The Pennsylvania State University

The Graduate School

Eberly College of Science

MOLECULAR EVOLUTION OF VIRULENCE AND

ANTIGENIC DIVERSITY IN BORDETELLA BRONCHISEPTICA

A Dissertation in

Biochemistry, Microbiology and Molecular Biology

by

Anne M. Buboltz

© 2008 Anne M. Buboltz

Submitted in Partial Fulfillment

of the Requirements

for the Degree of

Doctor of Philosophy

December 2008

The dissertation of Anne M. Buboltz was reviewed and approved* by the following:

Eric T. Harvill Associate Professor of Microbiology and Infectious Diseases Dissertation Adviser Chair of Committee

Avery August Professor of Immunology

Peter J. Hudson Professor of Biology

Kenneth C. Keiler Associate Professor of Biochemistry and Molecular Biology

Kathleen Postle Professor of Biochemistry and Molecular Biology

Richard J. Frisque Professor of Molecular Virology and Head of the Department of Biochemistry, Microbiology and Molecular Biology

* Signatures are on file in the Graduate School.

ii ABSTRACT

Bordetella is a genus of Betaproteobacteria consisting of nine species, many of which cause respiratory disease. The population structure of Bordetella is clonal, as the majority of strains fall into a small number of genotypic complexes. While strains of B. bronchiseptica are very closely related genetically, this species exhibits a high level of phenotypic diversity. For example, B. bronchiseptica has been isolated from the respiratory tract of more than 20 species of mammals, causes a wide-variety of severities of respiratory disease, strains can differ up to

100,000-fold in their lethal doses and can differ in their expression of virulence factors. Despite this phenotypic diversity exhibited by B. bronchiseptica strains, very few studies have mapped these traits to a phylogenetic tree to examine the evolution of these traits. Beyond that, even fewer studies have determined the underlying genetics factors associated with the phenotypic trait that was mapped which makes it impossible to determine if the phenotypic diversity is associated with the same genetic factor and to examine the molecular evolution of this trait.

Therefore, using a wide range of approaches including a murine model of infection, comparative genomics and transcriptomics, and phylogenetics, the molecular evolution of the genetics factors that appear to contribute to phenotypic diversity, measured either in terms of virulence or antigenic variation, were examined. The first section shows that the gene encoding adenylate cylcase toxin (CyaA) was replaced with a novel operon via lateral gene transfer (LGT) in a hypovirulent lineage of B. bronchiseptica. The next section shows that the type three secretion system (TTSS) contributes to the increased virulence of a B. bronchiseptica lineage. Finally, we found that two distinct O-Antigen loci, which appear to encode antigenically distinct O-Antigen serotypes, which homologously recombine between B. bronchiseptica lineages. Combined, data contained herein suggest that lateral gene transfer, differential gene expression and homologous

iii recombination all contribute to the phenotypic diversity of B. bronchiseptica strains. We discuss the implication of these findings on both within and outside the Bordetella field, consider the ecological forces that may cause and maintain this diversity and future avenues of research that result from these works.

iv TABLE OF CONTENTS

List of Figures ………………….……………………………………..………. ix

List of Abbreviations…………………………………………………….…….. xi

Acknowledgements……………………………………………………………. xiii

Chapter 1. INTRODUCTION…………………………………………………. 1

Microbial Genetic Diversity…………………………………………… 2

The clonal paradigm of bacteria …………………………………. 2

Bacterial Recombination and its detection …………...………… 2

Methods to analyze genetic diversity in bacterial populations ... 4

Basic Phylogenetic Definitions ……………....………………... 5

Comparative Genomics of Pathogenic Bacteria……..…………. 6

What affects Microbial Diversity?………….……….…………. 6

Evolution of Virulence ……………………………..…………………. 7

What is virulence and how is it measured?………………….…. 7

What pressures affect virulence? ……………………..………… 8

Bringing Fields Together ……………..………………………………… 9

Bordetella …………………………….………………………………… 10

Disease and Vaccines ………………………………..…………. 10

Evolution and Population Structure of the classical bordetellae ... 11

Bordetella BvgAS and Virulence Factors ……………..………… 12

B. bronchiseptica phenotypic diversity ………………..………… 13

Preface ..………………………………………………..………… 13

References ……………………………………………………..………… 14

v Chapter 2. REPLACEMENT OF ADENYLATE CYCLASE TOXIN IN A LINEAGE OF

BORDETELLA BRONCHISEPTICA.…………………………………………. 28

Abstract………………………………………………………………... 29

Introduction……………………………………………………………. 30

Materials and Methods………………………………………………… 33

Results…………………………………………………………………. 39

Discussion……………………………………………………………… 50

Authors and Contributions …..………………………………………… 55

References……………………………………………………………… 56

Chapter 3. TYPE III SECRETION SYSTEM CONTRIBUTES TO THE INCREASED

VIRULENCE OF A BORDETELLA BRONCHISEPTICA LINEAGE.…...... 64

Abstract………………………………………………………………… 65

Introduction…………………………………………………………….. 66

Materials and Methods…………………………………………………. 69

Results………………………………………………………………….. 76

Discussion……………………………………………………………… 85

Author and Contributions ………………………………………………… 89

References……………………………………………………………… 90

Chapter 4. RECOMBINATION OF O-ANTIGEN LOCI IN BORDETELLA BRONCHISEPTICA

AIDS IN EVASION OF CROSS-IMMUNITY.…………………………………. 98

Abstract……………………………………………………………….... 99

Introduction…………………………………………………………….. 100

Materials and Methods…………………………………………………. 103

vi Results………………………………………………………………….. 107

Discussion………………………………………………………………. 116

Authors and Contributions ………………………………………………. 120

References………………………………………………………………. 121

Chapter 5. SUMMARY AND SIGNIFICANCE………………………………... 127

Synopsis ………………………………….....……………….…………… 128

Implications ………………………………………………….…………... 129

Strains Representing B. bronchiseptica…………………………... 129

Clonal Diversity and Recombination References……..………….. 130

Vaccine Design ………………………………...……..………….. 131

Discussion Points …………………………………………….…………... 132

Evolutionary Ecology of Virulence …………....……..………….. 132

Evolutionary Ecology of Antigenic Variation ………..………….. 133

Future Directions ……………………………………………..………….. 134

Determining the Function of ptp genes ……..………..………….. 134

Determining other factors that increase ST32 strain virulence……. 135

Molecular Epidemiology of B. bronchiseptica ……..………….... 135

References ……………………………………………………………….. 138

Appendix ………………………………………………………………………… 145

Appendix A: Bordetella Strain List .………………………………….… 146

Appendix B: MLST primer list .………………………………………… 149

Appendix C: qRT-PCR, RT-PCR, PCR primer list for Chapter 2 ……… 150

Appendix D: Colonization of Nasal Cavity and Trachea by strains 253

vii and RB50 for Chapter 2………………………………….. 152

Appendix E: qRT-PCR Results for Chapter 2 ……………………….… 153

Appendix F: Western blot for protein expression of Ptx by Bordetella

strains for Chapter 2 …………..………………………….. 154

Appendix G: Clinical Reports Accompanying ST32 strains 1289 and

S308 for Chapter 3 ……………………………………….. 155

Appendix H: qRT-PCR Primer List for Chapter 3 …………………….. 157

Appendix I: qRT-PCR Results for Chapter 3 ………………………… 158

Appendix J: Colonization of Nasal Cavity and Trachea by strains 1289

and RB50 and Lungs by strains 448 and RB50 …………. 159

viii LIST OF FIGURES

Figures:

Chapter 2:

Figure 2.1: LD50 and quantification of lung bacterial load of B. bronchiseptica strains

RB50 and 253 ……………………………………………………………. 39

Figure 2.2: Whole Transcriptome Analysis and Adenylate Cyclase Toxin Expression

in B. bronchiseptica strains RB50 and 253 ………………………………. 41

Figure 2.3: Comparative Genomic Hybridization and Adenylate Cyclase Toxin Locus

in strains RB50 and 253 …………………………………………………. 43

Figure 2.4: Loss of cyaA in B. bronchiseptica strain lineage …………...…………… 45

Figure 2.5: Loss of cyaA among a lineage of B. bronchiseptica …………………….. 47

Figure 2.6: LD50 of B. bronchiseptica Sequence Type 27 strains and RB50 cyaA …. 48

Chapter 3:

Figure 3.1: LD50 and quantification of lung bacterial load of B. bronchiseptica strains

RB50 and 1289 ……………………………………………………………. 76

Figure 3.2: Whole Transcriptome Analysis and TTSS Expression in B. bronchiseptica

strains RB50 and 1289 …………………………………………………… 78

Figure 3.3: TTSS mediated affect on cytotoxicity and virulence of B. bronchiseptica

strains RB50 and 1289 ……………………………………………………. 80

Figure 3.4: MLST analysis of 61 Bordetella strains …………………………………. 82

Figure 3.5: TTSS mediated affect on virulence of B. bronchiseptica strain S308,

a ST32 isolate ……………………………………………………………. 83

ix Chapter 4:

Figure 4.1: Recognition of B. bronchiseptica strains RB50 and 1289 using antibodies

from convalescent-phase serum by western blot and ELISA …………….. 107

Figure 4.2: Determination of O-Antigen serotype in 19 B. bronchiseptica strains using

convalescent-phase serum by western blot ………………………………. 109

Figure 4.3: Comparative genomic hybridization and PCR analysis of LPS related-

genes in B. bronchiseptica strains ……………………………………….. 110

Figure 4.4: Mapping the presence of the classical or alternative O-Antigen genes to ST

in 49 B. bronchiseptica strains …………………………………………… 112

Figure 4.5: Effect of LPS vaccination and passive transfer of immune serum on numbers

of B. bronchiseptica strains RB50, 1289 and RB50Δwbm ……………… 114

x LIST OF ABBREVIATIONS cDNA: complementary DNA

CFU: Colony Forming Unit

CGH: Comparative Genomic Hybridization

CyaA: Adenylate Cyclase Toxin

ELISA: Enzyme Linked Immunosorbent Assay g: gravity

HRP: Horseradish Peroxidase

IACUC: Institutional Animal Care and Use Committee

Ig: Immunoglobulin

IP: Intraperitoneal

LCA: Last Common Ancestor

LD50: Mean Lethal Dose

LGT: Lateral Gene Transfer

LPS: Lipopolysaccharide

MLEE: Multi-Locus Enzyme Electrophoresis

MLST: Multi-Locus Sequence Type

O-Ag: O-Antigen

PCR: Polymerase Chain Reaction

PBS: Phosphate Buffered Saline

Ptp: Peptide Transport Protein

Ptx: Pertussis Toxin

PVDF: polyvinylidene diflouride qRT-PCR: Quantitative Real-Time Polymerase Chain Reaction

R0: Basic Reproductive Ratio

xi RD: Region of Difference

RT-PCR: Reverse Transcription Polymerase Chain Reaction

SAM: Significant Analysis of Microarrays

SDS-PAGE: Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

SS: Stainer-Scholte

UPGMA: Unweighted Pair Group Method with Arithmetic Mean

xii ACKNOWLEDGEMENTS:

Parts of this thesis have been published in peer-reviewed research journals. Chapter 2:

Replacement of Adenylate Cyclase Toxin in a Lineage of Bordetella bronchiseptica was published in the Journal of Bacteriology; Volume 190, Issue 15, pages 5502-5511. All appropriate permissions have been obtained to reproduce any figures or text for these articles.

When this thesis was submitted, Chapter 3: TTSS contributes to the increased virulence of a

Bordetella bronchiseptica lineage, and Chapter 4: Recombination of O-Antigen loci in

Bordetella bronchiseptica aids in evasion of cross-immunity were submitted to Infection and

Immunity (on 11-17-08 and 11-06-08, respectively) for publication.

I would like to thank the following people for scientific discussions regarding my thesis work: Dr. Eric Harvill, past and current members of his laboratory (especially Dr. Daniel Wolfe,

Dr. Liz Goebel and Dr. Gráinne Long), my committee members (Dr. Avery August, Dr. Peter

Hudson, Dr. Kenneth Keiler and Dr. Kathleen Postle) and Dr. Stephan Schüster for his guidance and help obtaining the preliminary automated annotation of strain 253 genomic sequence.

I was fortunate to work with many exceptional scientists working at other organizations to whom I owe many thanks: Dr. Tracy Nicholson at the Agricultural Research Service, USDA, carried out the microarray and qRT-PCR experiments and provided essential guidance throughout this work, Dr. Julian Parkhill and Dr. Mohammed Sebaihia at The Sanger Institute,

UK, for their critical discussion and access to unpublished genomic sequence of strain 253, Dr.

Andrew Preston at the University of Bristol, UK, for purifying Bordetella LPS and critical discussions, Dr. Scott Stibitz at the FDA for use of a novel Bordetella allelic exchange vector before its publication and Drs. Erik Hewlett and Gina Donato at the University of Virginia for reagents and critical discussion. Thanks also go to Drs. Frits Mooi at the National Institute of

xiii Public Health and the Environment, Netherlands, Gary Sanden at the Center for Disease

Prevention and Control, Bob Livingston at the University of Missouri Research Animal

Diagnostic Laboratory, Catherine Beckwith at the Pennsylvania State University College of

Medicine and David Relman at Stanford University School of Medicine for B. bronchiseptica isolates.

Last but not least, I would like to thank my family (Charles and Ruth Buboltz, Jennifer,

Barry, Michelle, Justin, and Warren Lotter, Emily, Steve, Abby and Owen Oliver and Tofty

Buboltz), the sailing vessel Lottery, and my friends Meghan Dmytriw, Elaine McDonald and

Maggie Parke for their laughs, love and support during my thesis research.

xiv

Chapter 1:

Introduction

1 Microbial Genetic Diversity:

Characteristics such as serology, host specificity, presence of virulence related genes, type of disease, geographical isolation and dates can be mapped to a phylogeny to provide insights into the pathogenicity and host adaptation of lineages within a species (1, 33, 34, 68, 89,

90).

The Clonal Paradigm of Bacteria:

Most multicellular organisms reproduce sexually with the formation and fusion of gametes, which leads to the random association of alleles or mutations at two or more loci (i.e. linkage equilibrium). Bacteria reproduce asexually by binary fission where the daughter cell contains a chromosome that is identical to that of the mother cell. Because chromosomal mutations are passed exclusively from mother to daughter cell via vertical transfer, they are non- randomly associated (i.e. linkage disequilibrium) (88). Therefore, a particular mutation will be associated with other mutations that arose during clonal expansion (89, 90). Distinct clonal lineages emerge by the accumulation of these mutations over successive generations. Therefore, the characterization of nucleotides at a few variable sites on the bacterial chromosome represents the evolutionary history of a given isolate and its phylogenetic relationship to other members of the population (90).

Bacterial recombination and its detection:

Recombination, either in the form of homologous recombination or lateral gene transfer

(LGT), challenges the clonal paradigm of bacteria because small genome segments are mobilized between strains or even species (14, 29, 33, 82, 90). The non-vertical spread of genes occurs via the so-called „parasexual‟ processes, conjugation, transduction and transformation (90). These processes introduce genes or mutations that spread independent of the lineage in which they

2 arose. The contribution of recombination to the generation of new genotypes varies widely among populations of bacteria (1, 33). While very low levels of recombination can be detected in some populations, leading to high clonality due to slow diversification that is entirely dependent on vertically transferred point mutations (15), other populations exhibit such high recombination rates that they do not conform to the clonal model, exhibiting no linkage disequilibrium and causing the phylogenetic signal from gene trees to be lost using traditional methods (43, 56, 89). Most populations are thought to reside somewhere between these extremes where recombination is a significant force in evolution but not so frequent as to prevent the emergence of bacterial lineages.

Both phylogenetic independent and dependent methods to detect recombination exist in bacterial populations. While neither is a foolproof method, both have served to identify many recombination events (44). One of the most popular phylogenetic independent methods of detecting recombination, and more specifically LGT, is through codon or nucleotide compositional bias in which blocks of DNA are found to harbor a different codon bias than elsewhere in the genome (44, 98). A good example of this phenomenon is the incorporation of an A/T rich gene segment, such as those from phages, into a G/C rich chromosome, such as many bacteria (75). The drawbacks of this approach are that there may be other factors besides

LGT that lead to compositional bias and that not all recently acquired DNA differ in compositional bias, such as the transfer of gene segments between closely related strains or species (44, 60).

Since a bacterial phylogeny is dependent on the clonal paradigm and recombination events challenge the clonal paradigm, recombination can disrupt the evolutionary history of bacteria as portrayed using phylogenetics. This effect can be exploited as a tool to detect

3 recombination in bacterial populations (44, 90). For example, a phylogenetic tree built upon a vertically inherited gene versus a gene that recombines between strains will portray two different evolutionary histories for a given bacterial population. Therefore, the inconsistency between these trees (e.g. phylogenetic conflict or incongruence) has been used as an indicator of recombination (44). Using these trees, the relative rates of recombination, or deviation from linkage disequilibrium, between groups of bacteria can be quantified by using an index of association, where the amount of recombination among a set of sequences and association between alleles at different loci is calculated (88).

Methods to analyze genetic diversity in bacterial populations:

The first and longest standing classification systems for bacteria were dependent on phenotypic variation, such as serotype using poly- or monoclonal antibodies (54, 86, 96). Many other methods including, bacteriophage typing, ribotyping, pulse-field gel electrophoresis, cell electrophoresis or other fingerprinting techniques, have been described to differentiation of bacterial strains (68, 86). The strength of these techniques is also their weakness in that the characterization of isolates is based on highly variable loci, which is advantageous for tracking strains during local outbreaks but is likely misleading in terms of long-term global epidemiology because of the likelihood of these loci being transferred between strains (68). Additionally, results from these methods are difficult or impossible to interpret phylogenetically (54, 86).

Therefore, typing systems arose based on highly conserved loci, where selectively neutral variation accumulates very slowly in the population, allowing for a strong basis to analyze strain variation globally and over long periods of time. The longest standing example of this is multi- locus enzyme electrophoresis (MLEE), which is based on the distinction of strains by the relative electrophoretic mobilities of a large number of enzymes (86). While MLEE provided the first

4 robust method for analyzing bacterial populations over large timescales and geographies, as well a way to examine the relative rates of recombination in a given bacterial population, results from different laboratories could not be readily combined, more than 15 loci typically need to be analyzed and not all nucleotide variations cause differences in elecrtrophoretic mobility (54, 67,

68, 96). To overcome these issues, the characterization of bacterial strain diversity has turned to using high-throughput nucleotide sequencing techniques which provides an unambiguous system for tracking strain variation (54, 68). One of the most commonly used nucleotide-based techniques is multi-locus sequence typing (MLST), where the nucleotide sequence of internal fragments (~500bp) from 5-10 highly conserved loci, such as housekeeping genes, which are distributed over the bacterial chromosome and isolated away from pathogenicity islands, are compared (68). MLST results can be shared unambiguously between laboratories through internet depositories (57, 67, 68). Results from MLST analysis have been used to analyze the population structure of bacteria, the association of lineage with disease, the molecular evolution of phenotypic traits, such as antibiotic resistance, and has revolutionized molecular epidemiology

(33, 96). Currently, MLST analysis serves at the gold standard for analyzing microbial diversity.

Basic phylogenetic definitions:

While there is no simple definition of a bacterial species (1), microbiologists have developed terms and definitions to describe groupings of bacteria within a species. However, these terms are subject to semantics between fields, making it important to define each phylogenetic term to avoid confusion. The term „strain‟ means any variant, no matter if they are measured at the nucleotide or phenotypic level, of a microorganism within a given population

(54). In this work, „strain‟ can be used interchangeably with „isolate.‟ A „clade‟ or „lineage‟ are usually interchangeable and refer to a group arising from the same common ancestor. When

5 using MLST analysis to analyze variants, a group of strains falling into the same allelic category is called a sequence type (ST) (68). A „complex‟ is a groups of isolates in which each shares five or more of the seven alleles with at least one other isolate in the group (34). Described hierarchically, a species is made up of one or more complexes, which includes one or more lineages, that may include one or more STs, which is represented by one or more strains.

Comparative Genomics of Pathogenic Bacteria:

With the increasing availability of genome sequences from multiple strains of pathogenic bacteria and the development of DNA microarrays, important insights into the evolution of bacterial diversity are being uncovered. The comparative genomics of closely related strains can be used to identify the genetic factors that cause different disease phenotypes or host tropisms

(36). For example, the association between genetic factors, such as LGT of virulence related genes, recombination, gene loss, phase variation and differences in gene expression, and phenotypic diversity can be determined (36, 47, 92). The contribution of these factors to virulence, disease phenotype and effects of antigenic variation can then be tested in an infection model (84, 92, 93). The pattern of emergence and maintenance of these factors in the bacterial population can be determined by mapping them to a phylogenetic tree (84, 93, 95).

What affects microbial diversity?:

From the molecular to the ecological level, much current research is focused on how and why different bacterial populations exhibit different levels of genetic diversity and how these levels are maintained (17, 54). Some molecular mechanisms important for generating diversity include the level of sequence identity between host and recipient, the ability to take up foreign

DNA through conjugation, transduction or transformation, the presence of insertional sequences, inefficient DNA repair systems and phase variation (17, 65, 90). In a broader context, many

6 ecological factors affect strain diversity. In general, it is thought or has been shown that forces such as within host competition, periodic selection, shifts in host population structure and host immunity can affect the diversity of a bacterial population (2, 19, 35, 53, 55, 58, 62, 63, 69).

Perhaps the most commonly studied and well-known example of the effect of host immunity on pathogen diversification is antigenic variation (64). In general, it appears that the level of diversity in a bacterial population is a balance between forces that increase and reduce strain diversity and that no single factor is predictor of bacterial strain structure (52).

Evolution of Virulence:

Work on evolutionary biology of virulence aims to understand how evolutionary processes shape patterns of disease within and between populations.

What is virulence and how is it measured?:

The term virulence tends to create controversy mostly because of semantics (81). There are many ways to define virulence including, but not limited to, the level of disease severity or pathology, a reduction in host fitness, an increase in parasite fitness, the rate of pathogen-induced host mortality or transmission (94). An additional level of complexity is added by the fact that most of these definitions can be quantified using different methods. For example, either increased pathology or increased clinical symptoms can be used as a measure of increased pathogen-induced disease severity. While none of these definitions is incorrect, different occasions may call for a different measure of virulence (81). For example, when examining an epidemic it would be more appropriate to measure virulence as the mean number of secondary cases a typical single infected individual will cause in a population with no immunity (i.e. reproductive ratio or R0) (6) than to measure virulence as increased parasite load. However, if one is examining the affect of a novel gene on virulence, it would be more realistic to analyze

7 virulence using the latter method since, even if the novel gene affects R0, the rarity or expense of transmission models inhibits experimental examination of R0. Therefore, given the scientific question, researchers should use the most appropriate definition/measure of virulence and make this explicitly clear. Here, we define virulence as pathogen-induced host mortality as measured by the inoculating dose that kills fifty percent of the infected individuals (LD50). This definition and measure was chosen because it is a gross and robust measure of virulence that is widely-used in studies of the molecular microbiology of host-pathogen interactions (94). Additionally, because a range of doses is used to analyze virulence, this method allows for the comparison of two pathogens whose virulence differs dramatically and, more importantly for our studies, the effect of particular factors on the virulence of these pathogens. We recognize that this definition and method certainly has shortcomings. For example, LD50 does not analyze the rate of mortality (an important parameter for modelers) and it is assumed that increased virulence is associated with increased transmission (an important parameter for ecologists). However, these methods have their own shortcomings in that survival rate at a given dose does not analyze mortality over a range of doses (which is required to be able to detect small changes in virulence due to a particular mutation) and transmission cannot be easily be analyzed (given the lack of an easily accessible and inexpensive transmission model) (16, 31). Therefore, our studies are a prime example of when multiple definitions and measures of virulence may be used but the most appropriate should be chosen and reasoned.

What pressures affect virulence?:

Using any of the above definitions of virulence, it is commonly observed that some microbes are more virulent than others. The most widely accepted view of virulence evolution assumes that there is a trade-off to virulence where the maintenance of harmful effects is

8 characterized by the presence of other beneficial traits (6, 30, 81). Therefore, different ecological forces in given niches may drive or select for strains with either increased or decreased levels of virulence. Much current research is focused on understanding ecological forces that influence virulence. For example, shifts in host population structure are thought to change the virulence of some organisms and are consistent with the rapid emergence of rabbit hemorrhagic disease virus (12, 13). Co-infections also appear to have influence over the level of virulence to which pathogens evolve (37, 40). When malaria was passaged through either vaccinated or unvaccinated mice, the resulting clones were both more virulent than the original clone and the clone collected after passage through vaccinated animals was more virulent than the clone collected after passage through unvaccinated animals (38, 39, 66). Together, these studies demonstrate that many ecological factors can affect the overall virulence of pathogens and it is likely that a combination of these, or other, factors act upon pathogens to drive their virulence equilibrium.

Bringing Fields Together:

Currently, much research is focused on determining the genetic causes that lead to phenotypic diversity. By designating strains by their phenotypic diversity in molecular epidemiology studies, it can be determined if the phenotype appears to have a role in cyclical dynamics, epidemic events or the persistence of pathogens. With these data, models can be developed to determine if predicted ecological forces can explain the molecular epidemiological data. When all of these fields are brought together, it can be proposed which ecological forces affect driving and/or maintaining genotypic diversity of pathogens within a host population. For example, theoretical disease models of co-circulating strains suggest that incomplete cross- immunity may generate conditions for strain-cycling behavior at the population level (7, 26, 48,

9 53, 58). While such interdisciplinary studies are still rare, they will continue to rise as the number of studies in the fields of molecular evolution of genotypic/phenotypic diversity, molecular epidemiology, experimental evolution and theoretical disease ecology increase. This integrated approach will expand our understanding of how and why pathogens emerge, evolve and are maintained, which will increase our ability to control infectious disease.

Bordetella:

Disease and Vaccines: Bordetella is a group of gram negative bacteria that includes at least eight species (B. bronchiseptica, B. pertussis, B. parapertussis, B. avium, B. hinzii, B. holmesii, B. tetranum and B. petrii) (70). The classical bordetellae, B. bronchiseptica, B. pertussis and B. parapertussis, all cause respiratory infections and are the most commonly isolated and studied of all the bordetellae. B. pertussis and B. parapertussis are the etiological agents of whooping cough in humans (70). This disease is characterized by paroxysmal coughing fits followed by a

“whooping” sound as air is inhaled though mucus-clogged airways. The severe coughing can last for 3 months, causes death in approximately 1 in every 150 infants infected with these pathogens and a total of approximately 300,000 deaths per year (10, 70). Whooping cough is relatively well controlled due to vaccinations programs that started in the 1940s (70). However,

B. pertussis is classified as a re-emerging pathogen and outbreaks still occur which suggests that these bacteria are endemic in the human population despite high vaccine coverage (11). While these vaccines effectively prevent B. pertussis-caused disease, the vaccines are derived solely from B. pertussis components and provide little if any protection against B. parapertussis infection (25, 99).

B. bronchiseptica infects a broad-range of mammals, including but not limited to, pigs, cows, cats, dogs, rabbits, monkeys, koalas, polar bears, seals, leopards and guinea pigs (45, 70,

10 76). This bacterium most commonly causes asymptomatic infection of the upper respiratory tract but can also cause lethal pneumonia (45, 70). Infection by B. bronchiseptica predisposes animals to infection by other bacteria, such as Pasteurella multocida, or viruses, such as canine parainfluenza (59, 85). In surveys conducted at agricultural farms or animal houses, the infection of animals by B. bronchiseptica is common and frequently exceeds eighty percent (20,

87). In close living quarters, transmission can be observed between animals, even different species of animals (27). While the route of transmission is assumed to be via aerosol droplets, this has not been proven and other routes have not been ruled out (70). Although prevalence appears high in agricultural and veterinary settings, little is known about its epidemiology in natural settings (70). The most common vaccine strategy for this bacterium is intranasal administration of live, attenuated strains of B. bronchiseptica (70). These vaccines appear to vary widely in their efficacy against preventing disease as some vaccines have been noted to induce disease on their own (32, 46, 80, 91). None have examined if the vaccine protects against colonization.

Evolution and population structure of the classical bordetellae:

The classical bordetellae are basically clonal as the majority of isolates belong to a minimal number of clusters of closely related organisms when analyzed by a variety of methods

(24, 28, 41, 76, 77, 97). Furthermore, results from MLEE analysis support that there is relatively little horizontal gene flow among the classical Bordetella (97). Phylogenetic analyses and genome sequencing of one strain of each of the classical bordetellae showed that B. pertussis and

B. parapertussis have evolved independently, via chromosomal rearrangement and large scale genome decay, from a B. bronchiseptica-like progenitor (28, 79, 97). In fact, these three species are so closely related that it has been suggested that they be considered subspecies (77). While

11 B. perussis and B. parapertussis can be distinguished from each other using MLEE, MLST and

PCR screens among other techniques, the genetic diversity of strains within either species is extremely low, even undetectable by some methods, which indicates that the human adapted bordetellae emerged as pathogens relatively recently (3, 28, 97, 100). While still incredibly closely related, strains of B. bronchiseptica exhibit much higher levels of clonal diversity as some strains of B. bronchiseptica can be more distantly related to each other than to either of the human adapted bordetellae (23, 24, 28).

Bordetella BvgAS and Virulence Factors:

The bvg locus encodes a two-component signal transduction system that includes a histidine kinase sensor protein, BvgS, and a DNA-binding response-regulator protein, BvgA, in all classical Bordetella (8, 74). This signal transduction system mediates the phenotypic transition between virulent (Bvg+) and non-virulent (Bvg-) phases (21, 61). While the environmental cue causing transition between these phases during infection has not been described, it is known that chemical modulators, such as magnesium sulfate or nicotinic acid, and low temperatures, < 25 C, cause a transition from the virulent to non-virulent phase in vitro

(23, 78). Under Bvg- conditions, virulence related genes are switched off and there is maximal expression of virulence-repressed genes, motility loci, urease and alcaligin production which are thought to contribute to the survival of these bacteria under nutrient deprived conditions (4, 5,

22, 23, 72). Under Bvg+ conditions, the Bvg- regulated genes are switched off, genes that inhibit colonization are downregulated and all known virulence factors in the Bordetella are maximally expressed including adhesions (fimbriae, pertactin, filamentous hemagglutinin), toxins

(adenylate cyclase toxin, dermonecrotic toxin and pertussis toxin) and a type three secretion

12 system (23, 71, 73, 78). Using phase locked mutants, it was determined that the Bvg+ phase is both necessary and sufficient for colonization of the murine respiratory tract (21).

B. bronchiseptica phenotypic diversity:

The higher degree of genetic diversity of B. bronchiseptica correlates with strains of this species exhibiting higher levels of phenotypic diversity, host distribution, disease severities and virulence. For example, while B. pertussis and B. parapertussis strictly infect humans, B. bronchiseptica strains appear to infect a wide variety of mammals with little, if any, association between host and strain type (18, 28, 76). The colonization of hosts by B. bronchiseptica can lead to anything from asymptomatic infection to lethal pneumonia (45, 70). In a murine model of infection, the dose of B. bronchiseptica required to kill can differ up to 105-fold between isolates (49, 51). Strains of B. bronchiseptica can differ in virulence factor expression (9, 49, 76,

83). Despite the phenotypic diversity exhibited by B. bronchiseptica strains, very few studies have mapped these traits to a phylogenetic tree to examine the evolution of these phenotypes (9,

49, 50, 83). In all but one study (28), when phenotypic traits were mapped to a phylogenetic tree

(42, 51, 76), the underlying genetic factors associated with the trait were not examined which makes it impossible to determine if the phenotypic diversity is associated with the same genetic factor and the molecular evolution of this trait.

Preface:

All the studies contained in this thesis revolve around one centralized theme; to examine the molecular evolution of the genetic factors contributing to the phenotypic diversity of B. bronchiseptica strains. We address this using a broad range of approaches; examining the phenotypic diversity of B. bronchiseptica strains, either in terms of virulence, as measured by mean lethal dose (LD50) or antigenic variation, determining the genetic factors that appear to

13 cause the phenotypic variation using comparative genome analyses and examining the molecular evolution of these traits using phylogenetics.

The first part of this thesis focuses on (i) what genetic factor(s) appear to contribute to the decreased virulence of a B. bronchiseptica strain, (ii) if this factor is common to a lineage of B. bronchiseptica and (iii) if decreased virulence is common among this lineage. In brief, we show that the adenlyate cyclase toxin (cya) operon has been replaced by novel putative peptide transport genes (ptp) in a hypovirulent lineage of B. bronchiseptica.

The next section of this thesis focuses on (i) what genetic factor(s) contribute to the increased virulence of a B. bronchiseptica strain and (ii) if increased virulence is common among this lineage. We show that the type three secretion system (TTSS) contributes to the increased virulence of a B. bronchiseptica lineage.

