. Edwards KM, Berbers GAM (2014) Immune responses to pertussis vaccines and disease. Journal of Infectious Diseases 209 Suppl 1:S10–5.
5. Acosta AM, et al. (2015) Tdap vaccine effectiveness in adolescents during the 2012 Washington State pertussis epidemic. Pediatrics 135(6):981–989.
6. Mattoo S, Cherry JD (2005) Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clinical Microbiology Reviews 18(2):326–382.
7. Cotter PA, Jones AM (2003) Phosphorelay control of virulence gene expression in Bordetella. Trends in Microbiology 11(8):367–373.
8. Cummings CA, Bootsma HJ, Relman DA, Miller JF (2006) Species- and strain-specific control of a complex, flexible regulon by Bordetella BvgAS. Journal of Bacteriology 188(5):1775–1785.
9. Cotter PA, Miller JF (1997) A mutation in the Bordetella bronchiseptica bvgS gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvg-regulated antigens. Molecular Microbiology 24(4):671–685.
10. Stockbauer KE, Fuchslocher B, Miller JF, Cotter PA (2001) Identification and characterization of BipA, a Bordetella Bvg-intermediate phase protein. Molecular Microbiology 39(1):65–78.
11. Deora R, Bootsma HJ, Miller JF, Cotter PA (2001) Diversity in the Bordetella virulence regulon: transcriptional control of a Bvg-intermediate phase gene. Molecular Microbiology 40(3):669–683.
12. Cotter PA, Miller JF (1994) BvgAS-mediated signal transduction: analysis of phase- locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infection and Immunity 62(8):3381–3390.
13. Martinez de Tejada G, et al. (1998) Neither the Bvg- phase nor the vrg6 locus of Bordetella pertussis is required for respiratory infection in mice. Infection and Immunity 66(6):2762–2768.
47 14. Merkel TJ, Stibitz S, Keith JM, Leef M, Shahin R (1998) Contribution of regulation by the bvg locus to respiratory infection of mice by Bordetella pertussis. Infection and Immunity 66(9):4367–4373.
15. Byrd MS, Mason E, Henderson MW, Scheller EV, Cotter PA (2013) An improved recombination-based in vivo expression technology-like reporter system reveals differential cyaA gene activation in Bordetella species. Infection and Immunity 81(4):1295–1305.
16. Veal-Carr WL, Stibitz S (2005) Demonstration of differential virulence gene promoter activation in vivo in Bordetella pertussis using RIVET. Molecular Microbiology 55(3):788–798.
17. Akerley BJ, Cotter PA, Miller JF (1995) Ectopic expression of the flagellar regulon alters development of the Bordetella-host interaction. Cell 80(4):611–620.
18. Kaut CS, et al. (2011) A Novel Sensor Kinase Is Required for Bordetella bronchiseptica to Colonize the Lower Respiratory Tract. Infection and Immunity 79(8):3216–3228.
19. Hester SE, Lui M, Nicholson T, Nowacki D, Harvill ET (2012) Identification of a CO2 responsive regulon in Bordetella. PLoS One 7(10):e47635.
20. Relman DA, Domenighini M, Tuomanen E, Rappuoli R, Falkow S (1989) Filamentous hemagglutinin of Bordetella pertussis: nucleotide sequence and crucial role in adherence. Proceedings of the National Academy of Sciences of the United States of America 86(8):2637–2641.
21. Cotter PA, Yuk MH, Mattoo S, Akerley BJ, Boschwitz J, Relman DA, Miller JF (1998) Filamentous hemagglutinin of Bordetella bronchiseptica is required for efficient establishment of tracheal colonization. Infection and Immunity 66(12):5921–5929.
22. Vojtova J, Kamanova J, Sebo P (2006) Bordetella adenylate cyclase toxin: a swift saboteur of host defense. Current Opinion in Microbiology 9(1):69–75.
23. Stockbauer KE, Foreman-Wykert AK, Miller JF (2003) Bordetella type III secretion induces caspase 1-independent necrosis. Cell Microbiology 5(2):123–132.
24. Smith JG, Latiolais JA, Guanga GP, Pennington JD, Silversmith RE, Bourret RB (2003) A search for amino acid substitutions that universally activate response regulators. Molecular Microbiology 51(3):887–901.
25. Scarlato V, Prugnola A, Aricó B, Rappuoli R (1990) Positive transcriptional feedback at the bvg locus controls expression of virulence factors in Bordetella pertussis. Proceedings of the National Academy of Sciences of the United States of America 87(17):6753–6757.
26. Roy CR, Miller JF, Falkow S (1990) Autogenous regulation of the Bordetella pertussis bvgABC operon. Proceedings of the National Academy of Sciences of the United States of America 87(10):3763–3767.
48 27. Boucher PE, Yang MS, Schmidt DM, Stibitz S (2001) Genetic and biochemical analyses of BvgA interaction with the secondary binding region of the fha promoter of Bordetella pertussis. Journal of Bacteriology 183(2):536–544.
28. Boucher PE, Yang MS, Stibitz S (2001) Mutational analysis of the high-affinity BvgA binding site in the fha promoter of Bordetella pertussis. Molecular Microbiology 40(4):991–999.
29. Mason E, Henderson MW, Scheller EV, Byrd MS, Cotter PA (2013) Evidence for phenotypic bistability resulting from transcriptional interference of bvgAS in Bordetella bronchiseptica. Molecular Microbiology 90(4):716–733.
30. Weiss AA, Hewlett EL, Myers GA, Falkow S (1983) Tn5-induced mutations affecting virulence factors of Bordetella pertussis. Infection and Immunity 42(1):33–41.
31. Knapp S, Mekalanos JJ (1988) Two trans-acting regulatory genes (vir and mod) control antigenic modulation in Bordetella pertussis. Journal of Bacteriology 170(11):5059–5066.
32. Hot D, Antoine R, Renauld-Mongénie G, Caro V, Hennuy B, Levillain E, Huot L, Wittmann G, Poncet D, Jacob-Dubuisson F, Guyard C, Rimlinger F, Aujame L, Godfroid E, Guiso N, Quentin-Millet MJ, Lemoine Y, Locht C (2003) Differential modulation of Bordetella pertussis virulence genes as evidenced by DNA microarray analysis. Molecular Genetics and Genomics 269(4):475–486.
33. Carrica MDC, Fernandez I, Martí MA, Paris G, Goldbaum FA (2012) The NtrY/X two- component system of Brucella spp. acts as a redox sensor and regulates the expression of nitrogen respiration enzymes. Molecular Microbiology 85(1):39–50.
34. Atack JM, Srikhanta YN, Djoko KY, Welch JP, Hasri NH, Steichen CT, Vanden Hoven RN, Grimmond SM, Othman DS, Kappler U, Apicella MA, Jennings MP, Edwards JL, McEwan AG (2013) Characterization of an ntrX mutant of Neisseria gonorrhoeae reveals a response regulator that controls expression of respiratory enzymes in oxidase-positive proteobacteria. Journal of Bacteriology 195(11):2632–2641.
35. Parkhill J, Sebaihia M, Preston A, Murphy LD, Thomson N, Harris DE, Holden MT, Churcher CM, Bentley SD, Mungall KL, Cerdeño-Tárraga AM, Temple L, James K, Harris B, Quail MA, Achtman M, Atkin R, Baker S, Basham D, Bason N, Cherevach I, Chillingworth T, Collins M, Cronin A, Davis P, Doggett J, Feltwell T, Goble A, Hamlin N, Hauser H, Holroyd S, Jagels K, Leather S, Moule S, Norberczak H, O'Neil S, Ormond D, Price C, Rabbinowitsch E, Rutter S, Sanders M, Saunders D, Seeger K, Sharp S, Simmonds M, Skelton J, Squares R, Squares S, Stevens K, Unwin L, Whitehead S, Barrell BG, Maskell DJ (2003) Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nature Genetics 35(1):32–40.
49 36. Pazy Y, Motaleb MA, Guarnieri MT, Charon NW, Zhao R, Silversmith RE (2010) Identical phosphatase mechanisms achieved through distinct modes of binding phosphoprotein substrate. Proceedings of the National Academy of Sciences of the United States of America 107(5):1924–1929.
37. Huynh TN, Stewart V (2011) Negative control in two-component signal transduction by transmitter phosphatase activity. Molecular Microbiology 82(2):275–286.
38. Zhao R, Collins EJ, Bourret RB, Silversmith RE (2002) Structure and catalytic mechanism of the E. coli chemotaxis phosphatase CheZ. Nature Structural Biology 9(8):570–575.
39. Zu T, Manetti R, Rappuoli R, Scarlato V (1996) Differential binding of BvgA to two classes of virulence genes of Bordetella pertussis directs promoter selectivity by RNA polymerase. Molecular Microbiology 21(3):557–565.
40. Elian Dupré, Herrou J, Lensink MF, Wintjens R, Vagin A, Lebedev A, Crosson S, Villeret V, Locht C, Antoine R, Jacob-Dubuisson F. (2015) Virulence Regulation with Venus Flytrap Domains: Structure and Function of the Periplasmic Moiety of the Sensor-Kinase BvgS. PLoS Pathogens 11(3): 1–21.
41. Dupré E, Wohlkonig A, Herrou J, Locht C, Jacob-Dubuisson F, Antoine R (2013) Characterization of the PAS domain in the sensor-kinase BvgS: mechanical role in signal transmission. BMC Microbiology 13(1):1–1.
42. Melton AR, Weiss AA (1989) Environmental regulation of expression of virulence determinants in Bordetella pertussis. Journal of Bacteriology 171(11):6206–6212.
43. Herrou J, Bompard C, Wintjens R (2010) Periplasmic domain of the sensor-kinase BvgS reveals a new paradigm for the Venus flytrap mechanism. Proceedings of the National Academy of Sciences of the United States of America 107(40):17351–17355.
44. Lesne E, Krammer EM, Dupre E, Locht C, Lensink MF, Antoine R, Jacob-Dubuisson F (2016) Balance between Coiled-Coil Stability and Dynamics Regulates Activity of BvgS Sensor Kinase in Bordetella. mBio 7(2):e02089–15–10.
45. Bock A, Gross R (2002) The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier. European Journal of Biochemistry 269(14):3479–3484.
46. Alvarez AF, Rodriguez C, Georgellis D (2013) Ubiquinone and Menaquinone Electron Carriers Represent the Yin and Yang in the Redox Regulation of the ArcB Sensor Kinase. Journal of Bacteriology 195(13):3054–3061.
47. Georgellis D, Kwon O, Lin EC (2001) Quinones as the redox signal for the arc two- component system of bacteria. Science (New York, NY) 292(5525):2314–2316.
50 48. Julio SM, Inatsuka CS, Mazar J, Dieterich C, Relman DA, Cotter PA (2009) Natural-host animal models indicate functional interchangeability between the filamentous haemagglutinins of Bordetella pertussis and Bordetella bronchiseptica and reveal a role for the mature C-terminal domain, but not the RGD motif, during infection. Molecular Microbiology 71(6):1574–1590.
49. Martinez de Tejada G, Miller JF, Cotter PA (1996) Comparative analysis of the virulence control systems of Bordetella pertussis and Bordetella bronchiseptica. Molecular Microbiology 22(5):895–908.
50. Inatsuka CS, Xu Q, Vujkovic-Cvijin I, Wong S, Stibitz S, Miller JF, Cotter PA (2010) Pertactin is required for Bordetella species to resist neutrophil-mediated clearance. Infection and Immunity 78(7):2901–2909.
51. Henderson MW, Inatsuka CS, Sheets AJ, Williams CL, Benaron DJ, Donato GM, Gray MC, Hewlett EL, Cotter PA (2012) Contribution of Bordetella Filamentous Hemagglutinin and Adenylate Cyclase Toxin to Suppression and Evasion of Interleukin- 17-Mediated Inflammation. Infection and Immunity 80(6):2061–2075.
52. Warfel JM, Zimmerman LI, Merkel TJ (2014) Acellular pertussis vaccines protect against disease but fail to prevent infection and transmission in a nonhuman primate model. Proceedings of the National Academy of Sciences of the United States of America 111(2):787–792.
53. Zepp F, Knuf M, Habermehl P, Schmitt JH, Rebsch C, Schmidtke P, Clemens R, Slaoui M (1996) Pertussis-specific cell-mediated immunity in infants after vaccination with a tricomponent acellular pertussis vaccine. Infection and Immunity 64(10):4078–4084.
54. Ausiello CM, Lande R, Urbani F, la Sala A, Stefanelli P, Salmaso S, Mastrantonio P, Cassone A (1999) Cell-mediated immune responses in four-year-old children after primary immunization with acellular pertussis vaccines. Infection and Immunity 67(8):4064–4071.
55. Ausiello CM, Urbani F, la Sala A, Lande R, Cassone A (1997) Vaccine- and antigen- dependent type 1 and type 2 cytokine induction after primary vaccination of infants with whole-cell or acellular pertussis vaccines. Infection and Immunity 65(6):2168–2174.
56. Ryan M, McCarthy L, Rappuoli R, Mahon BP, Mills KH (1998) Pertussis toxin potentiates Th1 and Th2 responses to co-injected antigen: adjuvant action is associated with enhanced regulatory cytokine production and expression of the co-stimulatory molecules B7-1, B7-2 and CD28. International Immunology 10(5):651–662.
57. Anderson MS, Garcia EC, Cotter PA (2012) The Burkholderia bcpAIOB genes define unique classes of two-partner secretion and contact dependent growth inhibition systems. PLoS Genetics 8(8):e1002877.
51 58. Soane MC, Jackson A, Maskell D, Allen A, Keig P, Dewar A, Dougan G, Wilson R. (2000) Interaction of Bordetella pertussis with human respiratory mucosa in vitro. Respiratory Medicine 94(8):791–799.
52
CHAPTER 3. THE BVGS PAS DOMAIN: AN INDEPENDENT SENSORY PERCEPTION MODULE IN THE BORDETELLA BRONCHISEPTICA BVGAS PHOSPHORELAY2
Introduction
Pertussis, also known as whooping cough, is a severe, highly contagious, reemerging respiratory disease (1). It is caused by the bacterium Bordetella pertussis, which infects only humans and appears to be capable of surviving only transiently outside the human respiratory tract (2). By contrast, the closely related species Bordetella bronchiseptica infects nearly all mammals and can survive long periods of time in ex vivo environments, including those with scarce nutrients such as filtered pond water and buffered saline (3, 4). Despite these differences,
B. pertussis and B. bronchiseptica produce a nearly identical set of virulence factors that are regulated at the level of transcription by functionally interchangeable BvgAS Two-Component
Regulatory Systems (TCS) (5). By activating and repressing at least four classes of genes,
BvgAS controls transition of the bacteria between three different phenotypic phases: the Bvg+ phase, which is necessary for virulence in mammals (4), the Bvg– phase, which, in B. bronchiseptica, is required for survival under nutrient-limiting conditions (4) and for interactions with non-mammalian hosts (6), and the Bvgi phase, which has been hypothesized to be important for bacterial transmission (7).
2 M. Ashley Sobran and Peggy A. Cotter. “The BvgS PAS domain: an independent sensory perception module in the Bordetella bronchiseptica BvgAS phosphorelay”. Accepted at Journal of Bacteriology. MAS contributed to this manuscript by assisting in the design, performance, and analysis of all presented research. MAS compiled and formatted all figures and tables, wrote all sections of the manuscript with the assistance of PAC, and addressed all reviewer comments with the assistance of PAC.
53
The BvgAS system is composed of an unorthodox sensor kinase, BvgS, and a response regulator, BvgA (8). BvgS contains tandem, N-terminal, periplasmic Venus Flytrap (VFT) domains, followed by a transmembrane domain, a cytoplasmic Per/Arnt/Sim (PAS) domain, a histidine kinase (HK) domain, a receiver (REC) domain, and a C-terminal, histidine phosphotransfer (Hpt) domain (Fig. 3.1A). BvgA contains an N-terminal REC domain and a C- terminal helix-turn-helix (HTH) DNA binding domain. When Bordetella are grown on Bordet-
Gengou (BG) blood agar or in Stainer-Scholte (SS) broth at 37C, BvgS autophosphorylates, and, via a His-Asp-His-Asp phosphorelay, trans-phosphorylates BvgA. BvgA~P forms homodimers capable of binding DNA and activating or repressing gene transcription (9). Under these conditions, BvgA~P levels are high and the bacteria express the Bvg+ phase, which is characterized by transcription of all known vir-activated genes (vags), including those encoding critical virulence factors (10). When Bordetella are grown at 25°C or at 37°C in the presence of millimolar concentrations of nicotinic acid (NA) or magnesium sulfate (MgSO4), BvgA is unphosphorylated (11), presumably due to the reversal of the BvgAS phosphorelay, resulting in the Bvg– phase. The Bvg– phase is characterized by the expression of genes that are repressed by
BvgA~P (termed vir-repressed genes (vrgs)) and lack of expression of vags (10). In B. bronchiseptica, flagellar regulon genes, including the flagellin-encoding gene flaA, are vrgs (12).
When Bordetella transition from the Bvg– phase to the Bvg+ phase, or when the bacteria are cultured in the presence of low concentrations of NA or MgSO4, BvgA~P levels in the cell are low, resulting in the Bvgi phase, which is characterized by repression of the vrgs, maximal expression of the intermediate phase gene bipA, and expression of vags with promoters containing high affinity BvgA~P binding sites (such as bvgAS itself and fhaB, encoding the adhesin filamentous hemagglutinin (FHA)) but not vags with promoters containing low affinity
54
BvgA~P binding sites (such as the ptx operon, which encodes pertussis toxin and its export system) (9, 13, 14). The transition from Bvg+ phase to Bvg– phase is termed phenotypic modulation.
