US010653712B2
United States Patent ( 10 ) Patent No.: US 10,653,712 B2 Hoge et al. (45 ) Date of Patent : May 19 , 2020
(54 ) HIGH PURITY RNA COMPOSITIONS AND 6,528,262 B1 3/2003 Gilad et al. METHODS FOR PREPARATION THEREOF 8,383,340 B2 2/2013 Ketterer et al. 8,710,200 B2 4/2014 Schrum et al . 8,754,062 B2 6/2014 De Fougerolles et al. (71 ) Applicant: Moderna TX , Inc., Cambridge, MA 8,822,663 B2 9/2014 Schrum et al. (US ) 8,999,380 B2 4/2015 Bancel et al. 9,221,891 B2 12/2015 Bancel et al. (72 ) Inventors : Stephen Hoge , Brookline , MA (US ) ; 9,303,079 B2 4/2016 Bancel et al. 9,464,124 B2 10/2016 Bancel et al. William Issa , Dedham , MA (US ) ; 9,512,456 B2 12/2016 Wang et al. Edward J. Miracco , Arlington , MA 9,597,380 B2 3/2017 Chakraborty et al . (US ) ; Jennifer Nelson , Brookline, MA 9,868,691 B2 1/2018 Benenato et al. (US ) ; Amy E. Rabideau , Waltham , MA 9,872,900 B2 1/2018 Ciaramella et al. 10,064,934 B2 9/2018 Ciaramella et al. (US ) ; Gabor Butora , Martinsville , NJ 10,064,935 B2 9/2018 Ciaramella et al . (US ) 10,124,055 B2 11/2018 Ciaramella et al. 10,207,010 B2 2/2019 Besin et al. ( 73 ) Assignee : ModernaTX , Inc., Cambridge , MA 10,273,269 B2 4/2019 Ciaramella (US ) 2001/0001066 Al 5/2001 Cezayirli et al. 2001/0005506 A1 6/2001 Cezayirli et al . Subject to any disclaimer , the term of this 2006/0247195 A1 11/2006 Ray ( * ) Notice : 2007/0281336 A1 12/2007 Jendrisak et al . patent is extended or adjusted under 35 2008/0220471 A1 9/2008 Davis et al . U.S.C. 154 ( b ) by 0 days. 2010/0028943 Al 2/2010 Thomas et al. 2010/0048883 A1 2/2010 Ketterer et al. ( 21) Appl. No .: 16 /001,786 2010/0291156 Al 11/2010 Barner et al . 2012/0301955 A1 11/2012 Thomas et al. 2013/0102034 Al 4/2013 Schrum et al. ( 22 ) Filed : Jun . 6 , 2018 2013/0259923 A1 10/2013 Bancel et al. 2013/0266640 A1 10/2013 De Fougerolles et al . (65 ) Prior Publication Data 2014/0142290 A1 5/2014 Madden et al. US 2018/0363019 A1 Dec. 20 , 2018 (Continued ) Related U.S. Application Data FOREIGN PATENT DOCUMENTS (63 ) Continuation of application No. EP 2092064 B1 9/2010 PCT/ US2017 /051674 , filed on Sep. 14 , 2017 . WO WO 2005/118857 A2 12/2005 ( Continued ) (60 ) Provisional application No. 62/ 394,711 , filed on Sep. 14 , 2016 . OTHER PUBLICATIONS Edelmann , et al. (2014 ) Methods, v.65 ( 3 ): 333-41 . ( Year: 2014 ). * (51 ) Int. CI. Gruegelsiepe, et al . Handbook of RNA Biochemistry , ed . R.K. C12P 19/34 ( 2006.01 ) Hartmann , Part I.1 , pp . 3-21 , 2005. ( Year: 2005) . * A61K 31/7105 ( 2006.01 ) Nedialkov , et al. ( 2003 ) NTP -driven Translocation by Human RNA COZK 14/505 ( 2006.01 ) Polymerase II. The Journal of Biological Chemistry , vol . 278( 20 ) :18303 A61P 33/00 (2006.01 ) 18312. ( Year : 2003 ). * A61P 31/12 ( 2006.01) U.S. Appl . No. 15 /089,050 , filed Apr. 1 , 2016 , Ciaramella et al. A61P 31/04 U.S. Appl . No. 15 /674,569 , filed Aug. 11 , 2017 , Ciaramella et al. ( 2006.01 ) U.S. Appl . No. 15 /674,585 , filed Aug. 11, 2017, Ciaramella et al. A61P 35/00 ( 2006.01 ) U.S. Appl. No. 15/ 674,591 , filed Aug. 11, 2017, Ciaramella et al . C12N 15/10 ( 2006.01 ) U.S. Appl. No. 15 / 266,791 , filed Sep. 15 , 2016 , Bancel et al . GOIN 33/68 (2006.01 ) U.S. Appl. No. 15 / 905,576 , filed Feb. 26 , 2018 , Bancel et al. ( 52 ) U.S. Cl. U.S. Appl. No. 15 /674,872 , filed Aug. 11 , 2017 , Besin et al. ??? A61K 31/7105 ( 2013.01 ) ; A61P 31/04 (Continued ) (2018.01 ) ; A61P 31/12 ( 2018.01) ; A61P 33/00 ( 2018.01) ; A61P 35/00 (2018.01 ) ; CO7K Primary Examiner Jennifer Pitrak McDonald 14/505 ( 2013.01 ) ; C12N 15/10 ( 2013.01 ) ; ( 74 ) Attorney , Agent, or Firm Wolf , Greenfield & C12P 19/34 ( 2013.01 ) ; GOIN 3376851 Sacks, P.C. (2013.01 ) (57 ) ABSTRACT The invention relates to improved RNA compositions for ( 58 ) Field of Classification Search use in therapeutic applications . The RNA compositions are None particularly suited for use in human therapeutic application See application file for complete search history. ( e.g., in RNA therapeutics ) . The RNA compositions are made by improved processes, in particular , improved in (56 ) References Cited vitro - transcription ( IVT) processes. The invention also relates to methods for producing and purifying RNA ( e.g , U.S. PATENT DOCUM TS therapeutic RNAs ), as well as methods for using the RNA 5,756,264 A 5/1998 Schwartz et al . compositions and therapeutic applications thereof. 6,022,715 A 2/2000 Merenkova et al . 6,096,503 A 8/2000 Sutcliffe et al . 18 Claims, 72 Drawing Sheets 6,100,024 A 8/2000 Hudson et al . Specification includes a Sequence Listing. US 10,653,712 B2 Page 2
( 56 ) References Cited WO WO 2018/170256 Al 9/2018 WO WO 2018/170260 A1 9/2018 U.S. PATENT DOCUMENTS WO WO 2018/170270 A1 9/2018 WO WO 2018/170347 A1 9/2018 2014/0147432 A1 5/2014 Bancel et al . WO WO 2018/175783 A1 9/2018 2014/0148502 A1 5/2014 Bancel et al . WO WO 2018/187590 A2 10/2018 2014/0193482 A1 7/2014 Bancel et al. WO WO 2018/200737 A1 11/2018 2014/0206752 Al 7/2014 Afeyan et al . WO WO 2018/232355 Al 12/2018 2014/0378538 Al 12/2014 Bancel WO WO 2018/232357 A1 12/2018 2015/0141499 A1 5/2015 Bancel et al. WO WO 2019/036670 A1 2/2019 2015/0307542 Al 10/2015 Roy et al. WO WO 2019/036682 A1 2/2019 2015/0315541 A1 11/2015 Bancel et al. WO WO 2019/036683 A1 2/2019 2016/0024141 A1 1/2016 Issa et al. WO WO 2019/036685 Al 2/2019 2016/0032273 A1 2/2016 Shahrokh et al. WO WO 2019/103993 Al 5/2019 2016/0038612 A1 2/2016 Hoge et al. 2016/0317647 A1 11/2016 Ciaramella et al. 2017/0202979 Al 7/2017 Chakraborty et al. OTHER PUBLICATIONS 2017/0340724 A1 11/2017 Ciaramella et al . 2017/0340725 A1 11/2017 Ciaramella et al . U.S. Appl. No. 15 /674,599 , filed Aug. 11 , 2017, Ciaramella et al. 2018/0000953 A1 1/2018 Almarsson et al. PCT/ US2017 /051674 , dated Dec. 14 , 2017 , International Search 2018/0002393 A1 1/2018 Bancel et al. Report and Written Opinion . 2018/0028645 Al 2/2018 Ciaramella et al. [No Author Listed ], MEGAscript Kit Product Manual, Oct. 27 , 2018/0028664 Al 2/2018 Besin et al. 2009. Ambion/ Invitrogen website : http://lools.invitrogen.com/contenl/ 2018/0237849 Al 8/2018 Thompson 2018/0243225 A1 8/2018 Ciaramella sfs/ manuals / cms_072987.pdf, ( last accessed Mar. 17, 2013 ). 2018/0243230 A1 8/2018 Smith Andrews -Pfannkoch , C. et al. , Hydroxyapatite -mediated separation 2018/0271970 A1 9/2018 Ciaramella et al . of double - stranded DNA , single - stranded DNA , and RNA genomes 2018/0273977 Al 9/2018 Mousavi et al. from natural viral assemblages. Appl Environ Microbiol . Aug. 2018/0274009 A1 9/2018 Marquardt et al. 2010 ;76 ( 15 ) :5039-45 . Epub Jun . 11, 2010 . 2018/0280496 Al 10/2018 Ciaramella et al . Devoldere et al. , Evading innate immunity in nonviral mRNA 2018/0289792 Al 10/2018 Ciaramella et al . 2018/0303929 Al 10/2018 Ciaramella et al . delivery : don't shoot the messenger. Drug Discov Today . Jan. 2018/0311336 A1 11/2018 Ciaramella et al. 2016 ;21 ( 1 ) :11-25 . doi: 10.1016 /j.drudis.2015.07.009 . Epub Jul. 23 , 2018/0312549 A1 11/2018 Ciaramella 2015 . 2018/0318409 A1 11/2018 Valiante et al. Easton et al. , Rapid , nondenaturing RNA purification using weak 2018/0363019 Al 12/2018 Hoge anion -exchange fast performance liquid chromatography . RNA. 2019/0008938 A1 1/2019 Ciaramella et al. Mar. 2010; 16 ( 3 ): 647-53 . Epub Jan. 25, 2010 . 2019/0099481 A1 4/2019 Ciaramella et al . Georgopoulos et al. , Use of high - performance liquid chromato 2019/0192646 Al 6/2019 Cohen et al . graphic fractionation of large RNA molecules in the assay of group I intron ribozyme activity. J Chromatogr A. Jan.28 , 2000 ;868 ( 1) : 109 FOREIGN PATENT DOCUMENTS 14 . Kariko et al. , Generating the optimal mRNA for therapy : HPLC WO WO 2008/077592 Al 7/2008 purification eliminates immune activation and improves translation WO WO 2011/071931 A2 6/2011 of nucleoside- modified , protein - encoding mRNA . Nucleic Acids WO WO 2013/102203 Al 7/2013 Res. Nov. 2011 ;39 ( 21 ) :e142 . WO WO 2014/140211 Al 9/2014 Kauffman et al. , Optimization of Lipid Nanoparticle Formulations WO WO 2014/152966 Al 9/2014 WO WO 2014/160243 A1 10/2014 for mRNA Delivery in Vivo with Fractional Factorial and Definitive WO WO - 2015188933 A1 * 12/2015 C12Q 1/6844 Screening Designs. Nano Lett . Nov. 11 , 2015 ; 15 ( 11 ): 7300-6 . doi: WO WO 2016/164762 A1 10/2016 10.1021/ acs.nanolett.5b02497 . Epub Oct. 20 , 2015. WO WO 2016/201377 A1 12/2016 Koch , G., et al ., Quantitative Studies on the Infectivity of ribo WO WO 2017/015457 Al 1/2017 nucleic acid from partially purified and highly purified poliovirus WO WO 2017/015463 A1 1/2017 preparations. Virology . Mar. 1960 ; 10 ( 3 ) : 329-343 . WO WO 2017/019935 Al 2/2017 Lewandowski, L.J. et al. , Separation of the infectious ribonucleic WO WO 2017/020026 A1 2/2017 acid of potato spindle tuber virus from double - stranded ribonucleic WO WO 2017/031232 A1 2/2017 acid of plant tissue extracts . J Virol . Nov. 1971 ; 8 ( 5 ) :809-12 . WO WO 2017/031241 A1 2/2017 Mellits, K.H. et al. , Removal of double - stranded contaminants from WO WO 2017/062513 A1 4/2017 WO WO 2017/066789 Al 4/2017 RNA transcripts: synthesis of adenovirus VA RNAI from a T7 WO WO 2017/070601 A1 4/2017 vector. Nucleic Acids Res. Sep. 25 , 1990 ;18 ( 18 ): 5401-6 . WO WO 2017/070616 A1 4/2017 Sahin et al. , mRNA - based therapeutics developing a new class of WO WO 2017/070618 A1 4/2017 drugs . Nat Rev Drug Discov. Oct. 2014 ; 13 ( 10 ): 759-80 . doi: 10.1038 / WO WO 2017/070620 A1 4/2017 nrd4278 . Epub Sep. 19 , 2014 . WO WO 2017/070622 A1 4/2017 Steinle et al ., Concise Review : Application of In Vitro Transcribed WO WO 2017/070623 A1 4/2017 Messenger RNA for Cellular Engineering and Reprogramming : WO WO 2017/201333 A1 11/2017 Progress and Challenges. Stem Cells . Jan. 2017 ; 35 ( 1) : 68-79 . doi: WO WO 2017/201340 A1 11/2017 10.1002 / stem.2402 . Epub Jun . 20 , 2016 . WO WO 2017/201342 Al 11/2017 Thess et al. , Sequence- engineered mRNA Without Chemical Nucleoside WO WO 2017/201347 Al 11/2017 Modifications Enables an Effective Protein Therapy in Large Ani WO WO 2018/053209 Al 3/2018 mals . Mol Ther . Sep. 2015 ; 23 ( 9 ) : 1456-64. doi: 10.1038/ mt.2015 . WO WO 2018/075980 A1 4/2018 WO WO 2018/081459 Al 5/2018 103. Epub Jun . 8 , 2015 . WO WO 2018/081462 A1 5/2018 Wang et al ., Purification of the messenger ribonucleic acid for the WO WO 2018/089851 A1 5/2018 lipoprotein of the Escherichia coli outer membrane . Biochemistry . WO WO 2018/107088 A1 6/2018 Oct. 2 , 1979 ; 18 ( 20 ) :4270-7 . WO WO 2018/111967 Al 6/2018 Weissman et al. , HPLC purification of in vitro transcribed long WO WO 2018/144082 A1 8/2018 RNA . Methods Mol Biol. 2013 ; 969 :43-54 . doi: 10.1007 /978-1 WO WO 2018/144778 A1 8/2018 62703-260-5_3 . WO WO 2018/170245 A1 9/2018 U.S. Appl . No. 90 /014,167 , filed Aug. 17 , 2018, Ciaramella et al. US 10,653,712 B2 Page 3
( 56 ) References Cited U.S. Appl . No. 15 / 767,618 , filed Apr. 11, 2018 , Ciaramella et al . U.S. Appl. No. 16 / 136,386 , filed Sep. 20 , 2018 , Ciaramella et al. OTHER PUBLICATIONS U.S. Appl . No. 16 / 136,503 , filed Sep. 20 , 2018 , Ciaramella et al. U.S. Appl. No. 15 / 746,286 , filed Jan. 19 , 2018, Ciaramella et al . U.S. Appl. No. 16 /040,981 , filed Jul . 20 , 2018 , Ciaramella et al . U.S. Appl. No. 16 /031,951 , filed Jul. 10 , 2018 , Ciaramella . U.S. Appl. No. 16 /009,811 , filed Jun . 15 , 2018 , Ciaramella et al . [No Author Listed ], MEGAscript RNAi Kit Instruction Manual, U.S. Appl . No. 16 /009,848 , filed Jun . 15 , 2018 , Ciaramella et al . Oct. 2009. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/ U.S. Appl. No. 16 / 009,880 , filed Jun . 15 , 2018 , Ciaramella et al . cms_072987.pdf, ( last accessed Jul . 10 , 2019 ). U.S. Appl. No. 15 /981,762 , filed May 16 , 2018 , Bancel et al . U.S. Appl. No. 15 /239,613 , filed Aug. 17 , 2016 , Laska et al . U.S. Appl . No. 15 /387,263 , filed Dec. 21 , 2016 , Chen et al. U.S. Appl. No. 16 /036,318 , filed Jul. 16 , 2018 , Ciaramella et al. U.S. Appl . No. 15 /674,107 , filed Aug. 10 , 2017 , Besin et al. U.S. Appl. No. 16 / 048,154 , filed Jul. 27 , 2018 , Ciaramella et al. U.S. Appl. No. 16 /229,509 , filed Dec. 21, 2018 , Besin et al. U.S. Appl. No. 16 / 144,394 , filed Sep. 27 , 2018 , Ciaramella et al . U.S. Appl. No. 16 / 333,330 , filed Mar. 14 , 2019 , Hoge et al. U.S. Appl . No. 15 /748,773 , filed Jan. 30 , 2018, Ciaramella et al. U.S. Appl . No. 16 /389,545 , filed Apr. 19 , 2019 , Ciaramella et al. U.S. Appl . No. 15 / 155,986 , filed May 16 , 2016 , Fritz . U.S. Appl. No. 16 / 368,099, filed Mar. 28, 2019 , Ciaramella et al. U.S. Appl. No. 15 /753,293 , filed Feb. 17 , 2018 , Smith . U.S. Appl. No. 16 / 368,270 , filed Mar. 28 , 2019 , Ciaramella et al. U.S. Appl. No. 15/ 753,297 , filed Feb. 17, 2018 , Thompson . U.S. Appl. No. 16 /468,838 , filed Jun . 12, 2019 , Miracco . U.S. Appl. No. 15 /748,782 , filed Jan. 30 , 2018 , Mousavi et al. U.S. Appl. No. 16 / 001,765, filed Jun . 6 , 2018 , Marquardt et al. U.S. Appl. No. 16 /001,751 , filed Jun . 6 , 2018 , Mousavi et al U.S. Appl . No. 16 / 348,943 , filed May 10 , 2019 , Ciaramella . U.S. Appl. No. 15 / 156,249 , filed May 16 , 2016 , Miracco . U.S. Appl . No. 16 /467,142 , filed Jun . 6 , 2019 , Ciaramella et al. U.S. Appl. No. 15 /767,587 , filed Apr. 11 , 2018 , Ciaramella . U.S. Appl. No. 15 / 880,436 , filed Jan. 25 , 2018 , Ciaramella . U.S. Appl. No. 16 / 006,526 , filed Jun . 12, 2018 , Ciaramella . U.S. Appl. No. 16 /432,541 , Jun . 5 , 2019 , Rabideau et al . U.S. Appl. No. 16 /450,882 , filed Jun . 24 , 2019 , Ciaramella . U.S. Appl. No. 16 / 362,366 , filed Mar. 22 , 2019 , Ciaramella . U.S. Appl. No. 15 /767,600 , filed Apr. 11, 2018 , Ciaramella et al. U.S. Appl. No. 16 / 302,607 , filed Nov. 16 , 2018 , Benenato et al . U.S. Appl . No. 16 /023,013 , filed Jun . 29 , 2018 , Ciaramella et al. U.S. Appl. No. 16 / 131,793, filed Sep. 14 , 2018 , Ciaramella et al. U.S. Appl. No. 15 /769,710 , filed Apr. 19 , 2018, Ciaramella et al . U.S. Appl. No. 16 / 180,076 , filed Nov. 5 , 2018 , Cohen et al . U.S. Appl. No. 15 /767,609 , filed Apr. 11 , 2018 , Ciaramella et al . U.S. Appl. No. 15 /767,613 , filed Apr. 11, 2018 , Ciaramella et al. * cited by examiner Sin ' JU?red Rew 61 0707 j?YS I JO TL SN TIL'ESI'OI TI
dT alpha 1 RNA Surrogate DT EQ 1 RNA Surrogate UF alpha 1 RNA Surrogate UF EQ 1 RNA Surrogate feed alpha 1 RNA Surrogate feed EQ 1 RNA Surrogate