The penultimate section focuses on (i) if there is antigenic variation among B. bronchiseptica strains, (ii) the molecular evolution of this antigenic variation and (iii) how this variation affects cross-immunity between strains of B. bronchiseptica. In short, we demonstrate that the O-Antigen loci of B. bronchiseptica appear to homologously recombine which aids in evasion of cross-immunity between B. bronchiseptica strains.

In each section and in the final chapter of this thesis, we relate the molecular evolution of these phenotypic and genotypic traits to a broader audience by discussing the ecological forces that may drive and maintain strain diversity.

14 References:

1. Achtman, M., and M. Wagner. 2008. Microbial diversity and the genetic nature of

microbial species. Nat Rev Microbiol 6:431-40.

2. Adams, B., E. C. Holmes, C. Zhang, M. P. Mammen, Jr., S. Nimmannitya, S.

Kalayanarooj, and M. Boots. 2006. Cross-protective immunity can account for the

alternating epidemic pattern of dengue virus serotypes circulating in Bangkok. Proc Natl

Acad Sci U S A 103:14234-9.

3. Afonina, I., M. Metcalf, A. Mills, and W. Mahoney. 2008. Evaluation of 5'-MGB

hybridization probes for detection of Bordetella pertussis and Bordetella parapertussis

using different real-time PCR instruments. Diagnostic Microbiology and Infectious

Disease 60:429-432.

4. Akerley, B. J., and J. F. Miller. 1993. Flagellin gene transcription in Bordetella

bronchiseptica is regulated by the BvgAS virulence control system. J Bacteriol 175:3468-

79.

5. Akerley, B. J., D. M. Monack, S. Falkow, and J. F. Miller. 1992. The bvgAS locus

negatively controls motility and synthesis of flagella in Bordetella bronchiseptica. J

Bacteriol 174:980-90.

6. Anderson, R. M., and R. M. May. 1982. Coevolution of hosts and parasites.

Parasitology 85 (Pt 2):411-26.

7. Andreasen, V., J. Lin, and S. A. Levin. 1997. The dynamics of cocirculating influenza

strains conferring partial cross-immunity. J Math Biol 35:825-42.

8. Arico, B., J. F. Miller, C. Roy, S. Stibitz, D. Monack, S. Falkow, R. Gross, and R.

Rappuoli. 1989. Sequences required for expression of Bordetella pertussis virulence

15 factors share homology with prokaryotic signal transduction proteins. Proc Natl Acad Sci

U S A 86:6671-5.

9. Bemis, D. A., H. A. Greisen, and M. J. Appel. 1977. Bacteriological variation among

Bordetella bronchiseptica isolates from dogs and other species. J Clin Microbiol 5:471-

80.

10. Bisgard, K. M., F. B. Pascual, K. R. Ehresmann, C. A. Miller, C. Cianfrini, C. E.

Jennings, C. A. Rebmann, J. Gabel, S. L. Schauer, and S. M. Lett. 2004. Infant

pertussis: who was the source? Pediatr Infect Dis J 23:985-9.

11. Bjornstad, O. N., and E. T. Harvill. 2005. Evolution and emergence of Bordetella in

humans. Trends Microbiol 13:355-9.

12. Boots, M., P. J. Hudson, and A. Sasaki. 2004. Large shifts in pathogen virulence relate

to host population structure. Science 303:842-4.

13. Boots, M., and M. Mealor. 2007. Local Interactions Select for Lower Pathogen

Infectivity. Science 315:1284-1286.

14. Bowler, L. D., Q. Y. Zhang, J. Y. Riou, and B. G. Spratt. 1994. Interspecies

recombination between the penA genes of Neisseria meningitidis and commensal

Neisseria species during the emergence of penicillin resistance in N. meningitidis: natural

events and laboratory simulation. J Bacteriol 176:333-7.

15. Boyd, E. F., F. S. Wang, T. S. Whittam, and R. K. Selander. 1996. Molecular genetic

relationships of the salmonellae. Appl Environ Microbiol 62:804-8.

16. Brockmeier, S. L., and K. M. Lager. 2002. Experimental airborne transmission of

porcine reproductive and respiratory syndrome virus and Bordetella bronchiseptica. Vet

Microbiol 89:267-75.

16 17. Brown, S. P. 2006. Cooperation: integrating evolutionary and ecological perspectives.

Curr Biol 16:R960-1.

18. Buboltz, A. M., T. L. Nicholson, M. R. Parette, S. E. Hester, J. Parkhill, and E. T.

Harvill. 2008. Replacement of Adenylate Cyclase Toxin in a Lineage of Bordetella

bronchiseptica. J. Bacteriol.:JB.00226-08.

19. Buckee, C., L. Danon, and S. Gupta. 2007. Host community structure and the

maintenance of pathogen diversity. Proc Biol Sci 274:1715-21.

20. Cameron, R. D., C. J. Giles, and I. M. Smith. 1980. The prevalence of Brodetella

bronchiseptica and turbinate (conchal) atrophy in English pig herds in 1978-79. Vet Rec

107:146-9.

21. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of

phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect

Immun 62:3381-90.

22. Cotter, P. A., and J. F. Miller. 1997. A mutation in the Bordetella bronchiseptica bvgS

gene results in reduced virulence and increased resistance to starvation, and identifies a

new class of Bvg-regulated antigens. Mol Microbiol 24:671-85.

23. Cummings, C. A., H. J. Bootsma, D. A. Relman, and J. F. Miller. 2006. Species- and

strain-specific control of a complex, flexible regulon by Bordetella BvgAS. J Bacteriol

188:1775-85.

24. Cummings, C. A., M. M. Brinig, P. W. Lepp, S. van de Pas, and D. A. Relman. 2004.

Bordetella species are distinguished by patterns of substantial gene loss and host

adaptation. J Bacteriol 186:1484-92.

17 25. David, S., R. van Furth, and F. R. Mooi. 2004. Efficacies of whole cell and acellular

pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22:1892-8.

26. Dawes, J. H., and J. R. Gog. 2002. The onset of oscillatory dynamics in models of

multiple disease strains. J Math Biol 45:471-510.

27. Dawson, S., D. Jones, C. M. McCracken, R. M. Gaskell, C. A. Hart, and C. J.

Gaskell. 2000. Bordetella bronchiseptica infection in cats following contact with infected

dogs. Vet Rec 146:46-8.

28. Diavatopoulos, D. A., C. A. Cummings, L. M. Schouls, M. M. Brinig, D. A. Relman,

and F. R. Mooi. 2005. Bordetella pertussis, the causative agent of whooping cough,

evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog

1:e45.

29. Dowson, C. G., A. Hutchison, N. Woodford, A. P. Johnson, R. C. George, and B. G.

Spratt. 1990. Penicillin-resistant viridans streptococci have obtained altered penicillin-

binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae. Proc

Natl Acad Sci U S A 87:5858-62.

30. Ebert, D., and E. A. Herre. 1996. The evolution of parasitic diseases. Parasitology

Today 12:96-101.

31. Elahi, S., D. R. Thompson, S. Strom, B. O'Connor, L. A. Babiuk, and V. Gerdts.

2008. Infection with Bordetella parapertussis but not Bordetella pertussis causes

pertussis-like disease in older pigs. J Infect Dis 198:384-92.

32. Farrington, D. O., and W. P. Switzer. 1979. Parenteral vaccination of young swine

against Bordetella bronchiseptica. Am J Vet Res 40:1347-51.

18 33. Feil, E. J., and M. C. Enright. 2004. Analyses of clonality and the evolution of bacterial

pathogens. Curr Opin Microbiol 7:308-13.

34. Feil, E. J., and B. G. Spratt. 2001. Recombination and the population structures of

bacterial pathogens. Annu Rev Microbiol 55:561-90.

35. Ferguson, N. M., A. P. Galvani, and R. M. Bush. 2003. Ecological and immunological

determinants of influenza evolution. Nature 422:428-33.

36. Fitzgerald, J. R., and J. M. Musser. 2001. Evolutionary genomics of pathogenic

bacteria. Trends in Microbiology 9:547-553.

37. Gandon, S., V. A. Jansen, and M. van Baalen. 2001. Host life history and the evolution

of parasite virulence. Evolution 55:1056-62.

38. Gandon, S., M. Mackinnon, S. Nee, and A. Read. 2003. Imperfect vaccination: some

epidemiological and evolutionary consequences. Proc Biol Sci 270:1129-36.

39. Gandon, S., M. J. Mackinnon, S. Nee, and A. F. Read. 2001. Imperfect vaccines and

the evolution of pathogen virulence. Nature 414:751-6.

40. Gandon, S., M. van Baalen, and V. A. Jansen. 2002. The evolution of parasite

virulence, superinfection, and host resistance. Am Nat 159:658-69.

41. Gerlach, G., F. von Wintzingerode, B. Middendorf, and R. Gross. 2001. Evolutionary

trends in the genus Bordetella. Microbes Infect 3:61-72.

42. Giardina, P. C., L. A. Foster, J. M. Musser, B. J. Akerley, J. F. Miller, and D. W.

Dyer. 1995. bvg Repression of alcaligin synthesis in Bordetella bronchiseptica is

associated with phylogenetic lineage. J. Bacteriol. 177:6058-6063.

19 43. Go, M. F., V. Kapur, D. Y. Graham, and J. M. Musser. 1996. Population genetic

analysis of Helicobacter pylori by multilocus enzyme electrophoresis: extensive allelic

diversity and recombinational population structure. J Bacteriol 178:3934-8.

44. Gogarten, J. P., and J. P. Townsend. 2005. Horizontal gene transfer, genome

innovation and evolution. Nat Rev Microbiol 3:679-87.

45. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol Rev 44:722-38.

46. Goodnow, R. A., F. J. Shade, and W. P. Switzer. 1979. Efficacy of Bordetella

bronchiseptica bacterin in controlling enzootic atrophic rhinitis in swine. Am J Vet Res

40:58-60.

47. Graham, M. R., L. M. Smoot, C. A. L. Migliaccio, K. Virtaneva, D. E. Sturdevant, S.

F. Porcella, M. J. Federle, G. J. Adams, J. R. Scott, and J. M. Musser. 2002.

Virulence control in group A Streptococcus by a two-component gene regulatory system:

Global expression profiling and in vivo infection modeling. Proceedings of the National

Academy of Sciences 99:13855-13860.

48. Grenfell, B. T., O. G. Pybus, J. R. Gog, J. L. Wood, J. M. Daly, J. A. Mumford, and

E. C. Holmes. 2004. Unifying the epidemiological and evolutionary dynamics of

pathogens. Science 303:327-32.

49. Gueirard, P., and N. Guiso. 1993. Virulence of Bordetella bronchiseptica: role of

adenylate cyclase-hemolysin. Infect Immun 61:4072-8.

50. Gueirard, P., K. Le Blay, A. Le Coustumier, R. Chaby, and N. Guiso. 1998.

Variation in Bordetella bronchiseptica lipopolysaccharide during human infection. FEMS

Microbiol Lett 162:331-7.

20 51. Gueirard, P., C. Weber, A. Le Coustumier, and N. Guiso. 1995. Human Bordetella

bronchiseptica infection related to contact with infected animals: persistence of bacteria

in host. J Clin Microbiol 33:2002-6.

52. Gupta, S., and R. M. Anderson. 1999. Population structure of pathogens: the role of

immune selection. Parasitol Today 15:497-501.

53. Gupta, S., N. Ferguson, and R. Anderson. 1998. Chaos, persistence, and evolution of

strain structure in antigenically diverse infectious agents. Science 280:912-5.

54. Gupta, S., and M. C. Maiden. 2001. Exploring the evolution of diversity in pathogen

populations. Trends Microbiol 9:181-5.

55. Gupta, S., M. C. Maiden, I. M. Feavers, S. Nee, R. M. May, and R. M. Anderson.

1996. The maintenance of strain structure in populations of recombining infectious

agents. Nat Med 2:437-42.

56. Holmes, E. C., R. Urwin, and M. C. Maiden. 1999. The influence of recombination on

the population structure and evolution of the human pathogen Neisseria meningitidis.

Mol Biol Evol 16:741-9.

57. Jolley, K. A., M. S. Chan, and M. C. Maiden. 2004. mlstdbNet - distributed multi-locus

sequence typing (MLST) databases. BMC Bioinformatics 5:86.

58. Koelle, K., M. Pascual, and M. Yunus. 2006. Serotype cycles in cholera dynamics. Proc

Biol Sci 273:2879-86.

59. Kontor, E. J., R. J. Wegrzyn, and R. A. Goodnow. 1981. Canine infectious

tracheobronchitis: effects of an intranasal live canine parainfluenza-Bordetella

bronchiseptica vaccine on viral shedding and clinical tracheobronchitis (kennel cough).

Am J Vet Res 42:1694-8.

21 60. Koski, L. B., R. A. Morton, and G. B. Golding. 2001. Codon bias and base

composition are poor indicators of horizontally transferred genes. Mol Biol Evol 18:404-

12.

61. Lacey, B. W. 1960. Antigenic modulation of Bordetella pertussis. J Hyg (Lond) 58:57-

93.

62. Levin, B. R. 1981. Periodic selection, infectious gene exchange and the genetic structure

of E. coli populations. Genetics 99:1-23.

63. Levin, B. R., and J. J. Bull. 1994. Short-sighted evolution and the virulence of

pathogenic microorganisms. Trends Microbiol 2:76-81.

64. Lipsitch, M., and J. J. O'Hagan. 2007. Patterns of antigenic diversity and the

mechanisms that maintain them. Journal of The Royal Society Interface 4:787-802.

65. Lorenz, M. G., and W. Wackernagel. 1994. Bacterial gene transfer by natural genetic

transformation in the environment. Microbiol Rev 58:563-602.

66. Mackinnon, M. J., and A. F. Read. 2004. Immunity promotes virulence evolution in a

malaria model. PLoS Biol 2:E230.

67. Maiden, M. C. 2006. Multilocus sequence typing of bacteria. Annu Rev Microbiol

60:561-88.

68. Maiden, M. C., J. A. Bygraves, E. Feil, G. Morelli, J. E. Russell, R. Urwin, Q.

Zhang, J. Zhou, K. Zurth, D. A. Caugant, I. M. Feavers, M. Achtman, and B. G.

Spratt. 1998. Multilocus sequence typing: a portable approach to the identification of

clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A

95:3140-5.

22 69. Martcheva, M., B. M. Bolker, and R. D. Holt. 2008. Vaccine-induced pathogen strain

replacement: what are the mechanisms? Journal of The Royal Society Interface 5:3-13.

70. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical

manifestations of respiratory infections due to Bordetella pertussis and other Bordetella

subspecies. Clin Microbiol Rev 18:326-82.

71. Mattoo, S., A. K. Foreman-Wykert, P. A. Cotter, and J. F. Miller. 2001. Mechanisms

of Bordetella pathogenesis. Front Biosci 6:E168-86.

72. McMillan, D. J., M. Shojaei, G. S. Chhatwal, C. A. Guzman, and M. J. Walker.

1996. Molecular analysis of the bvg-repressed urease of Bordetella bronchiseptica.

Microb Pathog 21:379-94.

73. Merkel, T. J., S. Stibitz, J. M. Keith, M. Leef, and R. Shahin. 1998. Contribution of

regulation by the bvg locus to respiratory infection of mice by Bordetella pertussis. Infect

Immun 66:4367-73.

74. Miller, J. F., C. R. Roy, and S. Falkow. 1989. Analysis of Bordetella pertussis virulence

gene regulation by use of transcriptional fusions in Escherichia coli. J Bacteriol

171:6345-8.

75. Moszer, I., E. P. Rocha, and A. Danchin. 1999. Codon usage and lateral gene transfer

in Bacillus subtilis. Curr Opin Microbiol 2:524-8.

76. Musser, J. M., D. A. Bemis, H. Ishikawa, and R. K. Selander. 1987. Clonal diversity

and host distribution in Bordetella bronchiseptica. J Bacteriol 169:2793-803.

77. Musser, J. M., E. L. Hewlett, M. S. Peppler, and R. K. Selander. 1986. Genetic

diversity and relationships in populations of Bordetella spp. J Bacteriol 166:230-7.

23 78. Nicholson, T. L. 2007. Construction and validation of a first-generation Bordetella

bronchiseptica long-oligonulceotide microarray by transcriptional profiling the Bvg

regulon. BMC Genomics 8:220.

79. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M.

T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga,

L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D.

Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis,

J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S.

Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E.

Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M.

Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead,

B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences

of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet

35:32-40.

80. Pejsak, Z., B. Wasinska, I. Markowska-Daniel, and A. Hogg. 1994. Field evaluation

of thirteen regimens for the control of progressive atrophic rhinitis. Comp Immunol

Microbiol Infect Dis 17:125-32.

81. Read, A. F. 1994. The evolution of virulence. Trends in Microbiology 2:73-76.

82. Reeves, P. 1993. Evolution of Salmonella O antigen variation by interspecific gene

transfer on a large scale. Trends Genet 9:17-22.

83. Roop, R. M., 2nd, H. P. Veit, R. J. Sinsky, S. P. Veit, E. L. Hewlett, and E. T.

Kornegay. 1987. Virulence factors of Bordetella bronchiseptica associated with the

24 production of infectious atrophic rhinitis and pneumonia in experimentally infected

neonatal swine. Infect Immun 55:217-22.

84. Saeij, J. P. J., J. P. Boyle, S. Coller, S. Taylor, L. D. Sibley, E. T. Brooke-Powell, J.

W. Ajioka, and J. C. Boothroyd. 2006. Polymorphic Secreted Kinases Are Key

Virulence Factors in Toxoplasmosis. Science 314:1780-1783.

85. Sakano, T., M. Okada, A. Taneda, T. Mukai, and S. Sato. 1997. Effect of Bordetella

bronchiseptica and serotype D Pasteurella multocida bacterin-toxoid on the occurrence of

atrophic rhinitis after experimental infection with B. bronchiseptica and toxigenic type

AP. multocida. J Vet Med Sci 59:55-7.

86. Selander, R. K., D. A. Caugant, H. Ochman, J. M. Musser, M. N. Gilmour, and T. S.

Whittam. 1986. Methods of multilocus enzyme electrophoresis for bacterial population

genetics and systematics. Appl Environ Microbiol 51:873-84.

87. Shashidhar, B. Y., N. R. Underdahl, and T. E. Socha. 1983. Serologic survey for

Bordetella bronchiseptica in Nebraska specific-pathogen-free pigs. Am J Vet Res

44:1123-5.

88. Smith, J. M., N. H. Smith, M. O'Rourke, and B. G. Spratt. 1993. How clonal are

bacteria? Proc Natl Acad Sci U S A 90:4384-8.

89. Spratt, B. G., W. P. Hanage, and E. J. Feil. 2001. The relative contributions of

recombination and point mutation to the diversification of bacterial clones. Curr Opin

Microbiol 4:602-6.

90. Spratt, B. G., and M. C. Maiden. 1999. Bacterial population genetics, evolution and

epidemiology. Philos Trans R Soc Lond B Biol Sci 354:701-10.

25 91. Stevenson, A., and M. Roberts. 2003. Use of Bordetella bronchiseptica and Bordetella

pertussis as live vaccines and vectors for heterologous antigens. FEMS Immunol Med

Microbiol 37:121-8.

92. Sumby, P., A. R. Whitney, E. A. Graviss, F. R. DeLeo, and J. M. Musser. 2006.

Genome-Wide Analysis of Group A Streptococci Reveals a Mutation That Modulates

Global Phenotype and Disease Specificity. PLoS Pathogens 2:e5.

93. Taylor, S., A. Barragan, C. Su, B. Fux, S. J. Fentress, K. Tang, W. L. Beatty, H. E.

Hajj, M. Jerome, M. S. Behnke, M. White, J. C. Wootton, and L. D. Sibley. 2006. A

Secreted Serine-Threonine Kinase Determines Virulence in the Eukaryotic Pathogen

Toxoplasma gondii. Science 314:1776-1780.

94. Thomas, S. R., and J. S. Elkinton. 2004. Pathogenicity and virulence. J Invertebr Pathol

85:146-51.

95. Urwin, R., A. J. Fox, M. Musilek, P. Kriz, and M. C. Maiden. 1998. Heterogeneity of

the PorB protein in serotype 22 Neisseria meningitidis. J Clin Microbiol 36:3680-2.

96. Urwin, R., and M. C. Maiden. 2003. Multi-locus sequence typing: a tool for global

epidemiology. Trends Microbiol 11:479-87.

97. van der Zee, A., F. Mooi, J. Van Embden, and J. Musser. 1997. Molecular evolution

and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme

electrophoresis and typing with three insertion sequences. J Bacteriol 179:6609-17.

98. Vernikos, G. S., and J. Parkhill. 2006. Interpolated variable order motifs for

identification of horizontally acquired DNA: revisiting the Salmonella pathogenicity

islands. Bioinformatics 22:2196-203.

26 99. Ward, J. I., J. D. Cherry, S. J. Chang, S. Partridge, H. Lee, J. Treanor, D. P.

Greenberg, W. Keitel, S. Barenkamp, D. I. Bernstein, R. Edelman, and K. Edwards.

2005. Efficacy of an acellular pertussis vaccine among adolescents and adults. N Engl J

Med 353:1555-63.

100. Yuk, M. H., U. Heininger, G. Martinez de Tejada, and J. F. Miller. 1998. Human but

not ovine isolates of Bordetella parapertussis are highly clonal as determined by PCR-

based RAPD fingerprinting. Infection 26:270-3.

27

Chapter 2:

Replacement of Adenylate Cyclase Toxin in a Lineage of Bordetella bronchiseptica

28

Abstract:

Bordetella bronchiseptica is a gram negative respiratory pathogen that infects a wide- range of hosts and causes a diverse spectrum of disease. This diversity is likely affected by multiple factors such as host immune status, polymicrobial infection and strain diversity. In a murine model of infection, we found that virulence, as measured by mean lethal dose (LD50), of

B. bronchiseptica strains varied widely. Strain 253 was less virulent than the typically studied strain, RB50. Transcriptome analysis showed that cyaA, the gene encoding adenylate cyclase toxin (CyaA), was the most downregulated transcript identified in strain 253 compared to strain

RB50. Comparative genomic hybridization and genome sequencing of strain 253 revealed that the cya locus, which encodes, activates and secretes CyaA, was replaced by an operon predicted to encode peptide transport proteins (ptp). Other B. bronchiseptica strains from the same phylogenetic lineage as strain 253 also lacked the cya locus, contained the ptp genes and were less virulent than strain RB50. Although the loss of CyaA would be expected to be counter- selected since it is conserved among the classical bordetellae and believed to be important to their success, our data indicate that loss of this toxin and gain of the ptp genes occurred in an ancestral strain that then expanded into a lineage. This suggests that there may be ecological niches in which CyaA is not critical for the success of B. bronchiseptica.

29

Introduction:

Bordetella is a genus of -proteobacteria consisting of nine species, many of which cause respiratory disease. Two of the three classical bordetellae, B. pertussis and B. parapertussis, are highly infectious pathogens that cause the acute disease whooping cough in humans (5, 25, 38).

The third, B. bronchiseptica infects a broad range of mammals resulting in a wide range of disease severities and chronically infects the upper respiratory tract (18, 38, 52). These three classical bordetellae are so closely related that it has been suggested that they be reclassified as subspecies (15, 40). B. pertussis and B. parapertussis appear to have independently emerged from a B. bronchiseptica-like progenitor through rearrangement and large scale genome decay

(13, 44). Chromosomal recombination appears to be infrequent among these bordetellae and the population structure of each appears to be clonal (39, 40, 55).

The bordetellae express many virulence factors such as adhesins, secretion systems, autotransporters and toxins that are regulated by a two-component signal transduction system,

BvgAS (10, 53). B. bronchiseptica contains nearly all the genes encoding virulence factors in B. pertussis and B. parapertussis but each subspecies expresses a different repertoire (11, 44). For example, promoter mutations in B. bronchiseptica have led to the lack of pertussis toxin (Ptx) expression, a B. pertussis specific toxin (1). Similarly, gene loss in B. pertussis has resulted in the absence of O-Antigen which is expressed by B. bronchiseptica and B. parapertussis (44).

The difference in the virulence factor repertoire of each subspecies is thought to contribute to the variation in host range and severities of disease (11, 44).

Adenylate cyclase toxin (CyaA) is highly conserved, is the only secreted protein toxin known to be expressed by all three classical bordetellae and is thought to be a main contributor to their success as respiratory pathogens (20, 28, 29, 38). CyaA is a 200 kDa, calmodulin

30 activated, bifunctional adenylate cyclase/hemolysin that belongs to the repeats-in-toxin family

(17, 59). CyaA, activated by calmodulin present in host cells but not in bacteria, is the most active adenylate cyclase known, causing rapid supraphysiological cAMP accumulation in target cells which inhibits invasivity, phagocytosis and chemotaxis and causes apoptosis (3, 26, 29, 57).

In a murine model of infection, CyaA contributes to colonization and persistence of B. bronchiseptica and B. pertussis in the lower respiratory tract, pathology and lethality (21, 24, 28,

58). The cya operon includes 5 genes that are responsible for the production and secretion of

CyaA; cyaA encodes CyaA, cyaC encodes a protein that post-translationally palmitoylates CyaA to form an enzymatically active toxin and cyaB, D and E genes are required for secretion of the toxin (2, 17, 23). There is also a gene annotated as cyaX which is predicted to be a LysR-family transcriptional regulator but has no known function associated with CyaA.

Despite the overall clonality of the classical bordetellae, phylogenetics and comparative genomic analyses indicate that B. bronchiseptica is more diverse than either B. pertussis or B. parapertussis (12, 13, 39, 40, 55). In fact, some strains of B. bronchiseptica are more distantly related to each other than they are to the two human-associated pathogens (13). Colonization of hosts by B. bronchiseptica can lead to anything from asymptomatic infection to lethal pneumonia

(18, 38). The dose of B. bronchiseptica required to kill the host can differ up to 100,000-fold between isolates using a murine model of infection (19, 20). Strains of B. bronchiseptica can differ in virulence factor expression (4, 19, 35, 39, 48) and regulation of gene expression can correlate with phylogenetic lineage (16, 39). Considering observations like these, it has been hypothesized that different phylogenetic lineages of B. bronchiseptica may utilize distinct sets of virulence factors (12, 13, 38, 40). However, the relation of strain virulence and virulence factor expression to phylogenetic lineage has not been addressed.

31

Here, we test if B. bronchiseptica strains of different phylogenetic lineages use distinct sets of virulence factors that relate to virulence. To identify strains that are most likely to differ in virulence factor expression, we screened for strains that differed in virulence, as measured by

LD50 in a murine model of infection. Then, whole-genome and phylogenetic approaches were used to examine these strains to determine which virulence factors differed and whether these differences were linked phylogenetically. We found that CyaA was not expressed by a hypovirulent isolate of B. bronchiseptica due to a replacement of the cya operon with a novel set of genes predicted to be involved in peptide transport (ptp). All strains from the same phylogenetic lineage as strain 253 also lacked cyaA, contained the ptp genes and were less virulent than strain RB50. All strains analyzed from other lineages contained cyaA and lacked the ptp genes. These data support the conclusion that CyaA is not present in all classical bordetellae, is not essential to the success of B. bronchiseptica and that different lineages of this species contain distinct sets of virulence factors that correlate with their virulence. Furthermore, these data are consistent with the overarching idea that the diversity of B. bronchiseptica related disease and broad host range may be due, in part, to the distinct sets of virulence factors used by strains of different phylogenetic lineages (11, 13, 16).

32

Material and Methods:

Bacterial Strains and Growth. B. bronchiseptica isolates, providers, locations, dates and sites of isolation are listed (Appendix A). A more detailed clinical report was not available for these isolates. All strains were maintained on Bordet-Gengou (BG) agar (Difco, Sparks, MD) containing 10% sheep’s blood (Hema Resources, Aurora, OR) with 20ug/mL streptomycin

(Sigma, St. Louis, MO). For inoculation, bacteria were grown overnight at 37ºC in Stainer-

Scholte (SS) broth to mid-logarithmic phase, bacterial density was measured by optical density read at 600nm (OD600) and diluted in sterile phosphate buffered saline (PBS) (Omnipur,

Gibbstown, NJ) to the appropriate concentration. Inocula were confirmed by plating dilutions on

Bordet Gengou (BG) agar and counting the resulting colonies after 2 days of incubation at 37°C

(24, 30).

Animal Experiments. 4 to 6 week old C57BL/6 mice were obtained from Jackson Laboratories

(Bar Harbor, ME) and were bred in our specific pathogen and Bordetella-free rooms. For inoculation, mice were lightly sedated with 5% isofluorane (IsoFlo; Abbott Laboratories) in oxygen and the indicated number of CFU of B. bronchiseptica in 50 µl of PBS (Omnipur,

Gibbstown, NJ) was gently pipetted onto the external nares as previously described (24, 60).

This method of inoculation efficiently distributes the bacteria throughout the respiratory tract

(30). For survival curves, groups of 3 to 4 mice were inoculated with the indicated dose and percent survival was monitored over a 28 day period. Mice with lethal bordetellosis, indicated by ruffled fur, labored breathing and diminished responsiveness were euthanized to alleviate unnecessary suffering (24, 37, 45). Statistical significance was calculated using a Fisher’s exact test where groups of mice were compared in terms of survival or death at the same given dose of two different strains. Convalescent sera was generated by inoculating mice with 105.7 CFU of

33 either RB50, RB50 cyaA or 253 and collecting sera 28 days post-inoculation as previously described (30). To quantify the number of bacteria in respiratory organs, groups of 3 to 4 mice were sacrificed at the indicated time point, and bacterial numbers in the lungs, trachea and nasal cavity were quantified as previously described (24, 30). The mean +/- standard error was determined for each treatment group. Statistical significance between strains in bacterial load was calculated by using an ANCOVA in Minitab (v. 13.30, Minitab Inc.). The explanatory variable used was bacterial strain and a covariate for day was fitted to control for the change in load over time. A significance level set at P values of < 0.05. All animal experiments were repeated at least twice with similar results. All mice were maintained in Pennsylvania State University approved housing facilities and were closely monitored in accordance with institutional guidelines and

IACUC regulations.

RNA isolation and preparation of labeled cDNA. For RNA isolation, two independent biological replicates of strains RB50 and 253 were grown in SS broth supplemented with

40μg/mL streptomycin. Bacteria were then subcultured at a starting OD600 of 0.02 into 50mLs of

SS broth and grown at 37°C for 24 hours to logarithmic phase (OD600 1.0) while shaking.

Bacteria were then harvested and total RNA was extracted with Trizol (Invitrogen, Carlsbad,

CA), treated with RNase-free DNase I (Invitrogen, Carlsbad, CA) and purified using RNeasy columns (Qiagen, Valencia, CA) according to the manufacturer’s instructions. A 2-color hybridization format was used and dye-swap experiments were performed analogously, in which the fluorescent labels were exchanged to ensure that uneven incorporation did not confound our results. For each reaction, fluorescently-labeled cDNA copies of 5 g from the total RNA pool were prepared as previously described (41).

34

Microarray hybridization and data analysis. The two differentially labeled reactions to be compared were combined and hybridized to a B. bronchiseptica, strain RB50 specific, long- oligonucleotide microarray as previously described (41). Slides were then scanned using a

GenePix 4000B microarray scanner, and analyzed with GenePix Pro software (Axon

Instruments, Union City, CA). Spots were assessed visually to identify those of low quality and arrays were normalized so that the median of ratio across each array was equal to 1.0.

Automatically and manually flagged spots, spots with the sum of medians (635/532) signal intensity less than or equal to 100, and spots with signal intensity below threshold (sum of median intensities plus one standard deviation above the mean background) were filtered out prior to analysis. Ratio data from the two biological replicates were compiled and normalized based on the total Cy3% intensity and Cy5% intensity to eliminate slide to slide variation. Gene expression data were then normalized to 16S rRNA. The statistical significance of the gene expression changes observed was assessed by using the significant analysis of microarrays

(SAM) program (54). A one-class unpaired SAM analysis using a false discovery rate of 0.60%

(<0.1%) was performed.