Although the BvgAS phosphorelay and transcriptional control of the BvgAS regulon are well characterized, the natural signals that impact BvgS activity and the mechanism by which these signals are perceived and integrated by this system are unknown. Of BvgS’s three putative sensory perception domains, the periplasmic VFTs have been studied most. Structure-function analyses support a model in which VFT2 (the domain closest to the membrane) is in a closed conformation in the absence of modulating signals, and that this conformation renders BvgS active (15, 16). Hence the ‘default’ state for BvgS is one in which it is an active kinase. Binding of NA to VFT2 alters its conformation and this change is apparently transduced across the membrane, which is proposed to cause reversal of the phosphorelay, resulting in the dephosphorylation of BvgA and a shift to the Bvg– phase (17).
The role of the PAS domain in regulating BvgS activity is less understood. PAS domains are abundant in prokaryotic signal transduction proteins and have a conserved structure, which includes a core binding pocket composed of a central, five-stranded antiparallel beta sheet and flanking alpha helices (18). Despite their conserved structure, PAS domains can perceive a multitude of stimuli, either by directly binding a signal molecule or by sensing with the assistance of a co-factor, in addition to promoting protein-protein interactions that mediate signal transduction (19–22). The PAS domain of BvgS contains two perception motifs that are critical for PAS domain function in other regulatory proteins; a quinone binding motif [aliphatic-(X)3-H-
(X)2,3-(L/T/S)] and a highly conserved cysteine residue (C607) (23, 24). In vitro studies with the cytoplasmic portion of BvgS from B. pertussis showed that kinase activity was decreased in the
55
presence of an oxidized ubiquinone analog and that the histidine in the quinone binding motif
(H643) contributed to this effect (23). Jacob-Dubuisson and colleagues hypothesized that H643 may be involved in binding heme, but were unable to detect heme, or other cofactors, bound to the BvgS PAS domain (25). Their characterization of an H643A mutant of B. pertussis showed no defect in activation of the ptx promoter under aerobic conditions, but, instead, a defect in responding to NA and MgSO4. This group also investigated the importance of the conserved cysteine (C607) and found that a C607A mutant was similarly defective only in its ability to modulate in response to NA (25). Approximately one-third of BvgS homologs contain coiled- coil domains instead of PAS domains. Jacob-Dubuisson and colleagues showed that a B. pertussis mutant in which the BvgS PAS domain was replaced with the coiled-coil domain from the BvgS homolog of Enterobacter cloacae was similar to wild-type bacteria in its ability to activate ptx expression and to respond to NA (26). Taking these and other observations together, this group concluded that the role of the BvgS PAS domain is primarily to transduce signals from the VFTs to the kinase domain and that it may not function as a sensory perception domain to sense signals on its own.
Our laboratory has focused primarily on studying B. bronchiseptica because its broad host range allows us to study the role of Bordetella virulence factors and their regulation using natural host animal models (27, 28). We were motivated to investigate the role of the BvgS PAS domain during respiratory infection by our recent observation that maintenance of BvgS kinase activity in the lower respiratory tract (LRT) requires another TCS called PlrSR (29). PlrSR is a member of the NtrYX family of TCS, members of which are involved in sensing and responding to changes in redox status and anaerobiosis (30, 31). We hypothesized that, in the LRT, PlrSR controls expression of genes that contribute to electron transport-coupled oxidative
56
phosphorylation and that deletion of plrS results in an altered redox state at the cytoplasmic membrane that is sensed by BvgS, perhaps via the PAS domain, resulting in its inactivation (i.e., converting it from a kinase to a phosphatase). In this study, we constructed B. bronchiseptica mutants with amino acid substitutions in the BvgS PAS domain and characterized them in vitro and in vivo to test this hypothesis.
Results
Mutants used in this study
To investigate the role of the BvgS PAS domain during infection, and to facilitate comparison of our results with those obtained with B. pertussis, we constructed mutant derivatives of B. bronchiseptica strain RB50 containing the same mutations as those that were present in the B. pertussis BPSM strains studied by Jacob-Dubuisson and colleagues (25, 26).
Specifically, we constructed strains producing BvgS proteins in which H643 or C607 were replaced by alanine, and a strain in which the amino acids corresponding to the PAS domain were replaced with the analogous 47 amino acid (aa) region from the BvgS homolog of
Enterobacter cloacae (Fig. 3.1B and 3.1C). We also constructed a strain in which BvgS C607 was replaced with the isosteric aa serine. As controls, we included the Bvg+ and Bvg– phase- locked strains RB53 (aka BvgSc) and RB54 (aka ∆bvgS), respectively.
Contribution of the PAS domain in regulating BvgS activity in vitro
To assess BvgS activity and sensitivity to modulating chemicals in our PAS domain mutants, we used two different gfp reporters; one containing the fhaB promoter (PfhaB), which contains high-affinity BvgA~P binding sites and therefore requires only very low levels of
BvgA~P for activation, and one containing the B. pertussis ptxA promoter (PptxA), which contains low-affinity BvgA~P binding sites and requires high levels of BvgA~P for activation (9, 13, 32,
57
33). The lower-affinity BvgA~P binding sites allow the PptxA-gfp fusion to discern a broader range of BvgA~P levels (and hence BvgS kinase activities) than the PfhaB-gfp fusion. As expected, both promoters were activated in wild-type bacteria (WT), but not in the ∆bvgS
+ mutant, when grown in SS broth at 37°C (Bvg phase conditions). PfhaB-gfp expression was
c similar in the strain containing the bvgS-C3 mutation (BvgS ) to that in WT, while PptxA-gfp expression was much higher in BvgSc than in WT (Fig. 3.2A and 3.2B), suggesting that BvgS kinase activity (either autokinase activity or a subsequent step in the transfer of the phosphoryl group to the Hpt and ultimately to BvgA) is greater in BvgSc than in WT when grown in SS at
– 37°C. When the bacteria were grown in medium containing 4 mM NA or 50 mM MgSO4 (Bvg phase conditions), PfhaB-gfp and PptxA-gfp expression was very low in the wild-type and ∆bvgS strains and remained high in BvgSc, demonstrating the requirement of BvgS for activation of
C these promoters and the insensitivity of BvgS to NA and MgSO4 in BvgS (Fig. 3.2A and 3.2B).
The “PASless” mutant (BvgSEc, the strain in which the BvgS PAS domain was replaced with the analogous sequence from the BvgS homolog in E. cloacae) activated PfhaB-gfp and PptxA- gfp to a greater level than WT when grown under Bvg+ phase conditions (Fig. 3.2A and 3.2B), suggesting that the PASless BvgS, like BvgSC, is a more active kinase than wild-type BvgS.
Expression of PfhaB-gfp and PptxA-gfp was significantly decreased when BvgSEc was cultured in the presence of NA or MgSO4 compared to growth in the absence of these chemical modulators, demonstrating the ability of the PASless BvgS to sense and respond to these signals (Fig. 3.2A and 3.2B). However, expression of PfhaB-gfp and, for NA, PptxA-gfp, in BvgEc did not decrease to the same low-to-undetectable levels in response to modulators as in WT (Fig. 3.2A and 3.2B).
One explanation for these results is that the PASless BvgS is somewhat less sensitive than wild- type BvgS to MgSO4 and NA. However, as the PASless BvgS appears to be a more active
58
kinase, it is possible that it responded similarly to wild-type BvgS, but its decreased activity was still sufficient to activate these promoters to some extent, especially PfhaB, which requires only very low amounts of BvgA~P for activation. Regardless of the underlying mechanism, these data indicate that the PASless BvgS protein is capable of sensing and responding to MgSO4 and NA.
C The H643A strain activated PfhaB and PptxA similarly to BvgS and BvgSEc when cultured in SS medium at 37C, indicating that the H643A substitution does not disrupt BvgS’s ability to function as a kinase, and apparently makes it a more active kinase, in vitro (Fig. 3.2A and 3.2B).
When grown in medium containing NA or MgSO4, PfhaB-gfp and PptxA-gfp expression was significantly reduced in the H643A mutant compared to growth in the absence of NA and
MgSO4, indicating that BvgS containing the H643A substitution is capable of sensing and responding to these chemicals. As with the PASless BvgS, BvgS containing the H643A substitution may be somewhat less sensitive to MgSO4 and NA, or may not fully inactivate in response to 4 mM NA or 50 mM MgSO4 because of its apparent increased kinase activity.
Substitution of C607 with alanine or serine affected BvgS activity differently, despite both substitutions ablating the reactivity of the cysteine. The C607A mutation resulted in increased PfhaB-gfp and PptxA-gfp expression (suggesting increased BvgS kinase activity) under
Bvg+ phase conditions (Fig. 3.2A and 3.2B), while the C607S substitution resulted in decreased
PptxA-gfp expression (suggesting decreased kinase activity or a defect in subsequent steps in the
+ phosphorelay) under Bvg phase conditions. Both strains responded to MgSO4 and NA similarly to wild-type bacteria (Fig. 3.2A and 3.2B).
In all of the BvgS PAS domain mutants, BvgS remained responsive to MgSO4 and NA, indicating that the PAS domain is not absolutely required for sensing these chemicals. However, the apparent level of BvgS activity and its sensitivity to MgSO4 and NA differed among strains,
59
suggesting that the PAS domain of BvgS does play a role in transducing signals sensed by the
VFTs to the cytoplasmic HK, REC and HPT domains, which is consistent with previous reports
(25).
Characterization of pGFLIP-PflaA and pBam reporters in BvgS PAS domain mutants in vitro
To investigate the role of the PAS domain in vivo, we sought to measure bacterial burden and BvgS activity in the respiratory tract. To measure BvgS activity in vivo, we used two reporters that we have used previously (29, 34, 35). pGFLIP-PflaA is a recombinase-based reporter that indicates whether the bacteria have expressed the flaA gene, and hence the Bvg– phase, at any time during the course of the experiment. Expression of flaA results in a conversion of the bacteria from GFP+ and Kmr to GFP– and Kms (34). By contrast, the pBam reporter provides an indication of whether the bacteria are in the Bvg– phase at the time of plating on BG- blood agar. Upon integration into the chromosome at the bvgAS locus, the pBam plasmid causes decreased transcription of bvgAS via the low-level, constitutively active P2 promoter. When wild-type B. bronchiseptica RB50 containing pBam is grown under Bvg– phase conditions, transcription from P2 is reduced such that a small proportion of the bacteria (~5%) in the population lack sufficient BvgAS for positive autoregulation of bvgAS (via the P1 promoter). As a consequence, ~5% of the bacteria are unable to efficiently transition to the Bvg+ phase when transferred to Bvg+ phase growth conditions and form larger, flatter, less hemolytic colonies termed LCPs (for large colony phenotype) (35). Although this reporter vastly underestimates the number of bacteria that are in the Bvg– phase at the time of sampling, it has proven useful in discerning differences in BvgAS activity during growth in vitro and in the lower respiratory tract
(LRT) (29, 35).
60
We first characterized the use of pGFLIP-PflaA and pBam in our PAS domain mutants in vitro. When grown overnight in SS broth at 37°C (Bvg+ phase conditions), all strains maintained
GFP fluorescence and formed few (<1%) LCPs, indicating the bacteria did not modulate under these conditions (Fig. 3.3A-D). Consistent with our previous results (29), when grown with
– either 4 mM NA or 50 mM MgSO4 (Bvg phase conditions), nearly 100% of WT bacteria lost
GFP fluorescence and ~2-10% formed LCPs, indicating that nearly 100% of the bacteria had modulated to the Bvg– phase in response to these chemicals and were in the Bvg– phase at the time of plating (Fig. 3.3A-D). For the BvgSEc, C607A, and C607S strains, a majority of bacteria recovered after growth with NA and MgSO4 had also lost GFP fluorescence, indicating that they had modulated to the Bvg– phase like WT. By contrast, very few GFP– colonies were recovered for the H643A mutant, demonstrating the inability of this strain to modulate to the Bvg– phase sufficiently to result in activation of PflaA in response to NA and MgSO4. Taken with the PfhaB-gfp and PptxA-gfp fusion data, these results indicate that although BvgS with the H643A substitution is able to sense NA and MgSO4, it does not dephosphorylate BvgA~P as completely as wild-type
BvgS such that PflaA is expressed, that is, it appears to modulate only partially.
In addition to indicating whether the bacteria are phenotypically Bvg– phase at the time of plating, the pBam reporter provides an indication of how quickly BvgS transitions from an inactive to active state, because LCPs are formed by delayed or defective positive autoregulation of the bvgAS promoter (which requires BvgA~P to bind to, and activate transcription from, the high-affinity binding sites upstream of P1) (35). The proportion of LCPs for the BvgSEc and
H643A mutants after growth in NA were lower than for WT, consistent with BvgS in these strains having increased kinase activity (and hence increased positive autoregulation) compared to wild-type BvgS, as suggested by the PptxA-gfp data (Fig. 3.2B). By contrast, the C607S mutant
61
formed dramatically more LCPs than WT bacteria after growth in NA, consistent with this BvgS protein having decreased kinase activity compared to wild-type BvgS, which is also consistent with the PptxA-gfp data. Altogether, these results indicate that the pGFLIP-PflaA and pBam reporters should be reliable indicators of BvgS activity in our PAS domain mutants in vivo.
The PAS domain is not required for BvgS kinase activity in the LRT in PlrSWT bacteria
One hypothesis for how PlrSR influences BvgS activity when the bacteria are in the LRT is that the BvgS PAS domain senses an activating signal that requires PlrSR and is needed for maintenance of BvgS kinase activity (Fig. 3.S1A). This signal would be absent in a ∆plrS mutant leading to BvgS inactivation (Fig. 3.S1B). We predicted that if this scenario were true, the
PASless BvgS in BvgSEc would be unable to sense the PlrSR-dependent activating signal and hence BvgS would fail to function as a kinase in bacteria with wild-type PlrSR (as well as in
∆plrS bacteria). To test this hypothesis, we inoculated mice intranasally with WT and BvgSEc containing pGFLIP-PflaA and pBam and determined the number of colony forming units (cfu),
GFP fluorescence, and LCP formation of bacteria recovered from the nasal cavity (NC) and right lung lobes at 0, 1, and 3 days post-inoculation. The BvgSEc mutant colonized the NC and lungs similar to WT and showed no evidence of modulation (no conversion to GFP– and few, if any,
LCPs) (Fig. 3.4A-C), indicating that PASless BvgS had maintained kinase activity throughout the infection. Therefore, either our initial hypothesis is wrong or the PASless BvgS protein no longer requires a PlrSR-dependent activating signal to initiate kinase activity in the LRT.
The C607S substitution hinders BvgS kinase activity and bacterial colonization in the lower respiratory tract (LRT) of mice
We also inoculated mice intranasally with WT, H643A, C607A, and C607S containing pGFLIP-PflaA and pBam to determine if the conserved histidine or cysteine residues in the PAS domain contribute to maintenance of BvgS kinase activity in vivo. While the H643A and C607A
62
mutants colonized the NC and lungs similar to WT and showed no evidence of modulation (no conversion to GFP– and few, if any, LCPs) (Fig. 3.4A-C), the C607S mutant was defective for colonization in the lungs and a small proportion of the C607S bacteria recovered from the NC and lungs had modulated, as indicated by the loss of GFP and development of LCPs (Fig. 3.4B and 3.4C). These data are consistent with the in vitro data suggesting that the H643A and C607A mutants have increased BvgS kinase activity while the C607S mutant has decreased BvgS kinase activity when grown under Bvg+ phase conditions. If these proteins function in vivo as they do in vitro, our data suggest that decreased BvgS kinase activity, but not increased BvgS kinase activity, is detrimental to the ability of the bacteria to colonize the LRT, which is consistent with previous studies that demonstrate the necessity of the Bvg+ phase for mammalian respiratory tract infection (4, 36).
A role for the BvgS PAS domain is revealed in the absence of PlrS in the LRT
A second hypothesis for how PlrSR influences BvgS activity when the bacteria are in the
LRT is that PlrSR prevents the generation of a signal that would inhibit BvgS kinase activity
(Fig. 3.S1C). In a ∆plrS mutant, this inactivating signal would accumulate, resulting in loss of
BvgS kinase activity (Fig. 3.S1D). If true, and if that signal is sensed by the BvgS PAS domain, then PASless BvgS, and potentially some of the PAS domain point mutants, would be insensitive to the inactivating signal and remain active in a ∆plrS mutant. To test this hypothesis, we deleted plrS in the BvgS PAS domain mutants and used the pGFLIP-PflaA and pBam reporters to evaluate
BvgS activity in these strains in vivo. Similar to and as previously shown for the ∆plrS mutant
(29), all strains containing the PAS domain mutations in addition to the ∆plrS mutation were severely defective for survival in the LRT, but colonized the NC similarly to WT (Fig. 3.5A).
(To unclutter Fig. 3.5, asterisks denoting statistical significance are shown only for comparisons
63
between the double mutants and the parental ∆plrS mutant.) Similar to the parental ∆plrS strain, the C607A ∆plrS and C607S ∆plrS double mutants showed evidence of modulation in the LRT, with a large percentage of GFP– bacteria recovered from the lungs at days 1 and 3 post- inoculation (Fig. 3.5B). A small proportion of bacteria of these same strains also modulated in the NC. These data suggest that C607 is not involved in the modulation of BvgS that occurs in the LRT in the absence of PlrS. Interestingly, despite the large number of GFP– cfu recovered for the C607A ∆plrS mutant, very few LCPs were generated (Fig. 3.5C), suggesting that, in this strain, BvgS functions more efficiently as a kinase than wild-type BvgS once modulatory pressure is removed, consistent with the in vitro data.