L2K 2 Factor Growth 1 Factor Growth G5 hEPO G2 hEPO GO hEPO G5 LUC G2 nLUC GO nLUC 2500 2000 1500 1000 500 )mL / pg ( IFNbeta 1Figure U.S. Patent May 19 , 2020 Sheet 2 of 72 US 10,653,712 B2
CUCUUAUUUCCC=3868.5SEQIDNO:1 SEQIDNO:1CUCUUAUUUCCC=3952.5 CUCUUAUUUCCC4048.3=SEQIDNO:1
7.5 7.5
7 7
6.5 6.5
Da 6 O
1 5.5 5.5 5.5
5
5 Counts(%)vs.AcquisitionTimemin 5 Counts(%)vs.AcquisitionTimemin 4.5 Counts(%)vs.AcquisitionTimemin
4 4 Alpha Alpha Equi Alpha Equi 3.54 3.5 3.534.5
3 WAAVAA 3 2,5 2.5
2
2 2 GOESITICScanFrag365.0V= ScanFrag=365.0VG5ESITIC G6-ESITICScanFrag=365.0V 1.5
7 12 3 24 2 3 2 3.24 2.8 2.6 2.4 2.2 2.87 2.6 2.4 2.2 3.5 2:5 Figure2 n S ' JU?d Rew '61 0707 j??YS E JO TL SN TIL'ESI'OI TI
dT alpha G6 1 RNA Surrogate DT EQ G6 1 RNA Surrogate dT alpha G5 1 RNA Surrogate dT EQ G5 1 RNA Surrogate dT alpha G0 1 RNA Surrogate DT EQ GO 1 RNA Surrogate
L2K 2 Factor Growth 1 Factor Growth G5 hEPO G2 HEPO GO hEPO G5 LUC G2 NLUC GO nLUC 3500 3000 2500 2000 1500 1000 500 0 Figure2(continued) )mL / pg( IFNbeta U.S. Patent May 19, 2020 Sheet 4 of 72 US 10,653,712 B2
2 7.64fer 7.27 U20 6.81 6.67 6.4 ht 6.2 COOMOOOOOOOOcoyCQCONVOY Counts(%Acquisition)vs.Timemin Counts(Acquisition%)vs.Timemin GGGAA
187 2.67 2.4 -ESITICScanFrag=365.0V x10ESITICScanFrag=365.0V 365.0VFrag=ScanTICESIx107 Frag=365.0VESITICScanx10
2 1.50 3 0.5 0 2.5 2 1.5 1 0.57 x107 0.8 Surrogate RNA2EQ SurrogateRNA 2alpha hEPOEQ hEPOalpha Figure3 U.S. Patent May 19 , 2020 Sheet 5 of 72 US 10,653,712 B2 win www
+T7 -T7 3.804.004.204.404.604.805.005.205.405.605.806.006.206.406.606.807.007.207.407.607.808.008.208.408.608.809.009.209.409.60 Minutes wah
Figure4 0.0150 0.0145 0.01401 0.01351 0.01301 20.01251 0.01201 0.0115 0.01101 0.0105 0.01001 0.00901 U.S. Patent May 19 , 2020 Sheet 6 of 72 US 10,653,712 B2 Figure 4 ( continued )
1,800 birinin 1,600 1,400 1,200 IFNbeta(pg/mL) 1,000
800
600
400
200
0 Odu09 G2nLuc nLucG5 hEPOG5*T7Reaction hEPOG5-17Reactionby U.S. Patent May 19 , 2020 Sheet 7 of 72 US 10,653,712 B2
RNaseIII GSEq RNasein Alpha
Size(nt) Size(nt) RNaseIII AlphaRP1184:G5(UntreatedAlphaRP183 :G5(weniger 2000+reductionindsRNA B2:G5EquiRPRNaseIII5500(1)Untreated)81:G5EquiRP 50004(0 Synergistic
0 6000 4500 40002 3500 30004 25004 20004 15004 10004 5004 6000 55001 5000 45001 40001 35001 men3000 2500 1500 1000 ogleNaseTreatment RNaselllTreatment Oood RNase1 RNaseIll G5EQ NoRP Alpha
200
Size(nt) RNaseilRPG5EquiNoA2:(1/ RNaseIIIAlphaRPNo8500A4:G5(1) UntreatedEquiNoRPA1:G5(1) Size(nt) 800010A3:G5AlphaRPUntreated 50001 3500 2500 20004 1500 1000 5001 75001 60001 500 3500 30001 2500120004 15001 10001 5007 -500 AppearanceoflowerMW4500 5AFigure trace------speciesin correlatesRNaseIII) (+dsRNAwithamoutof impurityinsample U.S. Patent May 19 , 2020 Sheet 8 of 72 US 10,653,712 B2 Figure 5B
47504500 (1 ) A8 : GO Equi No RP RNase III 4250- ( 1) A7 : GO Equi No RP Untreated 4000 3750 3500 3250 3000 2750 GO eq 2500 2250 NO RP 2000 1750 +/- RNase III 1500 859 1250 1000 750 20 500 250 -250 -02 200 Size (int ) 2000 6000 3200 ( 1) B8 :GO EquiRP RNase III 3000 ( 1) B7 : GO Equi RP Untreated 2800 2600 2400 2200 2000 1800 GO eq 1600 +/- RNase III
800 20
200
-200 200 500 Size (nt ) S'n ' ju?jd Rew 070761 J??US 6 JO TL SA TIL'ESG?OT &
II RNase RPEqui GO Untreated RP Equi GO lll RNase RP No qui GOE Untreated RP No Equi GO
Ill RNase RP Alpha G5 Untreated RP Alpha G5 lll RNase RP No Alpha G5 Untreated RP No Alpha G5 lll RNase RP Equi G5 Untreated RP Equi G5 lll RNase RP EquiNo GS Untreated RP NoEqui G5
G5 LEPO
G2 hEPO
GO WEPO
)ml / ng ( hEPO S'n ' juared AW61 otot JOYS OI JO TL SN TILES9?OT T III RNase RP Equi GO Untreated RP Equi GO ||| RNase RP NoEqui GO Untreated RP NoEqui GO III RNase RP Alpha G5 Untreated RP Alpha G5 III RNase RP No Alpha G5 Untreated RP No Alpha G5 III RNase RPEqui G5 Untreated RP Equi G5 III RNase RP NoEqui G5 Untreated RP NoEqui G5
L2K 2 Factor Growth 1 Factor Growth G5 hEPO G2 hEPO GO hEPO G5 NLUC Figure6(continued) G2 nLUC GO NLUC 4500 4000 3500 3000 500 0 )mL / pg( IFNbeta U.S. Patent May 19 , 2020 Sheet 11 of 72 US 10,653,712 B2
4000-1
-000 €
0677 2000-1
SurrogateEquiRNA2 1500 untreated treatedwith RNaseall 1000 RNaseII Untreated Size(nt)
087 200
155
20 20 Figure7 8000 7000 6000 5000 4000 3000 20004 10004 0 -428 10000 RFU U.S. Patent May 19 , 2020 Sheet 12 of 72 US 10,653,712 B2
4989
2658 28002803> alphaSurrogateRNA2 2000 untreated withtreated RNaseII
Size(nt) Untreated 500 399 392
- 200
Figurecontinued7() 20 24000 22000 20000 18000 16000 14000 12000 10000 8000 60004 4000 2000 0 -8104 RFU U.S. Patent May 19 , 2020 Sheet 13 of 72 US 10,653,712 B2
26.00 25.00 EquiRNASurrogate2 24.00 23.00 withtreated 22.00 untreated RNase 21.00 20.00 RNaselll 19.00 Untreated 18.00 17.00 16.00 15.00 14.00 13.00 12.00 Minutes
10.00 9.00 8.00 7.00 6.00 5.00 4.00 3.00 8AFigure 2.00 0.400.38 0.360.34 0.32 0.300.28 0.26 0.24 0.22 0.18 0.16 0.140.12 0.10 0.08 0.060.04 0.02 0.00 AU U.S. Patent May 19 , 2020 Sheet 14 of 72 US 10,653,712 B2
26.00 25.00 SurrogateRNA2Alpha 24.00 23.00 treatedwith RNaselll 22.00 untreated 21.00 20.00 lllRNase WWWWWWW 19.00 Untreated 18.00 17.00 16.00 15.00 14.00 13.00 12.00 11.00 00'0L
00'8 002 6.00 5.00 4.00 , 3.00 007 8BFigure , 1.00 0.60 0.55 0.50 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 U.S. Patent May 19 , 2020 Sheet 15 of 72 US 10,653,712 B2
ZoomedCurves Waste300 RPPLRP4000V4WI10July2014001MIDS14004Run3shallow001:10UV2280nm 290 RPPLRP4000V4WI10July2014001MTDS14004Run3shallow001:10Fractions =%Bacetonitrile(gradient) BY UV@260nm UV@280nm
{
a OOOF
( 280250260270
***** +
. ? Fractionscutacrossgradient 617181902314561718191011121234567891011212311121
1
190210220200230 1
1,2,3 RPPLRP4000V4WI10July2014001MTDS14004Run3shallow001:10U11260nm RPPLRP4000V4WI10July2014001MTOS14004Run3shallow001:10Conc RPPLRP4000V4WI10July2014001MTDS14004Run3shallow001:10Logbook ??tiBBIBIBBBBBBBB.CCCCCCCCCCC.CDDDDDDDDDDDDB 180 Waste .....!?? Figure9 150
AAAH 90 60 501 40 30 10 -10 -20 -30 U.S. Patent May 19 , 2020 Sheet 16 of 72 US 10,653,712 B2 Fraction1
D 3000
0007
h 1500
637 879 Size(nt) 597 563 553 Equimolar 476 500 412 359
196 - 200 182 153 136
20 20
10AFigure O 3400 3200 3000 2800 2600 2400 2200 2000 18001600 1600 1400 1200 1000 800 600 400 200 -114 U.S. Patent May 19 , 2020 Sheet 17 of 72 US 10,653,712 B2 2Fraction 4000W
3000
2000
1500
62 575 $ 2714 Size(nt) 643 625 564 273 500 456 415$ 363
191 200
Figure10A(continued) 20 20
1900 1800 17001600 1500 14004 1300 1200 1100 1000 -006 8004 RFU U.S. Patent May 19 , 2020 Sheet 18 of 72 US 10,653,712 B2
Fraction3 4000
30001
0007
1500
923
633 Size(nt) 626 5615705 476 500
361
200
Figure10A(continued) 20 20
52505000 4750 45004250 4000 3750 3500 3250 30002750 2500 2250 20001750 1500 1250 1000 750 500 250 -118 RFU U.S. Patent May 19 , 2020 Sheet 19 of 72 US 10,653,712 B2
Fraction4 -0001
3000-1
2000
-0091
940 934 Size(nt) 19 979 -009
200
20 -OZ 10BFigure
RFU U.S. Patent May 19 , 2020 Sheet 20 of 72 US 10,653,712 B2
Fraction5 4000
-0001
2000
1500
940 1000 931 Size(nt) 647 500
200
Figure10B(continued) 20 20
6000 5500 5000 45001 4000 350043500 3000 2500 2000 1500 1000 500 -231 U.S. Patent May 19 , 2020 Sheet 21 of 72 US 10,653,712 B2 fraction6 4000
3000
2000
1500
935 1000 925 Size(nt) 643 500
200
Figure10B(continued) 20 20
7500 7000 6500 6000 5500 5000 4500 4000 35001 3000 2500 2000 1500 1000 5004 01178 U.S. Patent May 19 , 2020 Sheet 22 of 72 US 10,653,712 B2
7Fraction 4000
3000
2000
1500
940 927 Size(nt) 652
-009
200
10CFigure 20 20 7500 7000 6500 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 1000 500 -258+ RFU U.S. Patent May 19 , 2020 Sheet 23 of 72 US 10,653,712 B2 Fraction8 4000
3000
2000
1500
1000
794 Size(nt) 652 500
200-1
Figure10C(continued) 20 ng mert 20
8500 8000 7500 7000 6500 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 1000 500 -206 U.S. Patent May 19 , 2020 Sheet 24 of 72 US 10,653,712 B2 Fraction9 4000
-000 €
2000
1500
1000 931 1798 Size(nt) 750 656
500
200
Figure10C(continued) 20 . 20
8000 7500 7000 6500 6000 5500+ 5000-1 4500 4000 3500 3000 2500 2000 1500 1000 500 204- U.S. Patent May 19 , 2020 Sheet 25 of 72 US 10,653,712 B2
Figure 10D
7000
IFN-b(pg/ml) 3000
2000
1000
0 L2K nLucGO nLucG2 G5nLuc LEPOEquiG52 HEPOEquiG54 HEPOEquiG55 GrowthFactor1 GrowthFactor2 GrowthFactor3 LEPOEquiG5_1 hEPOEquiG51RIII hEPOEquiG52Rill HEPOEquiG5_3 HEPOEquiG5_3Rill HEPOEquiG5_4Rill HEPOEquiG5_5RII hEPOEquiG56 hEPOEquiG56RIII LEPOEquiG5_7 HEPOEquiG57RII hEPOEquiG58 EquiG58RIIHEPO G5_94HEPOEqui LEPOEquiG59RIII untreated U.S. Patent May 19 , 2020 Sheet 26 of 72 US 10,653,712 B2
Fraction2 4000
3000
2000
1500
923 1000 898 Size(nt) 879 089 657 544 476 -009 449 352 >>
191 200
20 -OZ 11AFigure COOL 006 008 OOL -009 500 400 300 007 100 -48 1600 1500 1400 1300 1200 1000L RFU U.S. Patent May 19 , 2020 Sheet 27 of 72 US 10,653,712 B2
3Fraction 4000
3000
-0007
1500
927 1000 918
712 Size(nt) 626 557 468 500
357
200-1
Figure11A(continued) 20 20
5000 4750 45001 42501 4000 3750 3500 3250 3000 27502500 2250 2000 1750 1500 1250 1000 750 500 2504 -113 U.S. Patent May 19 , 2020 Sheet 28 of 72 Fraction4
925 !!! Size(nt) 1634 561
200
Figure11A(continued) 20 20
7000 6500 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 1000 500 -157 U.S. Patent May 19 , 2020 Sheet 29 of 72 US 10,653,712 B2
Fraction5 4000
3000
-0007
1500
1000
679 Size(nt) 566 500
007
11BFigure 20 . 20 8500 8000 7500 7000 6500 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 500 -363 U.S. Patent May 19 , 2020 Sheet 30 of 72 US 10,653,712 B2
Fraction6 4000
-000 €
-0007
1500
-000L
643 Size(nt) -009
200
Figure11B(continued) 20 20 9500 90008500 8000 75004 7000 65004 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 1000 500 -239 RFU U.S. Patent May 19 , 2020 Sheet 31 of 72 US 10,653,712 B2
Fraction7 4000
3000
000Z
1500
1000 995
Size(nt) 629 500
200
Figure11B(continued) 20 OC
9000 8500 8000 7500 7000 6500 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 1000 500 -252 U.S. Patent May 19 , 2020 Sheet 32 of 72 US 10,653,712 B2
Fraction8 4000
- 3000
2000
1500
940 929 794 729 647 Size(nt) 630 553 535 468 500 10903459
201 200
155 >
20 20 11CFigure 3200 3000 2800 2600 2400 2200 2000 0081 1600 1400 1200 1000 800 400 200 RFU U.S. Patent May 19 , 2020 Sheet 33 of 72 US 10,653,712 B2
Fraction9 4000
3000
- 0007
1500
1000 E96
O92 Size(nt) 643 548 500 466 )
200
Figure11C(continued) 20 OZ 750070007 7000 6500 6000 5500 5000 4500 4000 3500 3000 25004 2000 1500 1000 500 0-308 U.S. Patent May 19, 2020 Sheet 34 of 72 US 10,653,712 B2
Fraction10 4000
- 3000
-0007
1500
1000
794 Size(nt) 785 647 553 500
200
Figure11Ccontinued() 20 -OT
10000 9500 9000 8500 8000 7500 70006500 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 1000500 -225 RFU U.S. Patent May 19 , 2020 Sheet 35 of 72 US 10,653,712 B2
Figure 110
8000
7000
6000
5000
IFN-b(pg/ml) 4000
3000
2000
1000
0 L2K untrated nlucGO nlucG2 nlucG5 Factor1Growth GrowthFactor2 GrowthFactor3 hEPOAlphaG5_2 AlphaG5_2RIIIhEPO hEPOAlphaG5_3 RIIIhEPOAlphaG5_3 hEPOAlphaG5_4 hEPOAlphaG5_4RII hEPOAlphaG5_5 G5_5RIIIhEPOAlpha HEPOAlphaG5_6 RIIIHAlphaG5_6hEPO hEPOAlphaG5_7 hEPOAlphaG5_7RIII HEPOAlphaG5_8 RIIIAlphaG5_8hEPO hEPOAlphaG5_9 RIIIhEPOAlphaG5_9 LEPOAlphaG5_10 AlphaG5_10RIIIhEPO S'n ' juared Rew '61 0707 p??US € 9 JO TL SA TIL'ESG'OT T
GOGDPAlpha G5Equi G5Alpha dT Rill Alpha GDP GO VGOEqui
c dT Rill Equi GO
HA/ RP Alpha GDP GO
dT Alpha GDP GO dT Equi GO dT Rill Alpha G5 dT Rill Equi G5
RP Alpha G5 RP Equi G5 dT Alpha G5 H dT Equi G5
2.5- 2.0- 1.5- -1.0 w 0.5 0.0 12Figure ) mRNA ug/ ng ( dsRNA S'n ' JU?d Rew 61“ 070T jaaYS LE JO TL SA TIL'ESG?OT &
Vintage GO FIX 3 Vintage G5 FIX NORNaseilltreatment GDP G5 FFLUC 72RNasellltreatment Equi G5 FFLuc ) BC( GDP GO hEPO ) BC( Equi GO HEPO MP Equi GO HEPO FT Equi GO hEPO MP Alpha G5 hEPO FT Alpha G5 HEPO MP Equi G5 hEPO FT Equi G5 hEPO Alpha 2 Surrogate RNA Equi 2 Surrogate RNA Alpha 3 Surrogate RNA Equi 3 Surrogate RNA ) Ctrl Neg( Oligo7 G6 COV9 HEPO RP Equi TL G5 HEPO RP No Equi TL G5 HEPO RP Alpha G5 LEPO RP no Alpha G5 HEPO RP Equi G5 hEPO RP No Equi G5 HEPO 13Figure ) nglug( dsRNA n : S ' quared Rew 61“ 070T q??US € 8 JO TL SA TIL'ESG?OT &
3 Factor Growth
batt 2 Factor Growth D 1 Factor Growth
G5 nLuc D G2 nLuc
GO nLuc
L2K
untreated capped 6hr 25C Std GO capped 2hr 37C Std GO H capped N/ O 25C Std G5 capped 6hr 25C Std G5 D capped 2hr 370 Std G5 capped N/ O 25C GTP capped 6hr 25C GTP capped 2hr 37C GTP capped N/ O 25C GDP capped 6hr 25C GDP capped 2hr 37C GDP 14Figure o 4000 3500 3000 2500 2000 1500 000L 500 ]ml / pg( IFNbeta U.S. Patent May 19 , 2020 Sheet 39 of 72 US 10,653,712 B2
Clean CapClean2hr6hrO/N
Ribonucleosides-PostCapClean GDP37C2hr25C6hrO/NGTP25COG5std250GO AdenosineDGuanosineDCytidineMethyl-PseudouUridine
CleanCleanCap
CleanCap 15Figure 25000 20000 15000 10000 5000 0 ????? U.S. Patent May 19, 2020 Sheet 40 of 72 US 10,653,712 B2
Countsvs.AcquisitionTime(min) CountsAcquisitionvs.Time(min) with 2.833.23.43.63.844.24.44.64.855.25.45.65.866.26.46.66.877.27.47.67.88 whi$ 2.833.23.43.63.844.24.44.64.855.25.45.65.866.26.46.66.877.27.47.67.88
x106ESITICScanFrag=365.0Vnot7_G5_equi_eGFP_TL_10ug.d *106-ESITICScanFrag=365.0VTL_A9_10ug.d 16AFigure GO 0 1 ot ??? 1.4 1.21 0.8+ 0.6 0.4 0.2_17 1.41 1.2 0.8 0.6 0.4 0.2 U.S. Patent May 19 , 2020 Sheet 41 of 72 US 10,653,712 B2
Countsvs.AcquisitionTime(min) wu withU 2.833.23.43.63.844.24.44.64.855.25.45.65.866.26.46.66.877.27.47.67.88
w
Figure16A(continued) x106-ESITICScanFrag=365.0VTL_A7_10ug.d X106-ESITICScanFrag=365.0VTL_A8_10ug.d G5 G6
1 1.4 1.2 0.8 0.6 0.2 01 1.4 1.2 immat 0.8 0.6 0.45 0.2 0 U.S. Patent May 19, 2020 Sheet 42 of 72 US 10,653,712 B2
ppp-U15OH ppp-V12OH U13-OHppp OHU14-ppp U11-OHppp ppp-U12OH pppU13-OH None ppp-V13-0H ppp-U14-0H
GO(a) GO(b) GO(C) G5(a) G5(b) G5(c) G6(a) G6(b) G6(C)
Countsvs.AcquisitionTime(min) habohm Countsvs.AcquisitionTime(min) 3 33.23.43.63.844.24.44.64.855.25.45.65.866.26.46.66.877.27.4 33.23.43.63.844.24.44.64.855.25.45.65.866.26.46.66.877.27.4 -ESITICScanFrag=365.0VnoT7_G5_equi_eGFP_T100_10ug.d X106-ESITICScanFrag365.0V=T100_B12_10ug.d nam 16BFigure GO
1 0.4www 1061* 0.8 0.6 0.4 0.2 0.8 0.6 0.2 0 U.S. Patent May 19 , 2020 Sheet 43 of 72 US 10,653,712 B2 Mehm Countsvs.AcquisitionTime(min) Itella 33.23.43.63.844.24.44.64.855.25.45.65.866.26.46.66.877.27.4 Figure16Bcontinued() X106ESITICScanFrag=365.0VT100_310_10ug.d X106-ESITICScanFrag=365.0VT100_B11_10ug.d
G5 G6 1 0.6 0.4 0.2 1 0.8 0.6 0.2 S'n ' juared Rew 61“ 0707 J??US DD JO TL SA TIL'ESG'OT T
T100 eGFP , equi ,T7 + ,G6