Comparative genomic hybridization analysis. For DNA isolation, strains RB50 and 253 were grown in SS broth at 37°C with shaking overnight and genomic DNA was isolated from bacterial cultures using a DNA extraction kit (Qiagen, Valencia, CA) according to manufacturer’s instructions and digested with DpnII. For each labeling reaction, 2 g of digested genomic

DNA was randomly primed using Cy-5 and Cy-3 dye-labeled nucleotides, with BioPrime DNA labeling kits (Invitrogen, Carlsbad, CA) and the two differentially labeled reactions to be compared were combined and hybridized to a B. bronchiseptica long-oligonucleotide microarray

(41). Dye-swap experiments were also performed. Regions of difference (RDs), meaning genes

35 that are either divergent or absent, were identified by combining the conventional ratio based ranking along with a data rotation method (47). Briefly, all points belonging to genes with M > 0 were removed from the M-A-plot and the data was then rotated anti-clockwise to enable higher specificity of the candidate RDs (47). To further separate RDs from present genes, genes were then ranked by their M* value and assigned a ROTMIX-score, which is an average of two posterior probabilities using plain and rotated data (51). Each estimated posterior probability was derived using a two-component gaussian model. Genes were then considered RDs using a threshold of 0.6-1, with 1 representing the highest confidence of a gene being a RD. All microarray data and statistical analyses are available where previously described and have been deposited in MIAMExpress under the accession numbers E-MEXP-1203 and E-MEXP-1205 (8). qRT-PCR, RT-PCR and PCR. qRT-PCR was completed as previously described (41) and

RNA was extracted as described for the microarray experiment. RNA (1 μg) from each biological replicate was reverse transcribed using 300 ng of random oligonucleotide hexamers and SuperScript III RTase (Invitrogen, Carlsbad, CA). The resulting cDNA was diluted 1:1000 and 1 μL used in qRT-PCR reactions containing 300 nM primers, designed with Primer Express software (Applied Biosystems, Foster City, CA), and 2XSYBR Green PCR Master Mix (Applied

Biosystems, Foster City, CA). Primer sequences are listed (Appendix C). To confirm the lack of

DNA contamination, reactions without reverse transcriptase were performed. Dissociation curve analysis was performed for verification of product homogeneity. Threshold fluorescence was established within the geometric phase of exponential amplification and the cycle of threshold

(Ct) determined for each reaction. The cycle of threshold (Ct) from all biological replicates for each strain was compiled and the 16S RNA amplicon was used as an internal control for data normalization. Fold change in transcript level was determined using the relative quantitative

36 method (ΔΔCT) (50). For RT-PCR, the indicated bacterial strains were grown to logarithmic phase (OD600 0.3). Culture density was equalized between strains and RNA was isolated using a

Qiagen RNAeasy kit (Qiagen, Valencia, CA). The RNA was reverse transcribed into cDNA according to the manufacturer’s protocol (Promega, Madison, WI). cDNA from each strain was

PCR amplified using either cyaA primers or adk primers (13). All primers used are listed

(Appendix B, C).

Western Blots. B. bronchiseptica strains were grown to logarithmic phase in SS broth. 1 x 108

CFU of the indicated strain were treated with Laemmli sample buffer (33) and run on 10% SDS-

PAGE and protein was transferred to a polyvinylidene diflouride (PVDF) membrane (Millipore,

Bedford, MA). Membranes were probed with the monoclonal antibody 3D1 (anti-CyaA) (36)

(1:1,000 dilution) and goat anti-mouse (Ig H+L) HRP-conjugated (1:10,000 dilution) (Southern

Biotech, Birmingham, AL) to detect CyaA. To detect anti-CyaA antibodies in mouse sera, 5μL of 4ng/mL of recombinant CyaA was run on a 10% SDS-PAGE, transferred to a PVDF membrane (Millipore, Bedford, MA) and probed with serum from naïve, RB50-, RB50ΔcyaA- or

253- inoculated mice (1:1,500 dilution) and goat anti-mouse (Ig H+L) HRP-conjugated

(1:10,000) (Southern Biotech, Birmingham, AL). All membranes were visualized with ECL

Western Blotting Detection Reagents (Amersham Biosciences, Piscataway, NJ).

MLST and phylogenetic tree construction. MLST was performed as previously described

(13). All alleles were double stranded sequenced from each strain at either The Pennsylvania

State University sequencing center or Davis Sequencing (San Diego, CA). The sequences were trimmed and allele and sequence types were designated using the Bordetella MLST database

(http://pubmlst.org/bordetella) (13, 27). All sequence typing are available at this website. Using

37

MEGA 3.0, the alleles were concatenated, aligned and a UPGMA tree with 1000 bootstraps using the K2 model was constructed (32).

Genomic Sequencing and Analysis. The RB50 DNA sequence and detailed annotations are available through NCBI under the accession number NC_002927. The DNA from strain 253 was isolated using a DNA extraction kit (Qiagen, Valencia, CA) according to the manufacture’s instructions. The sequencing of strain 253 was preformed as previously described (44) and genomic sequence of 253 was obtained from the B. bronchiseptica complex sequencing project

(http://www.sanger.ac.uk/Projects /B_pertussis). The preliminary annotation of strain 253 genomic sequence was performed using Artemis (49) as previously described (44) and has been submitted to NCBI under the accession number CU633843. Comparative genomics of strains

RB50, 253 and Rhodoferax ferrireducens T118 (NC_007908) was completed using the Artemis

Comparison Tool (9). Detecting genomic island related signatures to detect horizontal gene transfer was completing using Alien Hunter, an Interpolated Variable Order Motifs method (56).

38

Results:

B. bronchiseptica strain 253 is less virulent than strain RB50.

To test our hypothesis that virulence and virulence factor expression relate to phylogenetic lineage, we first screened for

B. bronchiseptica strains that differ in virulence, as measured by mean lethal dose

(LD50) in a murine model of infection. In an initial survey, we identified strains that had higher or lower LD50’s than the typically studied and sequenced B. bronchiseptica strain, RB50, but did not differ in in vitro growth rate (data not shown) (38, 44). From just five B. bronchiseptica isolates, the LD50’s varied Figure 2.1: LD50 and quantification of lung bacterial load of B. bronchiseptica strains RB50 and 253. Groups of 3-4 up to 1,000 fold (Fig 2.1B, Fig 2.5A, Fig C57BL/6 mice were inoculated intranasally with the indicated doses of strains RB50 (A) or 253 (B). Survival curves were generated by inoculating mice with the indicated 3.1B). Consistent with what others have dose and determining percent survival over a 28 day period. (C) Groups of 3 mice were inoculated intranasally with 105.7 observed, there was no correlation between CFU of strain RB50 (closed squares) or strain 253 (open squares). Bacterial load in the lungs was quantified 3, 7, 14, 28 and 56 days post-inoculation. The dashed line indicates the host species from which the strain was the lower limit of detection. Bacterial numbers are expressed as the log10 mean +/- standard error (error bars). isolated and the ability to efficiently infect lab animals or virulence in the murine model (19) (data not shown). Here, we investigate the characteristics of a hypovirulent isolate of B. bronchiseptica, strain 253. When inoculated with

39

106.1, 106.3 or 106.6 CFU of strain RB50, 100%, 50% and 0% of mice survived the infection respectively (Fig 2.1A). When inoculated with 106.5, 107.3 or 107.5 CFU of strain 253, 66%, 50% and 33% of mice survived the infection respectively (Fig 2.1B) indicating that the LD50 of strain

253 is ten-fold higher, 17.9 million more CFU, than strain RB50. To determine if the increased

LD50 of strain 253 correlated with decreased bacterial load in the respiratory tract, groups of three mice were inoculated with 105.7 CFU of either strain RB50 or 253. In the lungs, strain

RB50 was present at 104.9, 106.3, 104.3,103.5 CFU and below the limit of detection (10 CFU) on days 3, 7, 14, 28 and 56 post-inoculation respectively (Fig 2.1C). Strain 253 was present at 105.6,

105.7, 103.8, 101.5 and below the limit of detection on days 3, 7, 14, 28 and 56 post-inoculation

(Fig 2.1C). Over the course of infection, colonization of strain 253 in the lower respiratory tract was lower than strain RB50 (bacterial strain: F1, 29 = 5.0, P = 0.033) when controlling for change in load over time (day; F1, 29 = 167.9, P < 0.001). In the trachea and nasal cavity, the bacterial load of strain 253 was not significantly different from strain RB50 over the course of infection

(Appendix D). Combined, these data indicate that strain 253 is less virulent and grows in numbers less efficiently than strain RB50 in the lower respiratory tract.

CyaA is not expressed by B. bronchiseptica strain 253.

Since these experiments were performed using genetically similar, inbred mice from an individual facility, and were age and gender matched, the difference in virulence can be attributed to differences in the B. bronchiseptica strains rather than other factors such as host immune status. Therefore, we sought to identify candidate bacterial genes that correlated with the decreased virulence of strain 253. Whole genome transcriptome analysis was performed to determine which genes were differentially expressed between strains 253 and RB50 (Fig 2.2A).

Of 5,013 genes, 205 genes were upregulated in strain 253 relative to strain RB50. These included

40

Figure 2.2: Whole Transcriptome Analysis and Adenylate Cyclase Toxin Expression in B. bronchiseptica strains RB50 and 253. Comparison of whole transcriptome analysis (A) and cya related genes (B) between strains RB50 and 253. The X-axis indicates the order of genes along the B. bronchiseptica strain RB50 5.3 megabase (Mb) chromosome. The Y-axis indicates the fold change in expression (FCE) of each gene. Negative fold change values indicate decreased gene expression of strain 253 genes compared to strain RB50, while positive fold change values indicate increased gene expression. Genes of interest are labeled with corresponding underscores (HP: hypothetical protein, Φ: phage related gene, wbm: O-Antigen related genes, ptx: pertussis toxin, TTSS: type three secretion system, fim: fimbria related genes, bbuR: urease regulator, cyaA: adenylate cyclase toxin). Error bars represent +/- the standard error. (C) RT-PCR of cyaA and adk in RB50, RB50ΔcyaA and 253 with samples including RNase treatment or lacking reverse transcriptase. (D) Western blot analysis for the presence of CyaA in bacterial lysates. Recombinant CyaA, RB50, RB50ΔcyaA or 253 lysates were probed for CyaA using the mAb 3D1. (E) Western blot analysis for the presence of anti-CyaA antibodies in sera from mice immunized with strains RB50, 253, RB50ΔcyaA or naïve sera. Using these sera, recombinant CyaA was probed.

21 predicted transcriptional regulators, 16 metabolism associated transcripts, 12 transporters, 10 electron transporters and 98 putative, hypothetical or probable genes. Unexpectedly, ptx associated genes were upregulated in strain 253 when examined by microarray and qRT-PCR

(Fig 2.2A, Appendix E). However, Ptx protein was not detected in whole cell extract of strain

253 by western blot analysis (Appendix F). No other genes encoding known virulence factors were upregulated in strain 253 relative to RB50.

Of 5,013 genes analyzed, 474 genes were downregulated in strain 253 relative to strain

RB50. Genes identified as downregulated in strain 253 included 147 putative, hypothetical or

41 probable genes and 115 phage related genes that are clustered along the chromosome (Fig 2.2A).

Additionally, 25 genes categorized as having roles in transcriptional regulation, 20 in metabolism, 24 in transport and 23 in electron transport were downregulated in strain 253. Four known virulence factors were downregulated in strain 253; fimbriae serotype 2 and 3 (fim2 and fim3), 2 of 17 O-Antigen related genes (wbmS and wbmO), 8 type three secretion system (TTSS) genes, and genes in the cya operon (cyaA and cyaC) (Fig 2.2A). While fim2, fim3, O-Antigen and TTSS related genes were downregulated 2 to 12-fold in strain 253, genes required for CyaA production and activation were downregulated from 4 to 172-fold (Fig 2.2B). Of all the downregulated transcripts identified in strain 253, the cyaA transcript had the largest fold decrease (Fig 2.2B). The expression of genes directly up and downstream of these genes was not significantly different between strains RB50 and 253 (Fig 2.2B).

To further analyze cyaA expression, RT-PCR was performed using strains RB50, 253, and RB50 cyaA (24). While transcript of adenylate kinase (adk), a housekeeping gene, was detected in all of these strains, transcript of cyaA was only detected in strain RB50 (Fig 2.2C).

These results were confirmed by qRT-PCR (Appendix E). Similarly, CyaA protein could be detected in the lysate of strain RB50 but not strains 253 or RB50ΔcyaA by western blot analysis

(Fig 2.2D). Antibodies against CyaA were detected in sera from mice immunized with strain

RB50, but these antibodies were not detected in sera from mice immunized with strains 253 or

RB50ΔcyaA or naïve mice (Fig 2.2E). Together, these data suggest that CyaA is not expressed by strain 253 during growth in vitro or in vivo.

Genes encoding CyaA are absent in B. bronchiseptica strain 253.

Two possibilities could lead to the lack of cyaA expression in strain 253. First, the cyaA gene may be present in strain 253 but not expressed. Second, the cyaA gene of strain 253 may be

42

Figure 2.3: Comparative Genomic Hybridization and Adenylate Cyclase Toxin Locus in strains RB50 and 253. CGH analysis of whole genome (A) or cya related and surrounding genes (B) between strains RB50 and 253. The X- axis indicates the order of genes along the B. bronchiseptica 5.3 megabase (Mb) chromosome. The Y-axis indicates the fold change in hybridization (FCH) for each gene. Negative fold change values indicate decreased hybridization of strain 253 genomic DNA compared to strain RB50, while positive fold change values indicate increased hybridization. Genes of interest have been labeled with corresponding underscores (HP: hypothetical protein, Φ: phage related gene, wbm: O-Antigen related genes, cyaA: adenylate cyclase toxin). Error bars represent +/- the standard error. PCR screen for the presence or absence of genes upstream, within and downstream of the cya operon in strains RB50 or 253. absent or so divergent that the cDNA inefficiently hybridizes to the microarray probe. These two possibilities were distinguished by CGH analysis which also allowed other candidate genes correlated with the decreased virulence of strain 253 to be identified. The absence of positive numbers indicated an absence of gene duplication events in strain 253 (Fig 2.3A). Of the 5,013 genes analyzed, 252 genes were identified as RDs (absent or divergent genes) in strain 253 relative to the RB50 genome. Most of the RDs were clustered along the chromosome indicating either large-scale loss of genes in strain 253 or insertion of genes in strain RB50 (Fig 2.3A). Of the RDs identified, 139 are phage related genes and comprised the majority of clustered RDs

(Fig 2.3A). Of the other RDs in strain 253, 57 genes are annotated in the RB50 genome (44) as hypothetical, putative or probable proteins, 7 as involved in metabolism, 14 in transcriptional regulation, 10 in transport, 4 in electron transport and 1 in two-component signal transduction. 43

Interestingly, the only known virulence factors identified as RDs in strain 253 were fimbrial serotype 2 (fim2), 2 of 17 O-Antigen related genes, and 4 genes in the cya locus (cya A, B, C and

D) (Fig 2.3A, 2.3B). The result that cyaB, C and D were identified as RDs but were not identified as differentially expressed between strains RB50 and 253 is likely due to a low level of expression of these genes in strain RB50 (Fig 2.2B, 2.3B). The gene upstream of the cya operon

(gabD) and genes downstream of the cya operon (cyaX, BB0329, BB0330) could be PCR amplified from both strains RB50 and 253 (Fig 2.3C). While the genes in the cya operon (cyaA,

B, C, D and E) were amplified from strain RB50, these genes could not be amplified from strain

253 (Fig 2.3C). Additionally, 6 other primer sets specific for regions across cyaA failed to produce a PCR product in strain 253 but were successful in strain RB50 (data not shown). To further investigate the genetic basis for the apparent divergence or absence of cya related genes, we searched the assembled contigs of the 253 genome (www.sanger.ac.uk/Projects/B_pertussis).

In strain RB50, the distance between the stop codon of gabD and the start codon of cyaX is

11,223 bp (Fig 2.4). In strain 253, these genes are separated by a novel stretch of 9,630 bp that is not present in the genome of strain RB50 (Fig 2.4). While the genes upstream and downstream of the cya operon (gabD and cyaX) in strain 253 are >99% identical to strain RB50, the genes of the cya operon could not be identified in the 9,630 bp segment or in any assembled contig from the genome of strain 253 (Fig 2.4, data not shown). Upon annotation of this novel DNA sequence, eight genes predicted to be an operon involved in peptide transport were identified (Fig 2.4). The putative function and name for each of these genes are: putative ABC transporter, substrate binding protein (ptpA), putative peptide ABC transporter, permease protein (ptpD), putative peptide ABC transporter, permease protein (ptpE), putative oligopeptide/dipeptide ABC transporter, ATP-binding protein (ptpL), putative

44

Figure 2.4: Loss of cyaA from B. bronchiseptica strain 253. Artemis Comparison Tool snapshot of BLASTN comparison between strain RB50 (top) and 253 (middle) and TBLASTX comparison of strain 253 (middle) and R. ferrireducens (bottom) genomes. Areas of sequence similarity are indicated by red bands (99% identity) and pink bands (45-64% identity). Arrows indicate the direction of transcription. Each gene is labeled as annotated in the RB50, 253 and R. ferrireducens T118 genomes.

oligopeptide/dipeptide ABC transporter, ATP-binding protein (ptpS), putative deaminase (ptpT), transcriptional regulator, RpiR family (ptpR) and N-acyl-D-amino-acid deacylase (ptpX) (Fig

2.4). No inverted repeats were found surrounding either the ptp operon in strain 253 or the cya operon in strain RB50 (data not shown). Additionally, there was no evidence to suggest that the ptp operon was recently horizontally transferred when the cya operon of strain RB50, the ptp operon of strain 253 and surrounding regions of each operon were compared and analyzed using a interpolated variable order motifs method which identifies differences in compositional biases at various levels (e.g. GC content, GC skew, codon, dinucleotide and amino acid bias, structural constraints) (data not shown) (56). Together, this suggests that both operons have existed in B.

45 bronchiseptica for enough time that amelioration appears to have occurred (34). Further analysis of these sequences showed that the last 11bp (2aa and a stop codon) of the cyaE gene remain intact at the 3’ end of the ptp operon in strain 253, suggesting that its ancestor may have contained the cya genes. While genes homologous to the ptp genes could not be found in any other sequenced Bordetella species, the most closely related operon was found in Rhodoferax ferrireducens strain T118 with 45-63% identity (Fig 2.4). The genes flanking this operon in R. ferrireducens do not have significant identity to that of strain 253 (Fig 2.4). Together, these data indicate that the cya operon was replaced by the ptp operon in strain 253.

Loss of cyaA and presence of ptp genes are shared among a B. bronchiseptica lineage.

Previous studies showed that CyaA is highly conserved among the classical Bordetella and enables the bacteria to grow to higher numbers in the lower respiratory tract (24, 44). Based on these findings, it would be predicted that a strain lacking CyaA should be less fit, and we therefore hypothesized that other strains closely related to strain 253 would contain cyaA. We completed MLST analysis on strain 253 and 29 more B. bronchiseptica isolates and constructed a UPGMA tree (Fig 2.5A, Appendix A). As previously described, strain RB50 was found to be in ST12 (Fig 2.5A) (13). Strain 253 was identified as a ST27 strain (Fig 2.5A). Five new STs were identified (STs 36-40), with the newly assigned ST40 being the most closely related sequence type to ST27 (Fig 2.5A).

To determine if other strains of the same ST as strain 253 contained a CyaA with hemolytic activity, we screened our ST27 strains and 13 strains previously identified as ST27, some of which were isolated from separate continents, for β-hemolysis, a CyaA-dependent function (Fig 2.5A, Appendix A) (13, 17) . Of all the B. bronchiseptica strains analyzed in this study, the only isolates that were not β-hemolytic were from ST27 and ST40, which suggests that

46

Figure 2.5: Loss of cyaA is shared among a B. bronchiseptica lineage. (A) A UPGMA tree with 1000 bootstraps based on concatenated MLST gene sequence of 43 B. bronchiseptica isolates. The color correspond to the indicate sequence types (ST). The numbers on the tree branches indicate branch strength. All branch strengths below 50 were removed. The identification number of each strain is listed. The asterisk next to the strain numbers in A indicate the isolates examined in C. (B) Western blot for CyaA from recombinant CyaA (rCyaA), strain RB50 (a ST12 strain), RB50 lacking cyaA, 10 ST27 strains and strain 1289, a ST32 strain. (C) PCR amplification of cyaA, the novel sequence predicted to encode peptide transport proteins present in 253 and adk in six non-ST27 strains, one ST40 strain, ten ST27 strains and RB50ΔcyaA. A sample containing no DNA template was included to ensure the absence of DNA contamination. The red star in B indicates the emergence of a B. bronchiseptica lineage lacking cyaA and containing the ptp genes. these strains lost the hemolytic activity of CyaA (data not shown). Additionally, none of the

ST27 strains analyzed produced CyaA protein when analyzed by western blot (Fig 2.5B). To determine if strains of the same ST as strain 253 contained cyaA, we attempted to PCR amplify cyaA from the indicated B. bronchiseptica strains (Fig 2.5A, 2.5C). cyaA could not be amplified from any ST27 strain, ST40 strain or RB50ΔcyaA (Fig 2.5C, data not shown). In contrast, cyaA could be amplified from strains of all other STs examined (Fig 2.5C). To ensure that a faulty genomic DNA isolation was not the cause of lack of cyaA amplification, a housekeeping gene, adk, was amplified from all B. bronchiseptica strains (Fig 2.5C). Together these results indicate

47 that all strains from the phylogenetic lineage including ST27 and ST40 lack cyaA, while all other lineages examined, retain and express a functional CyaA. We were able to PCR amplify a region of the ptp locus, present between gabD and cyaX, from all ST27 and ST40 strains but were unable to amplify this DNA from all other B. bronchiseptica strains examined (Fig 2.5C). These data suggest that all the strains examined from the B. bronchiseptica lineage including ST27 and

ST40 contain the ptp operon while strains from all other lineages lack the ptp genes. Together, these data suggest that the cya operon was replaced by the ptp operon in the last common ancestor (LCA) to the B. bronchiseptica lineage encompassing ST27 and ST40 strains.

Decreased virulence is shared among

ST27 strains.

Since cya genes are absent in

ST27 strains and strain 253 is less virulent than strain RB50, we sought to determine if decreased virulence is a common characteristic of ST27 strains.

Groups of three to four mice were inoculated with 106.9 to 107.5 CFU of either B. bronchiseptica ST27 strain 443

7.3 or 189. The LD50 of strain 443 was 10

CFU and mice did not succumb to 107.3

Figure 2.6: LD50 of B. bronchiseptica Sequence Type 27 CFU of strain 189 (Fig 2.6A). Strain 189 strains and RB50 cyaA. (A) Groups of 3-4 mice were inoculated intranasally with the indicated doses of strains 443 (closed and bold) or 189 (open and normal) which are both ST27 could be detected in the lungs, trachea strains. (B) Groups of 3-4 C57BL/6 mice were inoculated intranasally with the indicated doses of RB50ΔcyaA. Survival curves were generated by inoculating mice and determining and nasal cavity 28 days post- percent survival over a 28 day period.

48 inoculation, which suggests that this strain is not an avirulent BvgAS mutant, which are cleared from the host by this time post-inoculation (10) (X. Zhang and E.T. Harvill, unpublished data).

These data indicated that ST27 strains are less virulent than strain RB50. Groups of four mice

6.3 7.1 6.7 were inoculated with 10 to 10 CFU of RB50ΔcyaA. The LD50 of RB50ΔcyaA was 10 CFU, a 2.5-fold increase compared to the LD50 of strain RB50 (Fig 2.6B, 2.1A). These results demonstrate that CyaA contributes to the virulence of strain RB50. Since the LD50 of

RB50ΔcyaA is more similar to the LD50 of RB50 than that of the ST27 strains, the decreased virulence of ST27 strains is not likely to be solely due to the lack of CyaA expression.

49

Discussion:

Although B. bronchiseptica strains are relatively closely related (13, 39, 40, 55), this species causes a wide variety of disease severities in a broad host range and individual strains differ in their expression of virulence factors (4, 18, 19, 35, 39, 48). Based on these and other observations, we hypothesized that strains in different phylogenetic lineages utilize distinct sets of virulence factors which relate to virulence. We tested this hypothesis by relating virulence, as measured by LD50 in a murine model of infection, to whole-genome analyses and phylogenetics.

Transcriptome analysis revealed that cyaA was the most differentially expressed gene in the hypovirulent B. bronchiseptica strain 253 (Fig 2.1, 2.2). Comparative genomic hybridization revealed, and PCR and genomic sequencing confirmed that the cya operon was absent from strain 253 (Fig 2.3). Genome sequencing and annotation was used to show that the cya operon was replaced by the ptp operon (Fig 2.4, data not shown). Since CyaA is believed to be a critical toxin that is shared by all Bordetella species that infect mammals and that enables the bacteria to grow to higher numbers in the lower respiratory tract, a deletion of the cya operon would be expected to be strongly counter-selected (24, 28, 58). Therefore, we were surprised to find an entire lineage, comprising at least two STs, that lacks the genes encoding this toxin and contains a novel set of genes in its place (Fig 2.5).

While we focused on CyaA in this study, other genes were differentially expressed or identified as RDs between strains RB50 and 253 and may contribute to the difference in virulence between these two strains. Most of these were prophage related genes present in RB50 but not in strain 253, which also caused them to be identified as differentially expressed between the two strains. Other studies comparing B. bronchiseptica isolates have also identified these prophage related genes as RDs indicating that these gene clusters represent insertion events into

50 the RB50 genome rather than genes lost from strain 253 (12, 13). Another B. bronchiseptica strain lacking these prophage genes was more virulent compared to strain RB50 suggesting that it is unlikely that these genes are a main cause of the decreased virulence of strain 253 (A.M.

Buboltz and E.T. Harvill, unpublished data). Virulence associated genes that were downregulated and/or divergent or absent in strain 253 compared to strain RB50 included a few

O-Antigen and TTSS related genes, fim2, fim3 and the cya operon. The reason some O-Antigen related genes were identified as RDs and differentially expressed is because strain 253 contains the alternative O-Antigen locus (44, 46) (A.M. Buboltz and E.T. Harvill, unpublished data). The presence of either the classical or alternative O-Antigen locus does not appear to correlate with virulence of B. bronchiseptica strains in our murine model of infection. This suggests that these loci do not contribute to the difference in virulence between strains RB50 and 253 (A.M. Buboltz and E.T. Harvill, unpublished data). Our initial attempt to determine how much the loss of CyaA contributed to the decreased virulence of strain 253 by transiently expressing the cya operon

(approximately 11.1kB) on a plasmid competent for replication in Bordetella was unsuccessful due to a combination of insert size, low ligation efficiency and retention of the plasmid during infection in vivo (data not shown) (31). While it is tempting to speculate that CyaA is a main contributor to the decreased virulence of strain 253, our data showing that the LD50 of

RB50∆cyaA is closer to the LD50 of RB50 than it is to other ST27 strains indicates that CyaA could not be the sole contributor to the decreased virulence of ST27 strains (Fig 2.6). The decreased expression the other known virulence associated genes mentioned or uncharacterized virulence related genes may contribute to the decreased virulence of strain 253 compared to

RB50. Additionally, other factors besides the loss of virulence factors in strain 253 may contribute to the decreased virulence of this strain. A few examples could be differences in gene

51 expression between strains that change over the course of infection, which would not be observed during our in vitro analyses, or a gain of strain 253-specific genes that decrease the virulence of this isolate (14).

B. bronchiseptica strains lacking CyaA activity have been identified in previous studies

(20, 39, 42). In a human case study, B. bronchiseptica expressed CyaA early in infection, but did not express CyaA when isolated later during the chronic infection of the same host (20).

Since the isolates were otherwise indistinguishable, it was concluded that CyaA expression is important early in infection, but was somehow turned off during chronic infection. Since the strains we examined all share the same replacement of the cya locus and phylogenetic lineage

(Fig 2.5), it appears highly unlikely that this genetic change in isolates, collected from different hosts and separate continents (Appendix A), is occurring during individual infections by these strains. The wide-spread geographic distribution of ST27 strains demonstrates that the loss of cyaA has not resulted in a strong counter-selection against this lineage and indicates that the

LCA that lost CyaA has since successfully spread geographically.

Previous studies have shown a correlation between the expression of particular virulence factors and the disease severity caused by certain strains of B. bronchiseptica (7, 42, 48). Since detailed clinical information was not available for the ST27 strains analyzed in this study, we cannot determine if this lineage of B. bronchiseptica causes disease. Although a clinical sample of B. bronchiseptica isolated from a human would only be taken if the patient sought medical attention, many human-related cases of B. bronchiseptica occur in immunocompromised patients which can exacerbate disease (38). In one study, CyaA-deficient strains of the same multi-locus enzyme electrophoretic type did not cause atrophic rhinitis in pigs, which suggested that an absence of CyaA activity correlates with a lack of disease in these animals (39, 42, 43). If these

52 strains were found to be either ST27 or ST40 strains, it would suggest that this lineage is not associated with disease. If those strains were not of ST27 or ST40, then another cause leading to the loss of CyaA activity in B. bronchiseptica may exist (39).

CyaA causes B. bronchiseptica and B. pertussis to grow to higher numbers, persist longer in the respiratory tract and cause more severe pathology (21, 24, 58). For the hypovirulent lineage described herein to be successful, it may be that the loss of CyaA was compensated for by some other beneficial effect. For example, an exciting possibility is that the acquisition of the ptp genes may facilitate the success of these strains despite the loss of CyaA. The predicted function of the ptp genes suggests they are involved in oligo/dipeptide binding and transport which may provide a growth advantage in a particular host niche. Our laboratory is currently investigating the function and regulation of these genes with particular focus on conditions under which the ptp genes enhance this strain’s growth and the role of these genes in vivo. Another possibility is that strains lacking CyaA may also be selected for by a strong host immune response against CyaA that was conferred by prior B. bronchiseptica infection (22). Since CyaA is antigenic (Fig 2.2E) (19), B. bronchiseptica strains lacking this antigen would evade anti-

CyaA antibody responses, potentially giving this strain a selective advantage in host populations where CyaA expressing strains are endemic. Another possibility is that strains lacking CyaA may not be as lethal and allow more hosts to survive and transmit the bacteria (6).

Importantly, no strain should be considered representative of the species in view of the strain and phylogenetically-linked differences observed among B. bronchiseptica isolates. In a lineage of B. bronchiseptica that is closely related to B. pertussis, most strains lacked the dermonecrotic toxin gene, Ptx-related genes and had polymorphic LPS profiles (13). Regulation of alcaligin synthesis also appears to be associated with phylogenetic lineage (16). Strains of the

53 same electrophoretic type lacked CyaA activity but the cause for this loss was not examined (39).

Here, we describe a lineage of B. bronchiseptica that is hypovirulent and lacks the cya operon due to replacement by a novel ptp operon. The recovery of isolates of this lineage of different continents indicates that CyaA is not required for the success of B. bronchiseptica. The data presented herein suggest that different phylogenetic lineages utilize distinct sets of virulence factors. Therefore, it appears that even a species historically characterized by little genetic diversity is flexible enough in its metagenome to cause an overall change in virulence, which likely contributes to the wide variety of severities in disease observed and the ability to persist in a broad range of host populations.

54

Authors and Contributions:

Anne M. Buboltz1,2, Tracy L. Nicholson3, Mylisa R. Parette2, Sara E. Hester1,2, Julian Parkhill4,

Eric T. Harvill2*

1 Graduate Program in Biochemistry, Microbiology and Molecular Biology, The

Pennsylvania State University

2 Department of Veterinary and Biomedical Sciences, The Pennsylvania State University

3 Respiratory Diseases of Livestock Research Unit; National Animal Disease Center,

Agricultural Research Service, USDA, Ames, Iowa.

4 The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton,

Cambridge, UK

Conceived and designed the experiments: AMB, TLN, JP, ETH. Performed the experiments:

AMB, TLN, MRP, SHE, JP. Analyzed the data: AMB, TLN, JP. Wrote the paper: AMB, ETH.

55

References:

1. Arico, B., and R. Rappuoli. 1987. Bordetella parapertussis and Bordetella

bronchiseptica contain transcriptionally silent pertussis toxin genes. J Bacteriol

169:2847-53.

2. Barry, E. M., A. A. Weiss, I. E. Ehrmann, M. C. Gray, E. L. Hewlett, and M. S.

Goodwin. 1991. Bordetella pertussis adenylate cyclase toxin and hemolytic activities

require a second gene, cyaC, for activation. J Bacteriol 173:720-6.

3. Bassinet, L., P. Gueirard, B. Maitre, B. Housset, P. Gounon, and N. Guiso. 2000.

Role of adhesins and toxins in invasion of human tracheal epithelial cells by Bordetella

pertussis. Infect Immun 68:1934-41.

4. Bemis, D. A., H. A. Greisen, and M. J. Appel. 1977. Bacteriological variation among

Bordetella bronchiseptica isolates from dogs and other species. J Clin Microbiol 5:471-

80.

5. Bjornstad, O. N., and E. T. Harvill. 2005. Evolution and emergence of Bordetella in

humans. Trends Microbiol 13:355-9.

6. Blaser, M. J., and D. Kirschner. 2007. The equilibria that allow bacterial persistence in

human hosts. Nature 449:843-9.

7. Brockmeier, S. L., K. B. Register, T. Magyar, A. J. Lax, G. D. Pullinger, and R. A.

Kunkle. 2002. Role of the Dermonecrotic Toxin of Bordetella bronchiseptica in the

Pathogenesis of Respiratory Disease in Swine. Infect. Immun. 70:481-490.