For the BvgSEc ∆plrS and H643A ∆plrS mutants, and in contrast to the ∆plrS mutant, few
GFP– colonies and LCPs were recovered from the LRT (Fig. 3.5B and 3.5C), indicating that
BvgS remained active in these strains, supporting the hypothesis that the PAS domain senses a negative signal that accumulates in the absence of PlrS in the LRT. In vitro, both of these mutant
BvgS proteins were able to sense MgSO4 and NA, however, only the BvgSEc mutant was capable
– of modulating to the Bvg phase sufficiently to activate PflaA in response to both chemicals. The fact that the BvgSEc ∆plrS mutant did not activate PflaA in vivo indicates that the modulating signal sensed by BvgS in the ∆plrS mutant background in the LRT is different, or is sensed differently, than NA or MgSO4 in vitro. These results suggest that the PAS domain, rather than the VFTs, is responsible for sensing the modulating signal that occurs in the LRT in the absence of PlrS. These results are the first, of which we are aware, to implicate the PAS domain of BvgS as an independent perception domain capable of influencing the activity of BvgS and support the hypothesis that the BvgS PAS domain may sense an inactivating signal that is regulated by
PlrSR.
64
Discussion
The fact that BvgS contains three putative signal perception domains and therefore has the potential to integrate multiple distinct environmental signals has been known for 20 years
(21, 37, 38). To date, however, roles only for the VFT domains have been identified (15–17).
Studies investigating the purpose of the PAS domain have suggested a role only in transducing signals sensed by the VFTs to the cytoplasmic signaling domains (25, 26). Our data support this role for the PAS domain. However, our data collected from experiments investigating BvgS signaling during mammalian respiratory tract colonization indicate that the PAS domain can also function as a signal perception domain that is capable of influencing BvgS activity independently from the VFTs.
Our results cannot definitively distinguish whether the PAS domain senses an activating signal that is dependent on PlrSR (Fig. 3.S1A) or senses an inhibitory signal that is produced in the absence of PlrSR (Fig. 3.S1C). Regardless, our data support an important role for the PAS domain in sensing a signal(s) independent of the VFT domains. Our in vitro transcriptional analyses showed that both wild-type BvgS and PASless BvgS can sense NA and MgSO4, presumably via the VFT domains, and in response they modulate the bacteria to the Bvg– phase.
In vivo, wild-type BvgS was also sensitive to a PlrS-dependent signal in the LRT (the ∆plrS strain modulated to the Bvg– phase in the LRT), however, PASless BvgS was insensitive to this signal, indicating that this in vivo signal 1) is sensed differently than NA or MgSO4 (i.e., likely not via the VFTs) and 2) specifically requires the PAS domain for perception.
Similar to the PASless BvgS protein, BvgS with the H643A substitution was also insensitive to the PlrS-dependent signal in vivo; the H643A strain did not activate the PflaA promoter in the absence of PlrS in the LRT. Although this BvgS protein was capable of sensing
NA and MgSO4 in vitro, it did not modulate sufficiently to de-repress PflaA under these in vitro
65
conditions, and therefore, we cannot rule out that this strain did not modulate to some degree in vivo while in the LRT.
PlrSR is a member of the NtrYX family of TCS (39). Although some NtrYX family members are involved in nitrogen homeostasis, others, such as those in Brucella abortus and
Neisseria gonorrhoeae, control genes involved in bacterial respiration (such as those encoding high affinity cytochrome oxidases) in response to low oxygen (30, 40). We hypothesize that
PlrSR may similarly control the expression of genes that contribute to electron transport-coupled oxidative phosphorylation. Absence of appropriate cytochrome oxidases when the bacteria are in the LRT would likely alter the redox status of the electron transport chain components, such as ubiquinone, and would also likely prevent bacterial growth. Bock and Gross showed that BvgS kinase activity is inhibited by oxidized ubiquinone in vitro and that the H643 residue, which resides within a putative quinone binding motif in the BvgS PAS domain, contributes to BvgS’s sensitivity to this redox-active molecule (23). We are currently investigating whether PlrSR controls the expression of the multiple operons encoding high and low affinity cytochrome oxidases and, if so, their role in controlling BvgS activity in the LRT.
Our data suggest that the conserved cysteine residue (C607) does not contribute to the sensing capacity of BvgS (i.e., the ability to modulate) either in vitro or in vivo. However, this residue is important for maintaining BvgS kinase activity. In vitro, the C607A substitution resulted in increased PfhaB and PptxA transcription, while the C607S substitution resulted in decreased PptxA transcription. In vivo, the C607S mutant modulated (sufficiently to activate PflaA) to a greater extent than wild-type bacteria in both the nasal cavity and lungs, which is also consistent with this substitution reducing the kinase activity of BvgS, although it is also possible that the C607S substitution affected protein stability. (Decreased protein stability is unlikely to
66
explain altered activity for the other BvgS mutants as they each had increased kinase activity.)
Although more experiments will be required to determine the contribution of C607, one possibility is that C607 forms a disulfide bond between BvgS monomers in the kinase active conformation and that this conformation is sterically altered (rendering BvgS inactive) when the disulfide bond is reduced, or when the cysteine is replaced by serine with its hydroxyl groups.
Replacement of the cysteine with alanine may not disrupt the active conformation, and may even make it less susceptible to inadvertent disruption, hence the C607A mutant is a better kinase. The fact that the C607A (and C607S) mutants were capable of modulating, however, suggests that reduction of the disulfide bond that could occur between BvgS monomers is not necessary for sensing and responding to modulating signals, at least not those signals tested in our experiments.
Overall, our results are generally consistent with those of Jacob-Dubuisson and colleagues who demonstrated a role for the BvgS PAS domain in regulating efficient BvgS signal transduction (25). These results are not surprising as BvgS from B. bronchiseptica and B. pertussis are functionally interchangeable and the PAS domain is highly conserved between species (only differing by 2 amino acid residues) (5, 41). We did, however, identify some nuanced differences in BvgS activity between B. bronchiseptica and B. pertussis. When assessing BvgS kinase activity, our results indicated that BvgS in B. bronchiseptica fails to fully activate when the bacteria are grown under laboratory conditions. We showed that replacement of some amino acids in the PAS domain enhanced BvgS kinase activity compared to WT, indicating that the PAS domain influences BvgS kinase activity in B. bronchiseptica. This enhancement of kinase activity was not observed in B. pertussis with similar substitutions (25,
26), suggesting that BvgS may already be maximally active in vitro and/or the PAS domain does
67
not influence BvgS activation in B. pertussis. These data could explain why some strains of B. pertussis appear less sensitive to modulating signals in vitro (NA and MgSO4) compared to most
B. bronchiseptica isolates (5). If BvgS from B. pertussis has higher kinase activity in vitro, it is likely that more modulatory signal would be required to inhibit BvgS kinase activity sufficiently to noticeably decrease vag expression. We also observed that modification of the BvgS PAS domain had different effects on BvgS’s responsiveness to NA and MgSO4 in each species. In B. bronchiseptica, BvgS with the H643A substitution remained responsive to NA and MgSO4, while, in B. pertussis, this substitution rendered BvgS insensitive to both chemicals (25).
Similarly, the C607A substitution made BvgS from B. pertussis insensitive to modulation by
NA, however, BvgS responsiveness was unchanged by this substitution in B. bronchiseptica
(25). As the VFTs are implicated in sensing NA and MgSO4, the differences we observed are likely due to the significant variability of amino acid sequence encoding the BvgS VFT domains in B. bronchiseptica and B. pertussis (5, 41). While our data corroborate a role for the PAS domain in facilitating the transduction of signals though the BvgS protein, our results also highlight that it is important to consider how the VFT domains may influence the function of the
PAS domain and how the synergy of all perception domains contribution to the ultimate output of BvgS activity.
The VFT domains and the PAS domain serve as independent points of signal integration within BvgS. It is well known that the modulatory signals NA and MgSO4 require the VFT domains for perception in vitro and based on our working model, the PAS domain is perhaps sensitive to the redox state of ubiquinone. The natural signals sensed by BvgS, however, remain unknown. By having multiple separate signaling domains, BvgS has the potential to control bacterial gene expression appropriately in many environments. For example, in the mammalian
68
LRT BvgS kinase activity is essential for bacterial survival, therefore, it is likely that both the
VFT domains and the PAS domain are in an ‘on’ or active conformation, thus permitting BvgS activity. In a ∆plrS mutant in the LRT, however, BvgS is inactive and the PAS domain is likely in an ‘Off’ or inactive conformation based on our results. This environment, although artificial, potentially mimics a naturally occurring environment in which the PAS domain can integrate a signal that overrides an activating input sensed by the VFT domains, indicating the possibility that the VFT domains and the PAS domain could obtain various combinations of conformations, rendering BvgS on or off depending on which domain’s influence dominates within the specific environment encountered by the bacteria. Interestingly, not all BvgS homologs have PAS domains, suggesting that bacteria with simplified BvgS proteins perhaps do not encounter such a diverse range of environments and, therefore, do not require BvgS to integrate multiple signals
(26). The fact that a PAS domain in BvgS has been maintained in Bordetella is indicative of the critical role this domain plays in the regulation of this important TCS.
Materials and Methods
Bacterial strains, plasmids, and growth conditions
All bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli strains were grown using Lysogeny broth (LB) or agar at 37C. B. bronchiseptica strains were grown on Bordet-Gengou (BG) agar supplemented with 7.5% defibrinated sheep blood or in
Stainer-Scholte (SS) broth supplemented with SS supplement at 37°C (42). As needed, media was supplemented with ampicillin (Amp; 100 g/mL), streptomycin (Sm; 20 g/mL), gentamicin (Gm; 30 g/mL), kanamycin (Km; E.coli at 50 g/mL or B. bronchiseptica at 125
g/mL), or diaminopimelic acid (DAP; 300 g/mL).
69
Construction of B. bronchiseptica BvgS PAS domain mutant strains
DNA manipulation and cloning were performed according to standard methods (43). All restriction enzymes and DNA ligase were obtained from New England Bio Labs. High-fidelity
PFU Ultra II DNA polymerase was used for the construction of all allelic exchange vectors used in this study. GoTaq DNA polymerase was used for screening purposes during plasmid and strain construction. All enzymes were used according to the manufacturer’s instructions. The primers used in this study are listed in Table 2. All primers were synthesized by Eton
Biosciences and purified using a standard desalting method.
To create the BvgSEc mutation, primers MAB85-MAB90 were used to generate an approximately 1.2 kb DNA fragment, which contained a 141 bp sequence encoding an α-helical linker from the BvgS homolog in Enterobacter cloacae (GI: 915610361), flanked by homologous sequences (500 bp each) corresponding to the regions 5’ and 3’ to the PAS domain of the B.bronchiseptica bvgS gene. Individual point mutations in bvgS (H643A, C607A, and
C607S) were generated by constructing allelic exchange plasmids containing an approximately
1.0 kb DNA fragment of the bvgS sequence, centered on the PAS domain, with exact homology to bvgS except for the desired substitution and a unique restriction enzyme digestion site, used for screening. Primers used to generate the most 5’ and 3’ ends of the DNA fragments for each mutant were designed to include a BamHI restriction site at the 5’ end and a SacI restriction at the 3’ end, which were used to clone the DNA fragments into the allelic exchange plasmid pEG7S (7). Standard methods were then used to deliver this plasmid to RB50 and ∆plrS strains by conjugation using RHO3 cells. Double homologous recombination events that introduced the desired mutation into the chromosome were selected for using 15% sucrose (w/v) and screened for by restoration of BvgS activity indicated by the presence of hemolysis on BG-blood agar or through restriction digestion using the unique restriction enzyme site introduced for point
70
mutants. Sanger sequencing was used to verify each mutation in bvgS. The pGFLIP-PflaA and pBam reporters were introduced into each mutant strain, using tri-parental mating with conjugative RHO3 or by homologous recombination, respectively. Introduction of each reporter on to the chromosome was verified using PCR.
Construction of PptxA-gfp and PfhaB-gfp transcriptional reporters
To construct a GFP transcriptional reporter for PptxA, the ptxA promoter (position -5 to -
220 upstream of ptxA coding sequence) was amplified by PCR from B. pertussis Tohama I. To construct a GFP transcriptional reporter for PfhaB, the fhaB promoter (position -5 to -254 upstream of fhaB coding sequence) was amplified by PCR from B. bronchiseptica RB50. PCR products were then digested and cloned into the pUCgfpMAB plasmid using EcoRI and HindIII restriction sites. The resulting plasmids were subsequently sequenced to verify that each promoter was correctly fused 5’ to the S12 RBS and gfp. Each reporter plasmid was then
C introduced into WT, BvgS , ∆bvgS, BvgSEc, H643A, C607A, and C607S strains using tri- parental mating with conjugative RHO3. A strain of RB50 was also engineered to contain the pUCgfpMAB plasmid without a promoter driving gfp expression as a control
(RB50::pUCgfpMAB-EV). Reporter delivery to the Tn7 site was confirmed by PCR in each strain.
Transcription of PptxA-gfp and PfhaB-gfp reporters in vitro
+ To analyze expression of the PptxA-gfp and PfhaB-gfp transcriptional reporters under Bvg phase conditions, strains were grown on BG-blood agar supplemented with kanamycin at 37 °C until colonies formed. Approximately 3-4 colonies were used to inoculate liquid SS media containing streptomycin and kanamycin, with or without 4 mM nicotinic acid (NA) or 50 mM
MgSO4, depending on the experimental conditions tested. All cultures were incubated overnight
71
for ~18 h at 37 °C on a roller. Each overnight culture was then sub-cultured to an OD of 0.3 per mL into fresh liquid SS media containing streptomycin and kanamycin, with or without 4 mM nicotinic acid (NA) or 50 mM MgSO4, depending on the experimental conditions tested.
Subcultures were incubated for ~4 h at 37°C while rotating. Subsequently, 100 L of each culture were transferred to a well of a 96-well, flat bottom, polystyrene plate, and the OD600 and
RFU at excitation A485 and emission A535 (to detect GFP) were measured on a Perkin-Elmer
Victor3 1420 Multi-label plate reader. Total GFP expression was normalized by initial subtraction of background fluorescence, as determined from the RB50::pUCgfpMAB-EV strain, and normalization to the OD600 for each sample. Cultures were prepared and tested in duplicate and three experimental replicates were completed. Normalized GFP/OD600 values were averaged across all replicates.
Characterization of pGFLIP-PflaA and pBam reporters in vitro
Strains containing pGFLIP-PflaA and pBam reporters were grown overnight in SS medium with streptomycin and gentamycin, with and without 50 mM MgSO4 or 4 mM nicotinic acid.
After incubation at 37 °C for 24 h on a rotating incubator, an aliquot of cells from each experimental condition was diluted to a concentration of 3 x 103 cells/mL with 1X PBS and plated on BG-blood agar in duplicate. Plates were incubated for 72 h at 37 °C. White light and
GFP fluorescence images of each plate were captured using a G:Box Imaging System (Syngene).
Total cfu, GFP positive colonies, and LCP colonies were enumerated using the colony analysis protocol of the GeneTools Software package (Syngene). The total number of GFP negative colonies was calculated by subtracting the number of GFP positive colonies from the total number of colonies isolated. The percent GFP negative colonies and percent LCP colonies were
72
calculated based on the total number of colonies isolated. Each in vitro experimental condition was tested twice.
Evaluation of B. bronchiseptica modulation in vivo
Bacteria were cultured overnight at 37 °C in SS media with streptomycin, kanamycin, and gentamicin to maintain bacteria in the Bvg+ phase (42). Six-week-old female BALB/c mice from Jackson Laboratories were inoculated intranasally with 7.5 × 104 cfu of B. bronchiseptica strains (containing the pGFLIP-PflaA and pBam reporters) in 50 μL of 1 X DPBS. At each time point reported, right lung lobes and nasal cavity tissue were harvested and homogenized in 1 X
DPBS using a mini-beadbeater. Dilutions of the tissue homogenates were then plated on BG- blood agar and grown at 37C for 72 h. White light (to enumerate total cfu and LCPs) and blue light (to enumerate GFP+ colonies) images of each plate were captured using a G:Box Imaging
System (Syngene). Total cfu, GFP positive colonies, and LCP colonies were enumerated using the colony analysis protocol of the GeneTools Software package (Syngene). The total number of
GFP negative colonies was calculated by subtracting the number of GFP positive colonies from the total number of colonies isolated. The percent GFP negative colonies and percent LCP colonies were calculated by determining the ratio of GFP negative colonies or LCP colonies to the total number of colonies isolated.
Ethics statement
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (44). All animals were properly anesthetized for inoculations, monitored regularly, and euthanized when moribund. Efforts were made to minimize suffering. Our protocol was approved by the
73
University of North Carolina Institutional Animal Care and Use Committee (Protocol ID: 16-
246).
Statistical analysis
Statistical analysis was performed using Prism 8.0.1 software from GraphPad Software.
Statistical significance of all experimental data was determined using Mann-Whitney analysis. A p value < 0.05 was considered significant. Figures were generated using Adobe Illustrator CS6
(Adobe Systems).
