The Discovery of Wyosine Biosynthesis in Mitochondria Paul J

4262–4273 Nucleic Acids Research, 2015, Vol. 43, No. 8 Published online 6 April 2015 doi: 10.1093/nar/gkv286 A common tRNA modification at an unusual location: the discovery of wyosine biosynthesis in mitochondria Paul J. Sample1, Ludekˇ Korenˇ y´ 2, Zdenekˇ Paris1, Kirk W. Gaston3, Mary Anne T. Rubio1,Ian M.C. Fleming1, Scott Hinger1,EvaHorakov´ a´ 2, Patrick A. Limbach3, Julius Lukesˇ 2,4 and Juan D. Alfonzo1,3,5,* 1Department of Microbiology and The Center for RNA Biology, The Ohio State University, Columbus, OH 43210, USA, 2Institute of Parasitology, Biology Centre and Faculty of Sciences, University of South Bohemia, 37005 Ceskˇ e´ Budejoviceˇ (Budweis), Czech Republic, 3Rieveschl Laboratories for Mass Spectrometry, Department of Chemistry, University of Cincinnati, Cincinnati, OH 45221, USA, 4Canadian Institute For Advanced Research, Toronto, ON M5G 1Z8, Canada and 5Ohio State Biochemistry Program, The Ohio State University, Columbus, Ohio 43210, USA Received February 25, 2015; Revised March 21, 2015; Accepted March 24, 2015 ABSTRACT INTRODUCTION Establishment of the early genetic code likely A defining feature of all tRNAs is the presence of numer- required strategies to ensure translational ous post-transcriptional chemical modifications (1,2). Be- accuracy and inevitably involved tRNA post- cause some modifications are common to all tRNAs inall transcriptional modifications. One such modifica- domains of life, it has been suggested that such ‘primor- tion, wybutosine/wyosine is crucial for translational dial’ nucleosides were essential in ensuring reading-frame maintenance early in the evolution of translational sys- fidelity in Archaea and Eukarya; yet it does not tems (3–7). Although many positions in a tRNA can af- occur in Bacteria and has never been described in fect translational accuracy, position 37 of the anticodon mitochondria. Here, we present genetic, molecular loop plays an important, if not a critical, role in reading- and mass spectromery data demonstrating the first frame maintenance (6,8,9). This universally modified po- example of wyosine in mitochondria, a situation sition may harbor simple base methylations (such as 1- thus far unique to kinetoplastids. We also show that methylguanosine, m1G), which in the context of a specific these modifications are important for mitochondrial tRNA anticodon and depending on the inherent stability function, underscoring their biological significance. of anticodon-codon interactions, may be sufficient to pre- This work focuses on TyW1, the enzyme required vent translational errors. Other tRNAs may require more complex chemical groups such as N6-isopentenyladenosine for the most critical step of wyosine biosynthe- 6 6 sis. Based on molecular phylogeny, we suggest (i A) and N6-threonyladenosine (t A) (10–12). One of the most chemically intricate modifications that that the kinetoplastids pathways evolved via gene occur at position 37 of the anticodon loop involves the nu- duplication and acquisition of an FMN-binding cleoside wyosine (imG) and its derivatives, including wybu- domain now prevalent in TyW1 of most eukaryotes. tosine (yW) and hydroxywybutosine (OHyW) (5). Wyosine Phe These findings are discussed in the context of the derivatives are exclusively found in the single tRNA GAA extensive U-insertion RNA editing in trypanosome of Archaea and Eukarya, but despite its omnipresence, the mitochondria, which may have provided selective pathway varies greatly between these organisms. The eu- pressure for maintenance of mitochondrial wyosine karyotic pathway involves at least four sequential reactions 1 in this lineage. that use 1-methylguanosine (m G37), as a precursor (13). 1 The m G37 modification is itself the product of a phyloge- netically widespread methylation found in all domains of 1 life (14–17). Formation of m G37 is followed by the incor- poration of the C-1 and C-2 carbons of pyruvate by the *To whom correspondence should be addressed. Tel: +1 614 292 0004; Email: [email protected] Present addresses: Ludekˇ Koren´ˇ y, Division of Biological Chemistry and Drug Discovery, University of Dundee, Dundee, Scotland. Zdenekˇ Paris, Institute of Parasitology, Biology Centre, Ceskˇ eBud´ ejoviceˇ (Budweis), Czech Republic. C The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2015, Vol. 43, No. 8 4263 radical-SAM enzyme TYW1 to form an additional ring to a non-induced control grown in the absence of tetracy- on the methylated purine (18,19). The resulting product cline and a similar growth curve performed using wild type constitutes the minimal core of the