8. Buboltz, A. M., T. L. Nicholson, M. R. Parette, S. E. Hester, J. Parkhill, and E. T.

Harvill. 2008. Replacement of Adenylate Cyclase Toxin in a Lineage of Bordetella

bronchiseptica. J. Bacteriol.:JB.00226-08.

56

9. Carver, T. J., K. M. Rutherford, M. Berriman, M. A. Rajandream, B. G. Barrell,

and J. Parkhill. 2005. ACT: the Artemis Comparison Tool. Bioinformatics 21:3422-3.

10. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of

phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect

Immun 62:3381-90.

11. Cummings, C. A., H. J. Bootsma, D. A. Relman, and J. F. Miller. 2006. Species- and

strain-specific control of a complex, flexible regulon by Bordetella BvgAS. J Bacteriol

188:1775-85.

12. Cummings, C. A., M. M. Brinig, P. W. Lepp, S. van de Pas, and D. A. Relman. 2004.

Bordetella species are distinguished by patterns of substantial gene loss and host

adaptation. J Bacteriol 186:1484-92.

13. Diavatopoulos, D. A., C. A. Cummings, L. M. Schouls, M. M. Brinig, D. A. Relman,

and F. R. Mooi. 2005. Bordetella pertussis, the causative agent of whooping cough,

evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog

1:e45.

14. Foreman-Wykert, A. K., and J. F. Miller. 2003. Hypervirulence and pathogen fitness.

Trends in Microbiology 11:105-108.

15. Gerlach, G., F. von Wintzingerode, B. Middendorf, and R. Gross. 2001. Evolutionary

trends in the genus Bordetella. Microbes Infect 3:61-72.

16. Giardina, P. C., L. A. Foster, J. M. Musser, B. J. Akerley, J. F. Miller, and D. W.

Dyer. 1995. bvg Repression of alcaligin synthesis in Bordetella bronchiseptica is

associated with phylogenetic lineage. J. Bacteriol. 177:6058-6063.

57

17. Glaser, P., H. Sakamoto, J. Bellalou, A. Ullmann, and A. Danchin. 1988. Secretion of

cyclolysin, the calmodulin-sensitive adenylate cyclase-haemolysin bifunctional protein of

Bordetella pertussis. Embo J 7:3997-4004.

18. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol Rev 44:722-38.

19. Gueirard, P., and N. Guiso. 1993. Virulence of Bordetella bronchiseptica: role of

adenylate cyclase-hemolysin. Infect Immun 61:4072-8.

20. Gueirard, P., C. Weber, A. Le Coustumier, and N. Guiso. 1995. Human Bordetella

bronchiseptica infection related to contact with infected animals: persistence of bacteria

in host. J Clin Microbiol 33:2002-6.

21. Guiso, N., M. Rocancourt, M. Szatanik, and J. M. Alonso. 1989. Bordetella adenylate

cyclase is a virulence associated factor and an immunoprotective antigen. Microb Pathog

7:373-80.

22. Gupta, S., M. C. Maiden, I. M. Feavers, S. Nee, R. M. May, and R. M. Anderson.

1996. The maintenance of strain structure in populations of recombining infectious

agents. Nat Med 2:437-42.

23. Hackett, M., L. Guo, J. Shabanowitz, D. F. Hunt, and E. L. Hewlett. 1994. Internal

lysine palmitoylation in adenylate cyclase toxin from Bordetella pertussis. Science

266:433-5.

24. Harvill, E. T., P. A. Cotter, M. H. Yuk, and J. F. Miller. 1999. Probing the function of

Bordetella bronchiseptica adenylate cyclase toxin by manipulating host immunity. Infect

Immun 67:1493-500.

25. Heininger, U., K. Stehr, S. Schmitt-Grohe, C. Lorenz, R. Rost, P. D. Christenson, M.

Uberall, and J. D. Cherry. 1994. Clinical characteristics of illness caused by Bordetella

58

parapertussis compared with illness caused by Bordetella pertussis. Pediatr Infect Dis J

13:306-9.

26. Hewlett, E. L., G. M. Donato, and M. C. Gray. 2006. Macrophage cytotoxicity

produced by adenylate cyclase toxin from Bordetella pertussis: more than just making

cyclic AMP! Mol Microbiol 59:447-59.

27. Jolley, K. A., M. S. Chan, and M. C. Maiden. 2004. mlstdbNet - distributed multi-locus

sequence typing (MLST) databases. BMC Bioinformatics 5:86.

28. Khelef, N., H. Sakamoto, and N. Guiso. 1992. Both adenylate cyclase and hemolytic

activities are required by Bordetella pertussis to initiate infection. Microb Pathog 12:227-

35.

29. Khelef, N., A. Zychlinsky, and N. Guiso. 1993. Bordetella pertussis induces apoptosis

in macrophages: role of adenylate cyclase-hemolysin. Infect Immun 61:4064-71.

30. Kirimanjeswara, G. S., P. B. Mann, and E. T. Harvill. 2003. Role of antibodies in

immunity to Bordetella infections. Infect Immun 71:1719-24.

31. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop,

2nd, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning

vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-6.

32. Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: Integrated software for Molecular

Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5:150-163.

33. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature 227:680-5.

34. Lawrence, J. G., and H. Ochman. 1997. Amelioration of bacterial genomes: rates of

change and exchange. J Mol Evol 44:383-97.

59

35. Le Blay, K., P. Gueirard, N. Guiso, and R. Chaby. 1997. Antigenic polymorphism of

the lipopolysaccharides from human and animal isolates of Bordetella bronchiseptica.

Microbiology 143 ( Pt 4):1433-41.

36. Lee, S. J., M. C. Gray, L. Guo, P. Sebo, and E. L. Hewlett. 1999. Epitope mapping of

monoclonal antibodies against Bordetella pertussis adenylate cyclase toxin. Infect Immun

67:2090-5.

37. Mann, P. B., M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4 is critical to

innate host defense in a murine model of bordetellosis. J Infect Dis 189:833-6.

38. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical

manifestations of respiratory infections due to Bordetella pertussis and other Bordetella

subspecies. Clin Microbiol Rev 18:326-82.

39. Musser, J. M., D. A. Bemis, H. Ishikawa, and R. K. Selander. 1987. Clonal diversity

and host distribution in Bordetella bronchiseptica. J Bacteriol 169:2793-803.

40. Musser, J. M., E. L. Hewlett, M. S. Peppler, and R. K. Selander. 1986. Genetic

diversity and relationships in populations of Bordetella spp. J Bacteriol 166:230-7.

41. Nicholson, T. L. 2007. Construction and validation of a first-generation Bordetella

bronchiseptica long-oligonulceotide microarray by transcriptional profiling the Bvg

regulon. BMC Genomics 8:220.

42. Novotny, P., A. P. Chubb, K. Cownley, and J. A. Montaraz. 1985. Adenylate cyclase

activity of a 68,000-molecular-weight protein isolated from the outer membrane of

Bordetella bronchiseptica. Infect Immun 50:199-206.

60

43. Novotny, P., A. P. Chubb, K. Cownley, J. A. Montaraz, and J. E. Beesley. 1985.

Bordetella adenylate cyclase: a genus specific protective antigen and virulence factor.

Dev Biol Stand 61:27-41.

44. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M.

T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga,

L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D.

Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis,

J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S.

Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E.

Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M.

Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead,

B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences

of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet

35:32-40.

45. Pilione, M. R., L. M. Agosto, M. J. Kennett, and E. T. Harvill. 2006. CD11b is

required for the resolution of inflammation induced by Bordetella bronchiseptica

respiratory infection. Cell Microbiol 8:758-68.

46. Preston, A., A. G. Allen, J. Cadisch, R. Thomas, K. Stevens, C. M. Churcher, K. L.

Badcock, J. Parkhill, B. Barrell, and D. J. Maskell. 1999. Genetic basis for

lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect Immun 67:3763-7.

47. Repsilber, D., A. Mira, H. Lindroos, S. Andersson, and A. Ziegler. 2005. Data

rotation improves genomotyping efficiency. Biom J 47:585-98.

61

48. Roop, R. M., 2nd, H. P. Veit, R. J. Sinsky, S. P. Veit, E. L. Hewlett, and E. T.

Kornegay. 1987. Virulence factors of Bordetella bronchiseptica associated with the

production of infectious atrophic rhinitis and pneumonia in experimentally infected

neonatal swine. Infect Immun 55:217-22.

49. Rutherford, K., J. Parkhill, J. Crook, T. Horsnell, P. Rice, M. A. Rajandream, and

B. Barrell. 2000. Artemis: sequence visualization and annotation. Bioinformatics

16:944-5.

50. Saeed, A. I., V. Sharov, J. White, J. Li, W. Liang, N. Bhagabati, J. Braisted, M.

Klapa, T. Currier, M. Thiagarajan, A. Sturn, M. Snuffin, A. Rezantsev, D. Popov,

A. Ryltsov, E. Kostukovich, I. Borisovsky, Z. Liu, A. Vinsavich, V. Trush, and J.

Quackenbush. 2003. TM4: a free, open-source system for microarray data management

and analysis. Biotechniques 34:374-8.

51. Snipen, L., D. Repsilber, L. Nyquist, A. Ziegler, A. Aakra, and A. Aastveit. 2006.

Detection of divergent genes in microbial aCGH experiments. BMC Bioinformatics

7:181.

52. Staveley, C. M., K. B. Register, M. A. Miller, S. L. Brockmeier, D. A. Jessup, and S.

Jang. 2003. Molecular and antigenic characterization of Bordetella bronchiseptica

isolated from a wild southern sea otter (Enhydra lutris nereis) with severe suppurative

bronchopneumonia. J Vet Diagn Invest 15:570-4.

53. Stibitz, S., and M. S. Yang. 1991. Subcellular localization and immunological detection

of proteins encoded by the vir locus of Bordetella pertussis. J. Bacteriol. 173:4288-4296.

54. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microarrays

applied to the ionizing radiation response. PNAS 98:5116-5121.

62

55. van der Zee, A., F. Mooi, J. Van Embden, and J. Musser. 1997. Molecular evolution

and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme

electrophoresis and typing with three insertion sequences. J Bacteriol 179:6609-17.

56. Vernikos, G. S., and J. Parkhill. 2006. Interpolated variable order motifs for

identification of horizontally acquired DNA: revisiting the Salmonella pathogenicity

islands. Bioinformatics 22:2196-203.

57. Weingart, C. L., and A. A. Weiss. 2000. Bordetella pertussis virulence factors affect

phagocytosis by human neutrophils. Infect Immun 68:1735-9.

58. Weiss, A. A., and M. S. Goodwin. 1989. Lethal infection by Bordetella pertussis

mutants in the infant mouse model. Infect Immun 57:3757-64.

59. Weiss, A. A., E. L. Hewlett, G. A. Myers, and S. Falkow. 1983. Tn5-induced mutations

affecting virulence factors of Bordetella pertussis. Infect Immun 42:33-41.

60. Wolfe, D. N., G. S. Kirimanjeswara, and E. T. Harvill. 2005. Clearance of Bordetella

parapertussis from the lower respiratory tract requires humoral and cellular immunity.

Infect Immun 73:6508-13.

63

Chapter 3:

Type III Secretion System contributes to the increased virulence of a

Bordetella bronchiseptica lineage.

64

Abstract:

Despite the fact that closely related bacteria can cause different levels of disease, the genetic changes that cause some isolates to be more pathogenic than others are generally not well understood. We use a combination of approaches to determine the molecular basis for the increased virulence of a Bordetella bronchiseptica lineage. In a murine model of infection, the virulence of a strain isolated from a lethal infection, strain 1289, was 60-fold greater than one isolated from a healthy host, strain RB50. Transcriptome analysis and qRT-PCR showed that the

TTSS genes were more highly expressed by strain 1289 than strain RB50. Compared to strain

RB50, the TTSS of strain 1289 caused greater cytotoxicity and contributed more to virulence.

Using MLST, we identified another strain from the same lineage as strain 1289 and showed that the TTSS also contributed to the greater virulence of this strain relative to strain RB50. Our data suggest that the TTSS contributes to the increased virulence of a B. bronchiseptica lineage.

These data are consistent with the view that B. bronchiseptica lineages can cause different levels of virulence, which may contribute to this species’ ability to cause a wide-variety of diseases in a broad range of hosts.

65

Introduction:

Although the type and level of disease caused by different strains of pathogenic bacteria is known to vary, the molecular basis for these differences has been difficult to disentangle from the many other genetic changes that occur as strains diverge. Recently, a growing number of studies have identified factors that contribute to increased virulence of bacterial lineages by using a combination of genome-wide analyses, phylogenetics, mutational analysis and host infection models (15, 45, 48-50, 55, 57). Horizontal gene transfer of novel virulence factors, phage integration, phenotypic variation, gene loss and mutation have been shown to alter the phenotype or severity of disease (15, 50, 55).

Bordetella bronchiseptica is a gram-negative respiratory pathogen that infects a wide- range of mammals and is closely related to B. pertussis and B. parapertussis, the causative agents of whooping cough in humans (18, 33, 36). Colonization of hosts by B. bronchiseptica can lead to a range of diseases from lethal pneumonia to asymptomatic infection (18) which is thought to be caused by differences in host immune status, polymicrobial infection and/or

bacterial strain variation (18, 33). In inbred, specific pathogen free (SPF) mice, the LD50 differs up to 105-fold between bacterial strains suggesting that substantial differences in virulence may be due to strain variation alone (5, 19, 20).

While the population structure of these bacteria appears to be clonal, B. pertussis and B. parapertussis are more monomorphic than B. bronchiseptica strains and isolates of this species can be more distantly related to each other than to either of the human-associated pathogens (11,

36, 37, 59). Previously, it was shown that regulation of gene expression can correlate with phylogenetic lineage (17) and strains of B. bronchiseptica can differ in virulence factor expression (3, 19, 31, 36, 46). Recently, we showed that these concepts are interrelated as

66 phylogenetic lineages of B. bronchiseptica express different subsets of virulence factors that can be related to overall virulence (5).

B. bronchiseptica strains express many virulence factors including adhesins, secretion systems, autotransporters and toxins, that are globally regulated by the BvgAS two-component signal transduction system (7, 52). In the non-virulent, or Bvg- phase, which occurs at 25ºC or in the presence of chemical modulators such as MgSO4 or nicotinic acid, BvgAS is unable to activate virulence associated genes (10, 35, 38). During the virulent, or Bvg+ phase, which occurs when the bacteria are grown at 37ºC and in the absence of chemical modulators, BvgAS activates expression of a large set of virulence factors (7, 10, 38). The Bvg+ phase is both necessary and sufficient for colonization of the respiratory tract (1, 8). Amongst the Bvg regulated genes are those encoding a type III secretion system (TTSS), which is similar to others shown to directly translocate effector proteins through a needle-like injection apparatus directly into eukaryotic cells, disrupt host cell signaling and necrotic-like cell death (27, 61). Under Bvg+ conditions, the btr regulatory locus (including btrS, btrU, btrW and btrV) is transcribed (34).

BtrS is an ECF sigma factor that is necessary and sufficient for activating the more than 20

TTSS-related (bsc, bop, bsp, bte) genes (34). BscN is the putative ATPase that provides energy for the secretion of effector proteins and is required for the function of the TTSS apparatus (61).

TTSS gene products, BopB, BopC and BteA, have been shown to be secreted and required for cytotoxicity of mammalian cells (28, 29, 40). In a murine model of infection, the TTSS increases host IL-10 production and enhances persistence of B. bronchiseptica in the lower respiratory tract (43, 60, 61).

While correlations between the level of virulence or disease caused by B. bronchiseptica strains and specific bacterial factors have been made (5, 39, 46), limited studies have directly

67 tested if these factors cause some lineages to be more virulent than others (4). Here, we use genome-wide analyses, phylogenetics, allelic exchange and a murine model of infection to determine the bacterial factors that contribute to the increased virulence of a B. bronchiseptica lineage. We compared the relative virulence, as measured by mean lethal dose (LD50), of B. bronchiseptica strains from an asymptomatically infected (strain RB50) or diseased (strain 1289) host (8). Strain 1289 was approximately 60-fold more virulent and had increased TTSS related gene expression. The TTSS-mediated cytotoxicity and virulence caused by strain 1289 was greater than that caused by strain RB50. Using multi-locus sequence typing (MLST) analysis, we identified another strain from the same sequence type (ST) as strain 1289 and showed that, similar to strain 1289, the TTSS contributed to the greater virulence of this strain relative to strain RB50. Together, our data indicate that the TTSS contributes to the increased virulence of a B. bronchiseptica lineage. This is consistent with the idea that different phylogenetic lineages can differentially regulate their virulence factors to modulate their overall level of virulence which may contribute to the ability of B. bronchiseptica to persist in a broad range of hosts and cause different severities of disease.

68

Materials and Methods:

Bacterial Strains and Growth. B. bronchiseptica isolates, sources, locations, dates, anatomical site of isolation, reference and all available health and necropsy reports are included (Appendix

A). More detailed clinical data were not available for these isolates. All strains were maintained on Bordet-Gengou (BG) agar (Difco, Sparks, MD) containing 10% sheep’s blood (Hema

Resources, Aurora, OR) with 20μg/mL streptomycin (Sigma, St. Louis, MO). For inoculation, bacteria were grown overnight at 37ºC in Stainer-Scholte (SS) broth to logarithmic phase, bacterial density was measured by optical density read at 600nm (OD600) and diluted in sterile phosphate buffered saline (PBS; Omnipur, Gibbstown, NJ) to the appropriate concentration.

Inocula were confirmed by plating dilutions on BG agar and counting the resulting colonies after

2 days of incubation at 37°C as previously described (22, 26). Because the Bvg+ phase is required for colonization of the respiratory tract, only strains that appeared Bvg+ (domed and β- hemolytic) were used in the murine model of infection. Strains that exhibited rough colony morphology and lacked β-hemolysis, an indication of avirulent Bvg- mutants, which commonly occur upon in vitro passaging, were excluded from this type of analysis (51). For this reason, strains 1973 and 1987 were not analyzed in vivo.

Animal Experiments. 4 to 6 week old C57BL/6 mice were obtained from Jackson Laboratories

(Bar Harbor, ME), were bred and maintained in our specific pathogen and Bordetella-free rooms at the Pennsylvania State University. All experiments were completed in accordance with institutional guidelines. For inoculation, mice were lightly sedated with 5% isofluorane (IsoFlo;

Abbott Laboratories) in oxygen and the indicated number of CFU in 50µL of PBS of the appropriate B. bronchiseptica strain was gently pipetted onto the external nares as previously described (22, 26). For survival curves, groups of 3 to 4 mice were inoculated with the indicated

69 dose and percent survival was monitored over a 28 day period. Mice with lethal bordetellosis, indicated by ruffled fur, labored breathing and diminished responsiveness were euthanized to alleviate unnecessary suffering (22, 32, 42). Statistical significance was calculated using a

Fisher’s exact test where groups of mice were compared in terms of survival or death at a similar dose of two different strains as previously described (5). To quantify the number of bacteria in the lungs, trachea and nasal cavity, groups of 3 to 4 mice were inoculated with a sub-lethal dose

(1 x 104 CFU) and sacrificed at the indicated time point. Bacterial numbers in all respiratory organs were quantified as previously described (22, 25). The mean +/- standard error was determined for each treatment group. Statistical significance in bacterial load between strains was calculated by using an ANCOVA in Minitab (v. 13.30, Minitab Inc.). The explanatory variable used was bacterial strain and a covariate for day was fitted to control for the change in load over time (5). A P-value of < 0.05 was taken as statistically significant. All animal experiments were repeated at least twice with similar results.

Expression Arrays and Statistical Analysis. The expression array was carried out as previously described (5, 38). Briefly, bacteria were grown in SS broth, subcultured at a starting

OD600 of 0.02 into 50mL of SS broth, grown at 37°C for 24 hours while shaking and harvested in log phase (OD600 1.0). Total RNA was extracted with Trizol (Invitrogen, Carlsbad, CA), treated with RNase-free DNase I (Invitrogen, Carlsbad, CA) and purified using RNeasy columns

(Qiagen, Valencia, CA) according to the manufacturer’s instructions. RNA was isolated from two independent biological replicates of strains RB50 and 1289. A 2-color hybridization format was used and dye-swap experiments were performed. For each reaction, 5 g of cDNA was fluorescently labeled. The two differentially labeled reactions to be compared were combined and hybridized to a B. bronchiseptica strain RB50 specific long-oligonucleotide microarray (5,

70

38). Slides were then scanned using a GenePix 4000B microarray scanner and analyzed with

GenePix Pro software (Axon Instruments, Union City, CA). Spots were assessed visually to identify those of low quality and arrays were normalized so that the median of ratio across each array was equal to 1.0. Spots of low quality were identified and were filtered out prior to analysis. Ratio data from the two biological replicates were compiled and normalized based on the total Cy3% intensity and Cy5% intensity to eliminate slide to slide variation. Gene expression data were then normalized to 16S rRNA. The statistical significance of the gene expression changes observed was assessed by using the significant analysis of microarrays

(SAM) program (58). A one-class unpaired SAM analysis using a false discovery rate of 0.30%

(<0.1%) was performed. All microarray expression data have been deposited in MAIMExpress under the accession number E-MEXP-1736. qRT-PCR. qRT-PCR was completed as previously described (5, 38) and RNA was extracted as described for the microarray experiment. 1µg of RNA from each biological replicate was reverse transcribed using 300 ng of random oligonucleotide hexamers and SuperScript III RTase

(Invitrogen, Carlsbad, CA). The resulting cDNA was diluted 1:1000 and 1 μL used in qRT-PCR reactions containing 300 nM primers, designed with Primer Express software (Applied

Biosystems, Foster City, CA), and 2XSYBR Green PCR Master Mix (Applied Biosystems,

Foster City, CA). To confirm the lack of DNA contamination, reactions without reverse transcriptase were completed. Dissociation curve analysis was performed for verification of product homogeneity. Threshold fluorescence was established within the geometric phase of exponential amplification and the cycle of threshold (Ct) determined for each reaction. The cycle of threshold (Ct) from all biological replicates for each strain was compiled and the 16S RNA amplicon was used as an internal control for data normalization. Fold change in transcript level

71 was determined using the relative quantitative method (ΔΔCT) (47). All primer sequences and changes in gene expression analyzed by qRT-PCR are available (Appendix H, I).

Comparative genomic hybridization and statistical analysis. CGH analysis was completed as previously described (5). Briefly, strains RB50 and 1289 were grown in SS broth at 37°C with shaking overnight and genomic DNA was isolated from bacterial cultures using a DNA extraction kit (Qiagen, Valencia, CA) and digested with DpnII. For each labeling reaction, 2 g of digested genomic DNA was randomly primed using Cy-5 and Cy-3 dye-labeled nucleotides, with BioPrime DNA labeling kits (Invitrogen, Carlsbad, CA) and the two differentially labeled reactions to be compared were combined and hybridized to a B. bronchiseptica RB50 specific long-oligonucleotide microarray (5, 38). Dye-swap experiments were performed. Statistical analysis of CGH data was performed with SAS software 9.1.3 (SAS Institute, Inc., Cary, NC). A

MODECLUS procedure (PROC MODECLUS) based on nonparametric density estimation was used to cluster genes into divergent or non-divergent groups. All CGH data have been deposited in MIAMExpress under the accession number E-MEXP-1737.

Deletion of bscN in B. bronchiseptica. The gene encoding the ATPase that provides energy for secretion of proteins via the TTSS, bscN, was deleted from strain RB50 as previously described

(61). The deletion of bscN from strains 1289 and S308 was completed as follows. 419bp upstream and the first three codons of the bscN gene were PCR amplified using primers flanked with EcoRI on the 5' end and BamHI on the 3' end (F-atcgaattccggatcaggcggagaaga and R- taaggatccctgacgcatgcccctatc respectively). 420bp downstream and the last three codons of the bscN gene were PCR amplified using primers flanked with BamHI on the 5' end and EcoRI on the 3' end (F-cgcggatccgaatcctaatggacctgg and R-taggaattctccaggctctcgcgcaag respectively). The

PCR conditions were 95°C for 5 minutes, 30X (95°C 30 sec, 56°C 30 sec, 72°C for 1 min), 72°C

72 for 5 min. These fragments were PCR purified (Qiagen, Valencia, CA), BamHI digested (New

England Biolabs), gel purified (Qiagen, Valencia, CA) and ligated overnight at 4°C (New

England Biolabs). The ligation product was then amplified with the 5'F and 3'R primers as described above. The 846bp product was ligated into the TOPO-TA vector and transformed into

Mach1 DH5α cells (Invitrogen, Carlsbad, CA). Presence of the insert in TOPO-TA was screened for by the loss of β-galactosidase activity and EcoRI digest of the plasmid from resulting transformants. The 838bp insert was digested from TOPO-TA, gel purified and ligated overnight into the EcoRI digested pSS4245, a new Bordetella allelic exchange vector (Stibitz, S., manuscript in preparation). The ligation product was transformed as described above. Presence of the insert in pSS4245 was screened for by plasmid extraction from resulting transformants and digestion with EcoRI. The positive clone was named pSS4245ΔbscN. The resulting positive clones were sequenced after insertion into TOPO-TA and pSS4245 to ensure PCR induced mutations did not occur. DH5α harboring pSS4545ΔbscN or a plasmid competent for mating, pSS1827 (53), and the appropriate B. bronchiseptica strain grown under Bvg- conditions by growth on BG+50mM MgSO4 was mated for 4 hours on a BG+10mM MgCl2+50mM MgSO4 plate at 37°C. Then, B. bronchiseptica containing pSS4245ΔbscN was positively selected for using BG+Strep+Kan+50mM MgSO4 plates and incubated for 5 days at 37°C. Resulting B. bronchiseptica colonies were streaked on BG+Strep+Kan+50mM MgSO4 and grown at 37°C for

4 days. Resulting colonies were streaked on BG plates and incubated for 2 days at 37°C which resulted in colonies lacking pSS4245 and containing either the wild-type or knockout gene.

Colonies were screened for the presence of either the wild-type or knockout gene by using screening primers (F-atcgactacttcgcgggtatcgagaa and R-gagcagctggatttcatgctcgtg) which detected either the wild-type bscN gene (2003bp) or the bscN deletion (678bp) with the PCR

73 conditions of 95°C for 5 minutes, 30X (95°C 30 sec, 56°C 30 sec, 72°C for 1 min), 72°C for 5 min. To further confirm the presence and absence of the bscN gene, screening primers which amplify the middle of the bscN gene, and could therefore only amplify the wild-type gene

(1071bp), were used (F-gaacgatcatcaaggccgtcgttc and R-gtcctggtacttggccatcagttc). The absence of pSS4245 was confirmed by growth on BG+strep plates and lack of growth on BG+kan plates.

Cytotoxicity Assay. These assays were carried out as previously described (34, 61). Briefly,

J774 macrophages were cultured in DMEM supplemented with 10% FBS, 1% penicillin- streptomycin, 1% non-essential amino acids and 1% sodium pyruvate to 85% confluency in a 5%

CO2 at 37°C. Then, warmed RMPI lacking phenol-red, with 5% FBS, 1% L-glutamine, 1% non- essential amino acids and 1% sodium pyruvate was used to replace the DMEM. Bacterial infections were carried out using a multiplicity of infection (MOI) of 10 and bacterial suspensions were centrifuged onto the macrophage cells at 250g for 5 minutes and incubated in

5% CO2 at 37°C for the indicated amount of time. The cell culture supernatants were collected and percent lipodehydrogenase (LDH) release was analyzed using the Cytotox96 kit (Promega) according to the manufacturer’s instructions. Statistical significance in percent cytotoxicity between strains was calculated by using a Tukey simultaneous test in Minitab (v. 13.30, Minitab

Inc.). A P-value of < 0.05 was taken as statistically significant.

MLST and phylogenetic tree construction. Multi-locus sequence typing (MLST) analysis was performed as previously described (5, 11). In this study, ST of 3 strains (S308, S314, and 973) was determined (Appendix A). All alleles were double stranded sequenced at The Pennsylvania

State University Sequencing Center. The sequences were trimmed and allele and sequence types were designated using the Bordetella MLST database which are available at this website

(http://pubmlst.org/bordetella) (5, 11, 23). Using MEGA 4.0, the alleles were concatenated,

74 aligned and an Unweighted Pair Group Method with Arithmetic Mean (UPGMA) tree with 1000 bootstraps using the K2 model was constructed for these 5 strains and 58 strains whose ST was previously determined (5, 11, 56) (Appendix A).

75

Results:

B. bronchiseptica strain 1289 is more virulent than strain RB50.

Previous studies have shown that

B. bronchiseptica strains can vary widely in virulence (5, 19, 20). To establish a system in which we could measure the contribution of specific factors to the difference in virulence between strains, we compared the lethal dose (LD50), a measure of their virulence, of B. bronchiseptica strains in inbred, SPF mice. B. bronchiseptica strain RB50 was isolated from the nasal cavity of an asymptomatically infected host (8).

Consistent with previous studies of this strain, inoculation with 1 x 106, 3 x 106 or Figure 3.1: LD50 and quantification of lung bacterial load of B. bronchiseptica strains RB50 and 1289. Groups of 3-4 6 x 106 CFU of B. bronchiseptica strain C57BL/6 mice were inoculated intranasally with the indicated doses of strains RB50 (A) or 1289 (B). Survival curves were generated by inoculating mice with the RB50 lead to 100%, 50% and 0% survival indicated dose and determining percent survival over a 28 day period. (C) Groups of 3 mice were inoculated intranasally with 1 x 104 CFU of strain RB50 (closed respectively (Fig 3.1A) (5). B. diamonds) or strain 1289 (open squares). Bacterial load in the lungs was quantified 0, 3, 7, 14 and 28 days post- bronchiseptica strain 1289 was isolated inoculation. The dashed line indicates the lower limit of detection. Bacterial numbers are expressed as the log10 mean +/- standard error (error bars). from the thoracic cavity of a host with a lethal B. bronchiseptica infection (Appendix G). When inoculated with 1 x 104, 5 x 104 or 1 x

76

105 CFU of strain 1289, 100%, 50% and 0% of the mice survived the infection respectively (Fig

3.1B) indicating that the LD50 of strain 1289 is 60-fold lower, 2.95 million less CFU, than strain

RB50. Although these two isolates did not differ in growth rate in vitro (data not shown), we examined whether the greater virulence of strain 1289 might allow it to grow more rapidly in vivo. Groups of 15 mice were inoculated with a sublethal dose (1 x 104 CFU) of either strain

RB50 or 1289 and respiratory organs were excised to quantify bacterial load on days 0, 3, 7, 14, and 28 post-inoculation (Fig 3.1C). In the lungs, strain RB50 peaked at approximately 1 x 105

CFU and cleared to below the limit of detection (10 CFU) by day 28 post-inoculation (Fig 3.1C).

The bacterial load of strain 1289 was approximately 10-fold higher than strain RB50 over the course of infection (Fig 3.1C) (bacterial strain: F1,27 = 7.03, P = 0.013). Even 24-hours post- inoculation, the bacterial load of strain 1289 was 10-fold higher than strain RB50 (P = 0.002) which suggests that strain 1289 rapidly grows to higher numbers in the lungs (data not shown).

The bacterial load did not significantly differ between strain RB50 and 1289 in the trachea or nasal cavity over the course of infection (Appendix J). Combined, these data indicate that strain

1289 is more virulent than strain RB50 and rapidly grows to higher numbers in the lungs.

Type Three Secretion System genes are upregulated in strain 1289.

To identify candidate bacterial genes that correlated with the increased virulence of strain

1289, whole genome transcriptome analysis was performed between strains 1289 and RB50 (Fig

3.2A). Of the 5,013 genes represented on the RB50-specific microarray, 646 were downregulated in strain 1289 relative to strain RB50. These included 49 transporters, 47 metabolism related transcripts, 51 transcriptional regulators, 27 electron transporters, 11 two- component systems, 7 transcriptional or translational genes, 1 protein biosynthesis related transcript, 74 exported or membrane protein, 72 phage-related transcripts and 202 hypothetical,

77

Figure 3.2: Whole Transcriptome Analysis and TTSS Expression in B. bronchiseptica strains RB50 and 1289. (A) Comparison of whole transcriptome analysis between strains RB50 and 1289. The x axis indicates the order of genes along the B. bronchiseptica strain RB50 5.3 megabase (Mb) chromosome. The y axis indicates the fold change in expression (FCE) of each gene. Negative fold change values indicate decreased gene expression of genes in strain 1289 compared to strain RB50 and positive fold change values indicate increased gene expression in strain 1289 compared to strain RB50. Genes of interest are labeled with corresponding underscores (HP: hypothetical protein, Φ: phage related gene, TTSS: type three secretion system related genes, PEP: putative exported protein, BB4921: putative ferredoxin). Comparison of TTSS related gene expression between strains RB50 and 1289 by microarray analysis (B) and qRT-PCR (C). The x axis indicates the genes analyzed. The y axis indicates the fold increase in gene expression (FCE) in strain 1289 over strain RB50. Error bars represent +/- the standard error in A and B and standard deviation in C. predicted or probable genes. Additionally, 5 genes known to increase bacterial growth during infection and classified as adhesions or involved in evasion of complement, were downregulated

2-8 fold in strain 1289 as compared to strain RB50; filamentous hemagglutinin B (fhaB), filamentous hemagglutinin S (fhaS), bordetella colonization factor (bcfA), bordetella resistance to killing A (brkA) and one O-antigen related gene (wbmS) (Fig 3.2A) (6, 9, 13, 24, 54). The downregulated expression of brkA and fhaB in strain 1289 were confirmed by qRT-PCR

(Appendix I). When CGH analysis was completed on these strains, none of the known virulence factors were identified as divergent in strain 1289 suggesting that the decreased signal of these

78 virulence factors in strain 1289 identified in our transcriptome analysis is due to downregulation rather than sequence divergence.