74
Figures and Tables
Figure 3.1. The sensor kinase, BvgS, has a unique PAS domain, which may play a role in signal perception. (A) Schematic of the two-component phosphor-relay system BvgAS. BvgS is an unorthodox His-Asp-His sensor kinase, comprised of tandem, periplasmic, venus fly-trap (VFT) domains followed by a transmembrane (TM) domain, a cytoplasmic Per/Arnt/Sim (PAS) domain, a histidine kinase (HK) domain, a receiver (REC) domain, and a histidine phosphotransfer (Hpt) domain. BvgA is a classical DNA-binding response regulator, comprised of a receiver (REC) domain and a helix-turn-helix (HTH) DNA-binding domain. When active, BvgS autophosphorylates and the phosphoryl group is transferred to the REC and Hpt domains and then to BvgA. The phosphorylated form of BvgA (BvgA~P) can bind DNA and activate or repress gene expression. Although it has not been formally demonstrated, under inactivating conditions it is likely that the phosphorelay is reversed and the phosphoryl group is transferred from BvgA to the Hpt and REC of BvgS. (B) Amino acid sequence of the BvgS PAS domain (highlighted in yellow) and flanking domains (TM domain highlighted in grey and the HK domain highlighted in green). Red arrows highlight the highly conserved cysteine (C607) and histidine (His643) residues of the BvgS PAS domain that were targeted for mutagenesis. Grey numbers correspond to amino acid position in BvgS. (C) Schematic of the amino acid sequence of the alpha-helical linker (underlined in red) that was used to replace the BvgS PAS domain in the strain BvgSEc. The amino acid sequence of the N-terminal TM domain is highlighted in grey and the C-terminal HK domain is highlighted in green. Grey number corresponds to amino acid position in BvgS.
75
Figure 3.2. In B. bronchiseptica, the PAS domain influences BvgS kinase activity and sensitivity to chemical modulation in vitro. Transcriptional analysis of PptxA and PfhaB activity in C wild-type (WT), BvgS , ∆bvgS, BvgSEc, H643A, C607A, and C607S strains of B. bronchiseptica using the gfp based reporters. All strains were cultured in Stainer Scholte (SS) broth (Bvg+ growth conditions, black bars), in SS with 4mM nicotinic acid (Bvg– growth conditions, blue – bars), or in SS with 50mM MgSO4 (Bvg growth conditions, orange bars) at 37 °C with agitation. (A) Activity of the high-affinity BvgA~P PfhaB promoter was determined using the PfhaB-gfp reporter and (B) activity of the low-affinity BvgA~P PptxA promoter was determined using the PptxA-gfp reporter. Colored bars represent the mean normalized GFP fluorescence per cell (GFP/OD600) calculated from triplicate experiments. Error bars represent the standard deviation of normalized GFP/OD600 for each data set. Statistical significance (Mann-Whitney, P < 0.05) of values for each strain compared to WT under Bvg+ phase growth conditions (SS Broth) is indicated by a single * and statistically significance comparisons of values for a single strain cultured in each growth condition (SS Broth vs NA or SS Broth vs MgSO4) is indicated by an *, in addition to a bar indicating the exact comparison. ‘nd’ indicates “not detected”.
76
Figure 3.3. The PAS domain is important for BvgS inactivation in response to known modulatory chemicals in vitro. In vitro analysis of wild-type (WT), BvgSEc, H643A, C607A, and C607S modulation in response to the chemical signals nicotinic acid (NA) and magnesium sulfate (MgSO4). All strains contain the plasmid reporters pGFLIP-PflaA and pBam. Strains were cultured under Bvg+ (SS broth) and under two different Bvg– phase growth conditions (SS broth with 4 mM NA or 50 mM MgSO4) at 37 °C for ∼18 h with agitation and subsequently plated on BG-blood solid agar to enumerate the percentage of GFP− colonies (A and C) and LCPs (B and D). NA was used as the modulatory stimulus in (A) and (B). MgSO4 was used as the modulatory stimulus in (C) and (D). GFP negativity indicates bacterial modulation and loss of BvgS kinase activity. LCPs indicate bacteria present in the Bvg– phase when plated. Mann-Whitney analysis was used to compare % GFP negative values and % LCP values for all mutant strains compared to WT cultured in the same growth conditions. Statistical significance is indicated with * (P < 0.05).
77
Figure 3.4. A conserved cysteine residue in the PAS domain is important for maintaining BvgS kinase activity during respiratory tract colonization of mice. (A) Colonization of the nasal cavity (top) and right lung (bottom) tissue in female BALB/cJ mice by wild type (WT; black circles), BvgSEc (blue squares), H643A (green hexagons), C607A (yellow diamonds), and C607S (purple triangles) strains on days 0, 1, and 3 post-inoculation. All strains contain the 4 plasmid reporters, pGFLIP-PflaA and pBam. Mice were inoculated with 7.5 x10 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as short horizontal bars. (B) Percentage of GFP negative (% GFP–) bacteria recovered from the nasal cavity (top) and right lung (bottom). GFP negativity indicates bacterial modulation and loss of BvgS kinase activity. (C) Percentage of large colony phenotype (LCP) producing bacteria recovered from the nasal cavity (top) and right lung (bottom). LCPs indicate bacteria present in the Bvg– phase when recovered. Statistical significance (Mann-Whitney) is indicated with * (P < 0.05).
78
Figure 3.5. The PAS domain is required for BvgS modulation in response to PlrSR dysfunction during LRT colonization. (A) Colonization of the nasal cavity (top) and right lung (bottom) tissue in female BALB/cJ mice by wild type (WT; black circles), ∆plrS (red triangles), ∆plrS-BvgSEc (blue squares), ∆plrS-H643A (green hexagons), ∆plrS-C607A (yellow diamonds), and ∆plrS-C607S (purple triangles) strains on days 0, 1, and 3 post-inoculation. All strains 4 contain the plasmid reporters, pGFLIP-PflaA and pBam. Mice were inoculated with 7.5 x10 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as short horizontal bars. Homogenate from each organ was used to determine bacterial burden shown in graph A and in vivo bacterial modulation shown in graphs B and C. (B) Percentage of GFP negative (% GFP–) bacteria recovered from the nasal cavity (top) and right lung (bottom). GFP negativity indicates bacterial modulation and loss of BvgS kinase activity. (C) Percentage of large colony phenotype (LCP) producing bacteria recovered from the nasal cavity (top) and right lung (bottom). LCPs indicate bacteria present in the Bvg– phase when recovered. Mann-Whitney analysis was used to compare CFU, % GFP negative, and % LCP values for all BvgS PAS domain ∆plrS double mutants compared to the ∆plrS strain. Statistical significance is indicated with * (P < 0.05).
79
Figure 3.S1. The PAS domain of BvgS may sense an activating or inactivating signal in the LRT. (A) Schematic depicting how the PAS domain may be required to sense a PlrS-dependent activating signal that is required to maintain BvgS kinase activity in the LRT. Genes encoding a protein(s) required for the generation of an activating signal are regulated by the PlrSR TCS. The BvgS PAS domain is required for sensing this activating this signal and BvgS can function as a kinase. (B) Without PlrS, generation of the activating signal does not occur and BvgS would be off. (C) Schematic depicting how the PAS domain may sense a signal that inactivates BvgS in the LRT. Normally, the activity of a protein(s) encoded by a gene(s) regulated by the PlrSR system would inhibit the generation of an inactivating signal. (D) However, without PlrS this inactivating signal can accumulate and inhibit BvgS kinase activity via the PAS domain of the protein.
80
Table 3.S1. Bacterial Strains and Plasmids Used in this Study Table S1. Bacterial Strains and Plasmids Used in this Study Bacterial Strain or Plasmid Description Reference E.coli Strains DH5α Molecular cloning strain GIBCO BRL RHO3 Conjugation strain; Kms Δasd ΔaphA, DAP auxotroph (35) B. bronchiseptica Strains RB50 (WT) Wild-type B. bronchiseptica strain; Smr (4) BvgSC (RB53) RB50 containing the bvgS R570H point mutation; Smr (4) ∆bvgS (RB54) RB50 containing an in-frame deletion of bvgS; Smr (4) ∆plrS RB50 containing an in-frame deletion of plrS; Smr (39) RB50 containing bvgS with sequence encoding the PAS domain (bp 1690 to bp 2154) replaced with sequence BvgS This Study Ec encoding an α-helical linker from the BvgS homolog od Enterobacter cloacae; Smr H643A RB50 containing the bvgS H643A point mutation; Smr This Study C607A RB50 containing the bvgS C607A point mutation; Smr This Study C607S RB50 containing the bvgS C607S point mutation; Smr This Study RB50 containing an in-frame deletion of plrS and bvgS with sequence encoding the PAS domain (bp 1690 to ∆plrS – BvgSEc bp 2154) replaced with sequence encoding an α-helical linker from the BvgS homolog of Enterobacter This Study cloacae; Smr ∆plrS – H643A RB50 containing the bvgS H643A point mutation and a deletion of plrS; Smr This Study ∆plrS – C607A RB50 containing the bvgS C607A point mutation and a deletion of plrS; Smr This Study ∆plrS – C607S RB50 containing the bvgS C607S point mutation and a deletion of plrS; Smr This Study 81 Plasmids Suicide plasmid conferring sucrose sensitivity when integrated into the B. bronchiseptica chromosome, used pEG7S (4) for allelic exchange mutagenesis; Gmr pUCgfpMAB attTn7 site-specific integration vector containing gfp; Kmr This Study pTNS3 attTn7 transposase expression vector containing tnsABCD; Ampr (34) pGFLIP-PflaA pGFLIP with flp recombinase driven by the RB50 flaA promoter; Ampr, Kmr (34) Plasmid that integrates into the Bordetella chromosome 5’ to the bvgAS locus and allows for generation of pBam (35) LCPs; Ampr, Gmr Plasmid containing the 141 bp, a-helical linker sequence from the BvgS homolog of Enterobacter cloacae, pPAS-R4 (26) which was used to replace the sequence encoding the PAS domain in RB50 bvgS; Ampr PptxA-gfp pUCgfpMAB with gfp driven by the B.pertussis Tohama I ptxA promoter; Kmr This Study PfhaB-gfp pUCgfpMAB with gfp driven by the RB50 fhaB promoter; Kmr This Study pEG7S plasmid containing a ~1.2 kb DNA fragment with a 141 bp sequence that encodes an α-helical linker pEG7S-BvgSEc sequence from the BvgS homolog in Enterobacter cloacae situated between 5’ and 3’ homologous sequences This Study (500 bp each) that flank the PAS domain in RB50 bvgS pEG7S plasmid containing a ~1 kb DNA fragment encoding the H643A mutation and a silent BseRI mutation pEG7S-BvgS H643A This Study located 2 codons downstream of the H643 codon in bvgS pEG7S plasmid containing a ~1 kb DNA fragment encoding the C607A mutation and a silent AflII mutation pEG7S-BvgS C607A This Study located 4 bp downstream of the C607 codon in bvgS pEG7S plasmid containing a ~1 kb DNA fragment encoding the C607S mutation and a silent AflII mutation pEG7S-BvgS C607S This Study located 4 bp downstream of the C607 codon in bvgS
Table 3.S2. Primers Used in this Study
Table S2. Primers Used in this Study Primer Primer Description Sequence Name Orientation MAB13 Used in construction of pEG7S-BvgS H643A GCATGAGCTCAACCGCTACTTCGCC Forward MAB14 Used in construction of pEG7S-BvgS H643A GTGAGGAGGAACTCGGCCATCTCGCGAGCCA Reverse MAB15 Used in construction of pEG7S-BvgS H643A AGATGGCCGAGTTCCTCCTCACGCGCATGTC Forward MAB16 Used in construction of pEG7S-BvgS H643A ATGCGGATCCGAAGACGCGGATCG Reverse MAB85 Used in construction of pEG7S-BvgSEc ATCGTCTACCTGCGTCGACAGATTGTGCGC Forward MAB86 Used in construction of pEG7S-BvgSEc TCTGTCGACGCAGGTAGACGATCCAGCTCAGG Reverse MAB87 Used in construction of pEG7S-BvgSEc TGACGGATCCAGCTTCAGCCGGCCGT Forward MAB88 Used in construction of pEG7S-BvgSEc GGTCTTGGCCCGGTTAGAGTCTTCGGCG Reverse MAB89 Used in construction of pEG7S-BvgSEc TCTAACCGGGCCAAGACCACGTTCCTGG Forward MAB90 Used in construction of pEG7S-BvgSEc ATCGGAGCTCCGAGAACGGTTTGAACAGCTG Reverse MAB91 Used in construction of pEG7S-BvgS C607A and pEG7S-BvgS C607S TGACGGATCCAGCAGCGCTATCCCCAGG Forward MAB92 Used in construction of pEG7S-BvgS C607A AGGTACGCGTCATTCGCCAACAGCATGCGGCCTTCCT Reverse MAB93 Used in construction of pEG7S-BvgS C607A TTGGCGAATGACGCGTACCTCGACACCTTTGGCGTGACT Forward MAB94 Used in construction of pEG7S-BvgS C607A and pEG7S-BvgS C607S ATCGGAGCTCGGCGCCAGGTCGAATTTT Reverse MAB95 Used in construction of pEG7S-BvgS C607S AGGTACGCGTCATTAGACAACAGCATGCGGCCTTCCT Forward MAB96 Used in construction of pEG7S-BvgS C607S TTGTCTAATGACGCGTACCTCGACACCTTTGGCGTGACT Reverse MAB132 Used in construction of PfhaB-gfp GTACGAATTCCCGTGCGGGC Forward
82 MAB133 Used in construction of PfhaB-gfp GTACAAGCTTCGACCAGCGAAGTGAAGTAATC Reverse
MAB134 Used in construction of PptxA-gfp GTACGAATTCGCATACGTGTTGGCAACCG Forward MAB135 Used in construction of PptxA-gfp GTACAAGCTTTCTTCCCCTCTGCGTTTTGAT Reverse
REFERENCES
1. Cherry JD (2012) Epidemic Pertussis in 2012 — The Resurgence of a Vaccine- Preventable Disease. New England Journal of Medicine 367:785–787.
2. Kilgore PE, Salim AM, Zervos MJ, Schmitt H-J (2016) Pertussis: Microbiology, Disease, Treatment, and Prevention. Clinical Microbiology Rev 29:449–486.
3. Goodnow R (1980) Biology of Bordetella bronchiseptica. Microbiology Reviews 44:722– 38.
4. Cotter P, Miller J (1994) BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infection and Immunity 62:3381–90.
5. de Tejada G, Miller JF, Cotter PA (1996) Comparative analysis of the virulence control systems of Bordetella pertussis and Bordetella bronchiseptica. Molecular Microbiology 22:895–908.
6. Taylor-Mulneix DL, Bendor L, Linz B, Rivera I, Ryman VE, Dewan KK, Wagner SM, Wilson EF, Hilburger LJ, Cuff LE, West CM, Harvill ET (2017) Bordetella bronchiseptica exploits the complex life cycle of Dictyostelium discoideum as an amplifying transmission vector. PLoS Biology 15:e2000420.
7. Cotter PA, Miller JF (1997) A mutation in the Bordetella bronchiseptica bvgS gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvg‐regulated antigens. Molecular Microbiology 24:671–685.
8. Uhl M, Miller J (1994) Autophosphorylation and phosphotransfer in the Bordetella pertussis BvgAS signal transduction cascade. Proceedings of the National Academy of Sciences of the United States of America 91:1163–1167.
9. Jones AM, Boucher PE, Williams CL, Stibitz S, Cotter PA (2005) Role of BvgA phosphorylation and DNA binding affinity in control of Bvg‐mediated phenotypic phase transition in Bordetella pertussis. Molecular Microbiology 58:700–713.
10. Moon K, Bonocora RP, Kim DD, Chen Q, Wade JT, Stibitz S, Hinton DM (2017) The BvgAS Regulon of Bordetella pertussis. Mbio 8:e01526-17.
11. Boulanger A, Chen Q, Hinton DM, Stibitz S (2013) In vivo phosphorylation dynamics of the Bordetella pertussis virulence‐controlling response regulator BvgA. Molecular Microbiology 88:156–172.
12. Akerley B, Monack D, Falkow S, Miller J (1992) The bvgAS locus negatively controls motility and synthesis of flagella in Bordetella bronchiseptica. Journal of Bacteriology 174:980–990.
83
13. Williams CL, Boucher PE, Stibitz S, Cotter PA (2005) BvgA functions as both an activator and a repressor to control Bvgi phase expression of bipA in Bordetella pertussis. Molecular Microbiology 56:175–188.
14. Zu T, Manetti R, Rappuoli R, Scarlato V (1996) Differential binding of BvgA to two classes of virulence genes of Bordetella pertussis directs promoter selectivity by RNA polymerase. Molecular Microbiology 21:557–565.
15. Dupré E, Herrou J, Lensink MF, Wintjens R, Vagin A, Lebedev A, Crosson S, Villeret V, Locht C, Antoine R, Jacob-Dubuisson F (2015) Virulence Regulation with Venus Flytrap Domains: Structure and Function of the Periplasmic Moiety of the Sensor-Kinase BvgS. PLoS Pathogens 11:e1004700.
16. Herrou J, Bompard C, Wintjens R, Dupré E, Willery E, Villeret V, Locht C, Antoine R, Jacob-Dubuisson F (2010) Periplasmic domain of the sensor-kinase BvgS reveals a new paradigm for the Venus flytrap mechanism. Proceedings of the National Academy of Sciences of the United States of America 107:17351–17355.
17. Dupré E, Lesne E, Guérin J, Lensink MF, Verger A, de Ruyck J, Brysbaert G, Vezin H, Locht C, Antoine R, Jacob-Dubuisson F (2015) Signal Transduction by BvgS Sensor Kinase: Binding of Modulator Nicotinate Affects the Conformation and Dynamics of the Entire Periplasmic Moiety. The Journal of Biological Chemistry 290:23307–23319.
18. Möglich A, Ayers RA, Moffat K (2009) Structure and Signaling Mechanism of Per- ARNT-Sim Domains. Structure 17:1282–1294.
19. Henry JT, Crosson S (2011) Ligand-Binding PAS Domains in a Genomic, Cellular, and Structural Context. Annual Reviews of Microbiology 65:261–286.
20. Gilles-Gonzalez M-A, Gonzalez G (2004) Signal transduction by heme-containing PAS- domain proteins. Journal of Applied Physiology (Bethesda, MD 1985) 96:774–83.