T100 eGFP ,equi ,T7 * ,G5
eGFPT100 ,equi , T7 + , GO
eGFPT100 , alpha , +17 , G6
T100 eGFP , alpha ,T7 + , G5 eGFPT100 , alpha , T7 + , GO
G5 ,equi , -17 , eGFPT100 G5 , alpha , -T7 , Th eGFP G5 ,equi , -T7 , eGFPT100 G5 ,alpha , -T7 , TL eGFP 1800 1600 1400 1200 000L 800 009 400 200 o )ml / pg( IFNbeta 17Figure U.S. Patent May 19 , 2020 Sheet 45 of 72 US 10,653,712 B2
6851.1calcUncap: 6317.5calc:Uncap C1calc:7145.2 C1calc:6611.6 7489.13 C1 7283.24 294.12137144.09 6843.037145.247378.82 NocappedF20product 6980.10 Countsvs.Mass-toCharge(m/z) 78.9609 6770.01ppp 6850.97pp X104-ESIScan(rt:4.001-4.400min,25scans)Frag=365.0VpppF20ANDpppR2012annealcap_3uL.dDec... 6850.99 610062006300640065006600670068006900700071007200730074007500 x104-ESIScan(rt:3.999-4.415min,26scans)Frag=365.0V10_pppF20_cap.3uL.dDeconvoluted x105-ESIScan(rt:4.005-4.404min,25scans)Frag=365.0V11pppR20_cap_3uLdDeconvoluted 6622.66 6461.766622.666771.00 6531.936675.046077.346264,01 6316.64 6236.671 6316.63 6236.66
1 22 aandoaand 0 0 2 0 1.57pppF20 0.5 0.8 pppRC200.6 0.4 0.21 1.5 0.5 18Figure pppRC20pppF20+ U.S. Patent May 19 , 2020 Sheet 46 of 72 US 10,653,712 B2
9464.149592.199691.06 9625.669729.10 9598.57 9464.14 Countsvs.Mass-toCharge(m/z) ppP9319.06 ppp 90009100920093009400950096009700 CIP-treated OH x104ESIScanírt:2958-3.931min,118scans)Frag=365.0V16_oppR3O_OHF25_... OH 19159.11 +9159.12 OH9239.1019399.03 9024.05 9024.07
4 3 2 1 0 5 0 6 3.57 2.5 1.5 0.5t9023.08 x104ESIScan(ft:2.892-4214min,160scans)Frag=365.0V21.popR30_CHF20_a.Esirt2956-3.92811815.pppR30_OHF20_C... x104ESIScan(it2.888-4219min,161scans)Frag=365.0V23_ppR3O_OHF30_.x104ESIScan(rt2.959-3.932min,118scans)Frag=365.0V17.pppR30_OHF30_C... 9705.05 9529.149704.04 9660.52 ppp ppp ppp Countsvs.Mass-toCharge(m/z) 9399.03 9399.04 91009200930094009500960097009800 +9399.02 x104-ESIScan(rt:2.89-4.221min,161scans)Frag-365.0V22pppR30_0HF25_... 9319.06 untreated 9159.129319.05 9093.009319,06 9092.99
4 2 6 4 2 5 4 31 2 8 6 0 8+ o CCCUUVAUUCUCUCUUUUCUUCUCAUUCUU-PPP NOSEQ:2ID CCCUUUAUUCUCUCUUUUCUUCUCAUUCUU-APP NO3:SEQID CCCUUUAUUCUCUCUUUUCUUCUCAUUCUU-PPP 4IDNO:SEQ 19Figure F20OH-+R30ppp OH-GGGAAAUAAGAGAGAAAAGA F25OH-+pppR30 OH-GGGAAAVAAGAGAGAAAAGAAGAGU F30OH-R30+ppp OH-GGGAAAUAAGAGAGAAAAGAAGAGUAAGAA U.S. Patent May 19 , 2020 Sheet 47 of 72 US 10,653,712 B2
9543.559661.51 ??? ppp 19543.54_9706.04 Countsvs.Mass-toCharge(m/z) 9399.03 9399.04 90009100920093009400950096009700 x104ESScanfit2.956-3.929min,118Scans)Frag=335.0V18_9pR30_OHF35_C... pp 9319.00 x104EsiScan(it2.962-3934min.118scans)Frag=36.0V19pe230_04F40_C pp 9319.06 OH 19159.13093 OHI 9159.13 9023.08 9093.001
ppp Countsvs.Mass-toCharge(m/z) PPP 94009500960097009800910092009300 x104Es!Scan(it2887-4.218min,161scans)Frag=365.0V24pepR30_OHF35...9399.04 9818.08TL_954356970507 x104EsiScanit2.896-4217mila,161scans)Frac-365.0V25_pR30_OHF40_2..9399.05 93101089114.9919704.079543.561 9093.00
2 11 0 6151
5IDNO:SEQ SEQIDNO:6
Figure19(continued) CCCUUUAUUCUCUCUUUUCUUCUCAUUCUU-PPP CCCUUUAUUCUCUCUUUUCUUCUCAUUCUU-Ppp F35OH-+R30ppp OH-GGGAAAVAAGAGAGAAAAGAAGAGUAAGAAGAAAU F40OH-R30+ppp GGGAAAVAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGOH- U.S. Patent May 19 , 2020 Sheet 48 of 72 US 10,653,712 B2
Figure 20
10452 10000 1 G5 Equi dT (1 )A7 : Group 7 9500 w - (1 ) A5 : Group 5 9000 G5 EquiRP 8500 5 G5 Equi Rill TrisR ( 1) A3 : Group 3 8000 ( 1 )A1 : Group 1 7500 7 G5 Equi RIII DT - 7000 6500 6000 5500 5000 C 4500 RFU 4000 3500 3000 2500 2000 1500 1000 500 -188 20 200 500 1000 1500 2000 Size (nt )
12939 2 G5 Alpha dT ( 1 )A8 : Group 8 12000 - (1 )A6 : Group 6 11000 G5 Alpha RP 6 G5 Alpha RIIl TriSRP ( 1 )A4 : Group 4 10000 8 ( 1 )A2 : Group 2 9000 G5 Alpha Rill dT 8000 7000 1 6000 5000 4000 3000 2000 1000 -157 20 200 500 1000 1500 2000 Size (nt ) U.S. Patent May 19 , 2020 Sheet 49 of 72 US 10,653,712 B2
Figure 20 ( continued ) 7500 7000 9 GO Equi dT (1 ) B2 : Group 14 6500 12 GO Equí Rill TrisRP ( 1 )A12 : Group 12 6000 14 G5 Equi RIIl DT ( 1 )A9 : Group 9 5500+ 5000 4500 4000 3500 RFU 3000 2500 2000 1500 500 -221 20 200 500 1000 1500 2000 3000 Size (nt )
10500 10000 GO GDP Alpha dT --- ( 1) B3: Group 15 9500 9000 11 GO GDP Alpha RP /HA -- (1 ) 81 : Group 13 8500 - ( 1) A11 : Group 11 8000 13 GO GDP Alpha RIII TriSRP 75004 15 GO GDP Alpha Rill dT ( 1) A10 : Group 10 7000 6500 6000 5500 5000 4500 4000 3500 3000+ 2500 2000 15001 1000 500 20 200 500 1000 1500 2000 Size (nt ) Sn' juared Rew 61“ 0707 j??YS OS JO TL SN TILES9'01 &
G5EquiG5Alpha ZGOEqui GOGDPAlpha 3 Factor Growth 2 Factor Growth H 1 Factor Growth G5 nLuc G2 nLuc GO nLuc L2K untreated dT Rill Alpha GDP GO 2 dT Rill Equi GO
dT Alpha GDP GO dT Equi GO DT Rill Alpha G5 dT Rill Equi G5
RP Alpha G5 RPEqui G5 dT Alpha G5 21Figure dT Equi G5 )ml / pg ( b- IFN S'n ' juared Rew 61“ 0707 134S IS JO TL SA TIL'ESG?OT &
PBS LNP Empty GOGDPAlpha G5Equi G5Alpha VAGOEqui INOD dT Rill Alpha GDP GO dT RIIIEqui GO
2 HA/ RP Alpha GDP GO 1216Study dT Alpha GDP GO dT Equi GO dT Rill Alpha G5 RIIITEqui G5
RP Alpha G5 RP Equi G5 dT Alpha G5 dT Equi G5 22Figure 2x107 2x107 20LXL 5x106
OOOOOO )mL / pg( Concentration huEpo U.S. Patent May 19 , 2020 Sheet 52 of 72 US 10,653,712 B2 Figure 23A 35000 GCSF ( 12 ) 30000 25000 E 20000 ???6d 15000 10000 5000 h G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GDP LNP dT dT RP RP RINIRIN RIU dT Alpha Alpha Rill Alpha RP Rill dT IFN - alpha ( 30 ) 3000 2500 2000 mLpg/ 1500 1000 500
rooms G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GDP LNP RP RP RIUI RIU dT Alpha Alpha Rill Alpha dT dT RP RII dT MCP - 1 (51 ) 140000 120000 100000 mLpg/ 80000 60000 40000 20000 0 ko G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GOP LNP RP RII RII dT Alpha Alpha Rill Alpha dT dT RP dT RIII dT U.S. Patent May 19 , 2020 Sheet 53 of 72 US 10,653,712 B2 Figure 23B IFN - gamma (38 ) 60000 50000 40000 ???td 30000 20000 10000
G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GDP LNP dT RP RP RIJIRIII dT Alpha Alpha Rill Alpha RP dT RII dT IL - 12p70 (39 ) 25 20 mLpg/ 15 10 5 0 ia A G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GDP LNP dT dT RP RP RIII RIII dT Alpha Alpha Rill Alpha dT dT RP dT RII dT 400 MIP - 1 beta (72 ) 350 300 250 mLpg/ 200 150 100 50 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha EquiG5 Alpha Equi GDP GDP Equi GDP LNP dT RP RP RIII RIU dT Alpha Alpha RIII Alpha dT dT RP dT RIII dT U.S. Patent May 19 , 2020 Sheet 54 of 72 US 10,653,712 B2 Figure 230 5000 IL -6 ( 28 ) 4500 4000 3500 3000 ???6d 2500 2000 1500 1000 500 Tag G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GDP LNP RP RP Rill RINRIII dT Alpha Alpha Rill Alpha dT RP dT RII IP - 10 (22 ) 14000 12000 10000 mLpg/ 8000 6000 I 4000 2000 0 G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GDP LNP dt RP RII RII dT Alpha Alpha Rill Alpha dT dT dT RP RIU dT RANTES ( 44 ) 3500 3000 2500 mLpg/ 2000 1500 1000 500
G5 G5 G5 G5 G5 G5 GO GO GO GO GO Empty Equi Alpha Equi Alpha Equi Alpha Equi GDP GDP Equi GDP LNP dT RP RP RII RIII dT Alpha Alpha Rill Alpha dT dT RP dT RII U.S. Patent May 19 , 2020 Sheet 55 of 72 US 10,653,712 B2
Figure 23D TNF - alpha (45 ) 120
100
80 pg/mL 60
40
20
0 EquiG5 AlphaG5 EquiG5 AlphaG5 EquiG5 AlphaG5 EquiGO GDPGO GDPGO EquiGO GDPGO EmptyLNP dT RP RIII RII dT Alpha Alpha Rill Alpha dT dT dT RP dT RII dT S'n ' juared Rew 61“ 0707 j??US 9S JO TL SA TIL'ESG?OT &
PBS LNP Empty G5Alpha GOGDPAlpha EquiG5V VGOEqui ENON dT Rill Alpha GDP GO dT Rill Equi GO
PUA RP Alpha GDP GO dT Alpha GDP GO ActivatedBcellfrequencies dTEqui GO TH dT Rill Alpha G5 dT Rill Equi G5
??????? RP Alpha G5 RPEqui G5 ???????? dT Alpha G5 dT Equi G5 35 splenocytes total in cells * CD69 * CD86 of Percentage 24Figure U.S. Patent May 19 , 2020 Sheet 57 of 72 US 10,653,712 B2
R12 hEPO R8 HEPO R8 + F12 R12 + F8 R12 + 12 Fr , R8 F8 R12 R8 F12 F8 2 Factor Growth 1 Factor Growth G5 hEPO G2 HEPO 09 Od34 G5 LUC G2 NLUC GO NLUC 1400 1200 1000 800 600 400 200 0 )ml / pg ( IFNbeta
SEQ:7IDNO :9SEQIDNO SEQIDNO:12 :13SEQIDNO SEQNO:14ID 10NO:SEQIDPPPCCCUUUAUUCUC- CCCUUUAUUCUCPPP-SEQIDNO:11 GGGAAAUAAGAGAAAAGAAGAGU850mer)...hEPO(ppp- ppp-CUCUUAUUUCCCSEQIDNO:8 850mer)GGGAAAUAAGAGAAAAGAAGAGU..HEPO(ppp- CCCUUUAU-PPP CCCUUUAU-PPP CCCUUUAU-PPP CCCUUUAUUCUC-PPP GGGAAAUAPPP- GGGAAAVAAGAGppp- UAUUUCCCppp- GGGAAAVAppp- GGGAAAVAAGAGppp- GGGAAAVAppp- GGGAAAUAAGAGppp-
25Figure ppp-F8+pppRC8 pppRC12F12+ppp- pppRC12ppp-F8+ pppRC8F12+ppp- hEPORC8+ppp- hEPO+RC12-ppp F8-ppp F12ppp- RC8ppp- RC12ppp- U.S. Patent May 19 , 2020 Sheet 58 of 72 US 10,653,712 B2
CCCUUUAUUCUCUCUUUUCU-PPPSEQIDNO:15 UUUUUUUUUUUUUUUUUUUUUUUU-PPPSEQIDNO:18 CCCUUUAUUCUCUCUUUUCU-pppNO19SEQ:ID UUUUUUUUUUUUUUUU-PPPNO16:SEQID UUUUUUUUUUUUUUUUUUUU-PPPSEQIDNO:17 GGGAAAUAAGAGAAAAGAAGAGU(250mer)...OP- GGGAAAUAAGAGAGAAAAGAPpp- OH-AAAAAAAAAAAAAAAAAAAAAAAAA OH-AAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAOHAAAAAAAA-
2 Factor Growth 1 Factor Growth 99 Od34 G2 hEPO A25(Tm22.6C)ppp-U16+OH 31.7C)TmA25OH(U20-+ppp 39CTm)A25(OHU25-+ppp ppp-RC20+C1RNAsurrogate2 09 Od34 59.9C)ppp-RC20(TmF20+Figure26 G5 OLUC G2 NLUC GO nLUC 1600 1400 1200 1000 800 600 400 200 0 )ml / pg ( IFNbeta U.S. Patent May 19 , 2020 Sheet 59 of 72 US 10,653,712 B2
NO20SEQ:ID NO22SEQ:ID 21NO:SEQIDOHCCCUUUAUUCUCUCUUUUCU- NO23:SEQIDCCCUUUAUUCUCUCUUUUCUppp- CCCUUUAUUCUCUCUUUUCU-PPPSEQIDNO:24 CCCUUUAUUCUCUCUUUUCU-PPPSEQIDNO:25 CCCUUUAUUCUCUCUUUUCUPPP-SEQIDNO:26 CCCUUUAUUCUCUCUUUUCU-PPPSEQIDNO:27 CCCUUUAUUCUCUCUUUUCU-PPP CCCUUUAUUCUCUCUUUUCU-PPP GGGAAAUAAGAGAGAAAAGAppp- GGGAAAUAAGAGAGAAAAGAppp- OH-GGGAAAUAAGAGAGAAAAGA OH-GGGAAAUAAGAGAGAAAAGAAGAGU OH-GGGAAAUAAGAGAGAAAAGAAGAGUAAGAA OH-GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAU OH-GGGAAAVAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAG OH-GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC
59.9C)pppR20(Tmppp-F20+ 27Figure OHR20+F20-ppp OH-F20+pppR20 OH-F25+pppR20 OH-F30+pppR20 OH-F35+pppR20 OH-F40+pppR20 OH-F47+pppR20 S'n ' juared Rew '61 0707 jaaYS 09 JO TL SA TIL'ESG?OT &
only RC20- OH only A25- OH only F47 - OH only F20- OH only polyUs- ppp only pppRC20 only pppF20 OHA25+ polyUs - ppp
OHA25+ pppU25 OHRC20 + OHF20 OHF47 + pppRC20 OHF40 + pppRC20 OHF35 + pppRC20 OHF30 + pppRC20 OHF25+ pppRC20 OHF20 + pppRC20 OHRC20 + pppF20 pppF20 + pppRC20
2 Factor Growth 1 Factor Growth G5 hEPO H G2 hEPO GO HEPO Figure27continued() H G5 LUC G2 NLUC GO NLUC 2500 2000 1500 1000 500 )ml / pg ( IFNbeta S'n ' juared Rew 61 0707 ja?US 19 JO TL SA TIL'ESG?OT & only pppU50 OHA30 + pppU50 OHA30 + pppU40 I OHA30 + pppU30 only OHF40 omly pppR40 omly pppR35 omly pppR30 omly pppR25 pppF20 + pppR20 OHF40 + pppR40 OHF35 + pppR40 OHF30 + pppR40 OHF25 + pppR40 OHF20 + pppR40 OHF40 + pppR35 OHF35 + pppR35 OHF30 + pppR35 OHF25 + pppR35 OHF20 + pppR35 OHF40 + pppR30 OHF35 + pppR30 OHF30 + pppR30 OHF25 + pppR30 OHF20 + pppR30 OHF40 + pppR25 OHF35 + pppR25 OHF30 + pppR25 OHF25 + pppR25 OHF20 + pppR25
2 Factor Growth 1 Factor Growth G5 hEPO G2 hEPO GO hEPO G5 LUC G2 nLUC GO LUC Figure28 3000 2500 2000 1500 1000 500 ml/ pg S'n ' juared Rew 61 0707 v?US 79 JO TL SN TIL'ES9'OI T only hPEOqRP only OHA30 only OHA20 only pppU50 ) only pppU40 Oligoonly only pppU35 only pppU30 only pppU25 hEPOqRP + pppU50 hEPOEQRP + pppU40 hEPOqRP + pppU35 hEPOA100 hEPOqRP + pppU30 hEPOeQRP + pppU25 OHA30 + pppU50 OHA30 + pppU40 OH-A30 OHA30+ pppU35 OHA30 + pppU30 OHA30 + pppU25 OHA20 + pppU50 OHA20 + pppU40 OH-A20 OHA20 + pppU35 OHA20 + pppU30 OHA20 + pppU25
2 Factor Growth 1 Factor Growth G5 hEPO G2 HEPO GO HEPO G5 LUC G2 LUC 29Figure GO LUC 2500 2000 1500 1000 500 )ml / pg ( IFNbeta S'n ' juared Rew 61“ 070T J?US 9 € JO TL SN TILES9'01 & only OHA30 only OHA20 only OHF40 only OHF12 only pppF40 only pppF35 only pppF30 only pppF25 only pppR20 only pppR16 INFbeta,BJFibroblasts48h. only pppR12 oligospppRC 2 Factor Growth 1 Factor Growth G5 hEPO G2 LEPO GO hEPO G5 LUC G2 LUC GO nLUC 1500 1000 500 2500 0007 ml/ pg only OHR40 only OHR20 only pppF47 only pppF40 only pppF35 only pppF30 only pppF25 only pppF20 INFbeta,BJFibroblasts48h. only pppF16 pppFwdoligos 2 Factor Growth 1 Factor Growth G5 HEPO G2 HEPO GO LEPO G5 LUC 30Figure G2 NLUC GO LUC 2500 2000 1500 1000 500 ml/ pg S'n ' JU?zed Rew 61“ 070T J?US 19 JO TL SN TILES9?OT T only OHR40 pppR40 + OHF40 pppR30 + OHF30 pppR20 + Oh20 * pppR16 * OHF16 pppR40 + pppF40 pppR35 + pppF35 pppR30 - pppF30 pppR25 * pppF25 pppR20 + pppF20 pppR16 + pppF16
OHR47 + pppF47 OHR40 + pppF40 OHR35+ pppF35 OHR30 + pppF30 OHR25 + pppF25 OHR20+ pppF20 OHR16+ pppF16
2 Factor Growth 1 Factor Growth G5 HEPO G2 hEPO GO LEPO G5 LUC G2 LUC 31Figure GO NLUC 3500 3000 2500 2000 1500 1000 500 )ml / pg( IFNbeta S'n ' JU?d Rew 61“ 0707 v?US S9 JO TL SN TILES9?OT T
only OHF12 CIP + OHF40 + pppR30 CIP + OHF35 + pppR30 CIP + OHF30 + pppR30 CIP + OHF25 + pppR30 CIP + OHF20 + pppR30 only pppR30 OHF30 + pppR30 2 Factor Growth CIP 1 Factor Growth G5 LEPO G2 HEPO GO LEPO G5 OLUC G2 NLUC GO NLUC 009 0 )ml / pg( IFNbeta
OHF40 + pppR30 OHF35 + pppR30 OHF30 + pppR30 OHF25 + pppR30 OHF20 + pppR30 only pppR30
2 Factor Growth 1 Factor Growth NoCIP G5 hEPO G2 hEPO GO LEPO G5 LUC G2 NLUC 32Figure GO LUC 2500 0007 009 1000 500 )ml / pg( IFNbeta Sn juared Rew '61 otot jaaYS 99 JO TL SA TIL'ESG'OT T
uL /ng 0.1 pppF40 uL/ ng 1 pppFR40 pppF40 u /ng 10 pppF40 " UL/ ng 100 pppF40
UL/ ng 0.1 pppR40 ul/ ng 1 pppR40 pppR40 ul/ ng 10 pppR40 uL/ ng 100 pppR40 ul/ ng 0.1 pppR30 uL/ ng 1 pppR30 pppR30 ul/ ng 10 pppR30 u/ ng 100 pppR30 uL/ ng 0.1 pppR20 nglu 1 pppR20 pppR20 uL/ ng 10 pppR20 uL/ ng 100 pppR20
L2K 2 Factor Growth 1 Factor Growth G5 hEPO G2 LEPO GO hEPO G5 nLUC G2 LUC 33Figure GO NLUC 4500 4000 3500 500 )ml / pg( IFNbeta Sn ju?Red Rew '61 0707 j?YS L9 JO TL SN TILES9?OT T
uL/ ng 100 OHF40 ul/ ng 100 OHF20 uL/ ng 0.1 pppR40 + pppF40 uL/ ng 1 pppR40 + pppF40 ul/ ng 10 pppR40 + pppF40 ul/ ng 100 pppR40 + pppF40 ul/ ng 0.1 pppR20 + pppF20 uL/ ng 1 pppR20 * pppF20 uL/ ng 10 pppR20 + pppF20 uL/ ng 100 pppR20 + pppF20 ul / ng 0.1 pppR40 + OHF40 uL / ng 1 pppR40 + OHF40 OHF20+pppR20OHF30pppR30OHF40pppR40pppF20pppF40 ul/ ng 10 pppR40 + OHF40 ul/ ng 100 pppR40 + OHF40 uL/ ng 0.1 pppR30 + OHF30 uL/ ng 1 pppR30 + OHF30 uL/ ng 10 pppR30 + OHF30 uL/ ng 100 pppR30 + OHF30 uL/ ng 01 pppR20+ OHF20 ul/ ng 1 pppR20 + OHF20 uL/ ng 10 pppR20 + OHF20 uL/ ng 100 pppR20+ OHF20
L2K 2 Factor Growth 1 Factor Growth G5 HEPO G2 HEPO GO HEPO G5 LUC G2 NLUC 34Figure GO LUC 4500 0001 3500 3000 2500 2000 1500 1000 o )ml /pg ( IFNbeta U.S. Patent May 19 , 2020 Sheet 68 of 72 US 10,653,712 B2 AGGGAAAUAAGAGAGAAAAGAAGAGUAAGAASEQIDNO:33 CGGGAAAVAAGAGAGAAAAGAAGAGUAAGAASEQIDNO:34 NO:35UGGGAAAVAAGAGAGAAAAGAAGAGUAAGAASEQID