We were particularly interested in determining which genes were upregulated in strain

1289 as they might contribute to the greater virulence of this strain. 607 genes were identified as upregulated in strain 1289 relative to strain RB50. These included 60 transporters, 67 metabolism related transcripts, 23 transcriptional regulators, 42 electron transporters, 7 two- component systems, 16 transcriptional or translational genes, 40 protein biosynthesis related transcripts, 75 exported or membrane protein genes, 16 phage-related transcripts and 154 hypothetical, predicted or probable genes. 33 genes associated with known virulence factors were upregulated in strain 1289 compared to strain RB50. Four of these genes were cyclolysin- activating lysine-acyltransferase (cyaC), bordetella resistance to killing B (brkB), one O-antigen related gene (wbmJ) and pertussis toxin subunit 4 precursor (ptxD) which were upregulated by

1.8 fold or more in strain 1289 (Fig 3.2A). The remaining 29 virulence-associated genes are related to the TTSS and were upregulated in strain 1289 from 1.4-8.5 fold over strain RB50 (Fig

3.2A, 3.2B). As expected, a strong correlation was observed between expression levels analyzed by microarray and qRT-PCR (R = 0.914). Although qRT-PCR did not confirm the upregulation of cyaC, all the TTSS related genes examined were upregulated 2.6-12.8 fold in strain 1289 compared to strain RB50 (Fig 3.2C, Appendix I). The upregulation of these virulence factor genes in strain 1289 does not appear to be due to gene duplication as no genes were identified as duplicated using CGH analysis.

79

TTSS causes increased cytotoxicity and contributes to the increased virulence of strain

1289.

The increased expression of such as large set of genes with a known coordinated function in virulence led us to hypothesize that strain 1289 exhibited greater TTSS-mediated effects compared to strain RB50. One well-described function attributed to the TTSS is cytotoxicity for a variety of mammalian cells (14, 34, 61). Since nearly all TTSS related genes are upregulated in strain

1289, we hypothesized that this strain may Figure 3.4: MLST analysis of 61 Bordetella strains. A UPGMA tree with 1000 bootstraps based on concatenated MLST gene sequence of 61 Bordetella isolates (58 B. bronchiseptica, 2 B.pertussis and 1 B. parapertussis). The identification number of each strain is listed. The asterisks indicate strains that have been or are undergoing full cause more TTSS-mediated cytotoxicity genome sequencing (41). As previously described, the ST is labeled next to each strain and the Complex is labeled next to each set of STs (Complex I, which includes B. bronchisetpica strains, Complex II, which includes B. pertussis strains, Complex III, which includes B. parapertussis strains and Complex IV, which includes B. bronchiseptica than strain RB50. Although J774 strains that appear to be most closely related to B. pertussis) as previously described (5, 11). The numbers on the tree branches indicate branch strength. All branch strengths below 50 were removed. macrophages treated with media alone did Figure 3.3: TTSS mediated affect on cytotoxicity and virulence of B. bronchiseptica strains RB50 and 1289. (A) Cytotoxicity of J774 macrophages treated with media (solid line, cross) or infected with RB50 (solid line, solid not release cytoplasmic LDH, infection of square), RB50ΔbscN (dashed line, solid square), 1289 (solid line, open triangle) or 1289ΔbscN (dashed line, open triangle) for 1, 2, 3 and 4 hours at an MOI of 10. The error bars represent +/- the standard deviation. (B) Groups of 3- these macrophages with strain RB50 at a MOI 4of C57BL/6 10 caused mice 5%, were inoculated7%, 34% intranasally and 87% with of their the indicated LDH doses of strains RB50ΔbscN (solid symbols, bold text) or 1289ΔbscN (open symbols, normal text). Survival curves were generated by inoculating mice with the indicated dose and determining percent survival over a 28 day period. to be released after 1, 2, 3 and 4 hours of infection respectively, indicating that RB50 is cytotoxic towards macrophages (P = 0.0001) (Fig 3.3A) as previously reported (34, 61). Upon infection with the same dose of strain 1289, the percent LDH release was higher than that caused by strain

RB50 (P = 0.0360) which indicates that strain 1289 causes more rapid cytotoxicity of macrophages than strain RB50 (Fig 3.3A). To determine if the cytotoxicity induced by these

80 strains is caused by the TTSS, isogenic mutants each lacking the bscN gene (RB50ΔbscN and

1289ΔbscN) were used to compare their cytotoxicity to J774 macrophages (Fig 3.3A). The percent LDH release caused by infection with RB50ΔbscN was lower than that of its parental strain, RB50, and was not significantly different from the media control (P = 0.0047 and P =

0.5758 respectively) which confirms that the TTSS of strain RB50 causes cytotoxicity toward macrophages (Fig 3.3A) (21, 61). Similarly, the percent LDH release caused by infection with

1289ΔbscN was lower than of its wild-type counterpart and was not significantly different from the media control or RB50 bscN (P < 0.0001, P = 0.2960 and P = 0.9857 respectively) (Fig

3.3A). The greater TTSS-dependent cytotoxicity caused by strain 1289 at earlier time points suggests that strain 1289 causes more rapid TTSS-mediated cytotoxicity than strain RB50.

Since the TTSS is associated with both cytotoxicity in vitro and virulence in vivo, we hypothesized that the TTSS contributes to the increased virulence of strain 1289 compared to strain RB50. To test this, mice were inoculated with the ΔbscN strains of RB50 and 1289 and

6 the LD50s of these isogenic mutant strains were determined. When inoculated with 8.0 x 10 or

1.0 x 107 CFU of RB50∆bscN, 100% and 0% of the mice survived the infection respectively (Fig

6 3.3B) indicating that the LD50 of strain RB50∆bscN is approximately 9.0 x 10 CFU, a 3-fold increase compared to the LD50 of strain RB50 (Fig 3.3B, 3.1A). When mice were inoculated with 1 x 105, 1.0 x 106 or 2.0 x 106 CFU of 1289∆bscN, 100%, 66% and 0% of the mice survived the infection respectively (Fig 3.3B) indicating that the LD50 of strain 1289∆bscN is approximately 1.2 x 106 CFU, a 24-fold increase compared to strain 1289 (Fig 3.3B, 3.1B).

Therefore, the TTSS appears to contribute more to the virulence of strain 1289 than to strain

RB50 (Fig 3.1A, 3.1B, 3.3B). Since the LD50 of 1289∆bscN is lower than that of RB50∆bscN, it suggests that another factor besides the TTSS also contributes to the increased virulence of strain

81

1289 (Fig 3.3B). Together, these data indicate that while the TTSS is not the sole factor, the increased virulence of strain

1289 compared to strain RB50 is partly dependent on the TTSS.

TTSS contributes to the increased virulence of ST32 strains.

To examine if isolates associated with severe B. bronchiseptica-related disease were of the same phylogenetic lineage as strain 1289, we completed MLST and phylogenetic analysis using strains from severly diseased hosts. Our MLST analysis and phylogenetic tree included 61

Bordetella strains (58 B. bronchiseptica from a broad range of geographies, dates and hosts, 2 B. pertussis strains and 1 B. parapertussis strain) (Fig 3.4, Appendix A)

(5, 11). Consistent with other phylogenetic

Figure 3.4: MLST analysis of 61 Bordetella strains. A UPGMA tree with 1000 bootstraps based on concatenated MLST gene sequence of 61 Bordetella isolates (58 B. bronchiseptica, 2 B.pertussis and 1 B. parapertussis). The identification number of each strain is listed. The asterisks indicate strains that have been or are undergoing full genome sequencing (41). As previously described, the ST is labeled next to each strain and the Complex is labeled next to each set of STs (Complex I, which includes B. bronchisetpica strains, Complex II, which includes B. pertussis strains, Complex III, which includes B. parapertussis strains and Complex IV, which includes B. bronchiseptica strains that appear to be most closely related to B. pertussis) as previously described (5, 11). The numbers on the tree branches indicate branch strength. All branch strengths below 50 were removed.

Figure 3.3: TTSS mediated affect on cytotoxicity and virulence of B. bronchiseptica strains RB50 and 1289. (A) Cytotoxicity of J774 macrophages treated with media (solid line, cross) or infected with RB50 (solid line, solid square), RB50ΔbscN (dashed line, solid square), 1289 (solid line, open triangle) or 1289ΔbscN (dashed line, open 82 triangle) for 1, 2, 3 and 4 hours at an MOI of 10. The error bars represent +/- the standard deviation. (B) Groups of 3- 4 C57BL/6 mice were inoculated intranasally with the indicated doses of strains RB50ΔbscN (solid symbols, bold text) or 1289ΔbscN (open symbols, normal text). Survival curves were generated by inoculating mice with the indicated dose and determining percent survival over a 28 day period. analyses, both B. pertussis and B. parapertussis appear to have evolved independently from B. bronchiseptica-like progenitors (Fig 3.4) (11, 41, 59). As previously described, strains RB50 and

1289 were identified as ST12 and ST32 isolates respectively (Fig 3.4) (5, 11).

Importantly, strains belonging to the same

STs as strains RB50 (11) and 1289 (Fig

3.4, Appendix A) have been isolated from several continents suggesting that these two lineages exist worldwide. Two Figure 3.5: TTSS mediated effect on virulence of B. bronchiseptica strain S308, a ST32 isolate. Groups of 3-4 isolates, strains S308 and S314, were C57BL/6 mice were inoculated intranasally with the indicated doses of strain S308 (solid symbols, bold text) or S308ΔbscN (open symbols, normal text). Survival curves were generated selected for MLST analysis because they by inoculating mice with the indicated dose and determining percent survival over a 28 day period. were collected from hosts with acute B. bronchiseptica-induced disease (Appendix G). While one of these strains, S308, belongs to the same ST as strain 1289, the other strain, S314, belongs to ST7 (Fig 3.4). These data suggest that not all strains causing severe B. bronchiseptica-induced disease are of the same phylogenetic lineage. However, within the ST32 lineage, all strains with an accompanying pathology report

(strains 1289 and S308) were associated with severe B. bronchiseptica-induced disease (Fig 3.4) suggesting that ST32 strains constitute a more virulent lineage.

To determine if ST32 strains share increased virulence, groups of 3-4 mice were inoculated with different doses of strain S308 and were monitored for survival (see criterion for strain selection in the materials and methods) (Fig 3.5). While 0% of the mice survived an inoculation of 1 x 105 CFU, 100% survived an inoculation with 5 x 104 CFU suggesting that the

4 4 LD50 is approximately 7.5 x 10 CFU (Fig 3.5), similar to that of strain 1289 (5 x 10 CFU) and

83 approximately 40-fold lower than that of strain RB50 (3 x 106 CFU) (Fig 3.1A, 3.1B, 3.5). To determine if the TTSS contributed to the increased virulence of strain S308, we deleted the bscN

6 6 gene from this strain and determined the LD50. When inoculated with 3 x 10 or 1 x 10 CFU of

S308ΔbscN, 0% and 100% of the mice survived the infection respectively (Fig 3.5). Therefore,

6 the LD50 of this strain is approximately 2 x 10 CFU, which is 27-fold higher than its parental wild-type strain (Fig 3.5). These data indicate that the TTSS contributes more to the virulence of strain S308 than to strain RB50 (Fig 3.5, 3.3B). Similar to strain 1289 bscN, the LD50 of

S308∆bscN is lower than RB50∆bscN, which suggests that another factor besides the TTSS also contributes to the increased virulence of strain S308. Together, these data suggest that the increased virulence of ST32 strains is partly dependent on the TTSS.

To determine if other strains closely related to ST32 are more virulent than strain RB50, we also analyzed strain 448 from ST23 (see criterion for strain selection in the materials and

6 methods) (Fig 3.4). The LD50 of strain 448 was approximately 1 x 10 CFU, 3-fold lower than strain RB50, and bacterial load in the lung was higher than strain RB50 over the course of the infection (data not shown, Appendix J) suggesting that strains closely related to ST32 are also more virulent than strain RB50.

84

Discussion:

The symptoms of a B. bronchiseptica infection can range from long-term asymptomatic carriage in the upper respiratory tract to fatal pneumonia (18). While previous studies have correlated differences in virulence or severity of disease to particular bacterial factors (5, 39, 46), few studies have shown that these factors actually contribute to the virulence of particular lineages (4). Here, we identify a bacterial factor that contributes to the increased virulence of a

B. bronchiseptica lineage by combining comparative genomic analyses, bacterial mutagenesis, phylogenetics and a host infection model. B. bronchiseptica strain RB50, which was isolated from asymptomatically infected host, was less virulent than strain 1289 which was isolated from a severely diseased host (Fig 3.1, Appendix G) (8). Transcriptome analysis revealed that TTSS- related genes were more highly expressed in strain 1289 compared to strain RB50 (Fig 3.2).

Using allelic exchange, we determined that the TTSS causes more rapid cytotoxicity to macrophages and contributes more to the virulence of strain 1289 than strain RB50 (Fig 3.3).

The TTSS also contributes to the increased virulence of another strain belonging to the same ST as strain 1289 (Fig 3.4, 3.5). Combined, these data suggest that the TTSS contributes to the increased virulence of a B. bronchiseptica lineage.

The amount of genomic content shared between strains of a single microbial species can vary substantially (30). The ‘core genome’ represents all genes shared between strains of the same species, while the ‘flexible genome’ are those genes that are variably present. The ‘flexible genome’ is thought to contribute to differences in virulence, host range and/or environmental niches of different strains. Recently, Cummings et.al. proposed an analogous distinction to describe those genes similarly expressed (the core regulon) or differentially expressed (the flexible regulon) between strains as not all genes are similarly regulated by BvgAS between

85

Bordetella strains (10). The TTSS appears to be part of the ‘flexible regulon’ as some B. pertussis strains express the TTSS while others do not (14, 61). The work described herein provides evidence that the TTSS is also part of the ‘flexible regulon’ of B. bronchiseptica as strains of this species differentially express TTSS-related genes (Fig 3.2). While nearly all known TTSS-related genes were upregulated in strain 1289 as compared to strain RB50, the genes encoding the master regulator of the TTSS, bvgAS, were not differentially expressed.

Since the TTSS is controlled by a complex, multi-layered, trans-regulatory gene network (34,

61), we propose that the increased expression of a yet unidentified, Bvg-activated activator or decreased expression of a Bvg-activated repressor may contribute to the differential expression of the TTSS between strains. This regulator may be one of the 23 upregulated or 51 downregulated transcriptional regulators identified in strain 1289.

Since 1289 bscN and S308 bscN are more virulent than RB50 bscN, we conclude that the TTSS is not the only factor that contributes to the increased virulence of ST32 strains.

Virulence may also be modified by novel acquired genes via phage or horizontal gene transfer, loss of hypovirulence genes, or mutation (15, 16). Many phage-related genes present in strain

RB50 were identified as absent in strain 1289. However, another study of ours showed that a B. bronchiseptica strain lacking these prophage genes is less virulent than strain RB50, making it unlikely that the lack of these genes contributes to the increased virulence of strain 1289 (5). A few known virulence related genes and many genes with unknown function were identified as differentially expressed or divergent between these strains. These genes may also contribute to the increased virulence of strain 1289 as compared to strain RB50. Differences in gene expression over the course of infection or a gain of novel, strain 1289-specific genes, both of which would not be detected in our analyses, may also contribute to the increased virulence of

86 strain 1289. Novel genes will be identified and their role in virulence can be accessed upon completion of full genome sequencing of strain 1289 (in progress, A.M. Buboltz, X. Zhang, S.C.

Schüster, E.T. Harvill et.al., unpublished data).

The most widely accepted view of virulence evolution assumes that there is a cost-benefit trade-off to virulence, defined here as any reduction in host fitness following infection (2, 12,

44). Under this framework, evolutionary processes that lead to the maintenance of harmful effects are thought to be characterized by the presence of other beneficial qualities (12). Thus, a fitness-decreasing change in one trait is accompanied by a fitness-increasing change in a different trait (12). The ST32 strains described herein appear to be quite successful as they have been isolated from three separate continents (South America, Europe and the United States)

(Appendix A) (59). Here, we show that ST32 strains appear to be associated severe disease and exhibit increased TTSS-mediated virulence, a potential cost in terms of increased host mortality at a given dose. The TTSS can also increase colonization and persistence of B. bronchiseptica in the lungs of mice (43, 61), which may help maximize transmission and allow for the selection and maintenance of these highly virulent ST32 strains. Thus, the fitness enhancement caused by increased TTSS-mediated effects may be accompanied by the unavoidable side-effect of increased virulence (44).

A high degree of clonal diversity appears to exist among B. bronchiseptica strains (3, 17,

19, 31, 36, 46). Recently, we reported that strains belonging to ST27 and ST40, which were collected from a wide geographical area, are hypovirulent and have lost the genes encoding adenylate cyclase toxin, which was previously believed to be among the few core factors required for the success of the classical bordetellae (5). Here, we report that strains belonging to

ST32, also collected from a broad range of geographies, are hypervirulent due to increased

87

TTSS-mediated effects. Combined, these studies support the conclusion that phylogenetic lineages of B. bronchiseptica differentially regulate and utilize distinct sets of virulence factors which can relate to the overall virulence of these STs. This versatility may contribute to the wide variety in severity of disease observed upon B. bronchiseptica infection and to the ability to persist in a broad range of host populations.

88

Authors and Contributions:

Anne M. Buboltz1,2 , Tracy L. Nicholson3 , Laura S. Weyrich1,2 , Eric T. Harvill1*

1 Department of Veterinary and Biomedical Sciences, The Pennsylvania State University,

115 Henning Building, University Park, PA 16802

2 Graduate Program in Biochemistry, Microbiology, and Molecular Biology, The

Pennsylvania State University, 108 Althouse Building, University Park, PA 16802

3 Respiratory Diseases of Livestock Research Unit; National Animal Disease Center,

Agricultural Research Service, USDA, Ames, Iowa.

Conceived and designed the experiments: AMB, TLN, ETH. Performed the experiments: AMB,

TLN, LSW. Analyzed the data: AMB, TLN. Wrote the paper: AMB, ETH.

89

References:

1. Akerley, B. J., P. A. Cotter, and J. F. Miller. 1995. Ectopic expression of the flagellar

regulon alters development of the Bordetella-host interaction. Cell 80:611-20.

2. Anderson, R. M., and R. M. May. 1982. Coevolution of hosts and parasites.

Parasitology 85 (Pt 2):411-26.

3. Bemis, D. A., H. A. Greisen, and M. J. Appel. 1977. Bacteriological variation among

Bordetella bronchiseptica isolates from dogs and other species. J Clin Microbiol 5:471-

80.

4. Brockmeier, S. L., K. B. Register, T. Magyar, A. J. Lax, G. D. Pullinger, and R. A.

Kunkle. 2002. Role of the Dermonecrotic Toxin of Bordetella bronchiseptica in the

Pathogenesis of Respiratory Disease in Swine. Infect. Immun. 70:481-490.

5. Buboltz, A. M., T. L. Nicholson, M. R. Parette, S. E. Hester, J. Parkhill, and E. T.

Harvill. 2008. Replacement of Adenylate Cyclase Toxin in a Lineage of Bordetella

bronchiseptica. J. Bacteriol.:JB.00226-08.

6. Burns, V. C., E. J. Pishko, A. Preston, D. J. Maskell, and E. T. Harvill. 2003. Role of

Bordetella O antigen in respiratory tract infection. Infect Immun 71:86-94.

7. Cotter, P. A., and A. M. Jones. 2003. Phosphorelay control of virulence gene

expression in Bordetella. Trends Microbiol 11:367-73.

8. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of

phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect

Immun 62:3381-90.

90

9. Cotter, P. A., M. H. Yuk, S. Mattoo, B. J. Akerley, J. Boschwitz, D. A. Relman, and

J. F. Miller. 1998. Filamentous hemagglutinin of Bordetella bronchiseptica is required

for efficient establishment of tracheal colonization. Infect Immun 66:5921-9.

10. Cummings, C. A., H. J. Bootsma, D. A. Relman, and J. F. Miller. 2006. Species- and

strain-specific control of a complex, flexible regulon by Bordetella BvgAS. J Bacteriol

188:1775-85.

11. Diavatopoulos, D. A., C. A. Cummings, L. M. Schouls, M. M. Brinig, D. A. Relman,

and F. R. Mooi. 2005. Bordetella pertussis, the causative agent of whooping cough,

evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog

1:e45.

12. Ebert, D., and E. A. Herre. 1996. The evolution of parasitic diseases. Parasitology

Today 12:96-101.

13. Elder, K. D., and E. T. Harvill. 2004. Strain-dependent role of BrkA during Bordetella

pertussis infection of the murine respiratory tract. Infect Immun 72:5919-24.

14. Fennelly, N. K., F. Sisti, S. C. Higgins, P. J. Ross, H. van der Heide, F. R. Mooi, A.

Boyd, and K. H. G. Mills. 2008. Bordetella pertussis Expresses a Functional Type III

Secretion System That Subverts Protective Innate and Adaptive Immune Responses.

Infect. Immun. 76:1257-1266.

15. Fitzgerald, J. R., and J. M. Musser. 2001. Evolutionary genomics of pathogenic

bacteria. Trends in Microbiology 9:547-553.

16. Foreman-Wykert, A. K., and J. F. Miller. 2003. Hypervirulence and pathogen fitness.

Trends in Microbiology 11:105-108.

91

17. Giardina, P. C., L. A. Foster, J. M. Musser, B. J. Akerley, J. F. Miller, and D. W.

Dyer. 1995. bvg Repression of alcaligin synthesis in Bordetella bronchiseptica is

associated with phylogenetic lineage. J. Bacteriol. 177:6058-6063.

18. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol Rev 44:722-38.

19. Gueirard, P., and N. Guiso. 1993. Virulence of Bordetella bronchiseptica: role of

adenylate cyclase-hemolysin. Infect Immun 61:4072-8.

20. Gueirard, P., C. Weber, A. Le Coustumier, and N. Guiso. 1995. Human Bordetella

bronchiseptica infection related to contact with infected animals: persistence of bacteria

in host. J Clin Microbiol 33:2002-6.

21. Harvill, E. T., P. A. Cotter, M. H. Yuk, and J. F. Miller. 1999. Probing the function of

Bordetella bronchiseptica adenylate cyclase toxin by manipulating host immunity. Infect

Immun 67:1493-500.

22. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller.

2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract

infection. Infect Immun 68:6720-8.

23. Jolley, K. A., M. S. Chan, and M. C. Maiden. 2004. mlstdbNet - distributed multi-locus

sequence typing (MLST) databases. BMC Bioinformatics 5:86.

24. Julio, S. M., and P. A. Cotter. 2005. Characterization of the filamentous hemagglutinin-

like protein FhaS in Bordetella bronchiseptica. Infect Immun 73:4960-71.

25. Kirimanjeswara, G. S., L. M. Agosto, M. J. Kennett, O. N. Bjornstad, and E. T.

Harvill. 2005. Pertussis toxin inhibits neutrophil recruitment to delay antibody-mediated

clearance of Bordetella pertussis. J Clin Invest 115:3594-601.

92

26. Kirimanjeswara, G. S., P. B. Mann, M. Pilione, M. J. Kennett, and E. T. Harvill.

2005. The complex mechanism of antibody-mediated clearance of Bordetella from the

lungs requires TLR4. J Immunol 175:7504-11.

27. Kubori, T., A. Sukhan, S. I. Aizawa, and J. E. Galan. 2000. Molecular

characterization and assembly of the needle complex of the Salmonella typhimurium type

III protein secretion system. Proc Natl Acad Sci U S A 97:10225-30.

28. Kuwae, A., T. Matsuzawa, N. Ishikawa, H. Abe, T. Nonaka, H. Fukuda, S. Imajoh-

Ohmi, and A. Abe. 2006. BopC Is a Novel Type III Effector Secreted by Bordetella

bronchiseptica and Has a Critical Role in Type III-dependent Necrotic Cell Death. J.

Biol. Chem. 281:6589-6600.

29. Kuwae, A., M. Ohishi, M. Watanabe, M. Nagai, and A. Abe. 2003. BopB is a type III

secreted protein in Bordetella bronchiseptica and is required for cytotoxicity against

cultured mammalian cells. Cellular Microbiology 5:973-983.

30. Lan, R., and P. R. Reeves. 2000. Intraspecies variation in bacterial genomes: the need

for a species genome concept. Trends Microbiol 8:396-401.

31. Le Blay, K., P. Gueirard, N. Guiso, and R. Chaby. 1997. Antigenic polymorphism of

the lipopolysaccharides from human and animal isolates of Bordetella bronchiseptica.

Microbiology 143 ( Pt 4):1433-41.

32. Mann, P. B., K. D. Elder, M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4-

dependent early elicited tumor necrosis factor alpha expression is critical for innate host

defense against Bordetella bronchiseptica. Infect Immun 72:6650-8.

93

33. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical

manifestations of respiratory infections due to Bordetella pertussis and other Bordetella

subspecies. Clin Microbiol Rev 18:326-82.

34. Mattoo, S., M. H. Yuk, L. L. Huang, and J. F. Miller. 2004. Regulation of type III

secretion in Bordetella. Mol Microbiol 52:1201-14.

35. Melton, A. R., and A. A. Weiss. 1989. Environmental regulation of expression of

virulence determinants in Bordetella pertussis. J Bacteriol 171:6206-12.

36. Musser, J. M., D. A. Bemis, H. Ishikawa, and R. K. Selander. 1987. Clonal diversity

and host distribution in Bordetella bronchiseptica. J Bacteriol 169:2793-803.

37. Musser, J. M., E. L. Hewlett, M. S. Peppler, and R. K. Selander. 1986. Genetic

diversity and relationships in populations of Bordetella spp. J Bacteriol 166:230-7.

38. Nicholson, T. L. 2007. Construction and validation of a first-generation Bordetella

bronchiseptica long-oligonulceotide microarray by transcriptional profiling the Bvg

regulon. BMC Genomics 8:220.

39. Novotny, P., A. P. Chubb, K. Cownley, and J. A. Montaraz. 1985. Adenylate cyclase

activity of a 68,000-molecular-weight protein isolated from the outer membrane of

Bordetella bronchiseptica. Infect Immun 50:199-206.

40. Panina, E. M., S. Mattoo, N. Griffith, N. A. Kozak, M. H. Yuk, and J. F. Miller.

2005. A genome-wide screen identifies a Bordetella type III secretion effector and

candidate effectors in other species. Mol Microbiol 58:267-79.

41. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M.

T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga,

L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D.

94

Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis,

J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S.

Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E.

Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M.

Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead,

B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences

of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet

35:32-40.

42. Pilione, M. R., L. M. Agosto, M. J. Kennett, and E. T. Harvill. 2006. CD11b is

required for the resolution of inflammation induced by Bordetella bronchiseptica

respiratory infection. Cell Microbiol 8:758-68.

43. Pilione, M. R., and E. T. Harvill. 2006. The Bordetella bronchiseptica type III secretion

system inhibits gamma interferon production that is required for efficient antibody-

mediated bacterial clearance. Infect Immun 74:1043-9.

44. Read, A. F. 1994. The evolution of virulence. Trends in Microbiology 2:73-76.

45. Reid, S. D., C. J. Herbelin, A. C. Bumbaugh, R. K. Selander, and T. S. Whittam.

2000. Parallel evolution of virulence in pathogenic Escherichia coli. Nature 406:64-67.

46. Roop, R. M., 2nd, H. P. Veit, R. J. Sinsky, S. P. Veit, E. L. Hewlett, and E. T.

Kornegay. 1987. Virulence factors of Bordetella bronchiseptica associated with the

production of infectious atrophic rhinitis and pneumonia in experimentally infected

neonatal swine. Infect Immun 55:217-22.

47. Saeed, A. I., V. Sharov, J. White, J. Li, W. Liang, N. Bhagabati, J. Braisted, M.

Klapa, T. Currier, M. Thiagarajan, A. Sturn, M. Snuffin, A. Rezantsev, D. Popov,

95

A. Ryltsov, E. Kostukovich, I. Borisovsky, Z. Liu, A. Vinsavich, V. Trush, and J.

Quackenbush. 2003. TM4: a free, open-source system for microarray data management

and analysis. Biotechniques 34:374-8.

48. Saeij, J. P. J., J. P. Boyle, S. Coller, S. Taylor, L. D. Sibley, E. T. Brooke-Powell, J.

W. Ajioka, and J. C. Boothroyd. 2006. Polymorphic Secreted Kinases Are Key

Virulence Factors in Toxoplasmosis. Science 314:1780-1783.

49. Schoen, C., J. Blom, H. Claus, A. Schramm-Gluck, P. Brandt, T. Muller, A.

Goesmann, B. Joseph, S. Konietzny, O. Kurzai, C. Schmitt, T. Friedrich, B. Linke,

U. Vogel, and M. Frosch. 2008. Whole-genome comparison of disease and carriage

strains provides insights into virulence evolution in Neisseria meningitidis. Proceedings

of the National Academy of Sciences 105:3473-3478.

50. Sitkiewicz, I., M. J. Nagiec, P. Sumby, S. D. Butler, C. Cywes-Bentley, and J. M.

Musser. 2006. Emergence of a bacterial clone with enhanced virulence by acquisition of

a phage encoding a secreted phospholipase A2. Proceedings of the National Academy of

Sciences 103:16009-16014.

51. Stibitz, S., W. Aaronson, D. Monack, and S. Falkow. 1989. Phase variation in

Bordetella pertussis by frameshift mutation in a gene for a novel two-component system.

Nature 338:266-9.

52. Stibitz, S., W. Aaronson, D. Monack, and S. Falkow. 1988. The vir locus and phase-

variation in Bordetella pertussis. Tokai J Exp Clin Med 13 Suppl:223-6.

53. Stibitz, S., and N. H. Carbonetti. 1994. Hfr mapping of mutations in Bordetella

pertussis that define a genetic locus involved in virulence gene regulation. J Bacteriol

176:7260-6.

96

54. Sukumar, N., M. Mishra, G. P. Sloan, T. Ogi, and R. Deora. 2007. Differential Bvg

Phase-Dependent Regulation and Combinatorial Role in Pathogenesis of Two Bordetella

Paralogs, BipA and BcfA. J. Bacteriol. 189:3695-3704.

55. Sumby, P., A. R. Whitney, E. A. Graviss, F. R. DeLeo, and J. M. Musser. 2006.

Genome-Wide Analysis of Group A Streptococci Reveals a Mutation That Modulates

Global Phenotype and Disease Specificity. PLoS Pathogens 2:e5.

56. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular

Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596-9.

57. Taylor, S., A. Barragan, C. Su, B. Fux, S. J. Fentress, K. Tang, W. L. Beatty, H. E.

Hajj, M. Jerome, M. S. Behnke, M. White, J. C. Wootton, and L. D. Sibley. 2006. A

Secreted Serine-Threonine Kinase Determines Virulence in the Eukaryotic Pathogen

Toxoplasma gondii. Science 314:1776-1780.

58. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microarrays

applied to the ionizing radiation response. PNAS 98:5116-5121.

59. van der Zee, A., F. Mooi, J. Van Embden, and J. Musser. 1997. Molecular evolution

and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme

electrophoresis and typing with three insertion sequences. J Bacteriol 179:6609-17.

60. Yuk, M. H., E. T. Harvill, P. A. Cotter, and J. F. Miller. 2000. Modulation of host

immune responses, induction of apoptosis and inhibition of NF-kappaB activation by the

Bordetella type III secretion system. Mol Microbiol 35:991-1004.

61. Yuk, M. H., E. T. Harvill, and J. F. Miller. 1998. The BvgAS virulence control system

regulates type III secretion in Bordetella bronchiseptica. Mol Microbiol 28:945-59.

97

Chapter 4:

Recombination of O-Antigen loci in Bordetella bronchiseptica aids in

evasion of cross-immunity.