21. Taylor B, Zhulin I (1999) PAS domains: internal sensors of oxygen, redox potential, and light. Microbiology and Molecular Biology Reviews: MMBR 63:479–506.
22. Gu Y-Z, Hogenesch JB, Bradfield CA (2000) The PAS Superfamily: Sensors of Environmental and Developmental Signals. Annual Review of Pharmacology and Toxicology 40:519–561.
23. Bock A, Gross R (2002) The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier. European Journal of Biochemistry 269:3479–3484.
24. Antelmann H, Helmann JD (2011) Thiol-Based Redox Switches and Gene Regulation. Antioxidants and Redox Signaling 14:1049–1063.
84
25. Dupré E, Wohlkonig A, Herrou J, Locht C, Jacob-Dubuisson F, Antoine R (2013) Characterization of the PAS domain in the sensor-kinase BvgS: mechanical role in signal transmission. BMC Microbiology 13:172.
26. Lesne E, Krammer E-M, Dupre E, Locht C, Lensink M, Antoine R, Jacob-Dubuisson F (2016) Balance between Coiled-Coil Stability and Dynamics Regulates Activity of BvgS Sensor Kinase in Bordetella. Mbio 7:e02089-15.
27. Julio SM, Inatsuka CS, Mazar J, Dieterich C, Relman DA, Cotter PA (2009) Natural‐host animal models indicate functional interchangeability between the filamentous haemagglutinins of Bordetella pertussis and Bordetella bronchiseptica and reveal a role for the mature C‐terminal domain, but not the RGD motif, during infection. Molecular Microbiology 71:1574–1590.
28. Cotter P, Yuk M, Mattoo S, Akerley B, Boschwitz J, Relman D, Miller J (1998) Filamentous hemagglutinin of Bordetella bronchiseptica is required for efficient establishment of tracheal colonization. Infection and Immunity 66:5921–9.
29. Bone AM, Wilk AJ, Perault AI, Marlatt SA, Scheller EV, Anthouard R, Chen Q, Stibitz S, Cotter PA, Julio SM (2017) Bordetella PlrSR regulatory system controls BvgAS activity and virulence in the lower respiratory tract. Proceedings of the National Academy of Sciences of the United States of America 114:E1519–E1527.
30. Atack JM, khanta YN, Djoko KY, Welch JP, Hasri NH, Steichen CT, Hoven RN, Grimmond SM, Othman D, Kappler U, Apicella MA, Jennings MP, Edwards JL, McEwan AG (2013) Characterization of an ntrX Mutant of Neisseria gonorrhoeae Reveals a Response Regulator That Controls Expression of Respiratory Enzymes in Oxidase-Positive Proteobacteria. Journal of Bacteriology 195:2632–2641.
31. del Carrica M, Fernandez I, Sieira R, Paris G, Goldbaum F (2013) The two‐component systems PrrBA and NtrYX co‐ordinately regulate the adaptation of Brucella abortus to an oxygen‐limited environment. Molecular Microbiology 88:222–233.
32. Decker KB, James TD, Stibitz S, Hinton DM (2012) The Bordetella pertussis model of exquisite gene control by the global transcription factor BvgA. Microbiology 158:1665– 1676.
33. Kinnear SM, Marques RR, Carbonetti NH (2001) Differential Regulation of Bvg- Activated Virulence Factors Plays a Role in Bordetella pertussis Pathogenicity. Infection and Immunity 69:1983–1993.
34. Byrd MS, Mason E, Henderson MW, Scheller EV, Cotter PA (2013) An Improved Recombination-Based In Vivo Expression Technology-Like Reporter System Reveals Differential cyaA Gene Activation in Bordetella Species. Infection and Immunity 81:1295–1305.
85
35. Mason E, Henderson MW, Scheller EV, Byrd MS, Cotter PA (2013) Evidence for phenotypic bistability resulting from transcriptional interference of bvgAS in Bordetella bronchiseptica. Molecular Microbiology 90:716–733.
36. Akerley BJ, Cotter PA, Miller JF (1995) Ectopic expression of the flagellar regulon alters development of the bordetella-host interaction. Cell 80:611–620.
37. Aricó B, Miller J, Roy C, Stibitz S, Monack D, Falkow S, Gross R, Rappuoli R (1989) Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins. Proceedings of the National Academy of Sciences of the United States of America 86:6671–6675.
38. Aricó B, Scarlato V, Monack D, Falkow S, Rappuoli R (1991) Structural and genetic analysis of the bvg locus in Bordetella species. Molecular Microbiology 5:2481–2491.
39. Kaut CS, Duncan MD, Kim J, Maclaren JJ, Cochran KT, Julio SM (2011) A Novel Sensor Kinase Is Required for Bordetella bronchiseptica To Colonize the Lower Respiratory Tract. Infection and Immunity 79:3216–3228.
40. de Bagüés M, Loisel-Meyer S, Liautard J-P, Jubier-Maurin V (2007) Different Roles of the Two High-Oxygen-Affinity Terminal Oxidases of Brucella suis: Cytochrome c Oxidase, but Not Ubiquinol Oxidase, Is Required for Persistence in Mice. Infection and Immunity 75:531–535.
41. Herrou J, Debrie A-S, Willery E, Renaud-Mongénie G, Locht C, Mooi F, Jacob- Dubuisson F, Antoine R (2009) Molecular Evolution of the Two-Component System BvgAS Involved in Virulence Regulation in Bordetella. PLoS One 4:e6996.
42. Hulbert RR, Cotter PA (2009) Current Protocols in Microbiology. Current Protocols in Microbiology Chapter 4:4B.1.1-4B.1.9.
43. Joseph Sambrook, David W. Russell (2001) Molecular cloning: a laboratory manual. 3rd Ed, Volume 1-3, ISBN: 9780879695774.
44. Committee on Care and Use of Laboratory Animals. 1996. Guide for the Care and Use of Laboratory Animals (NIH, Bethesda), DHHS Publisher No (NIH) 85-23.
86
CHAPTER 4. TWO HIGH AFFINITY CYTOCHROME OXIDASES ARE REQUIRED FOR MAXIMAL COLONIZATION OF THE MAMMALIAN LOWER RESPIRATORY TRACT BY BORDETELLA BRONCHISEPTICA3
Introduction
Bordetella pertussis is the Gram-negative bacterium responsible for causing the severe respiratory illness pertussis, or whooping cough, in humans (1). Despite high rates of vaccination, pertussis has reemerged as an urgent global public health threat in recent years (2,
3). Closely related to B. pertussis, Bordetella bronchiseptica can also cause severe respiratory illness, but in a wide range of mammals (4, 5). Despite differences in host range, B. pertussis and
B. bronchiseptica use a similar set of virulence factors to colonize the mammalian respiratory tract. In both species the expression of almost all known virulence factor-encoding genes is controlled by BvgAS, a complex, two-component sensory transduction system (5–8). Our laboratory primarily studies B. bronchiseptica because its broad host range permits the use of natural host animal models to study the role of Bordetella virulence factors and their regulation in vivo (9, 10). In addition to regulating virulence, BvgAS differentially regulates the expression of hundreds of genes in Bordetella, allowing the bacteria to transition between three different phenotypic phases: the Bvg+ phase that is necessary for virulence in mammals (11); the Bvg– phase that in B. bronchiseptica is required for survival under nutrient-limiting conditions (11, 12)
3 M. Ashley Sobran. This chapter describes intriguing preliminary data regarding the potential connection between the PlrSR and BvgAS TCSs. MAS contributed to the worked presented in this chapter by assisting in the design, performance, and analysis of all research. MAS compiled and formatted all figures and tables and wrote all sections of this chapter. It is hoped that the research presented in this chapter will be included in a published manuscript in the future.
87
and for interactions with non-mammalian hosts (13); and the Bvgi phase that has been hypothesized to be important for bacterial transmission (12, 14).
The BvgAS system comprises two proteins. BvgS is a membrane-spanning sensor kinase with two, N-terminal, periplasmic Venus Flytrap domains (VFTs), followed by a transmembrane domain, a cytoplasmic Per-Arnt-Sim (PAS) domain, a histidine kinase (HK) domain, a receiver domain (REC), and a C-terminal histidine phosphotransfer (Hpt) domain (15). BvgA is a canonical response regulator with a N-terminal REC domain and a C-terminal helix-turn-helix
(HTH) DNA binding domain (16, 17). When Bordetella is grown in the laboratory at 37˚C on
Bordet-Gengou (BG) blood agar or in Stainer-Scholte (SS) broth, BvgS undergoes autophosphorylation and functions as a kinase (18–20). Subsequently, via a His-Asp-His phosphorelay, BvgS trans-phosphorylates BvgA (15, 18, 21). BvgA~P can then dimerize and bind DNA to promote or repress gene transcription (17, 22, 23). When BvgS is active (kinase activity) high levels of BvgA~P accumulate in the cell and the bacteria express the virulent Bvg+ phase, which is characterized by the expression of all known virulence factors (7). BvgS can also function as a phosphatase. When Bordetella is cultured in the presence of millimolar concentrations of nicotinic acid (NA) or magnesium sulfate (MgSO4), or at low temperature
(25˚C) BvgS dephosphorylates BvgA, inactivating the regulator protein (15, 24–28). When levels of BvgA~P are depleted within the cell, the bacteria express the Bvg– phase, which is characterized by the expression genes required for bacterial survival in nutrient limited conditions and those encoding the flagella apparatus in B. bronchiseptica (11, 12, 29). When
BvgA~P accumulates to intermediate levels within the cell, the bacteria express the Bvgi phase, which is characterized by maximal expression of the intermediate phase gene bipA (12, 22, 30,
31). The transition from expressing the Bvg+ phase to expressing the Bvg– phase is termed
88
‘phenotypic modulation’. Although BvgS activity can be manipulated in the laboratory, the environmental signals that influence BvgS activity are unknown.
It has been known for some time that the activity of BvgAS and expression of the Bvg+ phase is essential for Bordetella colonization of the mammalian respiratory tract (11, 18, 21, 24,
32–34). Recently, we discovered that maintenance of BvgS kinase activity in the lower respiratory tract (LRT) requires the activity of another TCS called PlrSR (10). Furthermore, we have demonstrated that the PAS domain of BvgS is required for BvgS’s dependency on the
PlrSR system specifically at this site of infection. It is unknown, however, by what mechanism the PlrSR system influences BvgS function in the LRT.
PlrSR is a member of the NtrYX family of TCS, members of which are involved in sensing and responding to changes in redox status and anaerobiosis (35–37). In Brucella abortus and Neisseria gonorrhoeae, NtrYX systems control genes involved in bacterial respiration, such as those encoding high affinity cytochrome oxidases (HACOs), in response to low oxygen (37,
38). Bordetella are strict aerobes and rely on cytochrome oxidases to convert oxygen into water as the terminal electron acceptor during respiration (39, 40). B. bronchiseptica contains seven gene loci predicted to encode cytochrome oxidases. Three of the cytochrome oxidases, one aa3- type and two bo3-type, are predicted to have a low affinity for oxygen, while the remaining four, one cbb3-type and three bd-type, are predicted to have high affinity for oxygen (41). In the LRT, a potentially low oxygen environment, high affinity cytochrome oxidases (HACOs) may be required for Bordetella respiration to ensure efficient utilization of scare oxygen (42). Loss of
HACOs within a low O2 environment would likely alter the redox status of the electron transport chain components within the bacterial membrane, including the redox reactive molecule ubiquinone. Interestingly, the BvgS PAS domain, which is required for BvgS’s dependency on
89
PlrSR in the LRT, contains a quinone binding perception motif [aliphatic-(X)3-H-(X)2,3-(L/T/S)] and it has been reported that BvgS kinase activity is sensitive to the redox state of ubiquinone
(43, 44). Therefore, based on our work and the work of others, we hypothesize that PlrSR controls the expression of genes encoding HACOs, which are required for bacterial respiration and maintenance of BvgAS kinase activity in the LRT.
Despite the large number of cytochrome oxidase-encoding loci maintained in the
Bordetella genome, little is known about how they are regulated, how the encoded proteins contribute to the physiology of the bacteria, how the genes encoding cytochromes are regulated, or whether they are required for bacterial survival in the mammalian host. In vitro studies focused on understanding cytochrome c biogenesis in B. pertussis showed that cytochrome c and cytochrome c-dependent oxidases (the aa3-type and cbb3-type cytochromes) are dispensable for bacterial growth in the laboratory, indicating that quinol dependent cytochromes (bo3-type and bd-type cytochromes) can sustain bacterial respiration under these conditions (39, 45).
Additional studies indicate that the cbb3-type cytochrome is likely non-functional in B. pertussis as mutations in the genes encoding aa3-type cytochrome subunits render B. pertussis oxidase negative (46). Although, multiple transcription analyses have been performed for Bordetella grown in various conditions, these studies provide little evidence of how the cytochrome oxidase operons are regulated (7, 47, 48). In this study, we used transcriptional and recombinase-based reporters to characterize the expression profile of HACO encoding genes in vitro and in vivo and to determine if HACO expression depends on PlrSR. We also characterized B. bronchiseptica mutants with deletions in HACO genes in a mouse model of colonization to determine the importance of HACOs for persistence of Bordetella and for the maintenance of BvgAS activity in vivo.
90
Results
High-affinity cytochrome oxidase loci are differentially regulated in ambient air in vitro
To characterize the expression profile of each putative high affinity cytochrome oxidase
(HACO) operon in vitro, we constructed transcriptional reporters with the predicted promoters of each HACO gene cluster driving the expression of lacZ. We evaluated HACO promoter activity in the wild-type B. bronchiseptica strain RB50 (WT) compared to promoter activity in two
BvgAS phase-locked mutants (BvgSC and ∆bvgS) and a plrS deletion mutant (∆plrS) to determine if any HACO genes are transcriptionally regulated by BvgAS or PlrSR.
When grown under Bvg+ phase conditions (37˚C) in ambient air, the activity of two
HACO promoters, BB4498-BB4497 (cydAB1) and BB1238-BB239 (cydAB2), were significantly increased in the Bvg– phase-locked mutant (∆bvgS) compared to the Bvg+ phase-locked mutant
(BvgSC) or wild-type RB50 (WT) (Fig. 4.1A and 4.1B), indicating that these HACO genes are repressed by BvgAS under these conditions. Expression of cydAB1 and cydAB2 was also significantly greater in WT and BvgSC compared to the wild-type empty vector control (WT-
EV), suggesting that these genes may also be regulated via a mechanism independent of BvgAS
(Fig. 4.1A and 4.1B). The BB3329-BB326 (ccoNOQP) promoter was highly active in WT grown under Bvg+ phase conditions (Fig. 4.1D), however, expression of ccoNOQP did not dependent on BvgAS or PlrSR activity as there was no difference in ccoNOQP transcription between
BvgAS phase-locked strains, a ∆plrS mutant, and WT (Fig. 4.1D). The BB4012-BB4011
(cydAB3) promoter was expressed in WT at very low levels, suggesting these genes are not expressed under Bvg+ phase growth conditions and are not regulated by BvgAS or PlrSR in vitro
(Fig. 4.1C). Overall, these data demonstrate that putative HACO operons are differentially regulated in B. bronchiseptica and that BvgAS has the ability to influence the transcription of two HACO loci in ambient air conditions in vitro.
91
B. bronchiseptica requires high-affinity cytochrome oxidases to robustly colonize the mammalian lower respiratory tract
To determine if high affinity cytochrome oxidases (HACO) contribute to Bordetella colonization of the respiratory tract, we engineered strains of B. bronchiseptica with deletions in each HACO operon. We also constructed a strain lacking the genes encoding all three bd-type
HACOs and a strain lacking all HACOs, to determine if any HACOs may be functionally redundant. We then tested these strains in a mouse model of colonization.
Strains lacking a single HACO or multiple HACOs colonized the murine nasal cavity
(NC) similar to WT (Fig. 4.2A and 4.3A), suggesting that HACOs are not required for
Bordetella colonization of the upper respiratory tract. In the lower respiratory tract (LRT), the
∆cydAB3 mutant was significantly attenuated in colonization of the trachea compared to WT and exhibited reduced colonization in the lungs, indicating that this cytochrome is required for robust bacteria colonization of the LRT (Fig. 4.2B and 4.2C). In vitro, under Bvg+ phase conditions, the cydAB3 promoter was not active in WT, however the essentiality of this gene cluster in vivo, suggests that cydAB3 operon may only be expressed during colonization of the LRT. Similarly, the ∆cydAB1 mutant also exhibited reduced colonization of the LRT compared to WT, indicating that this cytochrome may also contribute to Bordetella survival in the mammalian host (Fig. 4.2B and 4.2C). All other single HACO deletion strains were able to colonize the LRT similar to WT
(Fig. 4.2B and 4.2C).
B. bronchiseptica strains lacking genes encoding all bd-type cytochromes (∆cydAB123) or all four HACOs (∆all HACOs) were attenuated in the LRT compared to WT (Fig. 4.3B and
4.3C). Although ∆cydAB123 and ∆all HACOs exhibited very similar colonization kinetics, only the ∆all HACOs mutant was significantly defective for colonization compared to WT, suggesting that the cbb3- type HACO (ccoNOQP) contributes to Bordetella colonization in the LRT.
92
However, attenuation was not observed for the single cooNOQP deletion strain, suggesting that the slight contribution of this cytochrome to colonization of the LRT may only occur when all other HACOs are non-functional. Compared to the ∆cydAB1 and ∆cydAB3 single deletion mutants, ∆cydAB123 and ∆all HACOs were similarly attenuated in the LRT, suggesting that
HACOs are not functionally redundant in B. bronchiseptica when in the LRT. Overall, these data indicate that the cytochromes cydAB1 (BB4498-BB4497) and cydAB3 (BB4012-4011) likely contribute to robust colonization of the lower mammalian respiratory tract by B. bronchiseptica.