OligoSequence(5'3')
AF30 CF30 UF30
Figure35 2500 2000 1500 1000 500 )ml / pg ( IFNbeta U.S. Patent May 19, 2020 Sheet 69 of 72 US 10,653,712 B2
NO28SEQ:ID GUUCUUACUCUUCUUUUCUCUCUUAUUUCCCGR30SEQIDNO:29 GR35GAUUUCUUCUUACUCUUCUUUUCUCUCUUAUUSEQIDNO:30
OligoSequence(5'?3) GR25GACUCUUCUUUUCUCUCUUAUUUCCC UCCC
36Figure 0 2500 2000 1500 1000 500 )ml / pg( IFNbeta U.S. Patent May 19 , 2020 Sheet 70 of 72 US 10,653,712 B2
Figure 37 30
2500
2000 IFNbeta(pg/ml)
500
o NLUCGO NLUCG2 HNLUCG5 hEPOGO hEPOG2 hEPOG5 GrowthFactor1H GrowthFactor2 OHF16+OHR16 OHF20+OHR20 OHF30+OHR30 OHF40+OHR40 U.S. Patent May 19 , 2020 Sheet 71 of 72 US 10,653,712 B2 Figure 38 100
mP (run -on ) 50 %3'functionality OH (clean )
0 WTalpha WTEQ
Figure 39 Calculated dsRNA (1ug mRNA )
0.6
0.4
dsRNA(ng/ugmRNA)
0.21
0.0 EQ -RP alpha -RP EQ + RP alpha + RP U.S. Patent May 19 , 2020 Sheet 72 of 72 US 10,653,712 B2
'5ppp Reverse complement impurities 3...-A100NN ...3'-A100NN '5Jappp
5-Ppp 40Figure Run-ontranscripts '5ppp- ||||||| Mg2+ 5'ppp'3-A100 5'ppp'3--A100 '5ppp-
RNAP '5 NTPS yo -ppp Fulllength-product 5ppp- 5'ppp 5'ppp DNA plasmid LinearizeddsDNAtemplate 5ppp 1111111 Abortive/ transcripts 5'ppp truncated 5'ppp US 10,653,712 B2 1 2 HIGH PURITY RNA COMPOSITIONS AND understanding of the nature of contaminants in IVT- gener METHODS FOR PREPARATION THEREOF ated mRNA preparations, in order to better control for levels and nature of contaminants in IVT preparations . There RELATED APPLICATIONS further exists a need for improved methods of preparing 5 mRNA for therapeutic use and for high purity compositions This application is a continuation of international patent produced according to such methods . application serial number PCT/US2017 /051674 , filed Sep. 14 , 2017 , which claims the benefit under 35 U.S.C. $ 119 ( e ) SUMMARY OF INVENTION of U.S. provisional application 62 /394,711 , filed Sep. 14 , 2016 , the entire contents of each of which are incorporated 10 The invention involves, at least in part , the discovery of by reference herein in its entirety . novel methods for in vitro RNA synthesis and related products . The RNA transcripts produced by the methods BACKGROUND OF INVENTION described herein have enhanced properties which result in The ability to design , synthesize and deliver a nucleic 15 qualitatively and quantitatively superior compositions com acid , e.g. , a ribonucleic acid (RNA ) for example , a messen prising said RNA transcripts . The RNA transcripts produced ger RNA (mRNA ) inside a cell, has provided advancements by the methods described herein have enhanced properties in the fields of therapeutics, diagnostics, reagents and for particularly important for mRNA , IncRNA , and other thera biological assays. Many advancements are being made in peutic and diagnostic RNA uses , such as improved immune the process of intracellular translation of the nucleic acid and 20 silencing and better safety profiles . production of at least one encoded peptide or polypeptide of In particular, IVT RNA compositions of the invention are interest. substantially free of certain undesirable contaminants rou mRNA has immense therapeutic potential in thatmRNA tinely associated with the IVT process. Notably , however , therapeutics can transiently express essentially any desired the methods of the invention arrive at mRNA compositions protein while avoiding the adverse effects of viral and 25 suitable for therapeutic use by controlling the nature and DNA - based nucleic acid delivery approaches. Mammalian levels of contaminants produced in the IVT reaction , i.e., the cells , in particular , human cells , however , contain sensors of contaminants are not made in the initial reaction , as con nucleic acids including RNA as part of the innate immune trasted to art -described methods which attempt to remove system and it is desirable to avoid such sensing and contaminants once they have been produced . Without being immune response when developing mRNA therapeutics. 30 bound in theory , it is believed that preventing the production In theory , mRNAs produced via chemical synthesis hold of unwanted contaminants in the IVT reaction from the promise as mRNA therapeutics, however, the majority of the outset provides for improved compositions having higher research in this important therapeutic area to date has purity and potency , measur for example , in terms of focused on in vitro - transcribed ( IVT) mRNA , as this enzy increased translation from full - length , intact mRNA in the matic process facilitates the production of long RNAs, on 35 composition . the order of 1-2 or more kB , the standard length of most A composition comprising an in vitro - transcribed (IVT ) mRNA molecules. RNA and a pharmaceutically acceptable excipient, wherein Early work showed that incorporation ofmodified nucleo the composition is substantially free of reverse complement sides, in particular, pseudouridine , reduced innate immune transcription product is provided in some aspects of the activation and increased translation of mRNA , but residual 40 invention . In some embodiments , less than about 5 % , 4.5 % , induction of type I interferons ( IFNs) and proinflammatory 4 % , 3.5 % , 3 % , 2.5 % , 2 % , 1.5 % , 1 % , 0.9 % , 0.8 % , 0.7 % , cytokines remained (Kariko et al. ( 2005 ) Immunity 23 ( 2 ) : 0.6 % , or 0.55 % of the total mass of the RNA in the 165-75 ) . Progress was made towards the identification of the composition is reverse complement transcription product. In contaminants in nucleoside- modified IVT RNA identifying some embodiments , less than about 1.0 % of the mass of the double -stranded RNA (dsRNA ) as being at lease partially 45 RNA in the composition is reverse complement transcription responsible for innate immune activation . Removal of such product. In some embodiments , less than about 0.5 % of the contaminants by high performance liquid chromatography mass of the RNA in the composition is reverse complement (HPLC ) resulted in reduced IFN and inflammatory cytokine transcription product. In some embodiments , less than about levels and in turn , higher expression levels in primary cells 0.25 % of the mass of the RNA in the composition is reverse ( Kariko et al. (2011 ) Nuc. Acids Res. 39 :e142 ). Notably , 50 complement transcription product . In some embodiments , unmodified mRNAs still induced high levels of cytokine less than about 0.1 % of the mass of the RNA in the secretion although they were better- translated following composition is reverse complement transcription product. In HPLC purification . some embodiments , less than about 0.05 % of the mass of the WO 2013/102203 describes an RNAse III treatment RNA in the composition is reverse complement transcription method used to remove dsRNA from IVT mRNA for 55 product. In some embodiments , less than about 0.01 % of the repeated or continuous transfection into human or animal mass of the RNA in the composition is reverse complement cells , in particular , for reprogramming of cells from one transcription product. In some embodiments , less than about differentiation state to another . The method purports to result 0.005 % of themass of the RNA in the composition is reverse in preparations having decreased levels of dsRNA and complement transcription product . In some embodiments , increased levels of intact ssRNA , as evidenced by higher 60 less than about 0.001 % of the mass of the RNA in the levels of reprogramming factors and less toxicity to cells . composition is reverse complement transcription product. In Such methods, however, are not compatible for use in the exemplary embodiments , the mass of the RNA in the com preparation of mRNAs for therapeutic use , in particular , for position is determined by LC , J2 Elisa , RNase III, Gel human therapeutic use . RNAse III is known to digest ssRNA electrophoresis with radiolabeled NTPs, LCMS +/- nuclease as well as dsRNA and in trying to remove dsRNA contami- 65 or chemical digestion , NMR using labelled NTPs, chemi nants , the integrity of the desired ssRNA product is neces cally /isotopically /radioactively etc. labelled NTPs , cells , sarily jeopardized . Thus, there exists a need for better biochemical means, RIG - I ATPase activity or MS or gel US 10,653,712 B2 3 4 electrophoresis or other methods known in the art to be the RNA in the composition is cytokine -inducing RNA suitable for detection and /or quantitation of RNA in RNA contaminant. In some embodiments , the mass of the RNA in containing compositions. the composition is determined by LC or MS or gel electro In some embodiments the reverse complement transcrip phoresis or other method known in the art . tion product is fully complementary with a region of the 5 In some embodiments the invention features a composi RNA which is the desired or intended IVT transcription tion comprising an in vitro - transcribed ( IVT) RNA encoding produce ( e.g. , an mRNA , IncRNA , or other RNA greater a polypeptide of interest and a pharmaceutically acceptable than 50 nucleotides in length intended for therapeutic use ). excipient, wherein the composition has reduced levels of A product that is fully complementary with the RNA tran cytokine- inducing RNA contaminant and /or reverse comple script is considered to have 100 % complementarity ( e.g. , 10 ment transcription product . over the length of the reverse complement transcription In some embodiments of the compositions of the inven product . In other embodiments the reverse complement tion described herein , the the mass of the sum total of transcription product is partially complementary with a cytokine - inducing RNA contaminant and / or the reverse region of the RNA transcript. In some embodiments the complement transcription product is less than about 10 % , reverse complement transcription product is 70 % , 75 % , 15 9 % , 8 % , 7 % , 6 % , 5 % , 4.5 % , 4 % , 3.5 % , 3 % , 2.5 % , 2 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 1.5 % , 1 % , 0.9 % , 0.8 % , 0.7 % , 0.6 % , or 0.55 % , 0.5 % , 0.45 % , 98 % , or 99 % complementary with a region of the RNA 0.4 % , 0.35 % , 0.3 % , 0.0.25 % , 0.2 % , 0.15 % , 0.1 % , 0.05 % , transcript. In yet other embodiments the reverse complement 0.01 % , 0.005 % , or 0.001 % of the total mass of the RNA in product is 70 % -90 % , 75 % -90 % , 80 % -90 % , 85 % -90 % , the composition . In some embodiments the ratio of the 90 % -95 % , 91 % -95 % , 92 % -95 % , 93 % -95 % , 94 % -95 % , 20 cytokine- inducing RNA contaminant to RNA transcription 95 % -99 % , 96 % -99 % , 97 % -99 % , or 98 % -99 % complemen product ( e.g. , intended or desired RNA transcript) in the tary with a region of the RNA transcript. composition is 99 : 1 , 95: 5 , 90 : 10,85 : 15 , 80:20 , 75:25 , 70:30 , The skilled artisan will appreciate that unintended or 65:35 , 60:40 , 55:45 , 50:50 , 45:55 , 40:60 , 35:65 , 30:70 , undesireable reverse complement transcription products 25:75 , 20:80, 15:85 , 10:90, 5:95 , or 1:99 . In other embodi generated in an IVT reaction can have complementarity not 25 ments the ratio of the reverse complement transcription only to the RNA transcript which is the intended or desired product to the RNA transcription product ( e.g. , intended or product of the IVT reaction ( e.g., an mRNA , IncRNA , or desired RNA transcript) in the composition is 99 : 1 , 95 :5 , other RNA greater than 50 nucleotides in length intended for 90:10 , 85:15 , 80:20 , 75:25 , 70:30 , 65:35 , 60:40 , 55:45 , therapeutic use ) but also can have complementarity to a 50:50 , 45:55 , 40:60 , 35:65 , 30:70 , 25:75 , 20:80 , 15:85 , strand of the DNA template from which the intended or 30 10:90 , 5:95 , or 1:99 . desired RNA transcript is produced . Without being bound in The size of the contaminant may vary . In some embodi theory , it is believed that certain unintended or undesireable ments the length of the cytokine - inducing RNA contaminant transcription products contaminating IVT RNA composi and /or RNA transcription product is greater than 2 nucleo tions that are reduced or eliminated according to the novel tides up to and including the length of the full length processes of the instant invention are transcribed from the 35 transcription product ( e.g., the intended or desired transcrip intended or desired RNA transcription product , there exists tion produce , for example the mRNA transcript) . In other the possibility that certain unintended or undesireable tran embodiments the length of the cytokine- inducing RNA scription products contaminating IVT RNA compositions contaminant and / or RNA transcription product is greater may be transcribed from the DNA template used in the IVT than 5 , 10 , 15, 20 , 25 , 30 , 35 , 40 , 45 or 50 nucleotides each reactions. The latter supposition , while possible , does not 40 up to and including the length of the full length transcription appear to be evidenced by the data presented herein which product . In other embodiments the length of the cytokine demonstrates reverse complement transcription products inducing RNA contaminant and /or RNA transcription prod predominantly complementary to the 5' UTR and / or polyA uct is 2-500 nucleotides in length , 10-500 nucleotides in tail of mRNA transcripts , whereas reverse complement length , 15-500 nucleotides in length , 20-500 nucleotides in transcription products complementary to portions ( e.g. , 45 length , 30-500 nucleotides in length , 40-500 nucleotides in sequence elements ) of a DNA template not present in length , 50-500 nucleotides in length , 100-500 nucleotides in transcribed mRNA are significantly decreased and in some length , 200-500 nucleotides in length , 300-500 nucleotides instances not detectable . in length , 400-500 nucleotides in length , 2-200 nucleotides In other aspects the invention is a composition comprising in length , 10-200 nucleotides in length , 15-200 nucleotides an in vitro - transcribed ( IVT) RNA encoding a polypeptide 50 in length , 20-200 nucleotides in length , 30-200 nucleotides of interest and a pharmaceutically acceptable excipient, in length , 40-200 nucleotides in length , 50-200 nucleotides wherein the composition is substantially free of cytokine in length , 100-200 nucleotides