98

Abstract:

Antigenic variation is one mechanism pathogens use to avoid immune-mediated competition between closely related strains. Here, we show that two Bordetella bronchiseptica strains, RB50 and 1289, express two antigenically distinct O-antigen serotypes (O1 and O2, respectively). When 18 additional B. bronchiseptica strains were serotyped, all were found to express either the O1 or O2 serotype. Comparative genomic hybridization (CGH) and PCR screening showed that the expression of either the O1 or O2 serotype correlated with the strain containing either the classical or alternative O-antigen locus, respectively. Multi-locus sequence typing (MLST) analysis of 49 B. bronchiseptica strains was used to build a phylogenetic tree, which revealed that the two O-antigen loci did not associate with a particular lineage. This is the first evidence of homologous recombination of an antigenic locus between Bordetella strains.

From experiments using mice vaccinated with purified LPS from strain RB50 (O1), 1289 (O2) or

RB50Δwbm (O-antigen deficient), our data indicate that there is a lack of cross protection among

LPS vaccines containing different O-antigens. The lack of cross-reaction between O-antigen serotypes also appears to aid in the evasion of antibody-mediated clearance between strains. Our data are consistent with the idea that the O-antigen serotypes of B. bronchiseptica are encoded by separate O-antigen loci that are laterally transferred and aid in the evasion of cross-immunity between strains.

99

Introduction:

While the genetic structure of some pathogens is highly clonal with low levels of recombination, others can undergo such high levels of recombination that the signal for linkage disequilibrium can be lost (1). The point at which a pathogen lies in this spectrum is thought to be due to a balance between mechanisms that reduce diversity, such as within-host competition between strains, and those that drive variation, such as recombination (11, 16, 18, 27). Immune- mediated competition maintains genetic diversity of pathogens by selecting for strains that escape host-immunity via antigenic variation (10, 16).

One of the most commonly studied examples of antigenic variation in bacteria is O- antigen, a highly variable membrane-distal region of lipopolysaccharide (LPS) that is known for protecting gram-negative bacteria from complement-mediated killing and the bactericidal effects of antimicrobial peptides (12, 31, 41). Upon infection, O-antigens induce a robust antibody response, the specificity of which can be used to group microorganisms into serotypes (41).

Genetically distinct O-antigen loci have been observed to recombine between strains or species, and more than 100 serotypes can exist in some species (14, 30, 40-42). The presence of strains with different O-antigen serotypes is thought to allow escape from infection by phage. It can also allow escape from cross-immunity, which can lead to the coexistence of closely-related strains that circulate in the same host population, as has been observed with Vibrio cholera, typhodal Salmonella and the human-adapted Bordetella species (5, 21, 24, 28).

The genus Bordetella includes a group of closely related respiratory pathogens that cause a variety of diseases in broad-range of animals (B. bronchiseptica) and whooping cough in humans (B. pertussis and B. parapertussis). In Bordetella, it has been determined that the lpx, waa, wlb and wbm loci encode the lipid A, the inner core, the trisaccharide and the O-antigen

100 regions of LPS, respectively (34, 36). While many of these LPS related genes are shared between these species, there are species-specific differences. For example, the lipid A acylation patterns differ between these species despite nearly identical lpx genes and the trisaccharide is not synthesized by B. parapertussis likely due to a point mutation in the wlb locus (2, 34).

Additionally, while B. bronchiseptica and B. parapertussis express an O-antigen, the wbm locus has been deleted from B. pertussis, which results in a lack of O-antigen synthesis (34, 36). The

O-antigens of B. bronchiseptica and B. parapertussis are highly antigenic (45, 46), increase their resistance to complement-mediated killing (7, 12) and the ability of these species to colonize the lower respiratory tract of mice (7, 12).

The O-antigen locus contains 24 genes and spans more than 29kB in both B. bronchiseptica and B. parapertussis (34, 36). The first 14 genes, wbmA-N, are nearly identical between species and are thought to be involved in the synthesis of the O-antigen polymer, its linkage to the trisaccharide or core region, and O-antigen export (34, 36, 38). The last 3 genes,

BB0121-BB0123, are also nearly identical and are, therefore, proposed to be involved in the synthesis of some common structure (34, 36, 38). Between these two highly conserved regions, there are 7 genes, which are either weakly conserved or locus-specific, indicating that these genes comprise two different alleles and are thought to synthesize type-specific modifications

(34, 36, 38). More specifically, while B. bronchiseptica strain RB50 contains the classical wbm genes (wbmO, R, S and BB0124-BB0127), B. parapertussis strain 12822 and B. bronchiseptica strain CN7635E contain the alternative O-antigen genes (wbmO, P, Q, R, S, T, U) (34, 36).

While only the alternative locus has been found in B. parapertussis, B. bronchiseptica strains can harbor either the classical or alternative locus (9, 34, 36), which has led to the hypothesis that different O-antigen loci cause differences in structure and antigenicity between B. bronchiseptica

101 strains (34). While it has not been determined if O-Antigen serotype correlates with locus type, the presence of the classical or alternative locus correlates with the ala-type or lac-type modification on the non-reducing, terminal sugar residue of O-antigen, respectively (25, 34, 39) and these modifications correspond to different reactivites of the O-antigen to monoclonal and polyclonal antibodies (25, 44) (Preston, unpublished data).

While the maintenance of different O-antigen loci, structures and serotypes in B. bronchiseptica likely has important epidemiological consequences, the molecular evolution of these O-antigen loci and their role in evading cross-immunity in an experimental model of infection has not been examined. Here, we use a broad-range of approaches to shed light on these questions. We determine that nearly all B. bronchiseptica strains express one of two O- antigen serotypes that are not cross-reactive, which correlates with the presence of either the classical or alternative O-antigen locus. Using comparative genomic hybridization (CGH) and multi-locus sequence typing (MLST), we show that the presence of these loci does not correlate with a particular phylogenetic lineage suggesting that they recombine between B. bronchiseptica strains. Additionally, the O-antigen from these strains do not induce cross-protective immunity and this aids in the evasion of cross-reactive antibody responses in a murine model of infection.

Our data are consistent with the idea that the O-antigen serotypes of B. bronchiseptica are encoded by separate O-antigen loci that recombine and aid in the evasion of cross-immunity between strains. We discuss the importance of this work in terms of the maintenance of pathogen strain structure and epidemiological consequences.

102

Materials and Methods:

Bacterial Strains, Growth and LPS preparation. All wild-type B. bronchiseptica isolates, sources, locations, dates, anatomical site of isolation, reference and all available health and necropsy reports have been previously described (6, 8, 9) (Buboltz A.M., Nicholson T.L.,

Weyrich L.S., Harvill E.T., submitted for publication) (Appendix A). Strain RB50 wbm is an isogenic mutant of strain RB50 that lacks wbmB to wbmD and the N-terminal half of wbmE and has been previously described (7, 37). All strains were maintained on Bordet-Gengou (BG) agar

(Difco, Sparks, MD) containing 10% sheep’s blood (Hema Resources, Aurora, OR) with

20ug/mL streptomycin (Sigma, St. Louis, MO). LPS was purified from strains RB50, 1289 and

RB50Δwbm as previously described (19) using a modification of the method of Hitchcock and

Brown (3, 20).

Western Blots. Western blots were performed essentially as previously described (6, 46).

Briefly, B. bronchiseptica strains were grown to logarithmic phase in Stainer-Scholte (SS) broth.

1 x 108 CFU of the indicated strain was treated with Laemmli sample buffer (26) and run on 10%

SDS-PAGE and protein was transferred to a polyvinylidene diflouride (PVDF) membrane

(Millipore, Bedford, MA). Membranes were probed with convalescent serum from RB50- or

1289- inoculated mice (1:1,000 dilution) and goat anti-mouse (Ig H+L) HRP-conjugated

(1:10,000) (Southern Biotech, Birmingham, AL). All membranes were visualized with ECL western blotting detection reagents (Amersham Biosciences, Piscataway, NJ).

ELISAs. ELISA experiments were carried out essentially as previously described (32, 45).

Whole-cell bacteria or purified LPS from the indicated strains were diluted to 7 x 106 CFU/mL or 50 µg/mL in a 1:1 mix of 0.2M sodium carbonate and 0.2M sodium bicarbonate buffers, respectively. These antigens were added to each well of a 96-well plate, and incubated for 1 h at

103

37°C in a humidified chamber. A 1:50 dilution of each serum sample was added to the first well and serially diluted across the plates. After another incubation period, the plates were washed and goat anti-mouse (Ig H+L) HRP-conjugated (1:10,000 dilution) was added. After another incubation period, plates were washed and 2,2'-azino-bis(3-ethylbenz-thiazoline-6-sulfonic acid) in a phospho-citrate buffer and hydrogen peroxide were added to wells and incubated for 30 min at room temperature in the dark and read on a plate reader at 405 nm. The titer was calculated using an end-point, slope-adapted method by comparison to similarly treated naïve serum.

Statistical significance in titer between bacterial strains or purified LPS was calculated by using an ANOVA and Tukey simultaneous test in Minitab (v. 13.30, Minitab Inc.). A P-value of <

0.05 was used for all experiments.

Comparative genomic hybridization and statistical analysis. CGH analysis on strains RB50,

1289 and 253 have been previously described (6) (Buboltz A.M., Nicholson T.L., Weyrich L.S.,

Harvill E.T., submitted for publication). Briefly, strains RB50, 1289 and 253 were grown in SS broth, genomic DNA was isolated using a DNA extraction kit (Qiagen, Valencia, CA) and digested with DpnII. For each labeling reaction, 2 g of digested genomic DNA was randomly primed using Cy-5 and Cy-3 dye-labeled nucleotides, with BioPrime DNA labeling kits

(Invitrogen, Carlsbad, CA) and the two differentially labeled reactions to be compared were combined and hybridized to a B. bronchiseptica RB50 specific long-oligonucleotide microarray

(6, 33). Dye-swap experiments were performed. Statistical analysis of CGH data was performed with SAS software 9.1.3 (SAS Institute, Inc., Cary, NC). Regions of difference (RDs), meaning

RB50 genes that are either divergent or absent from the query strains, were identified using a

MODECLUS procedure (PROC MODECLUS) based on nonparametric density estimation. All genes are labeled as annotated in the RB50 genome (34). All CGH data have been deposited in

104

MIAMExpress under the accession numbers E-MEXP-1737 and E-MEXP-1205 and have been previously described (6) (Buboltz A.M., Nicholson T.L., Weyrich L.S., Harvill E.T., submitted for publication).

PCR. Genomic DNA was extracted from the indicated strains as described and were screened for the classical wbm genes (F-catgggtcgacgatttcaggaatgatgg, R-gagactagccaggagatttatcatccgc, product size = 728 bp, internal to BB0127 from NC_002927), alternative wbm genes (F- cgatgtcgatgattttcggtcgcttg, R- cgagcacgcatgctctttatatgg, product size = 801 bp, internal to

BPP0127/wbmR from NC_002928) and a housekeeping gene, adk (F-agccgcctttctcacccaacact, R- tgggcccaggacgagtagt, product size = 513bp, internal to BB2005) (Appendix B) (9, 34). The same

PCR conditions were used for all primer sets: 95ºC 5 min, 30X (95ºC 30sec, 58ºC 30sec, 72ºC

1min), 72ºC 5 min.

MLST and phylogenetic tree construction. All data regarding MLST analysis have been previously described (6, 9) (Buboltz A.M., Nicholson T.L., Weyrich L.S., Harvill E.T., submitted for publication) (Appendix B). Using MEGA 4.0 (43), the 7 alleles sequenced from each strain were concatenated, aligned and a Neighbor-Joining tree with 1,000 bootstraps using the K2 model was constructed for the indicated strains.

Animal Care, inoculation, vaccination and adoptive transfer protocols. 4 to 6 week old

C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME), were bred and maintained in our specific pathogen and Bordetella-free rooms at the Pennsylvania State

University. For inoculation, bacteria were grown overnight at 37ºC in SS broth to mid- logarithmic phase, bacterial density was measured by optical density read at 600nm (OD600) and diluted in sterile phosphate buffered saline (PBS, Omnipur, Gibbstown, NJ) to the appropriate concentration. Inocula were confirmed by plating dilutions on BG agar and counting the

105 resulting colonies after 2 days of incubation at 37°C as previously described (22, 23). For inoculation, mice were lightly sedated with 5% isofluorane (IsoFlo; Abbott Laboratories) in oxygen and 104 CFU in 50µL of PBS of the appropriate B. bronchiseptica strain was gently pipetted onto the external nares as previously described (22, 23). Bacterial load was determined by homogenizing the lung in 1mL of PBS, diluting to the appropriate concentration and plating aliquots. Two days later, the resulting colonies were counted (23). For vaccination studies, animals were immunized twice at 2-week intervals with 220µL i.p. injections containing 10µg of the indicated LPS + Imject Alum adjuvant (Thermo Scientific, Rockford, IL). One week after the last i.p. injection, mice received 50µL containing 1µg of the indicated LPS intranasally. One week after the intranasal vaccination, animals were challenged intranasally as described and sacrificed on day 3 post-challenge for determination of colonization levels. For adoptive transfer of serum, an intraperitoneal injection of 200 µl of convalescent-phase serum, obtained on day 28 post-inoculation from mice that were inoculated with either strain RB50, 1289 or RB50 wbm, into naive mice was immediately followed by inoculation with the appropriate bacterial strain.

The mean +/- standard error was determined for each treatment group. Statistical significance in bacterial load between strains was calculated by using an ANOVA and Tukey simultaneous test in Minitab (v. 13.30, Minitab Inc.). A P-value of < 0.05 was used for all experiments. All animal experiments were repeated at least twice with similar results. All experiments were completed in accordance with institutional guidelines.

106

Results:

Bordetella bronchiseptica strains express antigenically distinct O-antigen serotypes.

When convalescent sera collected from wild-type mice inoculated with either B. bronchiseptica strain RB50 or 1289 were used to probe strains RB50, 1289 and RB50∆wbm (an isogenic mutant of RB50 lacking O-antigen expression) (36) in western blot analysis (Fig 4.1A), we observed that these antibodies were not equally reactive to each strain. While strain RB50- induced sera recognized several antigens common to strains RB50, 1289 and RB50∆wbm, antibodies in this sera also recognized a broad smear of antigens (most prominent between 15-37

Figure 4.1: Recognition of B. bronchiseptica strains RB50 and 1289 using antibodies from convalescent- phase serum by western blot and ELISA. Western blots of B. bronchiseptica strain RB50-induced (A and C) and strain 1289-induced (B and D) sera were used to determine if antibodies raised against one strain recognized specific antigens of strains RB50 , 1289 and RB50Δwbm (A and B) or purified LPS from strains RB50 and 1289 (C and D). The numbers next to each western blot indicate molecular weight (kDa). ELISA was performed on RB50- (black), 1289- (dark grey) or RB50Δwbm- (light grey) induced serum to quantify titers of antibodies specific for strains RB50, 1289 or RB50Δwbm (E) or purified LPS from strains RB50, 1289 or RB50Δwbm (F). The dashed line represents the lower limit of detection.

107 kDa) present in strain RB50 but not strain RB50∆wbm (Fig 4.1A), which confirms previous reports showing that this smear is O-antigen (46). The O-antigen smear is also absent in the lysate of strain 1289 which suggests that this strain either does not express O-antigen or expresses an antigenically distinct O-antigen serotype (Fig 4.1A). To distinguish between these possibilities, we probed the same lysates with convalescent sera from mice infected with strain

1289. While an O-antigen smear was observed in the 1289 lysate, it was absent in both the

RB50 and RB50∆wbm lysates (Fig 4.1B). When lysates of strains RB50, 1289 and RB50∆wbm were probed with naïve sera, no bands of recognition appeared on the western blot confirming that there was no non-specific binding of antibodies (data not shown). Additionally, when these lysates were probed with RB50∆wbm-induced sera, the smear between 15-37 kDa did not appear suggesting that this smear is in fact antibody recognition of O-antigen (data not shown). Similar results were obtained when purified LPS from strains RB50Δwbm, RB50 or 1289 were probed with RB50- or 1289-induced sera (Fig 4.1C, D). Together, these data suggest that B. bronchiseptica strains RB50 and 1289 express two antigenically distinct O-antigen serotypes.

To quantify the cross-reactivity of antibodies to these B. bronchiseptica strains, we performed ELISA analysis using convalescent sera from RB50, 1289 and RB50∆wbm infections.

While all these sera recognized whole-cell RB50-antigen, the recognition of this antigen by

RB50-induced sera (titer 15,500) was approximately 20-30 fold higher than either the 1289-

(titer 550, P < 0.0001) or RB50∆wbm-induced sera (titer 400, P < 0.0001) (Fig 4.1E). When analyzed using 1289-antigen, all sera were cross-reactive but the recognition from 1289-induced antibodies (titer 19,700) was approximately 10-20 fold higher than either the RB50- (titer 2,500,

P <0.0001) or RB50∆wbm-induced sera (titer 1,000, P < 0.0001) (Fig 4.1E). When these sera were analyzed using RB50∆wbm as the antigen, the difference in antibody recognition between

108

Figure 4.2: Determination of O-Antigen serotype in 19 B. bronchiseptica strains using convalescent-phase serum by western blot. B. bronchiseptica strain RB50-induced and strain 1289-induced serum were used to determine if serum raised against one strain recognized antigens the same size as O-Antigen in whole cell lysates from the indicated strains. The numbers next to each western blot indicate molecular weight (kDa). strains RB50, 1289 and RB50∆wbm was abrogated (P > 0.3 for all comparisons) suggesting that the inefficient cross-reactivity of antibody responses between strains is caused by a difference in recognition of O-antigen. Similar results as those described for the whole-cell antigen were obtained when purified LPS from strain RB50, 1289 and RB50∆wbm were used as the antigen

(Fig 4.1F). Combined, these data suggest that inefficient cross-reactivity of antibody responses between B. bronchiseptica strains RB50 and 1289 is due to the presence of two antigenically distinct O-antigen serotypes.

To determine if these two O-antigen serotypes were common to other B. bronchiseptica strains, eighteen more strains were probed with either RB50- or 1289- induced sera using western blot analysis. Strains 305, 367, 381, 804, 806, 807, 851, 866, 1127 and 1128 all contain an O-antigen that was solely cross-reactive to RB50-induced sera (Fig 4.2). In contrast, strains

253, 336, 796, 801, 803, 891 and 1106 contain an O-antigen that was solely cross-reactive to

1289-induced sera (Fig 4.2). None of the strains analyzed contained O-antigens that were reactive to both RB50- or 1289-induced sera (Fig 4.2). Thus, of the nineteen B. bronchiseptica isolates analyzed here, only two O-antigen serotypes were identified. Together, these data

109 indicate that B. bronchiseptica strains express one of two O-antigen serotypes that are not cross- reactive, hereafter referred to as O1 (the RB50-like serotype) or O2 (the 1289-like serotype).

O-antigen serotype correlates with the classical or alternative wbm genes.

The expression of two antigenically distinct O-antigens led us to examine the genetic basis for this difference. Using comparative genomic hybridization (CGH) analysis, the divergence of genes involved in LPS-biosynthesis were compared between strains 1289 or 253

Figure 4.3: Comparative genomic hybridization and PCR analysis of LPS related-genes in B. bronchiseptica strains. (A) Comparison of LPS related-genes between strains RB50 and 1289 (black bars) or 253 (grey bars) using CGH analysis as previously described (6) (Buboltz A.M, Nicholson T.L., Weyrich L.S., Harvill E.T., submitted for publication). The x axis indicates the gene analyzed and the LPS structure with which it is associated. The y axis indicates the fold change in hybridization (FCH) for each gene. Negative fold or positive fold changes indicate decreased or increased hybridization of strain 1289 or 253 genomic DNA compared to strain RB50. Error bars represent +/- the standard error. The circles and stars on the x axis indicate genes identified as RDs between strains RB50 and 1289 or 253 respectively. (B) PCR screen for the presence of the classical wbm genes, the alternative wbm genes and adk in the indicated strains. A sample containing no DNA template was included to ensure the absence of DNA contamination.

110

(both O2 serotypes) and strain RB50 (O1 serotype) (6) (Buboltz A.M., Nicholson T.L., Weyrich

L.S., Harvill E.T., submitted for publication). Lipid A (lpxA, B, C, D, H, K and K), inner core

(waaA and C), trisaccharide (wlbA-JK and L), and the majority of O-antigen related genes

(wbmA-N) were not identified as RDs between strains RB50, 1289 and 253 (Fig 4.3A).

However, the most distal O-antigen related genes, wbmO-S and BB0123-BB0127, appeared to be more highly divergent than the other LPS-related genes between strains 1289 or 253 and strain

RB50 (Fig 4.3A). The identification of distal wbm genes as RDs suggests that either these genes are present but have a low degree of homology or they are absent in strains 1289 and 253.

Previously, B. bronchiseptica strains were shown to harbor either the classical (wbmO-R and BB0124-127) or alternative (wbmO-U) O-antigen locus (34, 36). Therefore, we hypothesized that strains expressing the O1 or O2 serotype would contain the classical or alternative O-antigen locus, respectively. To test this, strains expressing the O1 or O2 serotype were PCR screened for the presence of classical or alternative O-antigen genes and a housekeeping gene, adenylate kinase (adk) (9). adk could be PCR amplified from all 20 B. bronchiseptica strains analyzed (Fig 4.3B). The classical O-antigen gene, BB0127, could be

PCR amplified from strains RB50, 305, 367, 381, 804, 806, 807, 851, 866, 886, 1127 and 1128

(Fig 4.3B) which are all of the O1 serotype (Fig 4.2). The alternative O-antigen gene,

BPP0127/wbmR, could be PCR amplified from strains 1289, 253, 336, 796, 801, 803, 891 and

1106 (Fig 4.3B) which are all of the O2 serotype (Fig 4.1 and 4.2). Since strains 253 and 1289 are currently undergoing full-genome sequencing (6) (in progress, A.M. Buboltz, X. Zhang, S.C.

Schüster, E.T. Harvill et.al.), we compared their O-antigen loci to the fully sequenced alternative

O-antigen locus of B. parapertussis strain 12822 and found they were approximately 99% identical (data not shown). We did not identify a strain of the O1 serotype that contained the

111 alternative O-antigen genes or O2 serotype strains that contained the classical O-antigen genes

(Fig 4.3B). These data indicate that O1 strains contain the classical O-antigen genes, while O2 strains contain the alternative O-antigen genes.

O-antigen serotype does not correlate with phylogenetic relatedness.

In many gram-negative enteric bacteria, different loci encoding for an O-antigen are not associated with phylogenetic lineage, and therefore appear to be laterally transferred between strains or even species (21, 40). While enteric bacteria are known to coexist and transfer their O- antigen loci between strains, no previous evidence suggests that antigenic loci recombine between B. bronchiseptica strains. Therefore, we expected that the O-antigen loci would

Figure 4.4: Mapping the presence of the classical or alternative O-Antigen genes to ST in 49 B. bronchiseptica strains. A Neighbor-Joining tree with 1000 bootstraps based on concatenated MLST gene sequence of 49 B. bronchiseptica isolates. The identification number of each strain, the ST and the Complex to which each strain belongs are listed. Sequence types and complexes have been previously described (6, 9) (Buboltz A.M, Nicholson T.L., Weyrich L.S., Harvill E.T., submitted for publication). The highlighting indicates strains that contained either the classical (dark grey), alternative (light grey) or were PCR negative for either locus (no highlighting). The numbers on the tree branches indicate branch strength. All branch strengths below 50 were removed.

112 correlate with phylogenetic relatedness, which would indicate these loci do not recombine between strains. We completed MLST analysis and built a Neighbor-Joining tree containing 49

B. bronchiseptica strains (Fig 4.4). Each strain was PCR screened for the presence of either the classical or alternative O-antigen genes (Fig 4.4). Of the 49 strains analyzed, 19 strains contained the classical O-antigen genes, while 27 strains contained the alternative O-antigen genes (Fig 4.4). Three strains, all of which were Complex IV isolates, did not contain either the classical or alterative O-antigen genes (strains MO149, 309 and 755) (Fig 4.4). While the type of O-antigen locus did not vary within any ST, both the classical and alternative O-antigen genes were distributed throughout the tree (Fig 4.4). Combined, these data indicate that the classical and alternative O-antigen loci recombine among B. bronchiseptica strains.

B. bronchiseptica O-antigen serotypes aid in the evasion of cross-immunity between strains in vivo.

Since antibodies raised against one O-antigen type do not recognize the other type, we hypothesized that these two O-antigen serotypes would not be cross-protective in a murine infection model. To test this, groups of three mice were either vaccinated with purified LPS from strains RB50, 1289 or RB50Δwbm or left unvaccinated. After 28 days, mice were challenged with 104 CFU of either strain RB50 or 1289 (Fig 4.5A). In naïve mice, strain RB50 and 1289 grew to approximately 104.5 and 105.0 by three days post-inoculation in the lower respiratory tract (Fig 4.5A). In comparison, vaccination with RB50 LPS reduced the bacterial load of strain RB50 by approximately 10-fold (P = 0.021) (Fig 4.5A). This relatively low level of protection is expected considering this is an LPS-based vaccination regimen. In contrast to the vaccination with RB50 LPS, vaccination with 1289 or RB50∆wbm LPS did not lower the bacterial load of strain RB50 (P = 0.868 and 0.120, respectively) (Fig 4.5A). While the numbers

113 of strain 1289 were approximately 100- fold lower in mice vaccinated with LPS from strain 1289 compared to naïve animals (P < 0.0001), vaccination with

RB50 or RB50∆wbm LPS did not lower the bacterial load of strain 1289 (P =

0.9983 and 0.6729, respectively) (Fig

4.5A). Combined, these data indicate that the protective component of the LPS vaccine is the O-antigen and LPS vaccines containing different O-antigens do not induce cross-protection.

Since the antibody responses to Figure 4.5: Effect of LPS vaccination and passive transfer of immune serum on numbers of B. bronchiseptica strains RB50, 1289 and RB50Δwbm. each of these O-antigens were not (A) C57BL/6 mice were either left unvaccinated (black) or vaccinated with LPS purified from strains RB50 (dark grey), 1289 (light grey) or RB50Δwbm (white). (B) completely cross-reactive (Fig 4.1), we C57BL/6 mice were given either naïve serum (black), RB50- (dark grey), 1289- (light grey) or RB50Δwbm- hypothesized that the O-antigen serotypes induced serum (white) and then inoculated with either strain RB50 or 1289. CFU were quantified 3 days post- inoculation. Numbers of bacteria are expressed as the may aid in evasion of cross-immunity average Log CFU ± standard deviations. The dashed line represents the lower limit of detection. between strains. We first examined the cross-protection between strains in animals with either vaccine- or infection-induced immunity to either strain RB50 or 1289. Animals with either vaccine- or infection-induced immunity were fully protected against subsequent challenge with these strains (data not shown) indicating that a full memory response, consisting of both T- and B-cell mediated immunity, against one strain is sufficient to protect against infection by a heterologous strain expressing a different O-antigen.

114

Since our analyses indicated that the antibody response to strain RB50 was not completely cross- reactive to strain 1289 due to O-antigen variation and vice versa (Fig 4.1, 4.5A), we hypothesized that the O-antigen serotypes may aid in evasion of humoral immunity between strains. Therefore, naïve and RB50-, 1289- or RB50Δwbm- induced sera were collected 28 days post-inoculation, transferred into naïve mice, which were then inoculated with either strain RB50 or 1289 (Fig 4.5B). By 3 days post-inoculation, strains RB50 and 1289 grew rapidly to approximately 104.1 and 105.5 CFU in the lower respiratory tract of mice treated with naïve sera

(Fig 4.5B). When mice received RB50-induced sera, the bacterial load of strain RB50 was near or below the limit of detection (10 CFU), a 1,000-fold reduction in comparison to mice treated with naïve sera (P < 0.0001) (Fig 4.5B). In contrast to this high level of protection afforded by

RB50-induced sera, 1289-induced sera decreased the load of RB50 by 10-fold (P < 0.0001) which indicates that 1289-specific antibodies did not provide as efficient protection as RB50- induced antibodies (Fig 4.5B). Transfer of RB50∆wbm-induced sera did not decrease the bacterial load of strain RB50 (P = 0.998) indicating that antibodies to O-antigen are required for efficient antibody-mediated clearance of strain RB50 (Fig 4.5B). When mice infected with strain

1289 received 1289-induced antibodies, a 1,000-fold decrease in bacterial load was observed (P

< 0.0001) (Fig 4.5B). In contrast to this high level of protection, RB50- and RB50 wbm- induced sera decreased the load of strain 1289 by only 10-fold, which indicates that these antibodies did not provide as efficient protection as 1289-induced antibodies (P < 0.0001 and P

= 0.006, respectively) (Fig 4.5B) and shows that O-antigen specific antibodies to the O1 serotype did not contribute to the clearance of strain 1289. Taken together, these data support the conclusion that the lack of cross-reactivity between O-antigen serotypes causes inefficient antibody-mediated clearance of B. bronchiseptica strains.

115

Discussion:

Using a large set of B. bronchiseptica strains, this study builds upon previous reports suggesting that B. bronchiseptica strains can produce one of two immunologically distinct O- antigen serotypes (Fig 4.1, 4.2) (34, 36, 39). We suggest the names O1 and O2 to describe the

O-antigen serotypes that are cross-reactive with antibodies induced by strains RB50 and 1289, respectively. In all cases, the O1 and O2 serotypes were associated with the presence of the classical and alternative O-antigen loci, respectively (Fig 4.3). The phylogenetic relatedness of

B. bronchiseptica strains does not correlate with either of these O-antigen loci, which strongly suggests that they recombine between strains (Fig 4.4). This is the first evidence of a horizontally transferred locus encoding an antigen in Bordetella. The induction of serotype- specific immunity aids in evasion of humoral immunity between strains (Fig 4.1, 4.5). Together, our data are consistent with the idea that the O-antigen serotypes of B. bronchiseptica are encoded by separate O-antigen loci that recombine and contribute to the evasion of cross- immunity between strains.

Previously, it was determined that the LPS related genes of B. bronchiseptica isolates from Complex I were less polymorphic than those belonging to Complex IV, which includes strains that are more closely related to B. pertussis than other B. bronchiseptica strains (9). The majority of this variation was due to the lack of wbm genes in some Complex IV strains (9).

Consistent with this, we demonstrate that all Complex I isolates examined contain either the classical or alternative locus, while three Complex IV isolates did not contain either the classical or alternative locus (Fig 4.4). Like other Complex IV strains, the most likely explanation for this is that these strains do not have genes encoding for an O-antigen. One exception to this general conclusion is strain MO149, which appeared to produce an O-antigen in previous studies, despite

116 the absence of either the classical or alternative O-antigen genes (9). When analyzed more closely, it was determined that this strain does express an O-antigen that is distinct from either

O1 or O2 (Vinogradov, Preston, unpublished data). Sequencing of the wbm locus in strain

MO149 indicates that it contains orthologs of wbmA-D and homologs, with low levels of identity, to wbmF, H-K and BB0121 (Vinogradov, Preston, unpublished data). These data are consistent with the finding that this strain’s O-antigen did not cross-react with sera containing antibodies to either O1 or O2 (data not shown).

The majority of strains that were PCR-screened for the classical or alternative O-antigen loci were also screened for the expression of an O1 or O2 serotype (Fig 4.3, data not shown).

While all strains expressing one of these serotypes contained one of the loci, not all strains containing one of these loci always expressed one of these serotypes. Two possibilities could lead to this result. First, it has previously been observed B. bronchiseptica strains can lose their expression of O-antigen (15) potentially due to mutation of any of the genes required for its synthesis. This would lead to the ability to gentoype the O-antigen locus by CGH or PCR but not the expressed O-antigen serotype as we observe. Second, it may be that these strains express a novel O-antigen serotype encoded by a locus that contains genes similar to those being screened in our analysis. For example, the strain BPP5 (ST16) was observed to contain the alternative O-antigen locus but did not express either the O1 or O2 serotype. Currently, it is not known if this strain expresses an O-antigen. However, a previous study by Brinig et.al. showed that the wbm locus of this strain contains most of the alternative O-antigen genes but with numerous differences in the wbmA-N region. While 3 of 49 strains examined did not appear to contain either the O-antigen locus or express either O-antigen serotype and 6 of 46 strains containing either O-antigen locus could not be serotyped, these ‘non-typed’ strains still make up

117 a minority of B. bronchiseptica strains. This suggests that the O1 and O2 serotypes appear to dominate within B. bronchiseptica.

With some pathogens, O-antigen serotype has been shown to correlate with persistence of pathogens in a specific host-species, a particular disease phenotype or the virulence of strains as measured by LD50 in an infection model (21). In the case of B. bronchiseptica, a correlation between host-species or virulence and O-antigen serotype does not appear to exist. Although we did not directly test if O-antigen serotype caused a difference in virulence as the ‘serotype- specifying region’ of the O-antigen is large (~9kB) and difficult to swap between strains, we did not observe a relationship between the O-antigen serotype of strains and a particular level of virulence as measured by LD50 in our murine model of infection. For example, we have described O2 strains that are of substantially greater (Buboltz A.M., Nicholson T.L., Weyrich

L.S., Harvill E.T., submitted for publication) or lesser (6) virulence than strain RB50, an O1 strain (Fig 4.2). Additionally, we did not observe a correlation between host-species and O- antigen serotype (data not shown).