modification, with 4- cells. Targeted gene down-regulation was confirmed by RT- demethylwyosine (imG-14) as its simplest form (19). What PCR, as described below. follows this core tricyclic component is a series of reactions that vary among different organisms. For example, in most RT-PCR and qPCR eukaryotes the end product of the reaction is the nucleoside wybutosine (yW) (not shown in Figure 1A), the product of 3 Total T. brucei RNA was isolated using standard pro- additional enzymes in yeast (TYW2–TYW4) (13). In some tocols RNA (5 ␮g) was used for all RT-PCR reac- organisms, including humans, yW can be further modified tions following the manufacturer instructions (In- by a fifth enzyme, TYW5, to hydroxywybutosine (OHyW) vitrogen). Reverse primers specific for TYW1L (5 - (20)(Figure1A). TGATGACATCATCATTAGAGGAGC-3) and TYW1S In Archaea, the situation varies even more, with most (5-GTCGTGTGGGTTATCGACTTGC-3)wereused species having at least one type of wyosine derivative to generate cDNA. The resulting cDNAs were used ranging from 4-demethylwyosine (imG-14, the product of in PCR amplification reactions using the same re- TAW1) to isowyosine (imG2), wyosine (imG), methylwyo- verse primers, a forward primer specific for TYW1L sine (mimG), 7-carboxypropyl-demethylwyosine (yW-86) (5-CGTTGGCTGTTGGGTGTTAACG-3), and a and/or 7-aminocarboxypropylwyosine (yW-72) (21). This forward primer specific for the 5 UTR of TYW1S (5- diversity is created by TAW1, TAW2 and TAW3, which can TCGCCCGATGCTTTCGGAGC-3). Products were act in a strictly sequential pathway or in a combinatorial then analyzed by agarose gel electrophoresis. For each manner. Among these, most striking is the presence of a RNAi experiment the complete set of 4 primers (for pathway shared by some Crenarchaeota (Figure 1B), which TYW1L and TYW1S, respectively) were used to ensure lacks TAW2 and involves only TAW1 and TAW3, yielding that the RNAi down-regulation of one of the genes imG as the end product (21). did not affect the other, ruling out off-target effects. Wyosine and derivatives are thus far absent in Bacteria A similar reaction incubated in the absence of reverse Phe and instead bacterial tRNA has an encoded A37, which transcriptase served as a negative control (RT-) and as a then can be modified to i6A (or ms2i6A), given their shared control for DNA contamination. Quantitative real-time ancestry, the same is expected of mitochondria (6,22,23). PCR was performed with total RNA isolated from each However, in protists such as T. brucei, there is a complete cell line as described previously (26). The QuantiTect lack of tRNA genes in the mitochondrial genome (24). Reverse Transcription Kit (QIAGEN) and Oligo (dT)20 These organisms are therefore forced to import all of their (invitrogen) were used to generate cDNA. Quantitative tRNAs from the cytosol for organellar translation; their real-time PCR was performed as described elsewhere strategy for reading frame maintenance during translation (10). The primer pair Tyw1S-qPCR-FW (5GCTCGC then becomes of particular interest. TTGTGTGAGACTATAC3) and Tyw1S-qPCR-RV In the present study, we report two distinct pathways (5GTGTGCCAAACACCATCAAC3), Tyw1L-qPCR- for wyosine biosynthesis and its derivatives in trypanoso- FW (5CGGCTGACTCTCGTGAATAAA3)andTyw1L- matids: one cytosolic and the other mitochondrial. The qPCR-RV (5GGTGAGTGTTGATGTGCTACT3) coexistence of these two pathways is made possible by were used to detect Tyw1S and Tyw1L mRNA re- the trypanosomatid-specific presence of two TYW1 en- spectively. The primer pair of 18SrRNA 18S-qPCR-F zymes yielding different wyosine derivatives as end prod- (5GATTTTGGGCAACAGCAGGTC3) and 18S-qPCR- ucts: wybutosine/hydroxywybutosine, found in the cytosol R(5CCTACGAGACATTCCTCGTTGC3) was used as and mitochondrion, and wyosine, strictly confined to the an internal reference. mitochondrion. This represents the first example of an organellar wyosine pathway with implications for how the Western blot and immunofluorescence pathway evolved in eukaryotes and suggesting a new strategy for translational fidelity in mitochondrial systems. The protein coding regions of TYW1L and TYW1S were separately cloned into the T. brucei protein expression vec- MATERIALS AND METHODS tor pLew79-V5. This vector places a V5-epitope tag at the C-terminus of each protein. These constructs were individ- RNA interference ually transformed into procyclic T. brucei 29–13 cells and Portions of the coding sequence of the TYW1L and clonal cell lines were established as described before. Cells TYWS genes from Trypanosoma brucei were cloned into the were RNAi-induced by the addition

Load more