in length , 200-300 nucleo aboutinducing DNA contaminant . In some embodiments , less than tides in length , 300-400 nucleotides in length , 2-100 nucleo of the mass of the RNA in the composition is tides in length , 10-100 nucleotides in length , 15-100 nucleo cytokine- inducing RNA contaminant. In some embodi- 55 tides in length , 20-100 nucleotides in length , 30-100 ments , less than about 0.25 % of the mass of the RNA in the nucleotides in length , 40-100 nucleotides in length , or composition is cytokine- inducing RNA contaminant . In 50-100 nucleotides in length . some embodiments , less than about 0.1 % of the mass of the The skilled artisan will appreciate that RNA contaminants RNA in the composition is cytokine- inducing RNA contami of a certain structure and /or length are quite prone to nant. In some embodiments , less than about 0.05 % of the 60 stimulating undesired or unwanted immune responses , for mass of the RNA in the composition is cytokine- inducing example , RNA contaminants of at least 15 or at least 20 or RNA contaminant. In some embodiments , less than about at least 25 nucleotides in length , in particular, RNA con 0.01 % of the mass of the RNA in the composition is taminants that are double - stranded in nature (dsRNAs ). cytokine -inducing RNA contaminant. In some embodi Removal of such contaminants is possible using certain ments , less than about 0.005 % of the mass of the RNA in the 65 art -recognized methodologies (e.g. , enzymatic and / or puri composition is cytokine- inducing RNA contaminant. In fication processes or method steps ). However, each of such some embodiments , less than about 0.001 % of the mass of additional purification process or step in the generation of, US 10,653,712 B2 5 6 for example , mRNAs, IncRNA , or other RNA greater than tides in length . In other embodiments the polyU sequence is 50 nucleotides in length intended for therapeutic use , intro single stranded . In yet other embodiments the polyU duces the possibility of reduced fidelity of the in ended sequence is double stranded . product , for example , by subjecting the direct IVT reaction In some embodiments the cytokine- inducing RNA - con product to ( 1 ) enzymatic conditions (e.g. , RNAse treatment 5 taminant comprises a reverse complement of the 5 ' -end of producing fragments of RNA ) and /or ( 2 ) high temperature , the IVT RNA and /or a reverse complement of the 3 ' - end of the IVT RNA . In some embodiments the reverse comple non - physiologic solvent conditions ( e.g. , HPLC or RP chro ment of the 5' - end of the IVT RNA comprises a sequence matography conditions ) which can compromise the quality complementary to all or a portion of a 5 ' UTR of the IVT of the RNA product in the process of attempting to degrade 10 RNA . In other embodiments the reverse complement of the or remove contaminants . 3 '- end of the IVT RNA comprises a sequence complemen In certain aspects of the invention , undesired or unwanted tary to all or a portion of a polyA tail of the IVT RNA . In contaminants are a population of RNA species having a some embodiments the reverse complement comprises a distribution of, for example , sizes and masses within a sequence complementary the first 10-15 nucleotides of the 5 ' certain range . For example , a certain type of contaminant 15 UTR . In some embodiments the reverse complement com can have less than 5 % of any individual species of contami prises a sequence complementary the first 10-20 nucleotides nant ( i.e., RNA species of the same sequence , same length , of the 5' UTR . In some embodiments the reverse comple etc.) . In other embodiments contaminants can have have less ment comprises a sequence complementary the first 10-30 than 4.5 % , 4.0 % , 3.5 % , 3.0 % , 2.5 % , 2.0 % , 1.5 % , 1.0 % , nucleotides of the 5 ' UTR . In some embodiments the reverse 0.5 % , 0.4 % , 0.3 % , 0.2 % , 0.1 % , 0.05 % , 0.001 % , 0.0005 % , 20 complement comprises a sequence complementary the first or 0.0001 % of any individual species. 10-40 nucleotides of the 5 ' UTR . In yet other embodiments In some embodiments the reverse complement transcrip the cytokine -inducing RNA -contaminant comprises a tion product is a RNA (dsRNA , SSRNA or a ds -ssRNA sequence complementary to all or a portion of a 5 ' end , a 3' hybrid having a ds portion and a ss portion ) comprising a end , an open reading frame and /or a polyA tail of the RNA strand comprising a sequence which is a reverse comple- 25 or any combination thereof. ment of the IVT RNA or a RNA (dsRNA , SSRNA or a In some embodiments the cytokine - inducing RNA -con ds- ssRNA . In some embodiments , where the Poly A tail is taminant is a single stranded tri- phosphate reverse comple encoded within a PolyA : T tract within the DNA template , ment of 20 nucleotides or greater. In other embodiments the the reverse complement product comprises a strand com cytokine -inducing RNA -contaminant is a single stranded prising a polyU sequence or others ways commonly used in 30 tri -phosphate reverse complement of 25 nucleotides or the art to install polyA tails in RNA . The poly U sequence greater . In other embodiments the cytokine -inducing RNA is , for example , pppU ( U ) n wherein n is 1 or greater. In some contaminant is a single stranded tri- phosphate reverse embodiments n is 1-100 ( for encoded poly A tails where complement of 30 nucleotides or greater. In some embodi target RNA has 100 nt poly A tail . In other embodiments n ments the single stranded tri- phosphate reverse complement is greater than 30 or 30-200 . In exemplary embodiments the 35 is 20-200 nucleotides in length . In some embodiments the reverse complement product initiates with a 5 ' triphosphate single stranded tri - phosphate reverse complement is 20-100 ( 5 '- PPP ). In other embodiments the reverse complement nucleotides in length . In some embodiments the single product initiates with a 5' diphosphate (5 '- PP ) or a 5' stranded tri -phosphate reverse complement is 20-50 nucleo monophosphate ( 5 '- P ) . tides in length . In some embodiments the single stranded In some embodiments the reverse complement transcrip- 40 tri - phosphate reverse complement is 25-200 nucleotides in tion product comprises a reverse complement of the 5 ' - end length . In some embodiments the single stranded tri -phos of the IVT RNA and /or a reverse complement of the 3 ' -end phate reverse complement is 25-100 nucleotides in length . of the IVT RNA . In some embodiments the reverse comple In some embodiments the single stranded tri -phosphate ment of the 5 '- end of the IVT RNA comprises a sequence reverse complement is 25-50 nucleotides in length . In some complementary to all or a portion of a 5 'UTR of the IVT 45 embodiments the single stranded tri -phosphate reverse RNA . In other embodiments the reverse complement of the complement is 30-200 nucleotides in length . In some 3 '- end of the IVT RNA comprises a sequence complemen embodiments the single stranded tri -phosphate reverse tary to all or a portion of a polyA tail of the IVT RNA . In complement is 30-100 nucleotides in length . In some yet other embodiments the reverse complement of the 3 ' -end embodiments the single stranded tri -phosphate reverse is the reverse complement of a tailless RNA . In yet other 50 complement is 30-50 nucleotides in length . embodiments the reverse complement transcription product In other embodiments the cytokine -inducing RNA - con comprises a sequence complementary to all or a portion of taminant is a single stranded reverse complement having a a 5 ' end , a 3 ' end , an open reading frame and/ or a polyA tail terminal tri- phosphate - A , tri- phosphate - C , or tri - phosphate of the RNA or any combination thereof. U. In exemplary aspects of the invention , a cytokine- induc- 55 In other embodiments the cytokine - inducing RNA - con ing RNA -contaminant is a RNA (dsRNA , SSRNA or a taminant is a double stranded tri -phosphate reverse comple ds - ssRNA . In some embodiments the cytokine- inducing ment of 20 nucleotides or greater. In some embodiments the RNA - contaminant is a strand that in some embodiments double stranded tri -phosphate reverse complement has comprises a reverse sequence which is a reverse comple 20-200 nucleotides. In yet other embodiments the cytokine ment of the IVT RNA or a dsRNA or ssRNA comprising a 60 inducing RNA -contaminant is a double stranded tri -phos strand comprising a polyU sequence . phate reverse complement that is a perfect duplex (no single In some embodiments the strand comprising the sequence stranded regions ). In other embodiments the cytokine -in which is the reverse complement of the IVT RNA or the ducing RNA - contaminant is a double stranded tri- phosphate strand comprising the polyU sequence initiates with a 5 ' reverse complement that includes a single stranded over triphosphate ( 5 - PPP ) . In some embodiments the polyU 65 hang . sequence is greater than 20 nucleotides in length . In some In some aspects of the invention , a dsRNA comprises embodiments the polyU sequence is greater than 30 nucleo strands of between 20 and 100 nucleotides in length in some US 10,653,712 B2 7 8 embodiments . In other embodiments the dsRNA is of duplex UTP or the reaction further comprises a nucleotide diphos of between about 20 and about 50 bp in length . In yet other phate ( NDP) or a nucleotide analog and wherein the con embodiments the dsRNA comprises strands of 1-1,000 , centration of the NDP or nucleotide analog is at least 2x 5-1,000 , 10-1,000 , 100-1,000 , 500-1,000 , 1-10 , 1-20 , 1-50 , greater than the concentration of any one or more of ATP, 1-100 , 5-10 , 5-20 , 5-30 , 5-50 , 5-100 , 5-200 , 5-300 , 5-400 , 5 CTP or UTP , In some embodiments the ratio of concentra 10-20 , 10-30 , 10-100 , 10-200 , 10-300 , 10-400 , 10-500 , tion of GTP to the concentration of any one ATP , CTP or 20-25 , 20-30 , 20-100 , 20-200 , 20-300 , 20-400 , 20-500 , UTP is at least 2 : 1 , at least 3 : 1 , at least 4 : 1 , at least 5 : 1 or 30-35 , 30-40 , 30-100 , 30-200 , 30-300 , 30-400 , or 30-500 nucleotides in length . In yet other embodiments the dsRNA at least 6 : 1 . comprises strands of 1 nucleotide to full length transcript 10 ATPThe, CTP ratio and of UTPconcentration is , in some of embodimentsGTP to concentration 2: 1 , 4 :1 andof length . 4 : 1, respectively . In other embodiments the ratio of concen In other embodiments less than about 0.5 % of the mass of tration ofGTP to concentration of ATP, CTP and UTP is 3 : 1 , the RNA in the composition is dsRNA of a size greater than 6 :1 and 6 : 1, respectively . The reaction mixture may com 40 Thebase purity pairs .of the products may be assessed using known 15 prise GTP and GDP and wherein the ratio of concentration analytical methods and assays. In exemplary aspects of the of GTP plus GDP to the concentration of any one of ATP, invention the amount of reverse complement transcription CTP or UTP is at least 2 : 1 , at least 3 : 1 , at least 4 : 1 , at least product or cytokine - inducing RNA contaminant is deter 5 : 1 or at least 6 : 1 In some embodiments the ratio of mined by high -performance liquid chromatography (such as concentration of GTP plus GDP to concentration of ATP , reverse - phase chromatography, size -exclusion chromatogra- 20 CTP and UTP is 3 : 1 , 6 : 1 and 6 : 1 , respectively . phy ), Bioanalyzer chip -based electrophoresis system , In yet other embodiments the RNA is produced by a ELISA , flow cytometry , acrylamide gel , a reconstitution or process or is preparable by a process comprising surrogate type assay . The assays may be performed with or ( a ) forming a reaction mixture comprising a DNA tem without nuclease treatment (P1 , RNase III , RNase H etc.) of plate and adenosine triphosphate ( ATP ) , cytidine triphos the RNA preparation . Electrophoretic / chromatographic / 25 phate (CTP ), uridine triphosphate (UTP ) , guanosine triphos mass spec analysis of nuclease digestion products may also phate (GTP ) and optionally guanosine diphosphate (GDP ) , be performed . and a buffer magnesium -containing buffer , In some embodiments the mass of RNA is determined by (b ) incubating the reaction mixture under conditions such mass spectrometry such as LC -MS , MALDI- TOF (matrix that the RNA is transcribed , assisted laser desorption ionization time of flight) . 30 wherein the effective concentration of phosphate in the In some embodiments the composition comprises con reaction is at least 150 mM phosphate , at least 160 mM , at taminant transcripts that have a length less than a full length least 170 mM , at least 180 mM , at least 190 mM , at least 200 transcript , such as for instance at least 100 , 200 , 300 , 400 , mm , least 210 mM or at least 220 mM . The effective 500 , 600 , 700 , 800 , or 900 nucleotides less than the full concentration of phosphate in the reaction may be 180 mM . length . Contaminant transcripts can include reverse or for- 35 The effective concentration of phosphate in the reaction in ward transcription products ( transcripts ) that have a length some embodiments is 195 mM . In other embodiments the less than a full length transcript, such as for instance at least effective concentration of phosphate in the reaction is 225 100 , 200 , 300 , 400 , 500 , 600 , 700 , 800 , or 900 nucleotides mM . less than the full length . Exemplary forward transcripts In other embodiments the RNA is produced by a process include , for instance , abortive transcripts . In certain embodi- 40 or is preparable by a process comprising ments the composition comprises a tri -phosphate poly - U ( a ) forming a reaction mixture comprising a DNA tem reverse complement of less than 30 nucleotides . In some plate and adenosine triphosphate ( ATP ), cytidine triphos embodiments the composition comprises a tri -phosphate phate (CTP ), uridine triphosphate (UTP ), guanosine triphos poly -U reverse complement of any length hybridized to a phate (GTP ) and optionally guanosine diphosphate (GDP ), full length transcript. In other embodiments the composition 45 and a buffer magnesium - containing buffer , comprises a single stranded tri -phosphate forward transcript. ( b ) incubating the reaction mixture under conditions such In other embodiments the composition comprises a single that the RNA is transcribed , stranded RNA having a terminal tri- phosphate - G . In other wherein the magnesium -containing buffer comprises embodiments the composition comprises single or double Mg2 + and wherein the molar ratio of concentration of ATP stranded RNA of less than 12 nucleotides or base pairs 50 plus CTP plus UTP pus GTP and optionally GDP to con ( including forward or reverse complement transcripts ). In centration of Mg2 + is at least 1.0 , at least 1.25 , at least 1.5 , any of these embodiments the composition may include less at least 1.75 , at least 1.85 , at least 3 or higher . The molar than 50 % , 45 % , 40 % , 35 % , 30 % , 25 % , 20 % , 15 % , 10 % , ratio of concentration of ATP plus CTP plus UTP pus GTP 9 % , 8 % , 7 % , 6 % , 5 % , 4 % , 3 % , 2 % , 1 % , or 0.5 % of any one and optionally GDP to concentration ofMg2 + may be 1.5 . of or combination of these less than full length transcripts . 