Maintenance of BvgAS kinase activity does not depend on bd-type cytochrome oxidases in vivo
Based on our model, we predict that the activity of HACOs may influence the activity of the BvgAS system. BvgAS activation is essential for Bordetella colonization and our data indicate that cydAB1 (BB4498-BB4497) and cydAB3 (BB4012-4011) are required for robust colonization of the LRT, therefore we analyzed BvgAS activity in ∆cydAB1, ∆cydAB3, and
∆cydAB123, using the plasmid reporter, pGFLIP-PflaA. pGFLIP-PflaA is a recombinase-based reporter that indicates whether the bacteria have expressed the flaA gene, and hence the Bvg– phase, at any time during the course of the experiment (49). Expression of flaA results in a conversion of the bacteria from GFP+ and Kmr to GFP– and Kms (REF). As expected, all HACO deletion strains with pGFLIP-PflaA colonized the nasal cavity similar to WT (Fig. 4.4A). In contrast to our previous experiment, there was no significant difference in colonization of the
LRT by the HACO single deletion mutants compared to WT (Fig. 4.4B), however ∆cydAB123 was significantly attenuated in the lungs (Fig. 4.4B and 4.4C). For WT and all HACO mutants, very few, if any, GFP negative colonies were recovered from the mouse respiratory tract (Fig.
4.4D, 4.4E, and 4.4F), indicating that the flaA promoter was not expressed and all bacteria
93
remained in the Bvg+ phase during the experiment. Overall, these data demonstrate that maintenance of BvgS kinase activity does not depend on the function of bd-type HACOs during
Bordetella respiratory tract colonization.
Although required for robust colonization in vivo, the BB4012-BB4011 (cydAB3) promoter is inactive during colonization of the murine respiratory tract
We have shown that in B. bronchiseptica, the cydAB3 cytochrome operon is not expressed in vitro, however, this cytochrome is required for robust colonization of the LRT, suggesting that the genes encoding cydAB3 are only expressed during colonization of the LRT.
Using the pGFLIP reporter system, we aimed to determine if the cydAB3 promoter is active in vivo and if the PlrSR system regulates the expression of this gene cluster in the LRT. The putative cydAB3 promoter was engineered to drive expression of the flp recombinase in pGFLIP to create the plasmid reporter, pGFLIP-PcydAB3. This reporter was introduced into WT and a plrS deletion strain (∆plrS).
As expected, and shown previously (10, 35), WT and ∆plrS with the pGFLIP-PcydAB3 reporter colonized the NC similarly, while ∆plrS was rapidly cleared from the LRT (Fig. 4.5A and 4.5B). Very few, if any, WT bacteria were recovered from the NC and LRT were GFP–, indicating that the PcydAB3 was not active in WT during respiratory tract colonization (Fig. 4.5C and 4.5D). Similarly, very few GFP– ∆plrS bacteria were recovered from the upper and lower respiratory tract. Together, these data suggest that the cydAB3 promoter is not active during infection and is not regulated by the PlrSR system. These results contradict our previous data indicating that the cydAB3 cytochrome is required for Bordetella colonization in the LRT, suggesting that the cydAB genes are expressed during infection. Therefore, it is possible that the segment of DNA used to drive transcription of flp recombinase in pGFLIP-PcydAB3 does not contain the complete promoter region that regulates the cydAB3 operon or that the activity of
94
PcydAB3 is insufficient to adequately drive expression of the flp recombinase in order to resolve the gfp from the pGFLIP reporter.
Discussion
As obligate aerobes, pathogenic Bordetella rely on cytochrome oxidases to reduce oxygen into water as the final step in electron transport-coupled oxidative phosphorylation.
Although Bordetella maintains many loci encoding putative cytochrome oxidase complexes within its genome, it is unknown how these proteins contribute to the bacteria’s physiology and what role, if any, they may play in bacterial virulence. We became interested in understanding more about the requirement of cytochrome oxidases for Bordetella virulence and how they are regulated, in hopes of determining if HACOs govern the link between PlrSR and the master regulator of virulence, BvgAS, during bacterial colonization of the mammalian LRT. While our results indicate that some of the HACOs encoded in the B. bronchiseptica genome are required for robust bacterial colonization of the trachea and lungs, we found no evidence that BvgAS activity was influenced by the absence of HACOs and it remains to be determined if PlrSR regulates the expression of HACO encoding genes in vivo.
Out of the four HACO loci that B. bronchiseptica encodes, two are required for robust colonization specifically in the LRT: (BB4498-BB4497 (cydAB1) and BB4012-BB4011
(cydAB3)). No HACOs were required for B. bronchiseptica colonization of the upper respiratory tract. Our results indicate that CydAB1 and CydAB3 are not functionally redundant, and without either cytochrome approximately 90% of the bacteria are cleared from the LRT compared to
WT. Interestingly, bacteria lacking both cytochromes (CydAB1 and CydAB3, as well as
CydAB2, ∆cydAB123) did not exhibit a cumulative reduction in bacterial burden compared to the single deletion strains, indicating that perhaps the requirement of each cytochrome is
95
restricted to a distinct lower airway niche or to a specific time during the establishment of infection. In support of this idea, respiratory heterogeneity within a bacterial population has been implicated as being important for biofilm formation and colonization of the host by uropathogenic E. coli and it is possible that a similar phenomenon could explain the phenotypes we have observed for Bordetella colonization in the LRT (50).
While HACOs contribute to Bordetella survival in the LRT, a significant number of bacteria, lacking all functional HACOs (∆all HACOs), were recovered from the trachea and lungs, suggesting that other types of cytochrome oxidases (most likely the low affinity cytochrome oxidases (LACOs)) may also play a role in Bordetella colonization of the trachea and lungs. For example, bacteria still present in the lungs after 3 days of colonization may be localized within an environment that does not require the use of HACOs for bacterial respiration but instead depends on LACOs. To more completely understand how cytochrome oxidases contribute to Bordetella colonization of the mammalian host, we have expanded the scope of our studies to determine if LACOs are also important for LRT colonization and are interested in determining whether bacterial localization within the LRT influences the necessity of certain types of cytochrome oxidases.
CydAB1 and CydAB3 (BB4498-BB4497 (cydAB1) and BB4012-BB4011 (cydAB3)) are bd-type cytochrome oxidases. Bd cytochrome oxidases are prokaryotic-specific respiratory quinol:O2 oxidoreductases, which are unrelated to the extensively studied family of heme-copper oxidases and use quinols as a physiological reducing substrate (51–53). Many pathogenic bacteria produce bd-type cytochrome oxidases and virulence has been linked with the production of this particular type of oxidase (37, 50, 54–57). In addition to being critical for bacterial respiration and maintenance of the proton motive force, often in environments of low oxygen, it
96
has recently become appreciated that bd-type cytochrome oxidases are also important for defense against the host immune response and oxidative and nitrosative stresses (50, 53, 56–62). Mild to severe leukocytosis, or an influx of circulating white blood cells, is often associated with
Bordetella infection. Although Bordetella has an arsenal of toxins to evade immune cell clearance and to prevent reactive oxygen species (ROS) production from these cell types, it is possible that the production of bd-type cytochrome oxidases helps the bacteria resist oxidative stress during infection.
To date, our data suggest that maintenance of BvgS kinase activity does not depend on the activity of bd-type HACOs during respiratory tract colonization. Using pGFLIP-PflaA, we demonstrated that the flaA promoter was not activated in the triple bd-type cytochrome deletion mutant (∆cydAB123) during respiratory tract colonization, indicating that the bacteria did not
– modulate to the Bvg phase while in the host. However, by only using pGFLIP-PflaA, we cannot rule out that BvgS kinase activity was slightly reduced in the cytochrome mutants, albeit not enough to fully modulate the bacteria to the Bvg– phase. To confirm BvgS kinase activity is unaffected by the lack of HACO production, we plan to use the pGFLIP-PptxA reporter to assess
BvgS activity in our HACO deletion strains. The ptx promoter, which drives the expression of genes encoding pertussis toxin and its export system in B. pertussis, contains low affinity
BvgA~P binding sites and requires high levels of BvgA~P within the cell for activation.
Therefore, use of the pGFLIP-PptxA reporter would allow us to discern a minute drop in BvgA~P levels in the cell and hence slight changes in BvgS kinase activity. We are also interested in determining if BvgAS activity is influenced by the activity of LACOs since we hypothesize these proteins may be important for Bordetella LRT colonization and we plan to use both recombinase-based reporters to evaluate BvgAS activity in strains lack LACOs.
97
Based on our in vitro transcriptional analyses, no HACO loci were regulated by PlrSR.
However, it is important to note that our studies have been limited to the evaluation of bacteria grown in the laboratory in ambient air. We do not believe these growth conditions accurately mimic those encountered in the LRT; an environment in which B. bronchiseptica lacking PlrS is severely attenuated. A ∆plrS mutant exhibits no discernable phenotype compared to wild-type B. bronchiseptica when grown in vitro. Therefore, we plan to continue our analysis of cytochrome oxidase gene expression in bacteria grown in vitro with low oxygen and during respiratory tract colonization to understand which cytochrome oxidases are important under these conditions and if they are regulated by PlrSR.
Although we have demonstrated that some HACOs contribute to robust colonization of the LRT by Bordetella, our data indicate that additional types of cytochromes are required by the bacteria in this environment. Thus far, we have found no evidence that BvgAS activity is significantly affected by the absence of HACOs or that PlrSR regulates the expression of HACO encoding genes. However, many questions remain and we plan to expand the scope of our studies to evaluate whether LACOs are required for bacterial colonization of the LRT and to confirm that BvgS kinase activity is not influenced by cytochromes oxidase activity in vivo.
Regardless of our findings, the work presented in this chapter creates a strong foundation for further investigation into the importance of cytochrome oxidases for Bordetella physiology and pathogenesis in the mammalian host.
Materials and Methods
Bacterial strains, plasmids, and growth conditions
All bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli strains were grown using Lysogeny broth (LB) or agar at 37C. B. bronchiseptica strains were
98
grown on Bordet-Gengou (BG) agar supplemented with 7.5% defribinated sheep blood or in
Stainer-Scholte (SS) broth supplemented with SS supplement at 37°C. As needed, media was supplemented with ampicillin (Amp; 100 g/mL), streptomycin (Sm; 20 g/mL), gentamicin
(Gm; 30 g/mL), kanamycin (Km; E.coli at 50 g/mL or B. bronchiseptica at 125 g/mL), or diaminopimelic acid (DAP; 300 g/mL).
Construction of high-affinity cytochrome oxidase lacZ transcriptional reporters
To construct lacZ transcriptional reporters for all high-affinity cytochrome oxidase operons, each putative promoter was amplified by PCR from B. bronchiseptica RB50, using primers listed in Table 2. PCR products were digested and cloned into the pUC-lacZ plasmid using EcoRI and HindIII restriction sites. The insert was then sequenced for verification. The resulting plasmids were then introduced into WT, BvgSC, ∆bvgS, and ∆plrS strains using tri- parental mating with conjugative RHO3. Reporter delivery to the Tn7 site was confirmed by
PCR in each strain.
Transcriptional analysis of high-affinity cytochrome oxidase encoding genes in vitro
To analyze expression of the HACO genes under Bvg+ phase conditions a beta- galactosidase assay was used. Strains were grown on BG-blood agar supplemented with kanamycin at 37 °C until colonies formed. Approximately 3-4 single colonies were used to inoculate liquid SS media with kanamycin, which were grown overnight for ~18 h at 37 °C in ambient air on a roller. One-hundred microliters of each culture was diluted using 1x Z-Buffer with freshly added 2-Mercaptoethanol (-ME) to a 1mL total volume in a clean centrifuge tube.
Diluted samples were vortexed and 250 microliters (L) of each sample was transferred to a 96- well, flat bottom, polystyrene plate, and the OD600 was measured on a Perkin-Elmer Victor3
1420 Multi-label plate reader. Subsequently, 50 L of chloroform and 10 L of 0.1% SDS were
99
added to each of the remaining 750 L diluted samples to permeabilize the bacterial cells.
Samples were vortexed for ~ 15 seconds and allowed to settle until the organic and inorganic layers were clearly separated. In a 96-well, flat bottom, polystyrene plate, 50 L of each permeabilized cell sample, 150 L of fresh 1x Z-Buffer, and 50 L of ONPG at a concentration of 4 mg/mL were added to wells in triplicate. OD420 was then measured every minute for 20 minutes on a Perkin-Elmer Victor3 1420 Multi-label plate reader for each sample. -gal activity units were determined for each sample using the equation, -gal units = (∆OD420)/
((∆T)*(OD600)*(V)) where ∆OD420 equals the difference between OD420 readings at Time 2
(T2)- Time 1(T1) (Note: Values must be within the linear range of the 420 absorbance curve),
∆T equals Time 2 (T2)- Time 1(T1) in minutes, V equals the volume of culture assayed in milliliters (Amount of permeabilized cells added to each 96 well), and OD600 equals the optical density of each diluted sample. Cultures were tested in duplicate and the experiment was repeated three times. -gal activity units were averaged across all replicates.
Construction of B. bronchiseptica high-affinity cytochrome oxidase deletion strains
DNA manipulation and cloning were performed according to standard molecular cloning methods. All restriction enzymes and DNA ligase were obtained from New England Bio Labs.
High-fidelity PFU Ultra II DNA polymerase was used for construction of all allelic exchange vectors used in this study. GoTaq DNA polymerase was used for screening purposes during plasmid and strain construction. All enzymes were used according to the manufacturer’s instructions. The primers used for creating deletions are listed in Table 2. All primers were synthesized by Eton Biosciences and purified using a standard desalting method.
Allelic exchange plasmids were generated to delete each high affinity cytochrome oxidase operon. Primers were used to generate an approximately 1 kb DNA fragment containing
100
3 codons from the beginning of the first gene within the operon and 3 codons from the end of the last gene within the operon, flanked by homologous sequences (~500 bp each) corresponding to the regions 5’ and 3’ to the desired deletion. Primers used to generate the most 5’ and 3’ ends of the DNA fragments for each mutant were designed to include a BamHI restriction site at the 5’ end and a SacI restriction at the 3’ end, which were used to clone the DNA fragments into the allelic exchange plasmid pEG7S (63). Standard methods were then used to deliver these plasmids to RB50 by conjugation using RHO3 cells. Double homologous recombination events that introduced the desired mutation into the chromosome were selected for using 15% sucrose.
Sanger sequencing was used to verify deletion of each HACO operon. Allelic exchange was repeatedly performed using a different deletion plasmid each time to make the triple and quadruple HACO deletion strains. The pGFLIP-PflaA reporter was introduced into each mutant strain, using tri-parental mating with conjugative RHO3 and integration of the reporter on to the chromosome at the attTn7 site was verified using PCR.
Bacterial colonization of the mouse respiratory tract
Six-week-old female BALB/cJ mice from Jackson Laboratories (Bar Harbor, ME) were inoculated intra-nasally with 7.5 x 104 cfu B. bronchiseptica in 50 μL of phosphate-buffered saline (PBS). For all time points, nasal cavity, tracheal tissue, and right lung lobes were harvested; tissues were homogenized, and the number of cfu was determined by plating dilutions of tissue homogenates on BG blood agar supplemented with streptomycin.
Evaluation of B. bronchiseptica modulation in vivo
Bacteria were cultured overnight at 37 °C in SS media with streptomycin, kanamycin, and gentamicin to maintain bacteria in the Bvg+ phase (20). Six-week-old female BALB/c mice from Jackson Laboratories (Bar Harbor, ME) were inoculated intra-nasally with 7.5 × 104 cfu of
101
B. bronchiseptica strains (containing the pGFLIP-PflaA reporter) in 50 μL of 1 X DPBS. At each time point reported, nasal cavity, tracheal tissue, and right lung lobes were harvested and homogenized in 1 X DPBS using a mini-bead beater. Dilutions of the tissue homogenates were then plated on BG-blood agar, supplemented with streptomycin and gentamicin, and grown at
37C for 72 h. White light (to enumerate total cfu) and blue light (to enumerate GFP+ colonies) images of each plate were captured using a G:Box Imaging System (Syngene). Total cfu and
GFP positive colonies were enumerated using the colony analysis protocol of the GeneTools
Software package (Syngene). The total number of GFP negative colonies was calculated by subtracting the number of GFP positive colonies from the total number of colonies isolated. The percent GFP negative colonies was calculated by determining the ratio of GFP negative colonies to the total number of colonies isolated.
Construction of pGFLIP-PcydAB3 reporter
To construct pGFLIP-PcydAB3, the putative promoter (-1 to -179bp) driving expression of cydAB3 (BB4012-BB4011) was amplified by PCR from B. bronchiseptica RB50, using primers listed in Table 2. PCR products were digested and cloned into the pGFLIP plasmid using SacI and KpnI restriction sites. The construct was then sequenced for verification. The resulting plasmid was introduced into WT and ∆plrS strains using tri-parental mating with conjugative
RHO3. Reporter delivery to the Tn7 site was confirmed by PCR.