Ecological theory predicts that that two closely related, immunizing pathogens cannot occupy the same host population if immunity is cross-protective (4). However, escape of immune-mediated competition can occur through antigenic variation, which can lead to the maintenance of multiple, closely related pathogens in the same host population (13, 16, 17, 35).

For example, strains with O-antigen serotypes that are not cross-reactive cycle with the epidemic dynamics of cholera (24, 28). Similarly, it has been hypothesized that the four distinct O-antigen serotypes contribute to the coexistence of four typhodial Salmonella strains (21). Evasion of B. pertussis-induced immunity by the O-antigen of B. parapertussis has been shown to allow evasion of B. pertussis-induced immunity, potentially explaining the coexistence of these two

118 etiological agents of whooping cough in the human population (5, 45). While careful examination of the molecular epidemiology of B. bronchiseptica has not been completed to date

(29), it is reasonable to speculate that the generation of O-antigen variability by recombination among B. bronchiseptica strains may increase the ability of these bacterium to circulate within a given host population. Additionally, we speculate that the evasion of cross-immunity may represent one of the driving forces that maintain two distinct O-antigen serotypes among B. bronchiseptica.

119

Authors and Contributions:

Anne M. Buboltz1,2, Tracy L. Nicholson3, Alexia T. Karanikas1,4, Andrew Preston5, Eric T.

Harvill1

1 Department of Veterinary and Biomedical Sciences, The Pennsylvania State University,

115 Henning Building, University Park, PA 16802

2 Graduate Program in Biochemistry, Microbiology, and Molecular Biology, The

Pennsylvania State University

3 Respiratory Diseases of Livestock Research Unit; National Animal Disease Center,

Agricultural Research Service, USDA, Ames, Iowa.

4 Graduate Program in Cell and Developmental Biology, The Pennsylvania State

University

5 Department of Clinical Veterinary Science, University of Bristol, Langford, United

Kingdom

Conceived and designed the experiments: AMB, TLN, AP, ETH. Performed the experiments:

AMB, TLN, ATK, AP. Analyzed the data: AMB, TLN, AP. Wrote the paper: AMB, ETH.

120

References:

1. Achtman, M., and M. Wagner. 2008. Microbial diversity and the genetic nature of

microbial species. Nat Rev Microbiol 6:431-40.

2. Allen, A., and D. Maskell. 1996. The identification, cloning and mutagenesis of a

genetic locus required for lipopolysaccharide biosynthesis in Bordetella pertussis. Mol

Microbiol 19:37-52.

3. Allen, A. G., R. M. Thomas, J. T. Cadisch, and D. J. Maskell. 1998. Molecular and

functional analysis of the lipopolysaccharide biosynthesis locus wlb from Bordetella

pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Mol Microbiol 29:27-

38.

4. Anderson, R. M. 1995. Evolutionary pressures in the spread and persistence of

infectious agents in vertebrate populations. Parasitology 111 Suppl:S15-31.

5. Bjornstad, O. N., and E. T. Harvill. 2005. Evolution and emergence of Bordetella in

humans. Trends Microbiol 13:355-9.

6. Buboltz, A. M., T. L. Nicholson, M. R. Parette, S. E. Hester, J. Parkhill, and E. T.

Harvill. 2008. Replacement of Adenylate Cyclase Toxin in a Lineage of Bordetella

bronchiseptica. J. Bacteriol.:JB.00226-08.

7. Burns, V. C., E. J. Pishko, A. Preston, D. J. Maskell, and E. T. Harvill. 2003. Role of

Bordetella O antigen in respiratory tract infection. Infect Immun 71:86-94.

8. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of

phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect

Immun 62:3381-90.

121

9. Diavatopoulos, D. A., C. A. Cummings, L. M. Schouls, M. M. Brinig, D. A. Relman,

and F. R. Mooi. 2005. Bordetella pertussis, the causative agent of whooping cough,

evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog

1:e45.

10. Ferguson, N. M., A. P. Galvani, and R. M. Bush. 2003. Ecological and immunological

determinants of influenza evolution. Nature 422:428-33.

11. Fraser, C., W. P. Hanage, and B. G. Spratt. 2007. Recombination and the nature of

bacterial speciation. Science 315:476-80.

12. Goebel, E. M., D. N. Wolfe, K. Elder, S. Stibitz, and E. T. Harvill. 2008. O antigen

protects Bordetella parapertussis from complement. Infect Immun 76:1774-80.

13. Gog, J. R., and B. T. Grenfell. 2002. Dynamics and selection of many-strain pathogens.

Proc Natl Acad Sci U S A 99:17209-14.

14. Gonzalez-Fraga, S., M. Pichel, N. Binsztein, J. A. Johnson, J. G. Morris, Jr., and O.

C. Stine. 2008. Lateral gene transfer of O1 serogroup encoding genes of Vibrio cholerae.

FEMS Microbiol Lett.

15. Gueirard, P., K. Le Blay, A. Le Coustumier, R. Chaby, and N. Guiso. 1998.

Variation in Bordetella bronchiseptica lipopolysaccharide during human infection. FEMS

Microbiol Lett 162:331-7.

16. Gupta, S., and R. M. Anderson. 1999. Population structure of pathogens: the role of

immune selection. Parasitol Today 15:497-501.

17. Gupta, S., and M. C. Maiden. 2001. Exploring the evolution of diversity in pathogen

populations. Trends Microbiol 9:181-5.

122

18. Gupta, S., M. C. Maiden, I. M. Feavers, S. Nee, R. M. May, and R. M. Anderson.

1996. The maintenance of strain structure in populations of recombining infectious

agents. Nat Med 2:437-42.

19. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller.

2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract

infection. Infect Immun 68:6720-8.

20. Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among

Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J

Bacteriol 154:269-77.

21. Kingsley, R. A., and A. J. Baumler. 2000. Host adaptation and the emergence of

infectious disease: the Salmonella paradigm. Mol Microbiol 36:1006-14.

22. Kirimanjeswara, G. S., P. B. Mann, and E. T. Harvill. 2003. Role of antibodies in

immunity to Bordetella infections. Infect Immun 71:1719-24.

23. Kirimanjeswara, G. S., P. B. Mann, M. Pilione, M. J. Kennett, and E. T. Harvill.

2005. The complex mechanism of antibody-mediated clearance of Bordetella from the

lungs requires TLR4. J Immunol 175:7504-11.

24. Koelle, K., M. Pascual, and M. Yunus. 2006. Serotype cycles in cholera dynamics. Proc

Biol Sci 273:2879-86.

25. Kubler-Kielb, J., E. Vinogradov, G. Ben-Menachem, V. Pozsgay, J. B. Robbins, and

R. Schneerson. 2008. Saccharide/protein conjugate vaccines for Bordetella species:

preparation of saccharide, development of new conjugation procedures, and physico-

chemical and immunological characterization of the conjugates. Vaccine 26:3587-93.

123

26. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature 227:680-5.

27. Levin, B. R., and J. J. Bull. 1994. Short-sighted evolution and the virulence of

pathogenic microorganisms. Trends Microbiol 2:76-81.

28. Longini, I. M., Jr., M. Yunus, K. Zaman, A. K. Siddique, R. B. Sack, and A. Nizam.

2002. Epidemic and endemic cholera trends over a 33-year period in Bangladesh. J Infect

Dis 186:246-51.

29. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical

manifestations of respiratory infections due to Bordetella pertussis and other Bordetella

subspecies. Clin Microbiol Rev 18:326-82.

30. Mooi, F. R., and E. M. Bik. 1997. The evolution of epidemic Vibrio cholerae strains.

Trends Microbiol 5:161-5.

31. Murray, G. L., S. R. Attridge, and R. Morona. 2006. Altering the length of the

lipopolysaccharide O antigen has an impact on the interaction of Salmonella enterica

serovar Typhimurium with macrophages and complement. J Bacteriol 188:2735-9.

32. Myc, A., J. Buck, J. Gonin, B. Reynolds, U. Hammerling, and D. Emanuel. 1997.

The level of lipopolysaccharide-binding protein is significantly increased in plasma in

patients with the systemic inflammatory response syndrome. Clin Diagn Lab Immunol

4:113-6.

33. Nicholson, T. L. 2007. Construction and validation of a first-generation Bordetella

bronchiseptica long-oligonulceotide microarray by transcriptional profiling the Bvg

regulon. BMC Genomics 8:220.

124

34. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M.

T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga,

L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D.

Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis,

J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S.

Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E.

Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M.

Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead,

B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences

of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet

35:32-40.

35. Plotkin, J. B., J. Dushoff, and S. A. Levin. 2002. Hemagglutinin sequence clusters and

the antigenic evolution of influenza A virus. Proc Natl Acad Sci U S A 99:6263-8.

36. Preston, A., A. G. Allen, J. Cadisch, R. Thomas, K. Stevens, C. M. Churcher, K. L.

Badcock, J. Parkhill, B. Barrell, and D. J. Maskell. 1999. Genetic basis for

lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect Immun 67:3763-7.

37. Preston, A., and D. Maskell. 2001. The molecular genetics and role in infection of

lipopolysaccharide biosynthesis in the Bordetellae. J Endotoxin Res 7:251-61.

38. Preston, A., J. Parkhill, and D. J. Maskell. 2004. The bordetellae: lessons from

genomics. Nat Rev Microbiol 2:379-90.

39. Preston, A., B. O. Petersen, J. O. Duus, J. Kubler-Kielb, G. Ben-Menachem, J. Li,

and E. Vinogradov. 2006. Complete structures of Bordetella bronchiseptica and

Bordetella parapertussis lipopolysaccharides. J Biol Chem 281:18135-44.

125

40. Reeves, P. 1993. Evolution of Salmonella O antigen variation by interspecific gene

transfer on a large scale. Trends Genet 9:17-22.

41. Reeves, P. 1995. Role of O-antigen variation in the immune response. Trends Microbiol

3:381-6.

42. Stenutz, R., A. Weintraub, and G. Widmalm. 2006. The structures of Escherichia coli

O-polysaccharide antigens. FEMS Microbiol Rev 30:382-403.

43. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular

Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596-9.

44. Vinogradov, E., M. S. Peppler, and M. B. Perry. 2000. The structure of the

nonreducing terminal groups in the O-specific polysaccharides from two strains of

Bordetella bronchiseptica. Eur J Biochem 267:7230-7.

45. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The

O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced

immunity. Infect Immun 75:4972-9.

46. Wolfe, D. N., G. S. Kirimanjeswara, E. M. Goebel, and E. T. Harvill. 2007.

Comparative Role of Immunoglobulin A in Protective Immunity Against the bordetellae.

Infect Immun.

126

Chapter 5:

Summary and Significance

127

Synopsis:

While B. bronchiseptica strains are very closely related genetically (44, 45, 56), the phenotypic diversity of this species is quite broad in terms of the range of hosts it can infect (24,

43, 44) and the differences in the level of disease (11, 51), virulence (12, 27, 29) and virulence factor expression (6, 16, 27, 28, 44, 51) between strains. Despite this phenotypic diversity of B. bronchiseptica strains, very few studies have examined the molecular evolution of the genetic factors associated with this phenotypic diversity (16). Therefore, using virulence and antigenic variation as markers of phenotypic diversity, the works contained in this thesis examine the molecular evolution of the genetic factors that appear to contribute to these traits. This is studied by using a combination of approaches including an infection model, whole genomic comparisons, bacterial genetics and phylogenetics.

In the first data chapter of this thesis, the decreased virulence of a B. bronchiseptica isolate, strain 253 (Fig 2.1), was associated with the loss of CyaA (Fig 2.2, 2.3), a toxin that was thought to be highly conserved and expressed by all the classical bordetellae (43, 46). The genes encoding this toxin are replaced by a novel operon predicted to encode peptide transport proteins

(ptp) (Fig 2.4A). All other examined strains from the same lineage as strain 253 were also found to have lost the operon encoding this toxin (Fig 2.4B, 2.4C) and were less virulent than strain

RB50. Together, these data indicate that CyaA has been replaced in a hypovirulent lineage of B. bronchiseptica and that there are ecological niches in which CyaA is not critical for the success of B. bronchiseptica.

In the next chapter, the increased virulence of a B. bronchiseptica isolate, strain 1289

(Fig 3.1), was associated with the increased gene expression and function of the TSSS (Fig 3.2,

3.3). Using bacterial genetics, it was determined that the TTSS of strain 1289 caused the

128 increased TTSS-mediated cytotoxicity of macrophages (Fig 3.3A). The increased virulence of this strain was partly dependent on the TTSS (Fig 3.3B). The TTSS from another strain from the same ST as strain 1289 (Fig 3.4) also contributed to the increased virulence of this strain (Fig

3.5). Together, these data suggest that the TTSS contributes to the increased virulence of a B. bronchiseptica lineage.

In the penultimate chapter, it was determined that two B. bronchiseptica strains expressed antigentically distinct O-Antigen serotypes (O1 and O2) (Fig 4.1). When additional strains were analyzed, they were found to express either O1 or O2 (Fig 4.2). Comparative genomic analysis indicated, and PCR screening confirmed, that strains expressing the O1 and O2 serotypes contained either the classical and alternative O-Antigen loci respectively (Fig 4.3). These two O-

Antigen loci did not correlate with a particular phylogenetic lineage indicating that they homologously recombine within the species. The variation in O-Antigen appears to cause inefficient cross-protection, upon vaccination with purified LPS, and antibody mediated clearance, upon passive transfer of immune serum, between O1 and O2 expressing strains.

Combined, these data are consistent with the idea that the O-Antigen serotypes of B. bronchiseptica are encoded by distinct O-Antigen loci that recombine and aid in the evasion of cross-immunity between strains.

The next section of this chapter is broken down into three sections. First, we discuss the implications of this work. Next, the evolutionary ecological forces that may cause and maintain diversity among B. bronchiseptica strains are considered. Finally, future directions concerning this work are discussed.

Implications:

Strains representing B. bronchiseptica:

129

In the Bordetella field, many researchers assume that strain RB50, whose genome has been fully sequenced and is most commonly studied, is representative of the entire species. In some ways, this assumption is correct in that the genomic sequence of strain RB50 is very similar (>99% identical) to other B. bronchiseptica genomes (Buboltz unpublished, Parkhill unpublished). However, it is incorrect in that this strain does not represent all of the genomic and phenotypic variation of all B. bronchiseptica strains. Our studies, along with other previously published works, show that the genomic content of B. bronchiseptica strains can vary, and that the level of virulence and antigenic properties of strain RB50 are not similar to other B. bronchiseptica strains (12, 14, 16). Considering this, no strain of B. bronchiseptica should be considered representative of the species.

Clonal Diversity and Recombination:

In previous studies, it was shown that B. bronchiseptica is largely clonal as the majority of isolates group into a small number of complexes (16, 44, 45, 56). The small amount of diversity that is detectible using MLST is based solely on the slow accumulation of mutations that lead to chromosomal mutation that is passed by exclusively through vertical inheritance

(16). Additionally, when each of the genes sequenced in MLST analysis are used to build individual and concatenated trees, all trees represent similar ancestry which indicates that these housekeeping genes do not recombine between B. bronchiseptica strains. Thus, our MLST data are consistent with previous reports indicating that B. bronchiseptica is clonal.

However, since MLEE and MLST are based on the genetic variation within several enzymes and not the entire genome, these approaches are prone to underestimating the amount of genetic diversity resulting from homologous recombination and/or LGT within a bacterial species. Using microarray analysis and genome sequencing, we have observed that the uptake of

130 the ptp genes by ST27 strains via LGT (Fig 2.4), and presence of two different O-Antigen loci which appear to be transferred among B. bronchiseptica strains by homologous recombination

(Fig 4.4). Thus, while it appears that B. bronchiseptica is indeed clonal with little, if any, recombination between housekeeping genes, the work presented here describes the first evidence that LGT and homologous recombination occur within in this species.

Previous studies have shown that B. bronchiseptica strains can express different sets of virulence factors. Here, we build upon this observation by showing the association between lineage and differential virulence factor expression which can be caused by lateral gene transfer events (Fig 2.3-2.4), differential gene regulation (Fig 3.2) or homologous recombination (Fig

4.4). Therefore, it appears that even in closely related species, there can be lineage-associated differences in virulence factor expression.

Vaccine Design:

Most B. bronchiseptica vaccines are live attenuated strains with limited studies on their efficacy (40, 43). While these live vaccines are easy to administer and economically affordable, there are some drawbacks including their transmissibility, reactogenicity in immunocompromised hosts and the possible reversion to more virulent forms particularly with the wide variety of hosts, environments and coinfections that can be encountered with their use

(37, 41). Because of these concerns, many heat killed or acellular vaccines have been developed.

In these studies, we show that the antigenic profile of B. bronchiseptica strains can be distinct

(Fig 2.2, Fig 4.1). Therefore, if acellular vaccines are developed against B. bronchiseptica, these strain dependent antigenic differences should be considered. For example, an acellular vaccine consisting only of CyaA would not provide protection against ST27 B. bronchiseptica strains since they do not express CyaA (Fig 2.2). These data suggest that acellular vaccines developed

131 against B. bronchiseptica should be polyvalent. Because B. bronchiseptica whole-cell vaccines provides protection against infection in the lower respiratory tract (25) and there is complete protection between strains expressing different O-Antigen types when a whole-cell vaccines is used (chapter 4, data not shown), it appears that using a whole-cell vaccine may also provide sufficient protection against B. bronchiseptica related disease in the agricultural setting.

Discussion Points:

Evolutionary ecology of virulence in B. bronchiseptica:

With the increasing availability of complete genome sequences, more comparative genomic analyses are being used to identify the molecular causes underlying the difference in pathogenesis of closely related bacteria (18, 52-55). Similarly, much current research is focused on the ecological forces that drive the evolution of virulence (8, 9, 20-22, 39). However, the ecological forces that may drive the pathological differences we observe between strains are rarely discussed in molecular studies. Additionally, the molecular causes of strain dependent pathological differences are rarely discussed in studies focusing on the ecological forces driving virulence evolution (42). This gap between fields is likely because of the relative youth of both disciplines. As more studies are completed in the fields of comparative genomics, virulence evolution, molecular epidemiology, ecology of disease and host-pathogen interactions, these fields will become more integrated (19).

Our data show that strains from the hypovirulent ST27 (Fig 2.4, 2.5) and the hypervirulent ST32 (Fig 3.4, 3.5) have been isolated from geographically diverse locations and at separate times (Appendix A) indicating that these lineages, which cause different levels of virulence, are successful. Therefore, here, we discuss the ecological forces that may cause the evolution and maintenance of B. bronchiseptica strains that exhibit different levels of virulence.

132

The most widely accepted view of virulence evolution assumes that there is a trade-off to virulence where the maintenance of harmful effects is characterized by the presence of other beneficial traits (3, 17, 49). Under this framework, the increased virulence (a harmful trait) of

ST32 strains (Fig 3.3, 3.5) would be expected to have other beneficial traits. We suggest that the increased TTSS-mediated virulence of these strains is accompanied by increased TTSS-mediated colonization and persistence (47, 58). This may cause increased transmission, as increased load has been correlated with increased transmissibility for many other pathogens (42, 48). The absence of CyaA results in decreased colonization, pathology and lethality (Fig 2.5) (33, 57).

The loss of CyaA in all ST27 strains (Fig 2.4) likely contributes to the decreased virulence of these strains (Fig 2.5), which may result in decreased transmissibility of these strains (42, 48). In the case of B. bronchiseptica, conditions under which virulence or transmission potential change may include within host competition (36), shifts in host population density or heterogeneity (7, 9,

50), host immune status (5, 39) and/or coinfections (1, 26). Slight differences in these ecological parameters may select for strains of increased or decreased virulence. We suggest that the ability of B. bronchiseptica strains to cause different levels of virulence may aid in ability of this species to infect such a wide-range of hosts and cause different disease phenotypes.

Evolutionary ecology of antigenic variation:

Consistent with previous analyses, data presented here show that B. bronchiseptica is a clonal species with low levels of recombination, as indicated by the absence of recombination of housekeeping genes (16, 44, 45, 56). However, our data show that antigenic loci, which appear to encode two antigenically distinct O-Antigen serotypes, can homologously recombine between

B. bronchiseptica strains (Fig 4.2, 4.3, 4.4). Interestingly, these serotypes appear to dominate within the B. bronchiseptica bacterial population (Fig 4.2, 4.4). In other words, we did not

133 identify any other serotypes (Fig 4.2), and if one does exist, it would probably only be expressed by a minority of strains. One ecological force that may be driving and maintaining the dominance of these two antigenically distinct serotypes could be host immunity, as recombining dominant polymorphic antigens have been shown to organize pathogen populations into nonoverlapping combinations as a result of selection by the host immune system (13, 31, 32).

While it is expected that two closely related immunizing pathogens cannot occupy the same host population if immunity is cross-protective (2, 31), inefficient cross-immunity between strains can allow multiple strains to coexist (23, 31, 35). Combining these ideas, we suggest that the dominance of two antigenically distinct O-Antigen serotypes among B. bronchiseptica strains is an effect of evading host immunity.

Future Directions:

Determining the function of the ptp genes:

The finding that CyaA has been replaced in ST27 strains (Fig 2.4) was quite unexpected as CyaA is the only secreted, protein toxin expressed by all the classical bordetellae and the genes encoding this toxin are highly conserved (43, 46), which indicated that CyaA is, likely, critical for the success of these pathogens. However, our data indicate that this is not the case as

ST27 strains, which lack CyaA, have been isolated from disperse geographical locations and times (Appendix A). Therefore, the maintenance of the novel ptp genes in these ST27 strains suggests they may facilitate the success of these strains despite the loss of CyaA. The predicted function of the ptp genes suggests that they are involved in oligopeptide/dipeptide binding and transport (Fig 2.4), which may provide a growth advantage in a particular host niche. Future research focused on the (i) regulation of these genes, (ii) the function of these genes in

134 transporting amino acids and/or di- or oligopeptides, (iii) determining if the ptp genes provide a growth advantage in vitro (iv) and in vivo will shed light on the advantage these genes provide.

Determining other factors that contribute to the increased virulence of ST32 strains:

While our data suggest that the TTSS contributes to the increased virulence of ST32 strains, it appears that there is a TTSS-independent mechanism that increases the virulence of these strains as the LD50 of the isogenic ST32 mutants lacking the bscN gene are still more virulent than strain RB50 bscN (Fig 3.3, Fig 3.5). The effect of transient events, such as differences in gene expression over the course of infection, or acquisition of ST32-specific genes on virulence would not be observed in our analyses. Since the sequencing of strain 1289 is currently ongoing (Buboltz, Zhang et. al. unpublished data), we will soon be able to identify any novel genes and determine their effect on the increased virulence of this strain.

Molecular epidemiology of B. bronchiseptica:

Many of the studies contained in this thesis either apply concepts or make predictions concerning the evolutionary ecology and epidemiology of B. bronchiseptica. However, little is known about this species’ ecology or epidemiology, and even less about the molecular epidemiology, of B. bronchiseptica in wild populations (43). The results from studies completed in these areas, especially molecular epidemiology, could then be coupled with the data contained within this thesis to examine the ecological factors that correlate with the molecular evolution of

B. bronchiseptica.

We identify two distinct O-Antigen serotypes that are not cross protective in vivo and appear to dominate within B. bronchiseptica (Fig 4.1, 4.2, 4.4, 4.5). Many theoretical studies predict (4, 15, 30) and empirical examples have shown (35, 38) that for pathogens with only a few antigenically distinct strains, incomplete cross-immunity between strains drives cycling

135 behavior. Therefore, one could use molecular epidemiology to determine if (i) multiple B. bronchiseptica strains co-circulate at the same time or in a dynamic pattern and (ii) if these strains expressed different O-Antigen serotypes to support or negate the hypothesis that the O-

Antigen serotypes allow for the co-circulation of B. bronchiseptica strains.

In Neisseria gonorrhoeae, it has been shown that isolates causing disease versus those causing asymptomatic infection are, on average, associated with different phylogenetic lineages

(34). The data contained herein suggests that the level of virulence caused by B. bronchiseptica is lineage associated indicating that the genetic basis for these differences are linked (Fig 2.5,

3.5). If B. bronchiseptica disease is more highly dependent on the pathogen than other factors, such as the immune status of the host or co-infection, then one may predict that particular B. bronchiseptica lineages or STs may be more highly associated with disease outbreaks than others. Completing molecular epidemiological analyses on B. bronchiseptica strains from healthy and diseased hosts would provide data to examine this prediction.

Additionally, we predict that ecological forces, such as shifts in host population density or multiple infections, may select for B. bronchiseptica strains causing different levels of virulence. One could test these predictions by using molecular epidemiology. For example, it is known that B. bronchiseptica can predispose animals to other pathogens, such as Pasteurella multocida (10), which can lead to serious disease and mortality in agricultural settings. Using this knowledge, one could collect isolates of B. bronchiseptica from agricultural herds containing and lacking P. multocida to determine if the presence of multiple infections was associated with a particular lineage or caused increased or decreased virulence. This would be an indirect way to examine if multiple infections cause a selection on B. bronchiseptica virulence.

136

At the most basic level, any of these molecular epidemiological studies would enhance the understanding of the epidemiology of B. bronchiseptica. On another level, it should be noted that B. bronchiseptica is a prime candidate for the multi-disciplinary analyses suggested in this thesis. For example, while many other model systems are hampered by the lack of an experimental model of infection, the inability to genetically manipulate or culture strains, high biohazard safety levels, lack of a robust method for conducting molecular epidemiology, inability to genetically manipulate strains or complete comparative genomic analyses, all of these tools are available within the Bordetella field. Therefore, the most exciting frontier is the merging of multi-disciplinary fields to better understand the ecological forces that drive and/or maintain pathogen evolution and diversity, using B. bronchiseptica as its model system.

137

References:

1. Alizon, S., and M. van Baalen. 2008. Multiple Infections, Immune Dynamics, and the

Evolution of Virulence. Am Nat 172.

2. Anderson, R. M. 1995. Evolutionary pressures in the spread and persistence of

infectious agents in vertebrate populations. Parasitology 111 Suppl:S15-31.

3. Anderson, R. M., and R. M. May. 1982. Coevolution of hosts and parasites.

Parasitology 85 (Pt 2):411-26.

4. Andreasen, V., J. Lin, and S. A. Levin. 1997. The dynamics of cocirculating influenza

strains conferring partial cross-immunity. J Math Biol 35:825-42.

5. Antia, R., B. R. Levin, and R. M. May. 1994. Within-Host Population Dynamics and

the Evolution and Maintenance of Microparasite Virulence. Am Nat 144.

6. Bemis, D. A., H. A. Greisen, and M. J. Appel. 1977. Bacteriological variation among

Bordetella bronchiseptica isolates from dogs and other species. J Clin Microbiol 5:471-

80.

7. Boots, M., P. J. Hudson, and A. Sasaki. 2004. Large Shifts in Pathogen Virulence

Relate to Host Population Structure. Science 303:842-844.

8. Boots, M., P. J. Hudson, and A. Sasaki. 2004. Large shifts in pathogen virulence relate

to host population structure. Science 303:842-4.

9. Boots, M., and M. Mealor. 2007. Local Interactions Select for Lower Pathogen

Infectivity. Science 315:1284-1286.

10. Brockmeier, S. L., and K. B. Register. 2007. Expression of the dermonecrotic toxin by

Bordetella bronchiseptica is not necessary for predisposing to infection with toxigenic

Pasteurella multocida. Vet Microbiol 125:284-9.

138

11. Brockmeier, S. L., K. B. Register, T. Magyar, A. J. Lax, G. D. Pullinger, and R. A.

Kunkle. 2002. Role of the Dermonecrotic Toxin of Bordetella bronchiseptica in the

Pathogenesis of Respiratory Disease in Swine. Infect. Immun. 70:481-490.

12. Buboltz, A. M., T. L. Nicholson, M. R. Parette, S. E. Hester, J. Parkhill, and E. T.

Harvill. 2008. Replacement of Adenylate Cyclase Toxin in a Lineage of Bordetella

bronchiseptica. J. Bacteriol.:JB.00226-08.

13. Buckee, C., L. Danon, and S. Gupta. 2007. Host community structure and the

maintenance of pathogen diversity. Proc Biol Sci 274:1715-21.

14. Cummings, C. A., M. M. Brinig, P. W. Lepp, S. van de Pas, and D. A. Relman. 2004.

Bordetella species are distinguished by patterns of substantial gene loss and host

adaptation. J Bacteriol 186:1484-92.

15. Dawes, J. H., and J. R. Gog. 2002. The onset of oscillatory dynamics in models of

multiple disease strains. J Math Biol 45:471-510.

16. Diavatopoulos, D. A., C. A. Cummings, L. M. Schouls, M. M. Brinig, D. A. Relman,

and F. R. Mooi. 2005. Bordetella pertussis, the causative agent of whooping cough,

evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog

1:e45.

17. Ebert, D., and E. A. Herre. 1996. The evolution of parasitic diseases. Parasitology

Today 12:96-101.

18. Fitzgerald, J. R., and J. M. Musser. 2001. Evolutionary genomics of pathogenic

bacteria. Trends in Microbiology 9:547-553.

19. Galvani, A. P. 2003. Epidemiology meets evolutionary ecology. Trends in Ecology &

Evolution 18:132-139.

139

20. Gandon, S., M. Mackinnon, S. Nee, and A. Read. 2003. Imperfect vaccination: some

epidemiological and evolutionary consequences. Proc Biol Sci 270:1129-36.

21. Gandon, S., M. J. Mackinnon, S. Nee, and A. F. Read. 2001. Imperfect vaccines and

the evolution of pathogen virulence. Nature 414:751-6.

22. Gandon, S., M. van Baalen, and V. A. Jansen. 2002. The evolution of parasite

virulence, superinfection, and host resistance. Am Nat 159:658-69.

23. Gog, J. R., and B. T. Grenfell. 2002. Dynamics and selection of many-strain pathogens.

Proc Natl Acad Sci U S A 99:17209-14.

24. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol Rev 44:722-38.

25. Gopinathan, L., G. S. Kirimanjeswara, D. N. Wolfe, M. L. Kelley, and E. T. Harvill.

2007. Different mechanisms of vaccine-induced and infection-induced immunity to

Bordetella bronchiseptica. Microbes Infect 9:442-8.

26. Graham, A. L., I. M. Cattadori, J. O. Lloyd-Smith, M. J. Ferrari, and O. N.

Bjornstad. 2007. Transmission consequences of coinfection: cytokines writ large?

Trends Parasitol 23:284-91.

27. Gueirard, P., and N. Guiso. 1993. Virulence of Bordetella bronchiseptica: role of

adenylate cyclase-hemolysin. Infect Immun 61:4072-8.

28. Gueirard, P., K. Le Blay, A. Le Coustumier, R. Chaby, and N. Guiso. 1998.

Variation in Bordetella bronchiseptica lipopolysaccharide during human infection. FEMS

Microbiol Lett 162:331-7.

29. Gueirard, P., C. Weber, A. Le Coustumier, and N. Guiso. 1995. Human Bordetella

bronchiseptica infection related to contact with infected animals: persistence of bacteria

in host. J Clin Microbiol 33:2002-6.

140

30. Gupta, S., N. Ferguson, and R. Anderson. 1998. Chaos, persistence, and evolution of

strain structure in antigenically diverse infectious agents. Science 280:912-5.

31. Gupta, S., and M. C. Maiden. 2001. Exploring the evolution of diversity in pathogen

populations. Trends Microbiol 9:181-5.

32. Gupta, S., M. C. Maiden, I. M. Feavers, S. Nee, R. M. May, and R. M. Anderson.

1996. The maintenance of strain structure in populations of recombining infectious

agents. Nat Med 2:437-42.

33. Harvill, E. T., P. A. Cotter, M. H. Yuk, and J. F. Miller. 1999. Probing the function of

Bordetella bronchiseptica adenylate cyclase toxin by manipulating host immunity. Infect

Immun 67:1493-500.

34. Jolley, K. A., J. Kalmusova, E. J. Feil, S. Gupta, M. Musilek, P. Kriz, and M. C.

Maiden. 2000. Carried meningococci in the Czech Republic: a diverse recombining

population. J Clin Microbiol 38:4492-8.

35. Koelle, K., M. Pascual, and M. Yunus. 2006. Serotype cycles in cholera dynamics. Proc

Biol Sci 273:2879-86.

36. Levin, B. R., and J. J. Bull. 1994. Short-sighted evolution and the virulence of

pathogenic microorganisms. Trends Microbiol 2:76-81.