55 The molar ratio of concentration of ATP plus CTP plusUTP In other embodiments the RNA is produced by a process pus GTP and optionally GDP to concentration of Mg2 + in or is preparable by a process comprising some embodiments is 1.88 . The molar ratio of concentration ( a ) forming a reaction mixture comprising a DNA tem of ATP plus CTP plus UTP pus GTP and optionally GDP to plate and NTPs including adenosine triphosphate ( ATP ), concentration of Mg2 + in some embodiments is 3 . cytidine triphosphate ( CTP ), uridine triphosphate (UTP ) , 60 In some embodiments the composition is produced by a guanosine triphosphate (GTP ) and optionally guanosine process which does not comprise an dsRNase (e.g. , RNa diphosphate (GDP ), and (eg . buffer containing T7 co - factor selll) treatment step . In other embodiments the composition eg , magnesium ). is produced by a process which does not comprise a reverse ( b ) incubating the reaction mixture under conditions such phase (RP ) chromatography purification step . In yet other that the RNA is transcribed , wherein the concentration of at 65 embodiments the composition is produced by a process least one ofGTP , CTP, ATP , and UTP is at least 2x greater which does not comprise a high - performance liquid chro than the concentration of any one or more of ATP, CTP or matography (HPLC ) purification step . US 10,653,712 B2 9 10 The RNA in some embodiments is modified mRNA . In centration of the NDP or nucleotide analog is at least 2x other embodiments the RNA is unmodified RNA . In other greater than the concentration of any one or more of ATP , embodiments the RNA is lncRNA . In yet other embodi CTP or UTP. In some embodiments the ratio of concentra ments is RNA greater than 50 nucleotides in length . The tion of GTP to the concentration of any one ATP, CTP or RNA may include a UTP and the UTP is modified UTP . 5 UTP is at least 2 : 1 , at least 3 : 1 , at least 4 : 1 , at least 5 : 1 or In some embodiments the amount of reverse complement transcription product or cytokine- inducing species is deter at least 6 : 1 to produce the RNA . mined indirectly by a process comprising : In some embodiments the ratio of concentration of GTP (a ) producing a composition comprising a model RNA to concentration of ATP , CTP and UTP is 2 : 1 , 4 : 1 and 4 : 1 , from a DNA template encoding the model RNA under 10 respectivelytion ofGTP . toIn concentrationother embodiments of ATP the, CTP ratio and of UTP concentra is 3: 1, identical IVT conditions as used to produce a IVT RNA , and 6 : 1 and 6 : 1, respectively . In yet other embodiments the scription( b ) determining product or the cytokine amount- inducing of reverse species complement by LC -MS tran in reaction mixture comprises GTP and GDP and wherein the the composition comprising the model RNA , ratio of concentration ofGTP plus GDP to the concentration wherein the amount of reverse complement transcription 15 of any one of ATP , CTP or UTP is at least 2 : 1 , at least 3 : 1 , product or cytokine- inducing species by LC -MS in the at least 4 : 1 , at least 5 : 1 or at least 6 : 1 in other embodiments composition comprising the model RNA indicates the the ratio of concentration ofGTP plusGDP to concentration amount of reverse complement transcription product or of ATP, CTP and UTP is 3 :1 , 6 : 1 and 6 :1 , respectively . cytokine - inducing species in the composition comprising Any of the compositions described herein may be a the IVT RNA . 20 reaction mixture , e.g., a mixture of an IVT reaction that has In other aspects the invention is an in vitro - transcribed not been purified by other methods such as RP chromatog ( IVT) RNA composition wherein the RNA is not subject to raphy. In other aspects the compositions are final products RNaselII treatments and /or is not subject to RP purification . ready for therapeutic administration to a subject. In yet other aspects the invention is a composition com Each of the limitations of the invention can encompass prising an in vitro - transcribed ( IVT) single stranded RNA 25 various embodiments of the invention . It is , therefore , antici encoding a polypeptide of interest and a pharmaceutically pated that each of the limitations of the invention involving acceptable excipient, wherein greater than 98 % of the RNA any one element or combinations of elements can be is single stranded and wherein the single stranded RNA included in each aspect of the invention . This invention is comprises transcripts of different lengths. In some embodi not limited in its application to the details of construction ments the single stranded RNA comprising transcripts of 30 and the arrangement of components set forth in the follow different lengths includes full length transcript and abortive ing description or illustrated in the drawings. The invention transcripts . In some embodiments 80-98 % of the single is capable of other embodiments and ofbeing practiced or of stranded non - full length transcript comprises abortive tran being carried out in various ways. scripts . In yet other embodiments 95-98 % of the single stranded non - full length transcript comprises abortive tran- 35 BRIEF DESCRIPTION OF DRAWINGS scripts . A unit of use composition is provided in other aspects of The accompanying drawings are not intended to be drawn the invention . The unit of use composition is an in vitro to scale . In the drawings , each identical or nearly identical transcribed ( IVT ) single stranded RNA encoding a polypep component that is illustrated in various figures is represented tide of interest and a pharmaceutically acceptable excipient , 40 by a like numeral. For purposes of clarity , not every com wherein the composition is free of residual organic solvents . ponent may be labeled in every drawing . In the drawings: In other aspects the invention is a composition comprising FIG . 1 is a graph depicting the results of an IFN - B assay an in vitro -transcribed ( IVT) single stranded RNA encoding screening hEPO chemistry variants , nLuc and vehicle con a polypeptide of interest and a pharmaceutically acceptable trols as well as short model RNA - 1 in BJ fibroblasts. excipient ,wherein the composition is non - immunogenic and 45 FIG . 2 shows the results of an LCMS analysis of a short wherein the single stranded RNA comprises transcripts of model transcript . The model demonstrates that the abortive different lengths. In some embodiments the single stranded species are present in all three chemistries. The top trace RNA comprising transcripts of different lengths includes full shows unmodified short model RNA - 1 , the middle trace length transcript and fragment transcripts such as abortive shows short model RNA with all uridines modified to transcripts . Fragment transcripts include for instance non- 50 pseudouridine and all cytidines modified with 5'0 -methyl , full length sense RNAs, truncated or prematurely terminated and the bottom trace shows short model RNA1 with some transcripts as well as abortive transcripts which are typically uridine and cytidine residues modified . less than the first 25 nucleotides of a transcription product. FIG . 3 shows the results of an LCMS analysis of a model In other aspects , the invention is a method of preparing transcript. The model demonstrates the impurity profiles of RNA comprising 55 model RNA - 4 and hEPO prepared by IVT. (a ) forming a reaction mixture comprising a DNA tem FIG . 4 shows that T7 can be used to perform RNA plate and NTPs including adenosine triphosphate (ATP ), templated RNA transcription in the absence of DNA tem cytidine triphosphate (CTP ) , uridine triphosphate (UTP ) , plate which upon treatment confers an immunostimulatory guanosine triphosphate (GTP ) and optionally guanosine product. diphosphate (GDP ), and a buffer eg . a magnesium -contain- 60 FIGS. 5A and 5B show the impact of reverse- phase (RP ) ing buffer, and and IVT with an excess ofGTP on the amount of RNase III (b ) incubating the reaction mixture under conditions such substrate . Both alpha process and RP purification reduce that the RNA is transcribed , wherein the concentration of at RIII substrate. An additive effect of combining both is least one of GTP , CTP , ATP , and UTP is at least 2x greater shown. FIG . 5A shows a Capillary Electrophoresis analysis than the concentration of any one or more of ATP, CTP or 65 of RNase III treated hEPO G5 material . FIG . 5B shows a UTP or the reaction further comprises a nucleotide diphos Capillary Electrophoresis analysis of RNase III treated phate (NDP ) or a nucleotide analog and wherein the con hEPO GO material. US 10,653,712 B2 11 12 FIG . 6 shows transfection data from hEPO protein expres FIG . 31 is a graph depicting in vitro analysis of dsRNA sion and IFN - B . oligos standards with different 5 ' functionalities. FIG . 7 is a Capillary Electrophoresis analysis of a short FIG . 32 is a graph demonstrating that phosphatase cannot transcript transcribed using different processes and treated dephosphorylate dsRNA . with RNase III. The data show the effect of model RNAs 5 FIG . 33 is a graph demonstrating the ssRNA Impurity treated with RNase III . Dose Response (IFNbeta in BJ Fibroblasts ). FIGS . 8A and 8B show the results of the RP - IP purity FIG . 34 is a graph demonstrating the dsRNA Impurity method . FIG . 8A showsmodel RNA - 4 subjected to RNase Dose Response ( IFNbeta in BJ Fibroblasts ) . III treatment following IVT using the equimolar method and FIG . 35 is a graph demonstrating the IFNbeta Response FIG . 8B shows model RNA -4 subjected to RNase III treat 10 for modified 5 ' nucleotide on Forward Oligo Standards. ment following IVT with an excess of GTP. FIG . 36 is a graph demonstrating the IFNbeta Response FIG . 9 is a RP Fractionation of hEPO treated with and for modified 5 ' nucleotide on Reverse Complement Oligo without RNase III . Standards . FIGS. 10A - 10D show hEPO fraction RNase III fragment FIG . 37 is a graph demonstrating the IFNbeta Response analyzer data following equimolar (FIGS . 10A , 10B , and 15 for 5 ' hydroxyl functionalized dsRNA . 10C ) reactions. The hEPO was modified so that its uridine FIG . 38 is a graph demonstrating that that alpha process bases were 1 -methylpseudouridine . Treatment with RNase generates more OH (clean ) than equimolar process. III did not show appreciable purity differences using process FIG . 39 is a graph showing calculated dsRNA for 1 ug with excess GTP. With equimolar there is considerable 20 mRNA . substrate . FIG . 10D shows in vitro IFNbeta analysis of FIG . 40 is a schematic depicting a traditional in vitro hEPO EQ G5 untreated or after RNase III treatment under transcription (IVT ) process and types of impurities formed . equimolar conditions. FIGS . 11A - 11D show Capillary Electrophoresis analysis DETAILED DESCRIPTION of RP fractionated hEPO Alpha +/-RIII treatment. FIGS . 25 11A , 11B and 11C show the effects of IVT with an excess of In order to enhance methods for manufacturing protein GTP in the reactions . FIG . 11D shows IVT with excess GTP , coding polymers, new methods of generating RNA have which resulted in no IFN response . been developed . It has been discovered that changes can be FIG . 12 shows the results of a J2 anti - dsRNA ELISA made to an in vitro transcription process to produce an RNA assay . 30 preparation having vastly different properties from RNA FIG . 13 shows that dsRNA is removed by RNase III produced using a traditional in vitro transcription (IVT ) treatment. process. The RNA preparations produced according to the FIG . 14 shows the results of an IVT characterization methods of the invention (also referred to herein as the IVT study, illustrating that the IVT with an excess ofGTP is less RNA compositions ) have properties that enable the produc sensitive to low temperature- induced cytokine spikes. 35 tion of qualitatively and quantitatively superior composi FIG . 15 shows the nuclease P1 results of the IVT char tions comprising said RNA transcripts . Even when coupled acterization study . with extensive purification processes, RNA produced using FIGS. 16A to 16B show an impurity analysis by LCMS of traditional IVT methods is qualitatively and quantitatively RNA -based IVT in different chemistries using G5 in distinct from the RNA preparations of the invention . For Equimolar process (FIG . 16A ) and alpha process (FIG . 40 instance , the RNA preparations of the invention (and com 16B ) . positions comprising same) are less immunogenic in com FIG . 17 shows IFN - B in BJ fibroblasts under the different parison to RNA preparations and compositions comprising IVT conditions. same) made using traditional IVT. The RNA preparations FIG . 18 shows that dsRNA cannot be capped by vaccinia . produced according to the methods of the invention ( also FIG . 19 shows the effects of CIP treatment on different 45 referred to herein as the IVT RNA compositions ) further dsRNA species. have properties that enable the production of qualitatively FIG . 20 shows FA purity data from the in vivo experi and quantitatively superior protein production , for instance , ments . when translated . For instance, protein generated from the FIG . 21 shows IFN - B induction in BJ fibroblasts . RNA preparations of the invention is less immunogenic in FIG . 22 shows in vivo expression of hEPO . 50 comparison to RNA preparations made using traditional FIGS. 23A to 23D show cytokine Luminex data from the IVT . in vivo experiments. Additionally , increased protein expression levels with FIG . 