Evaluation of cydAB3 expression in vivo
Bacteria were cultured overnight at 37 °C in SS media with streptomycin and kanamycin
(REF). Six-week-old female BALB/c mice from Jackson Laboratories (Bar Harbor, ME) were inoculated intra-nasally with 7.5 × 104 cfu of B. bronchiseptica strains (containing the pGFLIP-
PcydAB3 reporter) in 50 μL of 1 X DPBS. At each time point reported, nasal cavity and right
102
lung lobes were harvested and homogenized in 1 X DPBS using a mini-bead beater. Dilutions of the tissue homogenates were plated on BG-blood agar, supplemented with streptomycin, and grown at 37C for 72 h. White light (to enumerate total cfu) and blue light (to enumerate GFP+ colonies) images of each plate were captured using a G:Box Imaging System (Syngene). Total cfu and GFP positive colonies were enumerated using the colony analysis protocol of the
GeneTools Software package (Syngene). The total number of GFP negative colonies was calculated by subtracting the number of GFP positive colonies from the total number of colonies isolated. The percent GFP negative colonies was calculated by determining the ratio of GFP negative colonies to the total number of colonies isolated.
Ethics statement
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (64). All animals were properly anesthetized for inoculations, monitored regularly, and killed when moribund.
Efforts were made to minimize suffering. Our protocol was approved by the University of North
Carolina Institutional Animal Care and Use Committee (Protocol ID: 16-246).
Statistical analysis
Statistical analysis was performed using Prism 7.0d software from GraphPad Software.
Statistical significance was determined using a Kruskal-Wallis test with multiple comparisons. P
< 0.05 was considered significant. Figures were generated using Adobe Illustrator CS6 (Adobe
Systems).
103
Figures and Tables
BB1238-BB1239 A. BB4498-BB4497 B. (cydAB2) (cydAB1)
BB4012-BB4011 BB3329-BB3326 C. (cydAB3) D. (ccoNOQP)
Figure 4.1. In vitro, BvgS influences the expression of high affinity cytochrome oxidase encoding genes in B. bronchiseptica. Transcriptional analysis of putative HACO promoter activity in wild-type (WT), BvgSC, ∆bvgS, and ∆plrS strains of B. bronchiseptica using the lacZ- based reporters. WT-EV and ∆bvgS-EV contain empty reporters with no promoter driving lacZ expression as controls. All strains were cultured in Stainer Scholte (SS) broth and ambient air at 37 °C with agitation (Bvg+ growth conditions). (A) Activity of the putative promoter for genes BB4498-97 (cydAB1). (B) Activity of the putative promoter for genes BB1238-39 (cydAB2). (C) Activity of the putative promoter for genes BB4012-11 (cydAB3). (D) Activity of the putative promoter for genes BB3329-26 (ccoNOQP). Colored bars represent the mean beta-gal activity units per cell calculated from triplicate experiments. Error bars represent the standard deviation of beta-gal activity units per cell for each data set. Statistical significance (Kruskal-Wallis Test with multiple comparison, P < 0.05) between strains is indicated with * (P < 0.05), ** (P < 0.01), and **** (P < 0.0001).
104
A.
B.
C.
Figure 4.2. Two bd-type high-affinity cytochrome oxidases contribute to B. bronchiseptica colonization of the trachea in mice. Colonization of the (A) nasal cavity, (B) trachea, and (C) right lung tissue in female BALB/cJ mice by wild type (WT; black circles), ∆cydAB1 (blue squares), ∆cydAB2 (red squares), ∆cydAB3 (green diamonds), and ∆ccoNOQP (purple triangles) strains on days 0, 1, 3, and 7 post-inoculation. Mice were inoculated with 7.5 x104 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as short horizontal bars. Statistical significance (Kruskal-Wallis test and Dunn’s multiple comparisons test, P < 0.05) is indicated with * (P < 0.05).
105
A. B. C.
Figure 4.3. Without high-affinity cytochrome oxidases B. bronchiseptica is significantly attenuated for colonization of the trachea and LRT in mice. Colonization of the (A) nasal cavity, (B) trachea, and (C) right lung tissue in female BALB/cJ mice by wild type (WT; black circles), ∆cydAB123 (orange hexagons), and ∆all HACOs (yellow triangles) strains on days 0, 1, 3, and 7 post-inoculation. Mice were inoculated with 7.5 x104 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as short horizontal bars. Statistical significance (Kruskal-Wallis test and Dunn’s multiple comparisons test, P < 0.05) is indicated with * (P < 0.05).
106
A. B. C.
D. E. F.
Figure 4.4. Maintenance of BvgS kinase activity does not require bd-type high-affinity cytochrome oxidases during respiratory tract colonization of mice. Colonization of the (A) nasal cavity, (B) trachea, and (C) right lung tissue in female BALB/cJ mice by wild type (WT; black circles), ∆cydAB1 (red squares), ∆cydAB3 (green triangles), and ∆cydAB123 (blue diamonds) strains on days 0, 1, and 3 post-inoculation. All strains contain the plasmid reporter, 4 pGFLIP-PflaA. Mice were inoculated with 7.5 x10 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as short horizontal bars. Percentage of GFP negative (% GFP–) bacteria recovered from the (D) nasal cavity, (E) trachea, and (F) right lung. GFP negativity indicates bacterial modulation and loss of BvgS kinase activity. Statistical significance (Kruskal-Wallis test and Dunn’s multiple comparisons test, P < 0.05) is indicated with * (P < 0.05).
107
A. B.
C. D.
Figure 4.5. The cydAB3 promoter is not active during respiratory tract colonization. Colonization of the (A) nasal cavity and (B) right lung tissue in female BALB/cJ mice by wild type (WT; black circles) and ∆plrS (red triangles) strains on days 0, 1, and 3 post-inoculation. 4 All strains contain the plasmid reporter, pGFLIP-PcydAB3. Mice were inoculated with 7.5 x10 cfu via the external nares. Each symbol represents a single animal, with the mean colonization depicted as short horizontal bars. Percentage of GFP negative (% GFP–) bacteria recovered from the (C) nasal cavity and (D) right lung. GFP negativity indicates the cydAB3 promoter was active in the bacteria. Statistical significance (Kruskal-Wallis test and Dunn’s multiple comparisons test, P < 0.05) is indicated with * (P < 0.05).
108
Table 4.S1. Bacterial Strains and Plasmids Used in this Study Table 1. Bacterial Strains and Plasmids Used in this Study Bacterial Strain or Plasmid Description Reference E.coli Strains DH5α Molecular cloning strain GIBCO BRL RHO3 Conjugation strain; Kms Δasd ΔaphA, DAP auxotroph (65) B. bronchiseptica Strains RB50 (WT) Wild-type B. bronchiseptica strain; Smr (11) BvgSC (RB53) RB50 containing the bvgS R570H point mutation; Smr (11) ∆bvgS (RB54) RB50 containing an in-frame deletion of bvgS; Smr (11) ∆plrS RB50 containing an in-frame deletion of plrS; Smr (35) ∆cydAB1 RB50 containing an in-frame deletion of genes BB4498-BB4497; Smr This Study ∆cydAB2 RB50 containing an in-frame deletion of genes BB1238-BB1239; Smr This Study ∆cydAB3 RB50 containing an in-frame deletion of genes BB4012-BB4011; Smr This Study ∆ccoNOQP RB50 containing an in-frame deletion of genes BB3329-BB3326; Smr This Study ∆cydAB123 RB50 containing an in-frame deletion of genes BB4498-BB4497, BB1238-BB1239, and BB4012-BB4011; Smr This Study RB50 containing an in-frame deletion of genes BB4498-BB4497, BB1238-BB1239, BB4012-BB4011, and BB3329- ∆all HACOs This Study BB3326; Smr Plasmids Suicide plasmid conferring sucrose sensitivity when integrated into the B. bronchiseptica chromosome, used for allelic pEG7S (12) exchange mutagenesis; Gmr pTNS3 attTn7 transposase expression vector containing tnsABCD; Ampr (65) pGFLIP-PflaA pGFLIP with flp recombinase driven by the RB50 flaA promoter; Ampr, Kmr (49) r r 109 pGFLIP-PcydAB3 pGFLIP with flp recombinase driven by the putative RB50 cydAB3 promoter (BB4012-BB4011); Amp , Km This Study pUC-lacZ attTn7 site-specific integration vector containing lacZ; Kmr (22) pUC-lacZ-cydAB1 pUC-lacZ with lacZ driven by the putative promoter for BB4498-BB4497; Kmr This Study pUC-lacZ-cydAB2 pUC-lacZ with lacZ driven by the putative promoter for BB1238-BB1239; Kmr This Study pUC-lacZ-cydAB3 pUC-lacZ with lacZ driven by the putative promoter for BB4012-BB4011; Kmr This Study pUC-lacZ-ccoNOQP pUC-lacZ with lacZ driven by the putative promoter for BB3329-BB3326; Kmr This Study pEG7S plasmid containing a ~1 kb DNA fragment encoding an in-frame deletion of BB4498-BB4497 situated between 5’ pEG7S-∆cydAB1 This Study and 3’ homologous sequences (500 bp each) that correspond to sequence flanking BB4498-BB4497 in RB50 bvgS pEG7S plasmid containing a ~1 kb DNA fragment encoding an in-frame deletion of BB1238-BB1239 situated between pEG7S-∆cydAB2 This Study 5’ and 3’ homologous sequences (500 bp each) that correspond to sequence flanking BB1238-BB1239 in RB50 bvgS pEG7S plasmid containing a ~1 kb DNA fragment encoding an in-frame deletion of BB4012-BB4011 situated between 5’ pEG7S-∆cydAB3 This Study and 3’ homologous sequences (500 bp each) that correspond to sequence flanking BB4012-BB4011 in RB50 bvgS pEG7S plasmid containing a ~1 kb DNA fragment encoding an in-frame deletion of BB3329-BB3326 situated between pEG7S-∆ccoNOQP This Study 5’ and 3’ homologous sequences (500 bp each) that correspond to sequence flanking BB3329-BB3326 in RB50 bvgS
Table 4.S2. Primers Used in this Study Table 2. Primers Used in this Study Primer Primer Description Sequence Name Orientation MAB97 Construction of the pUC-lacZ-cydAB1 Transcription Reporter ACTGGAATTCGGAGCTGATCGAGCTGTCCAC Forward MAB98 Construction of the pUC-lacZ-cydAB1 Transcription Reporter CAGTAAGCTTGAGACGCTCCCAGACGGTAGA Reverse MAB99 Construction of the pUC-lacZ-cydAB2 Transcription Reporter ACTGGAATTCAGGCACCATGCCACCGT Forward MAB100 Construction of the pUC-lacZ-cydAB2 Transcription Reporter CAGTAAGCTTTGAATCCGAACTGAATCCGG Reverse MAB101 Construction of the pUC-lacZ-cydAB3 Transcription Reporter CAGTGAATCCTGCCGGCCCACAGTTT Reverse MAB102 Construction of the pUC-lacZ-cydAB3 Transcription Reporter AGCTAAGCTTTAGAGCCTGTTTCCGGCAT Forward MAB103 Construction of the pUC-lacZ-ccoNOQP Transcription Reporter AGCTAAGCTTACACCACAGTCATGATGGCG Forward MAB104 Construction of the pUC-lacZ-ccoNOQP Transcription Reporter CAGTGAATTCCCGCGATATTGCGCGAT Reverse MAB57 Construction of the pEG7S-∆cydAB1 (Upstream Fragment) AGTCGAGCTCTTTTCGCGTTCCAACGTCA Forward MAB58 Construction of the pEG7S-∆cydAB1 (Upstream Fragment) ACTGGCTCCTGATCAGTACGAAGCCGACATGGCCTCC Reverse MAB59 Construction of the pEG7S-∆cydAB1 (Downstream Fragment) GGGAGGCCATGTCGGCTTCGTACTGATCAGGAGCCAGTCAT Forward MAB60 Construction of the pEG7S-∆cydAB1 (Downstream Fragment) TGACGGATCCAACGCCTCGCGCACCT Reverse MAB109 Construction of the pEG7S-∆cydAB2 (Upstream Fragment) GCCTCCTCAGTGATAACTCATCATGTGTGGCTCCC Reverse MAB110 Construction of the pEG7S-∆cydAB2 (Upstream Fragment) TGACGGATCCGTCAGCACGAACAGCGACG Forward MAB111 Construction of the pEG7S-∆cydAB2 (Downstream Fragment) CATGATGAGTTATCACTGAGGAGGCCGCC Reverse MAB112 Construction of the pEG7S-∆cydAB2 (Downstream Fragment) ATCGGAGCTCGCATGGTCAGCTGCAGCA Forward 110 MAB113 Construction of the pEG7S-∆cydAB3 (Downstream Fragment) CGAACGGTAGGCTTGCAACAGTGTTTCCG Forward MAB114 Construction of the pEG7S-∆cydAB3 (Downstream Fragment) ATCGGAGCTCGCGAACTCGTACATGAATTCGAA Reverse
MAB115 Construction of the pEG7S-∆cydAB3 (Upsteam Fragment) CTGTTGCAAGCCTACCGTTCGGTGTTCGGC Reverse MAB116 Construction of the pEG7S-∆cydAB3 (Upstream Fragment) TGACGGATCCGACCAGTTCATCGGCTTCG Forward MAB117 Construction of the pEG7S-∆ccoNOQP (Downstream Fragment) GCAGTTTGATCTGATCGTTCATCAGCCATCCCC Forward MAB118 Construction of the pEG7S-∆ccoNOQP (Downstream Fragment) ATCGGAGCTCCCTGGCACCTGCTCATGA Reverse MAB119 Construction of the pEG7S-∆ccoNOQP (Upstream Fragment) TGATGAACGATCAGATCAAACTGCTGTCGGC Reverse MAB120 Construction of the pEG7S-∆ccoNOQP (Upstream Fragment) TGACGGATCCACAGCACCAGCCCGAACA Forward MAB172 Introducing the PcydAB3 promoter into pGFLIP for in vivo analysis GTACGAGCTCTGCCGGCCCACAGTTTGC Forward MAB173 Introducing the PcydAB3 promoter into pGFLIP for in vivo analysis GTACGGTACCCAGTGTTTCCGCGCGAACG Reverse
REFERENCES
1. Kilgore PE, Salim AM, Zervos MJ, Schmitt H-J (2016) Pertussis: Microbiology, Disease, Treatment, and Prevention. Clinical Microbiology Review 29:449–486.
2. Cherry JD (2012) Epidemic Pertussis in 2012 — The Resurgence of a Vaccine- Preventable Disease. New England Journal of Medicine 367:785–787.
3. Cherry JD (2019) The 112-Year Odyssey of Pertussis and Pertussis Vaccines-Mistakes Made and Implications for the Future. Journal of the Pediatric Infectious Disease Society.
4. Diavatopoulos DA, Cummings CA, houls L, Brinig MM, Relman DA, Mooi FR (2005) Bordetella pertussis, the Causative Agent of Whooping Cough, Evolved from a Distinct, Human-Associated Lineage of B. bronchiseptica. PLoS Pathogens 1(4):e45.
5. Melvin JA, Scheller EV, Miller JF, Cotter PA (2014) Bordetella pertussis pathogenesis: current and future challenges. Nature Reviews Microbiology 12:nrmicro3235.
6. Parkhill J, Sebaihia M, Preston A, Murphy LD, Thomson N, Harris DE, Holden MT, Churcher CM, Bentley SD, Mungall KL, Cerdeño-Tárraga AM, Temple L, James K, Harris B, Quail MA, Achtman M, Atkin R, Baker S, Basham D, Bason N, Cherevach I, Chillingworth T, Collins M, Cronin A, Davis P, Doggett J, Feltwell T, Goble A, Hamlin N, Hauser H, Holroyd S, Jagels K, Leather S, Moule S, Norberczak H, O’Neil S, Ormond D, Price C, Rabbinowitsch E, Rutter S, Sanders M, Saunders D, Seeger K, Sharp S, Simmonds M, Skelton J, Squares R, Squares S, Stevens K, Unwin L, Whitehead S, Barrell BG, Maskell DJ (2003) Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nature Genetics 35:ng1227.
7. Moon K, Bonocora RP, Kim DD, Chen Q, Wade JT, Stibitz S, Hinton DM (2017) The BvgAS Regulon of Bordetella pertussis. Mbio 8:e01526-17.
8. de Tejada G, Miller JF, Cotter PA (1996) Comparative analysis of the virulence control systems of Bordetella pertussis and Bordetella bronchiseptica. Molecular Microbiology 22:895–908.
9. Julio SM, Inatsuka CS, Mazar J, Dieterich C, Relman DA, Cotter PA (2009) Natural‐host animal models indicate functional interchangeability between the filamentous haemagglutinins of Bordetella pertussis and Bordetella bronchiseptica and reveal a role for the mature C‐terminal domain, but not the RGD motif, during infection. Molecular Microbiology 71:1574–1590.
10. Bone AM, Wilk AJ, Perault AI, Marlatt SA, Scheller EV, Anthouard R, Chen Q, Stibitz S, Cotter PA, Julio SM (2017) Bordetella PlrSR regulatory system controls BvgAS activity and virulence in the lower respiratory tract. Proceedings of the National Academy of Sciences of the United States of America 114:E1519–E1527.
111
11. Cotter P, Miller J (1994) BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infection and Immunity 62:3381–90.
12. Cotter PA, Miller JF (1997) A mutation in the Bordetella bronchiseptica bvgS gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvg‐regulated antigens. Molecular Microbiology 24:671–685.
13. Taylor-Mulneix DL, Bendor L, Linz B, Rivera I, Ryman VE, Dewan KK, Wagner SM, Wilson EF, Hilburger LJ, Cuff LE, West CM, Harvill ET (2017) Bordetella bronchiseptica exploits the complex life cycle of Dictyostelium discoideum as an amplifying transmission vector. PLoS Biology 15:e2000420.
14. Stockbauer KE, Fuchslocher B, Miller JF, Cotter PA (2001) Identification and characterization of BipA, a Bordetella Bvg‐intermediate phase protein. Molecular Microbiology 39:65–78.