37. Levine, M. M., and M. B. Sztein. 2004. Vaccine development strategies for improving

immunization: the role of modern immunology. Nat Immunol 5:460-4.

38. Longini, I. M., Jr., M. Yunus, K. Zaman, A. K. Siddique, R. B. Sack, and A. Nizam.

2002. Epidemic and endemic cholera trends over a 33-year period in Bangladesh. J Infect

Dis 186:246-51.

141

39. Mackinnon, M. J., and A. F. Read. 2004. Immunity promotes virulence evolution in a

malaria model. PLoS Biol 2:E230.

40. Magyar, T., V. L. King, and F. Kovacs. 2002. Evaluation of vaccines for atrophic

rhinitis--a comparison of three challenge models. Vaccine 20:1797-802.

41. Mann, P., E. Goebel, J. Barbarich, M. Pilione, M. Kennett, and E. Harvill. 2007. Use

of a Genetically Defined Double Mutant Strain of Bordetella bronchiseptica Lacking

Adenylate Cyclase and Type III Secretion as a Live Vaccine. Infect Immun 75:3665-72.

42. Massey, R. C., M. J. Horsburgh, G. Lina, M. Hook, and M. Recker. 2006. The

evolution and maintenance of virulence in Staphylococcus aureus: a role for host-to-host

transmission? Nat Rev Microbiol 4:953-8.

43. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical

manifestations of respiratory infections due to Bordetella pertussis and other Bordetella

subspecies. Clin Microbiol Rev 18:326-82.

44. Musser, J. M., D. A. Bemis, H. Ishikawa, and R. K. Selander. 1987. Clonal diversity

and host distribution in Bordetella bronchiseptica. J Bacteriol 169:2793-803.

45. Musser, J. M., E. L. Hewlett, M. S. Peppler, and R. K. Selander. 1986. Genetic

diversity and relationships in populations of Bordetella spp. J Bacteriol 166:230-7.

46. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M.

T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga,

L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D.

Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis,

J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S.

Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E.

142

Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M.

Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead,

B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences

of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet

35:32-40.

47. Pilione, M. R., and E. T. Harvill. 2006. The Bordetella bronchiseptica type III secretion

system inhibits gamma interferon production that is required for efficient antibody-

mediated bacterial clearance. Infect Immun 74:1043-9.

48. Quinn, T. C., M. J. Wawer, N. Sewankambo, D. Serwadda, C. Li, F. Wabwire-

Mangen, M. O. Meehan, T. Lutalo, and R. H. Gray. 2000. Viral load and heterosexual

transmission of human immunodeficiency virus type 1. Rakai Project Study Group. N

Engl J Med 342:921-9.

49. Read, A. F. 1994. The evolution of virulence. Trends in Microbiology 2:73-76.

50. Regoes, R. R., M. A. Nowak, and S. Bonhoeffer. 2000. Evolution of virulence in a

heterogeneous host population. Evolution 54:64-71.

51. Roop, R. M., 2nd, H. P. Veit, R. J. Sinsky, S. P. Veit, E. L. Hewlett, and E. T.

Kornegay. 1987. Virulence factors of Bordetella bronchiseptica associated with the

production of infectious atrophic rhinitis and pneumonia in experimentally infected

neonatal swine. Infect Immun 55:217-22.

52. Saeij, J. P. J., J. P. Boyle, S. Coller, S. Taylor, L. D. Sibley, E. T. Brooke-Powell, J.

W. Ajioka, and J. C. Boothroyd. 2006. Polymorphic Secreted Kinases Are Key

Virulence Factors in Toxoplasmosis. Science 314:1780-1783.

143

53. Sitkiewicz, I., M. J. Nagiec, P. Sumby, S. D. Butler, C. Cywes-Bentley, and J. M.

Musser. 2006. Emergence of a bacterial clone with enhanced virulence by acquisition of

a phage encoding a secreted phospholipase A2. Proceedings of the National Academy of

Sciences 103:16009-16014.

54. Sumby, P., A. R. Whitney, E. A. Graviss, F. R. DeLeo, and J. M. Musser. 2006.

Genome-Wide Analysis of Group A Streptococci Reveals a Mutation That Modulates

Global Phenotype and Disease Specificity. PLoS Pathogens 2:e5.

55. Taylor, S., A. Barragan, C. Su, B. Fux, S. J. Fentress, K. Tang, W. L. Beatty, H. E.

Hajj, M. Jerome, M. S. Behnke, M. White, J. C. Wootton, and L. D. Sibley. 2006. A

Secreted Serine-Threonine Kinase Determines Virulence in the Eukaryotic Pathogen

Toxoplasma gondii. Science 314:1776-1780.

56. van der Zee, A., F. Mooi, J. Van Embden, and J. Musser. 1997. Molecular evolution

and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme

electrophoresis and typing with three insertion sequences. J Bacteriol 179:6609-17.

57. Weiss, A. A., and M. S. Goodwin. 1989. Lethal infection by Bordetella pertussis

mutants in the infant mouse model. Infect Immun 57:3757-64.

58. Yuk, M. H., E. T. Harvill, and J. F. Miller. 1998. The BvgAS virulence control system

regulates type III secretion in Bordetella bronchiseptica. Mol Microbiol 28:945-59.

144

Appendix:

145

Appendix A. Bordetella Strain List for Chapters 2, 3 and 4.

Strain Strain Site of REFERENCE ID Source Host Location Date Isolation ST Complex for STing Diavatopoulos Tohama I Miller human Japan 1952 unknown 1 2 2005 Diavatopoulos 446 CDC Human USA unknown unknown 3 4 2005 982 CDC unknown unknown unknown unknown 6 1 Buboltz 2008 866 UMADL Rat unknown unknown nasopharynx 6 1 Buboltz 2008 Guinea 886 UMADL Pig unknown unknown nasopharynx 6 1 Buboltz 2008 1127 UMADL Rat unknown unknown nasopharynx 6 1 Buboltz 2008 1128 UMADL Rat unknown unknown nasopharynx 6 1 Buboltz 2008 Guinea Diavatopoulos 308 CDC Pig USA unknown unknown 7 1 2005 Diavatopoulos 447 CDC Human USA unknown unknown 7 1 2005 Diavatopoulos 449 CDC unknown USA unknown unknown 7 1 2005 Diavatopoulos 755 CDC Human USA 1999 unknown 7 1 2005 Diavatopoulos 231 Mooi mouse USA unknown unknown 7 1 2005 973 CDC unknown unknown unknown unknown 7 1 Buboltz 2008 Relman/ S313 Beckwith Monkey Stanford 2/23/05 Lung 7 1 Buboltz 2008 Diavatopoulos 310 CDC Human USA unknown unknown 8 4 2005 Diavatopoulos 309 CDC Human USA unknown unknown 9 4 2005 381 UMADL Rabbit unknown unknown lung 12 1 Buboltz 2008 Diavatopoulos 756 CDC Human USA 2000 unknown 12 1 2005 Diavatopoulos 757 CDC Human USA 2000 unknown 12 1 2005 Diavatopoulos 761 CDC Human USA 2001 unknown 12 1 2005 Cotter, Diavatopoulos RB50 Peggy Rabbit USA 1994 nares 12 1 2005 C4 Covance Rabbit PA 2006 nasopharynx 14 1 Buboltz 2008 336 UMADL Rabbit unknown unknown nasopharynx 14 1 Buboltz 2008 796 UMADL Rabbit unknown unknown nasopharynx 14 1 Buboltz 2008 Diavatopoulos MO149 CDC Human USA unknown unknown 15 4 2005 New Diavatopoulos Bpp5 Mooi Sheep Zealand unknown unknown 16 1 2005 Diavatopoulos 445 CDC Human USA unknown unknown 17 4 2005 801 UMADL Guinea unknown unknown culture 18 1 Buboltz 2008 146

Pig Guinea 803 UMADL Pig unknown unknown culture 18 1 Buboltz 2008 German Diavatopoulos 12822 child human Germany unknown unknown 19 3 2005 Diavatopoulos 345 CDC Human USA 1996 unknown 21 4 2005 Diavatopoulos 448 CDC Human USA unknown unknown 23 1 2005 Diavatopoulos 18323 Miller human USA 1947 unknown 24 2 2005 1269 UMADL unknown unknown unknown culture 26 1 Buboltz 2008 Netherla Diavatopoulos 2115 Mooi human nds 2000 unknown 26 1 2005 983 CDC unknown unknown unknown unknown 27 1 Buboltz 2008 979 CDC unknown unknown unknown unknown 27 1 Buboltz 2008 253 UMADL Dog USA unknown nares 27 1 Buboltz 2008 Diavatopoulos 443 CDC Human USA unknown unknown 27 1 2005 Diavatopoulos 760 CDC Human USA 2001 unknown 27 1 2005 Diavatopoulos 189 Mooi Dog S. Africa 1979 unknown 27 1 2005 Netherla Diavatopoulos 238 Mooi Dog nds unknown unknown 27 1 2005 Diavatopoulos 752 CDC Human USA 1998 unknown 27 1 2005 Diavatopoulos 753 CDC Human USA 1998 unknown 27 1 2005 Diavatopoulos 759 CDC Human USA 2001 unknown 27 1 2005 Diavatopoulos 762 CDC Human USA 2001 unknown 27 1 2005 Diavatopoulos 763 CDC human USA 2001 unknown 27 1 2005 Diavatopoulos 1966 Mooi Dog unknown unknown unknown 27 1 2005 Netherla Diavatopoulos 2113 Mooi Human nds 1998 unknown 27 1 2005 978 CDC unknown unknown unknown unknown 28 4 Buboltz 2008 Guinea 891 UMADL Pig unknown unknown nasopharynx 28 4 Buboltz 2008 Diavatopoulos 259 Mooi turkey USA unknown unknown 29 4 2005 981 CDC unknown unknown unknown unknown 31 1 Buboltz 2008 South tharacic 1289 CDC Monkey America unknown cavity 32 1 Buboltz 2008 Diavatopoulos 1973 Mooi Monkey Germany unknown unknown 32 1 2005 Relman/ Stanford, S308 Beckwith Monkey CA 4/29/02 Nasal cavity 32 1 Buboltz 2008 147

Caspian Diavatopoulos 1987 Mooi seal Sea 2000 unknown 33 1 2005 Diavatopoulos 758 CDC Human USA 2000 unknown 34 4 2005 Guinea 305 CDC Pig unknown unknown culture 36 1 Buboltz 2008 Guinea 367 CDC Pig unknown unknown culture 36 1 Buboltz 2008 Guinea 804 CDC Pig unknown unknown culture 36 1 Buboltz 2008 Guinea 805 CDC Pig unknown unknown culture 36 1 Buboltz 2008 Guinea 807 CDC Pig unknown unknown culture 36 1 Buboltz 2008 Guinea 806 UMADL Pig unknown unknown Culture 36 1 Buboltz 2008 980 CDC unknown unknown unknown unknown 37 1 Buboltz 2008 C2 CDC Rabbit PA 2006 nasopharynx 38 1 Buboltz 2008 C3 CDC Rabbit PA 2006 nasopharynx 38 1 Buboltz 2008 Guinea 1106 CDC Pig unknown unknown nasopharynx 38 1 Buboltz 2008 C1 CDC Rabbit PA 2006 nasopharynx 39 1 Buboltz 2008 974 CDC unknown unknown unknown unknown 40 1 Buboltz 2008

148

Appendix B. Chapter 2, 3 and 4 MLST Primer List.

MLST PCR primers Gene Function Forward Primer Reverse Primer adk adenylate kinase AGCCGCCTTTCTCACCCAACACT TGGGCCCAGGACGAGTAGT fumC fumarate hydratase class II CGTGAACCGGGGCCAGTCGTC GGCCAGCCAGCGCACATCGTT serine glyA hydroxymethyltransferase CAACCAGGGCGTGTACATGGC CCGCGATGACGTGCATCAG icd isocitrate dehydrogenase CTGGTCCACAAGGGCAACAT ACACCTGGGTGGCGCCTTC pepA cytosol aminopeptidase CGCCCCAGGTTGAAGAAAATCGTC ATCAGGCCCACCACATCCAG pgm phoshoglucomutase CGCCCATGTCACCAGCACCGA CGCCGTCTATCGTAACCAG aromatic amino-acid tyrB aminotransferase CGAGACCTACGCTTATTACGAT TGCCGGCCAGTTCATTTT

149

Appendix C. Chapter 2. qRT-PCR, PCR and RT-PCR Primer List.

qRT-PCR primers Gene Gene Annotation/Function Forward Primer Reverse Primer Bb0323 cyaC, HlyC TCGCGCCGATTCAACTG TGCAACCGGCACGTCAT Bb0324 cyaA, cya CACTGAGCAGAACAATCCTTTCC CGTGAGCATCTGGCTTTCAC Bb0325 cyaB CGCAGCTGTGGAACGATTT TCGGTACGGCAGTTCAGGAT Bb0326 cyaD CGGCGCCTACGACTATACGA TCCGGAGACACATGCAACAC Bb0327 cyaE GATCTTTCGCTGGGCCATT CGGCGAACACCGAGACA Bb0328 cyaX ATGGTGATGGATCTACGTTGGTT CGTGAACTGGCCGCATTC Bb0499 hypothetical protein ACTGGGCCAAATCGGAAAG CCCTGAGTCTGTTCCGCAAA conserved hypothetical Bb0827 protein GCGAGGCGCACGATTG CGGTGCGACTTGGTGACAT substrate binding component of ABC Bb1008 transporter TGGTTTCCTGGCAGAACGA GACTGGTGGTCGATCCTGAAG Bb1168 putative exported protein GCGGCAGCTCGGATTTC CCCCACATCTTGCTGAGATTG Bb1285 cyoC CGTGTTTCGGCGTGTTCTC CTTGTAGCCGAACAGGGTCTTC putative RNA Bb1302 polymerase sigma factor TCATGCACAATCAATTCATCGA GGTCTCGGCCCCGTAATC Bb1467 pstC, phoW TCGCCTATGAAGCAAAACAATAAC GTCCGGGTGAGGTTCTTGAA Putative LysR-family Bb1607 transcriptional regulator TGGTTTGTCTCAAAAATGGATCA GCGGCAACCAGGTTGAAGT Bb1616 bopN TGCCGAGGAAAAGCATCACT GCCAGAGCATCGGACGTT Bb1617 bsp22 CGGCACGGGCGTCAT GGTGTAGGCACTTTCGAGTTCCT Bb1620 bopD CGGCTCGGTGAAGACATCTAC GCCTCCCGCATCTGTTGA Bb1622 bcrH2 ACGAGGCGCGCAATATCT TGCGTTGATCCTCAC Bb1638 brpL TGGTTTCTCCCCCGTCATC GCGTTGTCCGGTTTTTCG Bb1644 alr, dadB CAACAGCTGCACCTGGTCAT GCCTGGCAGCCATTCG Putative transcriptional Bb2721 regulator TGGTCTGGTGTATTTTATGCCTCTT CGTCCGGCAAGGTCTTCA conserved hypothetical Bb2917 protein CAATCGCTGCCGTACCAAA AGCCGGCAGTAGGGATCGT putative Bb3223 aminotransferase GCCGTGCCCGGATACTT TGCCGCACATCACTTCGT LysR-family Bb4719 transcriptional regulator GCACCAGGAGGGCATCCT GCCTGGGTCAGGTGATGAAA AsnC-family Bb4803 transcriptional regulator AATCCTTCCGTCCCTTTGGA GCAGTCACGCTGCATTTGG Bb4890 ptxA CGCCAGCTCGTACTTCGAA GATACGGCCGGCATTGTC putative bacterial Bb4897 secretion system protein GACGCGTATCTCGGTTCGA GGAGAACGCAACTCCATCATTT putative membrane Bb4898 protein GCCGCTGGTCTATTCCATGA GCCGGATATGCCATTCGA LysE family efflux Bb4915 protein TCTCGACGTGGTTGACCTTTT CCCGGGCGAGAATGAGAT 16s rRNA TCAGCATGTCGCGGTGAAT TGTGACGGGCGGTGTGTA

150

PCR primers (* also used for RT-PCR) Gene Function Forward Primer Reverse Primer succinate- semialdehyde dehydrogenase BB0322 (gabD) TTATGTCGAGTGGTTCGCCGAAGA CATTGCGGAACTTGGACACCATCA cyclolysin- activating lysine- cyaC acyltransferase TCCTGCGATCAGTTCGGCATGGTA ATTCTGCTGCGATGCAATGACGTG bifunctional hemolysin- adenylate cyclase cyaA* precursor AATCGAGCGCATACGGTTACGA AGCATTGGCAAGCACGACATCATC cyclolysin secretion ATP-binding cyaB protein TACTTTGTTCTTGCCCGCTTCGAG ATGACATTGAGCGTTTCCATGGCG cyclolysin secretion cyaD protein ATATCTGGACAGCCAGTATGCCGA AGTATCCGGAGACACATGCAACAC cyclolysin secretion cyaE protein TTCGCAACAATGTGATGGCGGCAA ATAATGGCCCAGCGAAAGATCCAC probable LysR- family transcriptional cyaX regulator ATGGTGATGGATCTACGTTGGTTCCA CGCGCGTACATACAGATTTCCATTGG probable extracellular solute- BB0329 binding protein ATGAAACGCCTTCTCAATGCGCTGAC CAGCGCTTGTACAAGGCCTCGAAATC glutamate/aspartate transport system permease protein BB0330 (gltJ) AGGTGTTTCGCAACATCCCGCTGATT AAACCTGGAACGAGTACTCCTGCATG predicted peptide transport (ptp) ptp related genes ATCCTGGTGCAACTGAGGTTCTG AGGTTGTGGGTGATGAACAGCAG

151

Appendix D. Chapter 2, Colonization of Nasal Cavity and Trachea by strains 253 and RB50.

Groups of 3 mice were inoculated intranasally with 10^5.5 CFU of strain RB50 (closed diamonds) or strain 253 (open squares). Bacterial load in the trachea (top) and nasal cavity (bottom) were quantified 3, 7, 14, 28 and 56 days post-inoculation. Error bars indicate +/- the standard error. Colonization by strains RB50 and 253 were not statistically different in the trachea or nasal cavity over the course of infection.

152

Appendix E. Chapter 2. qRT-PCR Results

Fold Change in Standard Gene Gene Annotation, Function Gene Expression ◊ Deviation Bb0323 cyaC, cyclolysin-activating lysine-acyltransferase NA* NA Bb0324 cyaA, bifunctional hemolysin-adenylate cyclase precursor 513379.68 0.17 Bb0325 cyaB, cyclolysin secretion ATP-binding protein 69368.83 0.63 Bb0326 cyaD, cyclolysin secretion protein NA* NA Bb0327 cyaE, cyclolysin secretion protein 18617.00 1.02 Bb0328 cyaX, probable LysR-family transcriptional regulator -1.25 0.15 Bb0499 hypothetical protein 3.48 0.18 Bb0827 conserved hypothetical protein 43.74 0.42 Bb1008 substrate binding component of ABC transporter -47.86 0.50 Bb1168 putative exported protein 21.17 0.41 Bb1285 cyoC, cytochrome C -16.13 0.21 Bb1302 putative RNA polymerase sigma factor -15.56 0.12 Bb1467 pstC, phoW 2.09 0.12 Bb1607 Putative LysR-family transcriptional regulator -8.79 0.46 Bb1616 bopN, TTSS related gene 11.88 0.26 Bb1617 bsp22, TTSS related gene 40.01 0.43 Bb1620 bopD, TTSS related gene 11.99 0.24 Bb1622 bcrH2 15.37 0.12 Bb1638 brpL -1.26 0.13 Bb1644 alr, dadB 7.38 0.41 Bb2721 Putative transcriptional regulator -9.28 0.27 Bb2917 conserved hypothetical protein 11.99 0.24 Bb3223 putative aminotransferase 189.89 0.41 Bb4719 LysR-family transcriptional regulator -9.13 1.09 Bb4803 AsnC-family transcriptional regulator -21.32 0.49 Bb4890 ptxA, pertussis toxin precursor 1 -16.64 0.49 Bb4897 putative bacterial secretion system protein -33.93 0.14 Bb4898 putative membrane protein -280.04 0.10 Bb4915 LysE family efflux protein -15.14 0.12 NA: Not analyzed. * Difference in gene expression was too high to accurately calculate. ◊ Negative Fold-Change indicates the gene is more highly expressed by strain 253. Positive Fold-Change indicates the gene is more highly expressed by strain RB50.

153

Appendix F. Chapter 2. Western blot for protein expression of Ptx by Bordetella strains.

Western blot analysis for the presence of pertussis toxin (Ptx) in bacterial lysates of B. bronchiseptica strains 253, RB50, PP13 (RB50 expressing Ptx), B. pertussis strain 536 and 536Δptx. Membranes were probed with 1B7, a monoclonal antibody specific for the S1 subunit of Ptx.

154

Appendix G. Chapter 3. Clinical Reports Accompanying Stain RB50 and the ST32 strains 1289 and S308.

Strain 1289: This strain was isolated from the lungs of a female squirrel monkey that was recently imported to the United States from South America and had died. Below is the information provided in the necropsy report of this monkey at The Research Animal Diagnostic Laboratory at the University of Missouri. Summary: Animal had two small and one large intussusception. We did not identify a cause of the intussusception, but it is likely a contributing cause to this animal’s death. In addition, this animal had a severe pneumonia. Lung swabs cultured positive for Bordetella bronchiseptica. The colonic swabs were positive for Campylobacter jejuni and negative for Salmonella sp. and Shigella sp. Necropsy: Animal weighed 551.9 grams. It had mild blood staining in the perineal region. The gastrointestinal tract was completely empty. There were two small intussusceptions within the jejunum and ileum. These were only mildly swollen. There was one large intussusception from the ileum, through the ileocecocolic junction into the colon about 5 cm long. The distal portion of the intussusceptum was purple and appeared necrotic. The lung had approximately two milliliters of cloudy fluid. The right lung appeared firm and mottled and had fibrous stands attached. The left lung appeared normal. Histopathology: brain no significant lesions esophagus no significant lesions gastrointestinal large ileocecocolic intuscusseption characterized by an intussusceptum tract that has necrosis, blunting of the crypts and hemorrhage on the distal tip, the more proximal portion is composed of mostly healthy tissue intestine helminth larva characterized by several parasitic larva in tunnels throughout the mucosa with no inflammatory reaction; small intestinal intussusception characterized by the intestinal lumen expanded with a large discrete mass of inverted healthy mucosa kidney mild multifocal mineralized casts in the medullary tubules liver no significant lesions lung marked fibrinous pneumonia characterized by large collections of fibrinous material within the alveoli and bronchioles, granular proteinaceous pulmonary exudate, and pulmonary edema in the alveoli and bronchioles as well as multifocal collections of peribronchiolar and perivascular lymphocytic infiltrate; post-mortem autolysis precluded further analysis Quadriceps muscle no significant lesions spleen no significant lesions

Strain S308: This strain was isolated from the nasal cavity of a squirrel monkey in Stanford Research Animal Facility on 4/29/02. The monkey was euthanized at the animal facility due to acute pnuemonia.

155

Strain RB50: See Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect Immun 62:3381-90. In brief, strain RB50 was isolated from the nasal cavity of an asymptomatically infected rabbit.

156

Appendix H. Chapter 3. qRT-PCR Primer List.

qRT-PCR primers Gene Annotation, Gene Function Forward Primer Reverse Primer Bb0323 cyaC, HlyC TCGCGCCGATTCAACTG TGCAACCGGCACGTCAT Bb0324 cyaA, cya CACTGAGCAGAACAATCCTTTCC CGTGAGCATCTGGCTTTCAC Bb0325 cyaB CGCAGCTGTGGAACGATTT TCGGTACGGCAGTTCAGGAT Bb0326 cyaD CGGCGCCTACGACTATACGA TCCGGAGACACATGCAACAC Bb0327 cyaE GATCTTTCGCTGGGCCATT CGGCGAACACCGAGACA Bb0328 cyaX ATGGTGATGGATCTACGTTGGTT CGTGAACTGGCCGCATTC Bb0961 brkA CGACCACCGGGACAACAC GGGATCGTCGTCGAGATTGA Putative Bb1589 dioxygenase CGACAGGCGCGAAAACC ACGGCGTGTTCCACACATC Bb1620 bopD CGGCTCGGTGAAGACATCTAC GCCTCCCGCATCTGTTGA Bb1621 bopB GCTCAATTCGACGAGGCCTAT TGTGCGTACTCGCCATATCG Bb1627 bscL CGACTACTTCGCGGGTATCG GCGGACCGCGCTCAT Bb1628 bscN AGCCAGCCGGGTCATGA ATACGTCCGGCCAGGTACTTG Bb1638 brpL, btrS TGGTTTCTCCCCCGTCATC GCGTTGTCCGGTTTTTCG Bb1642 btrU CCGTCTGGCCGAGAACAA GGTGAAGACGCCTATCAGCAA Bb2012 sodB CCGGCACGGAGTTCGA GCCACCCGAGGACTTCTTG putative regulatory Bb2367 protein CGTTCCGGCCTCGACAT GACCGACGCGATCAATCC Bb2646 gdhA, gdh TTCCACCAGGACGTGACCTT GGCATTCTTGATCGACATCCA wcbA, kpsC, Bb2923 lipA GCGCTGATCTGCGTCAAGA ACCCGGTCCATCTGTTCCA Bb2993 fhaB GGAATCAGTGCCGACTTCGA AGTTCCCACCCAGATATTGGGTAT Bb2994 bvgA TTGACGATCACCCTGTACTGAGA TCGAATCCTTCCTTTTCCATCA Bb3045 phaA GCTGGGCGTGGTGATGTC AGCCGGTGGTGCCAATAG Bb3170 hfq ACGTGCCCGTGTCCATCT TCGATCTGCCCCTGAAGCT Bb3934 dnaK GGACGGCGAAATGCAGTT CGGAGATGATGTAGTCGATGATG Bb3942 fur CCGCCACGGCTTCGT TGCATGTCCGGCAACG Bb4506 rpoN GGCACAAGGCCGAAATCA ACGGCTTCGCAATGGATATC rpoH, htpR, Bb4835 hin, fam TGGAGGCCGCAAACATG GGCGTTGCCGGAAAGG 16s 16s TCAGCATGTCGCGGTGAAT TGTGACGGGCGGTGTGTA

157

Appendix I. Chapter 3. qRT-PCR Results.

Fold Change in Gene Gene Gene Annotation, Fucntion Expression ◊ Standard Deviation Bb0323 cyaC, HlyC 0.352005 0.17868 Bb0324 cyaA, cya 3.3264884 0.25941 Bb0325 cyaB 2.3429616 0.30069 Bb0326 cyaD 1.903516 0.40534 Bb0327 cyaE 9.1726166 0.40376 Bb0328 cyaX 1.1183202 0.42988 Bb0961 brkA 17.818862 0.56908 Bb1589 Putative dioxygenase -9.2151011 0.12061 Bb1620 bopD -2.615947 0.11525 Bb1621 bopB -12.888389 0.12759 Bb1627 bscL -12.3748 0.08395 Bb1628 bscN -11.21481 0.09686 Bb1638 brpL, btrS -9.2727676 0.11632 Bb1642 btrU -7.9117673 0.08632 Bb2012 sodB 7.2333636 0.20649 Bb2367 putative regulatory protein 27.793328 0.37503 Bb2646 gdhA, gdh 25.675729 0.48452 Bb2923 wcbA, kpsC, lipA -7.3530018 0.59929 Bb2993 fhaB 22.87976 0.27016 Bb2994 bvgA 5.1873582 0.25866 Bb3045 phaA -49.430628 0.38061 Bb3170 hfq 18.935216 0.99361 Bb3934 dnaK 23.14561 0.23601 Bb3942 fur 17.81063 0.23089 Bb4506 rpoN 7.6263884 0.24631 Bb4835 rpoH, htpR, hin, fam 17.456188 0.55644 16s 16s -1 0.15171 ◊ Negative Fold-Change indicates the gene is more highly expressed by strain 1289. Positive Fold-Change indicates the gene is more highly expressed by strain RB50.

158

Appendix J. Chapter 3. Colonization of Nasal Cavity and Trachea by strains 1289 and RB50 and Lungs by strains 448 and RB50.

Comparison of bacterial load of B. bronchiseptica strains RB50 and 1289 in the trachea and nasal cavity and strains RB50 and 448 in the lungs over time. Groups of 3-4 wild-type mice were inoculated with 1 x 104 CFU of B. bronchiseptica strain RB50 (closed diamonds) or strain 1289 (open squares) and bacterial load in the trachea (A) and nasal cavity (B) were quantified 0, 3, 7, 14 and 28 days post-inoculation. Bacterial load was not found to be significantly different between these strains in the trachea or nasal cavity (P = 0.211 and 0.266 respectively).Groups of 3-4 C57BL/6 mice were inoculated with 1 x 104CFU of B. bronchiseptica strain RB50 (closed diamonds) or strain 448 (open squares) and bacterial load in the lungs was quantified 3, 7, 14 and 28 days post-inoculation (C). Bacterial load was significantly higher upon inoculation with strain 448 (P-value < 0.05). Error bars indicate +/-the standard deviation.

159

VITA

Anne M. Buboltz The Pennsylvania State University [email protected] 115 Henning Building 814-865-9134 University Park, PA. 16802

EDUCATION: May 04’: B.S. Biology, University of Mary Washington, Overall GPA 3.1 Dec. 08’: Ph.D. Biochemistry, Microbiology and Molecular Biology (BMMB), Penn State University, GPA 3.55, Thesis defense completed September 23, 2008. RECENT POSITIONS: Summer 2003: Research Assistantship in Molecular Genetics, University of Delaware, Department of Animal and Food Sciences Fall 2003: Teaching and Laboratory Assistant for Immunology, University of Mary Washington Fall 04’-Spring 05’: Teaching Assistant for Introductory Microbiology (MICRO201) and Applied Microbiology (MICRO421), Penn State University, Department of BMMB PUBLICATIONS (CURRENT, SUBMITTED OR IN PREPARATION): Wolfe, D.N., P.B. Mann, A.M. Buboltz, and E.T. Harvill. 2007. Delayed role of tumor necrosis factor- alpha in overcoming the effects of pertussis toxin. J Infect Dis. 196:1228-36. Buboltz, A.M., T.L. Nicholson, M.R. Parette, S.E. Hester, J. Parkhill, and E.T. Harvill. 2008. Replacement of Adenylate Cyclase Toxin in a prominent lineage of B. bronchiseptica. J Bac. 190(15):5502-11. Buboltz, A.M., T.L. Nicholson., L.S. Weyrich, E.T. Harvill. Type Three Secretion System contributes to the increased virulence of a B. bronchiseptca lineage. Submitted I&I 11/6/08. Buboltz, A. M., T.L. Nicholson, Karanikas, A. Preston and E.T. Harvill. Recombination of O- Antigen loci in B. bronchiseptica aids in evasion of cross-immunity. Submitted I&I. 11/17/08. Wolfe, D.N. A.M. Buboltz and E.T. Harvill. Inefficient TLR4 stimulation enables B. parapertussis to avoid rapid antibody mediated clearance. Accepted PLoS ONE 11/24/08. Nicholson, T.L, A.M. Buboltz, E.T. Harvill and S. Brockmeier. Growth phase dependent changes in B. bronchiseptica transcriptome. In preparation. SELECTED INVITED TALKS AND POSTERS: November 2006: International Bordetella Conference. Paris, France. “Loss of Adenylate Cyclase Toxin among closely related B. bronchiseptica strains.” December 2007: Centre for Infectious Disease Dynamics. Penn State University. “Lineage Dependent variation in B. bronchiseptica virulence factor expression.” 60 min. research presentation. April 2008: Keystone Conference on Molecular Evolution as a Driving Force in Infectious Disease. Breckenridge, Colorado. “Replacement of Adenylate Cyclase Toxin in a prominent lineage of B. bronchiseptica”. 15 min. research presentation & poster. September 2008: Thesis Defense. BMMB Department. Penn State University. “Molecular Evolution of Virulence Factors in B. bronchiseptica.” 60 min. oral dissertation. AWARDS AND GRANTS RECEIVED: Fall 2004: BMMB Bunton-Waller Graduate Award ($2000) Spring 2005: BMMB Paul M. Althouse Outstanding Teaching Assistant Award ($500) Fall 2006: BMMB Paul Berg Travel, Veterinary and Biomedical Science Paul Hand and College of Agricultural Sciences Tag Along Travel Awards ($1300 total) Fall 2007: College of Agricultural Sciences (CAS) Tag Along Travel Award ($1000) Fall 2006: CAS Competitive Research Grant ($2000) Fall 2006: CAS Seed Research Grant/Huck Institute matched (with Dr. Eric Harvill) ($30,000) Spring 2008: CAS Graduate Student and Institute of Molecular Evolutionary Genetics Travel Awards ($550 total)