24 shows in vivo B -cell activation frequencies . higher purity are produced from the RNA preparations FIG . 25 shows the results of an IFN - ß assay, analyzing described herein . Although not bound by a mechanism , it is short dsRNAs. The assay is an in vitro analysis of short 5' 55 believed that substantial protein expression levels are a triphosphorylated oligos . result of the high integrity of mRNA in the purified samples . FIG . 26 shows the results of an IFN - ß assay , analyzing While some purification procedures can effectively remove 20mer and polyU / A dsRNAs . a level of contaminants by degradation of those contami FIG . 27 shows an analysis of 3 ' overhang with respect to nants , the integrity of the pharmaceutical product is nega IFN - ß response . 60 tively impacted . For instance , it is asserted in prior art that FIG . 28 shows the results of a cytokine assay testing RNAse digestion of mRNA samples is useful for removing dsRNA standards with 5 ' overhang , perfect duplex , and 3 ' RNA contaminants . However, RNAse digestion also reduces overhang of varying lengths . the integrity of the mRNA by degrading portions of full FIG . 29 is a graph depicting in vitro analysis of polyU length transcript produced by the IVT reaction . In contrast to species. 65 the prior art IVT/ purification processes the integrity of FIG . 30 is a graph depicting in vitro analysis of ssRNA mRNA using the methods of the invention is quite high oligo standards. because the methods produce very little to no double US 10,653,712 B2 13 14 stranded transcripts that would require removal using pro of the undesirable contaminants produced using the prior art cedures such as RNAse digestion . processes . One parameter in the IVT reaction that may be The RNA produced by the processes described herein is manipulated is the relative amount of a nucleotide or nucleo any RNA greater than 30 nucleotides in length which may be tide analog in comparison to one or more other nucleotides used for therapeutic or diagnostic purposes . In some 5 or nucleotide analogs in the reaction mixture (e.g. , disparate embodiments the RNA is an RNA of greater than 40 , 50 , 60 , nucleotide amounts or concentration ) . For instance, the IVT 75 , 100 , 200 , 300 , 400 , 500 , or 1,000 nucleotides in length . reaction may include an excess of a nucleotides, e.g., In some embodiments the RNA is an RNA of greater than nucleotide monophosphate , nucleotide diphosphate or 1000 , 2000 , 3000 , 4000 , 5000 , 6000 , 7000 , 8000 , 9000 , nucleotide triphosphate and /or an excess of nucleotide ana 10,000 , 11,000 , or 12,000 nucleotides in length . The RNA in 10 logs and /or nucleoside analogs . The methods of the inven some embodiments is mRNA . In some embodiments the tion produce a high yield product which is significantly more RNA is an RNA of about 500 to about 4000 nucleotides in pure than products produced by traditional IVT methods . length , 1000 about to about 2000 nucleotides in length , 750 Nucleotide analogs are compounds that have the general about to3000 about nucleotides 1800 nucleotides in length , aboutin length 4000 , aboutto about 1500 7000 to 15 structure of a nucleotide or are structurally similar to a nucleotides in length , or about 6000 to about 12000 nucleo nucleotide or portion thereof. In particular, nucleotide ana tides in length . The mRNA may be modified or unmodified . logs are nucleotides which contain , for example , an ana In other embodiments the RNA is one or more of the logue of the nucleic acid portion , sugar portion and /or following : mRNA , modified mRNA , unmodified RNA , phosphate groups of the nucleotide. Nucleotides include, for IncRNA , self -replicating RNA , circular RNA , CRISPR 20 instance , nucleotide monophosphates , nucleotide diphos guide RNA . phates, and nucleotide triphosphates . A nucleotide analog , as Traditional IVT reactions are performed by incubating a used herein is structurally similar to a nucleotide or portion DNA template with an RNA polymerase and equimolar thereof but does not have the typical nucleotide structure quantities of nucleotide triphosphates , including GTP, ATP, (nucleobase -ribose - phosphate ). Nucleoside analogs are CTP , and UTP in a transcription buffer. An RNA transcript 25 compounds that have the general structure of a nucleoside or having a 5 ' terminal guanosine triphosphate is produced are structurally similar to a nucleoside or portion thereof. In from this reaction . These reactions also result in the pro particular , nucleoside analogs are nucleosides which con duction of a number of impurities such as double stranded tain , for example , an analogue of the nucleic acid and /or and single stranded RNAs which are immunostimulatory sugar portion of the nucleoside . and may have an additive impact. The methods of the 30 A nucleoside triphosphate , as used herein , refers to a invention which prevent formation of reverse complements molecule including a nucleobase linked to a ribose ( i.e. prevent the innate immune recognition of both species . In nucleoside ) and three phosphates (i.e. nucleotide ). A nucleo some embodiments the methods of the invention result in the tide diphosphate refers the samemolecule , but which has production of RNA having significantly reduced T cell two phosphate moieties. A nucleotide monophosphate refers activity than an RNA preparation made using prior art 35 to the same molecule , but which has one phosphate moiety . methods with equimolar NTPs. The prior art attempts to The nucleotide monophosphate , nucleotide diphosphate and remove these undesirable components using a series of triphosphate are sometimes referred to herein as NMP, NDP subsequent purification steps. Such purification methods are and NTP , respectively . The N in NMP, NDP and NTP refer undesirable because they involve additional time and to any nucleotide, including naturally occurring nucleotides , resources and also result in the incorporation of residual 40 synthetic nucleotides , and modified nucleotides . Thus the organic solvents in the final product , which is undesirable terms NDP and NTP refer to nucleotide diphosphates and for a pharmaceutical product. It is labor and capital intensive nucleotide triphosphates, respectively, having any naturally to scale up processes like reverse phase chromatography occurring , synthetic , or modified nucleotide therein . (RP ) : utilizing for instance explosion proof facilities, HPLC Natural nucleotide diphosphates include at least adenos columns and purification systems rated for high pressure , 45 ine diphosphate (ADP ), guanosine diphosphate (GDP ), cyti high temperature , flammable solvents etc. The scale and dine diphosphate ( CDP ), and uridine diphosphate (UDP ) . throughput for large scale manufacture are limited by these Natural nucleotide triphosphates include at least adenosine factors . Subsequent purification is also required to remove triphosphate (ATP ), guanosine triphosphate (GTP ) , cytidine alkylammonium ion pair utilized in RP process . In contrast triphosphate (CTP ), 5 -methyluridine triphosphate (m5UTP ) , the methods described herein even enhance currently uti- 50 and uridine triphosphate (UTP ) . In some embodiments the lized methods (eg RP ) . Lower impurity load leads to higher NDP and /or NTP are modified . For instance , modified NDP purification recovery of full length RNA devoid of cytokine or NTP may have a handle to enable easy purification and inducing contaminants eg . higher quality of materials at the isolation . outset. An additional advantage of the modified IVT pro Nucleotide triphophates are added to the RNA strand by cesses of the invention , when using RNase III as a prepara- 55 a polymerase such as 17 polymerase . Nucleotide diphos tive purification , is that since there is less RNase III sub phates and monophosphates, in contrast can initiate the strate , less inert/ extraneous cleavage products ( those that reaction ( e.g. , serve as the first transcribed monomer) but degrade but do not translate ) are generated by RNase III won't be incorporated within the strand by T7 polymerase treatment. If only trace amounts of dsRNA/ RNase III sub ( e.g., won't be incorporated anywhere else in the strand ) . In strate , even though may be cytokine silent, more final intact 60 some instances the nucleotide diphophates, such as GDP, RNA product intact cap /ORF /PolyA ) capable of translating may be incoproated as the first monomer . For instance if T7 protein is present . This leads to a reduced burden for any initiates with GDP and produces a 5'GDP a functional RNA subsequent purification . may be generated . 5 ' GDP initiated RNA is still a substrate It was discovered quite surprisingly , according to aspects for vaccinia capping enzyme. When an excess of NMP such of the invention , that the manipulation of one or more of the 65 as GMP is used in the reaction the purity may be enhanced reaction parameters in the IVT reaction produces a RNA by ligating a cap on , as the transcripted product with 5 ' P04 preparation of highly functional RNA without one or more is a substrate for ligase ( s ) ( e.g. , DNA /RNA ligase ( s )) . US 10,653,712 B2 15 16 The nucleotide analogs useful in the invention are struc -continued turally similar to nucleotides or portions thereof but, for example , are not polymerizable by T7 . Nucleotide /nucleo ?? Custom NTPs ( 25 mM each ) 7.2 ul 4 RNase Inhibitor 20 U side analogs as used herein (including C , T, A , U , G , dC , dT, 5 T7 RNA polymerase 3000 U dA , dU , or dG analogs) include for instance , antiviral 5 6 dH20 Up to 20.0 ul and nucleotide analogs , phosphate analogs (soluble or immobi 7 Incubation at 37 ° C. for 1 hr - 5 hrs . lized , hydrolyzable or non -hydrolyzable ), dinucleotide, tri nucleotide , tetranucleotide, e.g., a cap analog , or a precursor/ The crude IVT mix may be stored at 4 ° C. for 4-12 hours . substrate for enzymatic capping ( vaccinia , or ligase ) , a One unit of RNase - free DNase is then used to digest the nucleotide labelled with a functional group to facilitate 10 original template . After 15 minutes of incubation at 37 ° C., ligation /conjugation of cap or 5 ' moiety ( IRES ) , a nucleotide the RNA is purified using purification techniques such as dT labelled with a 5 ' P04 to facilitate ligation of cap or 5 ' resin , reverse phase HPLC or Ambion's MEGACLEARTM moiety , or a nucleotide labelled with a functional group / Kit (Austin , Tex . ) following the manufacturer's instructions. protecting group that can be chemically or enzymatically The exemplary IVT reaction is not limiting in terms of cleavable . Antiviral nucleotide/ nucleoside analogs include 15 components or amounts of components used . but are not limited to Ganciclovir , Entecavir , Telbivudine , Similar to traditionalmethods , the RNA of the invention Vidarabine and Cidofovir . may also be produced by forming a reaction mixture com IVT Reaction Conditions prising a DNA template , and one or more NTPs such as ATP , In exemplary aspects , the methods of the invention CTP, UTP, GTP ( or corresponding analog of aforementioned involve the production of RNA via an IVT reaction . IVT is 20 components ) and a buffer. The reaction is then incubated an art -recognized method used to generate synthetic poly under conditions such that the RNA is transcribed . However , nucleotides in vitro . In vitro transcribed (IVT ) RNA can be the methods of the invention involve the surprising finding engineered to transiently express proteins by structurally that the presence of an excess amount of one or more nucleotides and/ or nucleotide analogs can have significant resembling natural RNA . However, there are inherent chal impact on the end product. Themethods of the invention can lenges of this drug class , particularly related to controlling 25 be used to produce high quality product lacking unintended the translational efficacy and immunogenicity of the IVT or undesireable impurities and without impacting the effi RNA . In particular , IVT RNA produces unwanted innate cacy of the reaction . immune effects and there are very stringent purification The IVT methods of the invention involve a modification procedures by HPLC that are typically applied as an addi in the amount ( e.g., molar amount or quantity ) ofnucleotides tional, final RNA production step . The removal of minor 30 and / or nucleotide analogs in the reaction mixture. In some amounts of short double stranded RNA fragments is criti aspects , one or more nucleotides and / or one or more nucleo cally important to achieve this further reduced immune tide analogs may be added in excess to the reaction mixture . response . An excess of nucleotides and /or nucleotide analogs is any The typical reaction used in the prior art provides a high amount greater than the amount of one or more of the other fidelity reasonably high yield product. However , the product 35 nucleotides such as NTPs in the reaction mixture . For has a baseline level of contaminants , only some of which can instance , an excess of a nucleotide and / or nucleotide analog be removed using routine purification methods. The IVT may be a greater amount than the amount of each or at least reaction typically includes the following: an RNA poly one of the other individual NTPs in the reaction mixture or merase , e.g. , a 17 RNA polymerase at a final concentration may refer to an amount greater than equimolar amounts of of, e.g., 1000-12000 U /mL , e.g. , 7000 U /mL ; the DNA 40 the other NTPs. template at a final concentration of, e.g., 10-70 nM , e.g., 40 In the embodiment when the nucleotide and / or nucleotide nM ; nucleotides (NTPs ) at a final concentration of e.g., analog that is included in the reaction mixture is an NTP, the 0.5-10 mM , e.g. , 7.5 mM each ; magnesium at a final NTP may be present in a higher concentration than all three concentration of, e.g. , 12-60 mM , e.g., magnesium acetate at of the other NTPs included in the reaction mixture . The other 40 mM ; a buffer such as , e.g., HEPES or Tris at a pH of, e.g. , 45 three NTPs may be in an equimolar concentration one 7-8.5 , e.g. 40 mM Tris HC1, pH 8. In some embodiments 5 another . Alternatively one or more of the three other NTPs mM dithiothreitol (DTT ) and / or 1 mM spermidine may