15. Uhl AM, Miller JF (1996) Central Role of the BvgS Receiver as a Phosphorylated Intermediate in a Complex Two-component Phosphorelay. The Journal of Biological Chemistry 271:33176–33180.
16. Decker KB, James TD, Stibitz S, Hinton DM (2012) The Bordetella pertussis model of exquisite gene control by the global transcription factor BvgA. Microbiology 158:1665– 1676.
17. Jones AM, Boucher PE, Williams CL, Stibitz S, Cotter PA (2005) Role of BvgA phosphorylation and DNA binding affinity in control of Bvg‐mediated phenotypic phase transition in Bordetella pertussis. Molecular Microbiology 58:700–713.
18. Cotter PA, Jones AM (2003) Phosphorelay control of virulence gene expression in Bordetella. Trends in Microbiology 11:367–373.
19. Stainer D, Scholte M (1970) A Simple Chemically Defined Medium for the Production of Phase I Bordetella pertussis. Microbiology 63:211–220.
20. Hulbert RR, Cotter PA (2009) Current Protocols in Microbiology. Current Protocols in Microbiology Chapter 4:4B.1.1-4B.1.9.
21. Bock A, Gross R (2001) The BvgAS two-component system of Bordetella spp.: a versatile modulator of virulence gene expression. International Journal of Medical Microbiology 291:119–130.
22. Williams CL, Boucher PE, Stibitz S, Cotter PA (2005) BvgA functions as both an activator and a repressor to control Bvgi phase expression of bipA in Bordetella pertussis. Molecular Microbiology 56:175–188.
112
23. Perraud A-L, Rippe K, Bantscheff M, Glocker M, Lucassen M, Jung K, Sebald W, Weiss V, Gross R (2000) Dimerization of signaling modules of the EvgAS and BvgAS phosphorelay systems. Biochimica et Biophysica Acta 1478:341–354.
24. Steffen P, Goyard S, Ullmann A (1996) Phosphorylated BvgA is sufficient for transcriptional activation of virulence-regulated genes in Bordetella pertussis. EMBO Journal 15:102–9.
25. Scarlato V, Rappuoli R (1991) Differential response of the bvg virulence regulon of Bordetella pertussis to MgSO4 modulation. Journal of Bacteriology 173:7401–7404.
26. Dupré E, Lesne E, Guérin J, Lensink MF, Verger A, de Ruyck J, Brysbaert G, Vezin H, Locht C, Antoine R, Jacob-Dubuisson F (2015) Signal Transduction by BvgS Sensor Kinase: Binding of the Modulator Nicotinate Affects the Conformation and Dynamics of the Entire Periplasmic Moiety. The Journal of Biological Chemistry 290:23307–23319.
27. Prugnola A, Aricò B, Manetti R, Rappuoli R, Scarlato V. (1995) Response of the bvg regulon of Bordetella pertussis to different temperatures and short-term temperature shifts. Microbiology 141:2529–2534.
28. McPheat W, Wardlaw A, Novotny P (1983) Modulation of Bordetella pertussis by nicotinic acid. Infection and Immunity 41:516–22.
29. Akerley B, Monack D, Falkow S, Miller J (1992) The bvgAS locus negatively controls motility and synthesis of flagella in Bordetella bronchiseptica. Journal of Bacteriology 174:980–990.
30. Deora R, Bootsma HJ, Miller JF, Cotter PA (2001) Diversity in the Bordetella virulence regulon: transcriptional control of a Bvg‐intermediate phase gene. Molecular Microbiology 40:669–683.
31. Vergara-Irigaray N, Chávarri-Martínez A, Rodríguez-Cuesta J, Miller JF, Cotter PA, de Tejada G (2005) Evaluation of the Role of the Bvg Intermediate Phase in Bordetella pertussis during Experimental Respiratory Infection. Infection and Immunity 73:748–760.
32. Akerley BJ, Cotter PA, Miller JF (1995) Ectopic expression of the flagellar regulon alters development of the Bordetella-host interaction. Cell 80:611–620.
33. Merkel T, Stibitz S, Keith J, Leef M, Shahin R (1998) Contribution of regulation by the bvg locus to respiratory infection of mice by Bordetella pertussis. Infection and Immunity 66:4367–73.
34. de Tejada MG, Cotter P, Heininger U, Camilli A, Akerley B, Mekalanos J, Miller J (1998) Neither the Bvg- phase nor the vrg6 locus of Bordetella pertussis is required for respiratory infection in mice. Infection and Immunity 66:2762–8.
113
35. Kaut CS, Duncan MD, Kim J, Maclaren JJ, Cochran KT, Julio SM (2011) A Novel Sensor Kinase Is Required for Bordetella bronchiseptica To Colonize the Lower Respiratory Tract. Infection and Immunity 79:3216–3228.
36. del Carrica M, Fernandez I, Sieira R, Paris G, Goldbaum F (2013) The two‐component systems PrrBA and NtrYX co‐ordinately regulate the adaptation of Brucella abortus to an oxygen‐limited environment. Molecular Microbiology 88:222–233.
37. Atack JM, khanta YN, Djoko KY, Welch JP, Hasri NH, Steichen CT, Hoven RN, Grimmond SM, Othman D, Kappler U, Apicella MA, Jennings MP, Edwards JL, McEwan AG (2013) Characterization of an ntrX Mutant of Neisseria gonorrhoeae Reveals a Response Regulator That Controls Expression of Respiratory Enzymes in Oxidase-Positive Proteobacteria. Journal of Bacteriology 195:2632–2641.
38. de Bagüés M, Loisel-Meyer S, Liautard J-P, Jubier-Maurin V (2007) Different Roles of the Two High-Oxygen-Affinity Terminal Oxidases of Brucella suis: Cytochrome c Oxidase, but Not Ubiquinol Oxidase, Is Required for Persistence in Mice. Infection and Immunity 75:531–535.
39. Kranz RG, Beckett CS, Goldman BS (2002) Genomic analyses of bacterial respiratory and cytochrome c assembly systems: Bordetella as a model for the System II cytochrome c biogenesis pathway. Research in Microbiology 153:1–6.
40. Nieves DJ, Heininger U (2016) Bordetella pertussis. Microbiology Spectrum 4:311–339.
41. Poole R, Cook G. (2000) Redundancy of aerobic respiratory chains in bacteria? Routes, reasons and regulation. Advances in Microbial Physiology 43:165–224.
42. Morris RL, Schmidt TM (2013) Shallow breathing: bacterial life at low O2. Nature Reviews Microbiology 11:205.
43. Bock A, Gross R (2002) The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier. European Journal of Biochemistry 269:3479–3484.
44. Swem LR, Gong X, Yu C-A, Bauer CE (2006) Identification of a Ubiquinone-binding Site That Affects Autophosphorylation of the Sensor Kinase RegB. The Journal of Biological Chemistry 281:6768–6775.
45. Beckett CS, Loughman JA, Karberg KA, Donato GM, Goldman WE, Kranz RG (2000) Four genes are required for the system II cytochrome c biogenesis pathway in Bordetella pertussis, a unique bacterial model. Molecular Microbiology 38:465–481.
46. Feissner RE, Beckett CS, Loughman JA, Kranz RG (2005) Mutations in Cytochrome Assembly and Periplasmic Redox Pathways in Bordetella pertussis. Journal of Bacteriology 187:3941–3949.
114
47. Nicholson TL, Buboltz AM, Harvill ET, Brockmeier SL (2009) Microarray and Functional Analysis of Growth Phase-Dependent Gene Regulation in Bordetella bronchiseptica. Infection and Immunity 77:4221–4231.
48. Nicholson TL (2007) Construction and validation of a first-generation Bordetella bronchiseptica long-oligonucleotide microarray by transcriptional profiling the Bvg regulon. BMC Genomics 8:220.
49. Byrd MS, Mason E, Henderson MW, Scheller EV, Cotter PA (2013) An Improved Recombination-Based In Vivo Expression Technology-Like Reporter System Reveals Differential cyaA Gene Activation in Bordetella Species. Infection and Immunity 81:1295–1305.
50. Beebout CJ, Eberly AR, Werby SH, Reasoner SA, Brannon JR, De S, Fitzgerald MJ, Huggins MM, Clayton DB, Cegelski L, Hadjifrangiskou M (2019) Respiratory Heterogeneity Shapes Biofilm Formation and Host Colonization in Uropathogenic Escherichia coli. Mbio 10(2).
51. Forte E, Borisov VB, Vicente JB, Giuffrè A (2017) Chapter Four: Cytochrome bd and Gaseous Ligands in Bacterial Physiology. Advances in Microbial Physiology 71:171– 234.
52. Safarian S, Rajendran C, Müller H, Preu J, Langer JD, Ovchinnikov S, Hirose T, Kusumoto T, Sakamoto J, Michel H (2016) Structure of a bd oxidase indicates similar mechanisms for membrane-integrated oxygen reductases. Science 352:583–586.
53. Giuffrè A, Borisov VB, Mastronicola D, Sarti P, Forte E (2012) Cytochrome bd oxidase and nitric oxide: From reaction mechanisms to bacterial physiology. FEBS Letters 586:622–629.
54. Kinkel TL, Ramos-Montañez S, Pando JM, Tadeo DV, Strom EN, Libby SJ, Fang FC (2016) An essential role for bacterial nitric oxide synthase in Staphylococcus aureus electron transfer and colonization. Nature Microbiology 2:nmicrobiol2016224.
55. Shepherd M, Achard ME, Idris A, Totsika M, Phan M-D, Peters KM, Sarkar S, Ribeiro CA, Holyoake LV, Ladakis D, Ulett GC, Sweet MJ, Poole RK, McEwan AG, Schembri MA (2016) The cytochrome bd-I respiratory oxidase augments survival of multidrug- resistant Escherichia coli during infection. Scientific Reports 6:35285.
56. Borisov V, Forte E, Siletsky S, Arese M, Davletshin A, Sarti P, Giuffrè A (2015) Cytochrome bd protects bacteria against oxidative and nitrosative stress: A potential target for next-generation antimicrobial agents. Biochemistry 80:565–575.
57. Mason MG, Shepherd M, Nicholls P, Dobbin PS, Dodsworth KS, Poole RK, Cooper CE (2009) Cytochrome bd confers nitric oxide resistance to Escherichia coli. Nature Chemical Biology 5:94.
115
58. Novaes R, Teixeira A, de Miranda A (2019) Oxidative Stress in Microbial Diseases: Pathogen, Host, and Therapeutics. Oxidative Medicine and Cellular Longevity 2019:1–3.
59. Fischer M, Falke D, Naujoks C, Sawers GR (2018) Cytochrome bd Oxidase Has an Important Role in Sustaining Growth and Development of Streptomyces coelicolor A3(2) under Oxygen-Limiting Conditions. Journal of Bacteriology 200:e00239-18.
60. Forte E, Borisov VB, Falabella M, Colaço HG, Tinajero-Trejo M, Poole RK, Vicente JB, Sarti P, Giuffrè A (2016) The Terminal Oxidase Cytochrome bd Promotes Sulfide- resistant Bacterial Respiration and Growth. Scientific Reports 6:23788.
61. Giuffrè A, Borisov VB, Arese M, Sarti P, Forte E (2014) Cytochrome bd oxidase and bacterial tolerance to oxidative and nitrosative stress. Biochimica et Biophysica Acta 1837:1178–1187.
62. Borisov VB, Forte E, Davletshin A, Mastronicola D, Sarti P, Giuffrè A (2013) Cytochrome bd oxidase from Escherichia coli displays high catalase activity: An additional defense against oxidative stress. FEBS Letters 587:2214–2218.
63. Cotter P, Yuk M, Mattoo S, Akerley B, Boschwitz J, Relman D, Miller J (1998) Filamentous hemagglutinin of Bordetella bronchiseptica is required for efficient establishment of tracheal colonization. Infection and Immunity 66:5921–9.
64. Committee on Care and Use of Laboratory Animals (1996) Guide for the Care and Use of Laboratory Animals (NIH, Bethesda), DHHS Publishers No (NIH) 85-23.
65. Anderson MS, Garcia EC, Cotter PA (2012) The Burkholderia bcpAIOB genes define unique classes of two-partner secretion and contact dependent growth inhibition systems. PLoS Genetics 8(8):e1002877.
116
CHAPTER 5. DISCUSSION
For many years, dogma in the Bordetella field has considered the BvgAS system the
‘master regulator of virulence’, regulating the expression of all known protein virulence factor- encoding genes and three unique phenotypic phases. As a consequence, a large portion of the work studying Bordetella physiology and pathogenesis has been focused on understanding the
BvgAS system, and little is known about how other gene regulatory mechanisms contribute to
Bordetella survival and pathogenesis. By demonstrating that the PlrSR two-component system
(TCS) is required for BvgAS to become and remain fully active during infection in the LRT, this work begins to shed light on how Bordetella uses multiple TCSs to optimize bacterial virulence within the mammalian host, challenging the currently held dogma in the field.
An improved vaccine, capable of preventing transmission of Bordetella, is especially critical for the global population to combat the effects of pertussis disease. Efforts to design a vaccine that generates a protective immune response are required. The inclusion of new vaccine components, not present in the current vaccines, would improve vaccine-generated immunity, even within individuals previously vaccinated with the current acellular vaccine. By demonstrating that PlrS is required for Bordetella persistence in the LRT even when BvgAS is rendered constitutively active, this work suggests the presence of BvgAS-independent, PlrS- dependent virulence factors that are critical for bacterial survival in the trachea and lungs. Our current data support a model in which PlrS senses conditions present in the LRT and activates
PlrR, which controls expression of genes required for the maintenance of BvgAS activity and for essential BvgAS-independent functions. In addition to providing a major advance in our
117
understanding of virulence regulation in Bordetella, these results indicate the existence of previously unknown virulence factors that may serve as new vaccine components and therapeutic or diagnostic targets.
While much is known about the BvgAS phosphorelay and transcriptional control of the
BvgAS regulon, the natural signals that impact BvgS activity and the mechanism by which these signals are perceived and integrated by this system are unknown. As a result of our observation that maintenance of BvgS kinase activity in the LRT requires PlrSR, we were motivated to investigate which BvgS signal perception domain is required for this dependency. While the periplasmic venus fly-trap domains of BvgS have been implicated in responding to so-called modulating signals in vitro (nicotinic acid and MgSO4), a role for the cytoplasmic Per-Arnt-Sim
(PAS) domain in signal perception has not previously been demonstrated. By comparing B. bronchiseptica strains with mutations in the PAS domain-encoding region of bvgS with wild- type bacteria in vitro and in vivo, we found that although the PAS domain is not required to sense modulating signals in vitro, it is required for the inactivation of BvgS that occurs in the absence of PlrS in the LRT of mice, suggesting that the BvgS PAS domain functions as an independent signal perception domain. Our data also demonstrate that the BvgS PAS domain is important for controlling absolute levels of BvgS kinase activity and the efficiency of the response to modulating signals in vitro. To the best of our knowledge, our results are the first to indicate that
BvgS is capable of integrating sensory inputs from both the periplasm via the VFT domains and from the cytoplasm via the PAS domain to control precise gene expression patterns in diverse environmental conditions. These findings are significant as they illuminate a previously unappreciated sensory integration mechanism and mode of regulation of BvgAS, which has been a paradigm of TCS regulation for more than 30 years.
118
How PlrSR influences the activity of BvgAS in the LRT remains unknown and is a current area of investigation of our laboratory. Based on our data and that of others, we hypothesize that PlrSR controls the expression of HACOs encoding genes, the products of which are required for bacterial respiration and maintenance of BvgAS activity in the LRT. Although B. bronchiseptica has seven putative cytochrome oxidase-encoding loci, little is known about if or how or when these respiratory enzymes influence Bordetella physiology or pathogenesis. We have discovered that two bd-type HACOs are required for maximum Bordetella colonization of the LRT in mice, however, our results suggest that additional respiratory enzymes may also be required. We hypothesize that these may include low affinity cytochrome oxidases. BvgAS kinase activity does not appear to be affected by the absence of HACOs nor have we found evidence that PlrSR controls the expression of HACO encoding genes, but, further investigation is required to confirm these findings. Regardless of whether our hypothesis is correct, this work will provide a foundation for further study into how cytochrome oxidases contribute to
Bordetella respiration and pathogenesis. If our hypothesis is correct and BvgAS activity is influenced by the function of cytochrome oxidases, our results would be the first to identify a biologically relevant system with the capability of influencing BvgAS activity.
Upon completion of this body work, a number of outstanding questions remain, many of which are focused on understanding more about the PlrSR system and what important processes this system regulates in Bordetella. PlrSR is a member of the NtrYX family of TCS. Although
NtrXY systems are prevalent in proteobacteria, little is known about how these systems function.
By continuing to studying PlrSR in Bordetella, our future work will not only impact the
Bordetella field, but may also provide insight into how NtrYX-like systems in other bacteria function. We are interested in answering many of the following questions regarding PlrSR.
119
These questions include but are not limited to: What does PlrS sense?, Which sensory perception domains are important for PlrS function?, Why does PlrR appear to be essential?, and Is PlrS capable of phosphorylating and dephosphorylating PlrR? The most significant question regarding
PlrSR are what genes comprise the PlrSR regulon and which of these genes encode potential virulence factors or products that link PlrSR with BvgAS regulation during infection. To try to answer this pressing question, we plan to continue investigating the regulation and influence of cytochrome oxidases using B. bronchiseptica. In addition, our collaborators are carrying out a screen to identify genes expressed by Bordetella only in the LRT. Based on these results, we plan to evaluate which, if any, are under the control of PlrSR. Subsequently, these newly identified genes can be evaluated for their contribution to Bordetella pathogenesis in hopes of identifying new virulence factors and therapeutic targets that may help to improve vaccine and remedial strategies against pertussis disease.
120