be may be in a different concentration than one or more of the included . In some embodiments , an RNase inhibitor is other NTPs . included in the IVT reaction to ensure no RNase induced In some embodiments , the excess of the selected NTP is murinedegradation RNase during inhibitor the transcriptioncan be utilized reaction at a final . For concentra example , 50 2 times or fold (X ), 3x , 4x , 5x , 6x , 7x , 8X , 9X , 10x , 11x , 12x , tion of 1000 U /mL . In some embodiments a pyrophos 13x , 14x , 154 , 15x - 100 % , 10x - 90x , 10x -80X , 10X -70x or phatase is included in the IVT reaction to cleave the inor even greater than the amount of any one ormore of the other ganic pyrophosphate generated following each nucleotide individual NTPs in the reaction mixture . In other embodi incorporation into two units of inorganic phosphate . This ments , the excess of the selected NTP is 2 times or fold (x ), ensures that magnesium remains in solution and does not 55 3x , 4x , 5x , 6x , 7x , 8X , 9X , 10x , 11x , 12x , 13x , 14x , 15x , precipitate as magnesium pyrophosphate . For example , an 15x - 100x , 10x - 90x , 10x - 80x , 10x - 70x or even greater than E. coli inorganic pyrophosphatase can be utilized at a final the amount of the total of the other individual NTPs in the concentration of 1 U /mL . reaction mixture. In exemplary embodiments , the NTP is in A typical in vitro transcription reaction includes the a molar excess relative to other NTPs in the reaction following: 60 mixture . For example , the NTP in excess can be added at a molar ratio , e.g., 2 : 1 , 3 : 1 , 4 : 1 , 5 : 1 , 6 : 1 , 7 : 1 , 8 : 1 , 9 : 1 , 10 : 1 , 11: 1 , 12 : 1 , 13 : 1 , 14 : 1 , 15 : 1 , or greater than one or more of Template cDNA 1.0 ug the other NTPs in the reaction mixture . In other embodi 2 10x transcription buffer 2.0 ul (400 mM Tris -HCl pH 8.0 , ments , the excess of the selected NTP is in a concentration 190 mM MgCl2 , 50 mM DTT or 65 of 0.5 mm , 1.0 mm , 1.5 mM , 2.0 mm , 2.5 mM , 3.0 mm , TCEP , 10 mM Spermidine ) 3.54.0 mm , 4.5 mm , 5.0 mM , 5.5 mM , 6.0 mm , 7 mM , 8 mM , 9 mM , 10 mM , 15 mM , 20 mM , 30 mM , 40 mM , 50 US 10,653,712 B2 17 18 mM , 60 mm , 70 mm , 100 mm , 120 mM , 150 mM , or even about 5.5 : 1 , from about 5 : 1 to about 6 : 1 , from about 5.5 : 1 to greater than the amount of any one or more of the other about 6.5 : 1 , from about 6 : 1 to 7 : 1 , from about 6.5 : 1 to about individual NTPs in the reaction mixture or in a range of 7.5 : 1 , from about 7 : 1 to about 8 : 1 , from about 7.5 : 1 to about 60-100 mM or 4.5-100 mM . In other embodiments , the 8.5 : 1 , from about 8 : 1 to about 9 : 1 , from about 8.5 : 1 to about excess of the selected NTP is in a concentration of 0.5 mm , 5 9.5 : 1 , and from about 9 : 1 to about 10 : 1 . In an embodiment, 1.0 mM , 1.5 mM , 2.0 mM , 2.5 mM , 3.0 mM , 3.54.0 mM , 4.5 the ratio of concentration of GTP to the concentration of mM , 5.0 mM , 5.5 mM , 6.0 mm , 7 mM , 8 mm , 9 mm , 10 ATP, CTP, and UTP may be 2 : 1 , 4 : 1 , and 4 : 1 , respectively . MM , 15 mM , 20 mM , 30 mM , 40 mm , 50 mm , 60 mm , 70 In another embodiment, the ratio of concentration ofGTP to mM , 100 mm , 120 mM , 150 mM or even greater than the the concentration of ATP, CTP , and UTP may be 3 : 1, 6 : 1 , and amount of any one or more of the sum of the other NTPs in 10 6 : 1 , respectively . the reaction mixture . In the embodiment when the nucleotide and /or nucleotide In some instances , the NTP in excess in the reaction analog that is included in the reaction mixture is an NDP or mixture is NTP - 1 and the other NTPs in the reaction mixture a nucleotide analog , the NDP or nucleotide analog may be are NTP - 2 , NTP - 3 , and NTP - 4 . In some embodiments present in a higher concentration than all four of the NTPs NTP - 1 is present in the reaction mixture in a greater con- 15 included in the reaction mixture . The four NTPs may be in centration than NTP - 2 , NTP - 3 , and NTP - 4 and wherein an equimolar concentration to one another . Alternatively one NTP - 2 , NTP - 3 , and NTP - 4 are each in an equimolar amount. or more of the four NTPs may be in a different concentration In some embodiments the ratio of NTP - 1 :NTP - 2 :NTP - 3 : than one or more of the other NTPs . NTP -4 is at least 2 : 1 : 1 : 1 , at least 3 : 1 : 1 : 1 , at least 4 : 1 : 1 : 1 , at In other embodiments , the excess of the selected NDP or least 5 :1 :1 : 1 , at least 6 : 1: 1: 1 , at least 7: 1: 1 : 1 , at least 8 :1 : 1: 1, 20 nucleotide analog is 2 times or fold (X ), 3x , 4x , 5x , 6x , 7x , at least 9 : 1 : 1 : 1 , at least 10 : 1 : 1 : 1 , at least 11 : 1 : 1 : 1 , at least 8X , 9X , 10x , 11x , 12x , 13x , 14x , 15x , 15x - 100x , 10 % -90 % , 12 : 1 : 1 : 1 , at least 13 : 1 : 1 : 1 , at least 14 : 1 : 1: 1 , at least 15 : 1 : 1 : 1 , 10x - 80x , 10x -70x or even greater than the amount of any at least 16 : 1 : 1 : 1 , at least 17 : 1 : 1 : 1 , at least 18 : 1 : 1 : 1 , at least one or more of the individualNTPs in the reaction mixture . 19 : 1 : 1: 1 , each with a potential upper cap ofNTP - 1 as 20. In In other embodiments , the excess of the selected NDP or some embodiments the ratio of NTP - 1: NTP -2 + NTP -3 + 25 nucleotide analog is 2 times or fold (x ) , 3x , 4x , 5x , 6x , 7x , NTP - 4 is at least 3 : 3 , at least 5 : 3 , at least 6 : 3 , at least 7 : 3 , 8X , 9X , 10x , 11x , 12x , 13x , 14x , 15x , 15x - 100 % , 10 % -90 % , at least 8 : 3 , at least 9 :3 , at least 10 : 3 , or at least 15 : 3 , each 10x -80x , 10x - 70x or even greater than the amount of the with a potential upper cap of 20 : 3 . total of the individual NTPs in the reaction mixture . In In other embodiments NTP - 1 is present in the reaction exemplary embodiments , the NDP or nucleotide analog is in mixture in a greater concentration than NTP - 2 , NTP - 3 , and 30 a molar excess relative to other NTPs in the reaction NTP -4 and NTP - 2 and NTP - 3 are each in an equimolar mixture . For example , the NDP or nucleotide analog in amount and NTP - 4 is present in the reaction mixture in a excess can be added at a molar ratio , e.g., 2 : 1 , 3 : 1 , 4 : 1 , 5 : 1 , concentration higher than NTP - 2 and NTP - 3 and less than 6 : 1 , 8 : 1 , 9 : 1, 10 : 1 , 11 : 1 , 12 : 1 , 3 : 1 , 14 : 1 , 15 : 1 , or NTP - 1 . For instance , in some embodiments the ratio of greater than one or more of the NTPs in the reaction mixture . NTP - 1 :NTP - 4 :NTP - 2 :NTP - 3 is at least 3 : 2 : 1 : 1 , at least 35 In other embodiments , the excess of the selected NDP or 4 : 3 : 1 : 1 , at least 4 : 2 : 1 : 1 , at least 5 : 3 : 1 : 1 , at least 5 : 3 : 2 : 2 , at nucleotide analog is in a concentration of 0.5 mm , 1.0 mm , least 6 : 4 : 2 : 2 , at least 8 : 4 : 2 : 2 , at least 9 : 2 : 1 : 1 , at least 1.5 mM , 2.0 mM , 2.5 mM , 3.0 mM , 3.54.0 mM , 4.5 mM , 5.0 10 : 2 : 1 : 1 , at least 11: 2 : 1 : 1 , at least 12 : 2 : 1 : 1 , at least 13 : 2 : 1 : 1 , mM , 5.5 mM , 6.0 mm , 7 mm , 8 mm , 9 mm , 10 mm , 15 at least 14 : 2 : 1 : 1 , at least 15 : 2 : 1 : 1 , at least 16 : 2 : 1 : 1 , at least mM , 20 mM , 30 mm , 40 mm , 50 mM , 60 mM , 70 mM , 100 17 : 2 : 1 : 1 , at least 18 : 2 : 1 : 1 , at least 19 : 2 : 1 : 1 , each with a 40 mm , 120 mm , 150 mm , or even greater than the amount of potential upper cap of NTP - 1 as 20 . any one or more of the individual NTPs in the reaction In other embodiments NTP - 1 is present in the reaction mixture or in a range of60-100 mM or 4.5-100 mM . In other mixture in a greater concentration than NTP -2 , NTP -3 , and embodiments , the excess of the selected NDP or nucleotide NTP - 4 and NTP -2 and NTP - 3 are each in an equimolar analog is in a concentration of 0.5 mM , 1.0 mm , 1.5 mM , 2.0 amount and NTP - 4 is present in the reaction mixture in a 45 mM , 2.5 mM , 3.0 mM , 3.54.0 mm , 4.5 mm , 5.0 mm , 5.5 concentration less than NTP - 1 , NTP - 2 and NTP - 3 . For mM , 6.0 mm , 7 mm , 8 mM , 9 mm , 10 mM , 15 mM , 20 mm , instance , in some embodiments the ratio of NTP - 1 :NTP -3 : 30 mM , 40 mm , 50 mm , 60 mm , 70 mM , 100 mM , 120 NTP - 2 :NTP - 4 is at least 3 : 2 :2 : 1, at least 4 :3 : 3 : 1 , at least mM , 150 mM or even greater than the amount of any one or 4 : 2 : 2 : 1 , at least 5 : 3 : 3 : 1 , at least 5 : 3 : 3 : 2 , at least 6 : 4 : 4 : 2 , at more of the sum of the NTPs in the reaction mixture . least 8 : 4 : 4 : 2 , at least 9 : 2 : 2 : 1 , at least 10 : 2 : 2 : 1 , at least 50 In some instances , the NTPs in the reaction mixture are 11 : 2 : 2 : 1 , at least 12 : 2 : 2 : 1 , at least 13 : 2 : 2 : 1 , at least 14 : 2 : 2 : 1 , NTP - 1, NTP - 2 , NTP - 3, and NTP - 4 . In some embodiments at least 15 :2 : 2 : 1 , at least 16 : 2 :2 : 1 , at least 17 : 2 : 2 : 1 , at least NDP or nucleotide analog is present in the reaction mixture 18 : 2 : 2 : 1 , at least 19: 2 : 2 : 1 , each with a potential upper cap of in a greater concentration than NTP - 1 , NTP - 2 , NTP - 3 , and NTP - 1 as 20 . NTP - 4 and wherein NTP - 1 , NTP - 2 , NTP - 3 , and NTP - 4 are NTP - 1 in some embodiments is GTP , ATP , UTP, or CTP . 55 each in an equimolar amount. In some embodiments the NTP - 2 in some embodiments is GTP, ATP , UTP , or CTP . ratio of NDP or nucleotide analog: NTP - 1 + NTP + 2 :NTP - 3 + NTP - 3 in some embodiments is GTP , ATP, UTP , or CTP . NTP - 4 is at least 4 : 4 , at least 5 : 4 , at least 6 : 4 , at least 7 : 4 , NTP - 4 in some embodiments is GTP, ATP , UTP , or CTP . at least 8 : 4 , at least 9 : 4 , at least 10 : 4 , or at least 15 : 4 , each In some embodiments , the NTP is GTP and it is present with a potential upper cap of 20 : 4 . in the mixture at a ratio of at least 2 : 1 , at least 3 : 1 , at least 60 In some embodiments the excess of NDP or nucleotide 4 : 1 , at least 5 : 1 , at least 6 : 1 , at least 7 : 1 , at least 8 : 1 , at least analog is combined with an equivalent or greater concen 9 : 1 , at least 10 : 1 , at least 11: 1 , at least 12 : 1 , at least 13 : 1 , at tration of one of the four NTPs . least 14 : 1 , or at least 15 : 1 relative to the concentration of any In other embodiments NDP or nucleotide analog is pres one of ATP , CTP , or UTP . The ratio of GTP to other NTPs ent in the reaction mixture in a greater concentration than may be from about 2 : 1 to about 3 : 1 , from about 2.5 : 1 to 65 NTP - 1 ,NTP - 2 , NTP -3 , and NTP - 4 and NTP - 1, NTP -2 and about 3.5 : 1 , from about 3 : 1 to about 4 : 1 , from about 3.5 : 1 to NTP - 3 are each in an equimolar amount and NTP - 4 is about 4.5 :1 , from about 4 :1 to about 5 : 1, from about 4.5 : 1 to present in the reaction mixture in a concentration less than US 10,653,712 B2 19 20 or greater than NTP - 1 , NTP - 2 and NTP - 3 . For instance , in 7x , 8X , 9X , 10x, 11x , 12x , 13x , 14x , 15x , 15x - 100x, some embodiments the ratio of NDP or nucleotide analog : 10x - 90x , 10x -80x , 10x - 70x or even greater than the amount NTP - 1 :NTP -3 :NTP - 2 :NTP - 4 is at least 3 : 2 : 2 : 2 : 1 , at least of the NTP in the reaction mixture . 4 : 3 : 3 : 3 : 1 , at least 4 : 2 : 2 : 2 : 1 , at least 5 : 3 : 3 : 3 : 1 , at least In each of the embodiments described herein , the NTP and 5 : 3 : 3 : 3 : 2 , at least 6 : 4 : 4 : 4 : 2 , at least 8 : 4 : 4 : 4 : 2 , at least 5 NDP may be , for example , GTP and GDP, respectively , and 9 : 2 : 2 : 2 : 1, at least 10 :2 : 2 : 2 : 1 , at least 11: 2 : 2 : 2 : 1 , at least may be present in the mixture in a concentration at least 6 12 : 2 : 2 : 2 : 1 , at least 13 : 2 : 2 : 2 : 1 , at least 14 : 2 : 2 : 2 : 1 , at least times or fold ( ), 7x , 8X , 9X , 10x , 11x , 12x , 13x , 14x , 15x , 15 : 2 : 2 : 2 : 1 , at least 16 : 2 : 2 : 2 : 1 , at least 17 : 2 : 2 : 2 : 1 , at least 15x - 100x , 10x -90x , 10x - 80x , 10x - 70x or even greater than 18 : 2 : 2 : 2 : 1 , at least 19 :2 : 2: 2 :1 , each with a potential upper the amount of any one of ATP , CTP, or UTP in the reaction cap of NDP or nucleotide analog as 20 . 10 mixture . In exemplary embodiments , the NTP and NDP in In other embodiments NDP or nucleotide analog is pres combination are in a molar excess relative to the other ent in the reaction mixture in a greater concentration than individual NTPs in the reaction mixture. For example , the NTP - 1 , NTP -2 , NTP - 3 , and NTP - 4 and NTP - 2 and NTP - 3 NTP and NDP combination mixture can be added at a molar are each in an equimolar amount and NTP - 1 and /or NTP - 4 ratio , e.g. , 2 : 1 , 3 : 1, 4 : 1 , 5 : 1, 6 : 1 , 7 :1 , 8 : 1, 9: 1 , 10 :1 , 11 :1 , are present in the reaction mixture in a concentration less 15 12 : 1 , 13 : 1 , 14 : 1 , 15 : 1 , or greater in the reaction mixture. The than or greater than NTP - 2 and NTP - 3 . In other embodi ratio ofGTP and GDP to other NTPs may be from about 2 : 1 ments NDP or nucleotide analog is present in the reaction to about 3 : 1 , from about 2.5 : 1 to about 3.5 : 1 , from about 3 : 1 mixture in a greater concentration than NTP - 1 , NTP - 2 , to about 4 : 1 , from about 3.5 : 1 to about 4.5 : 1 , from about 4 : 1 NTP - 3 , and NTP - 4 and NTP - 1 , NTP - 2 , NTP - 3 , and NTP - 4 to about 5 : 1 , from about 4.5 : 1 to about 5.5 : 1 , and from about are each present in a different amount from one another . 20 5 : 1 to about 6 : 1 . In one embodiment, the ratio of concen In some embodiments the upper limit of the excess of tration of GTP to the concentration of ATP , CTP , and UTP nucleotide or nucleotide analog in the reaction mixture is may be 3 :1 , 6 : 1, and 6 : 1 , respectively . governed by the solubility limit. In other embodiments the ratio of NTP to NDP and in In some embodiments the NTPs are salt NTPs . For some embodiments GTP to GDP is considered relative to the instance the NTPs may be ammonium NTPs, tris NTPs , 25 ratio or purine nucleotide to pyrimidine nucleotide (Pu :Py ) lithium NTPs, potassium NTPs, or sodium NTPs. in the reaction mixture . In some embodiments the GTP :GDP In one embodiment of the invention , the IVT method may to Pu : Py ratios are 2 : 1, 3 : 1, 4 :1 , 5 : 1 , 6 : 1, 7 :1 , 8 :1 , 9 : 1 , 10 :1 , involve the addition of a combination of NTP and NDP to 11: 1 , 12 : 1 , 13 : 1 , 14 : 1 , 15 : 1 , or greater in the reaction the reaction mixture . The NTP and NDP in combination may mixture . be added in excess to the reaction mixture. An excess of the 30 In some embodiments , the buffer contains phosphate . The combination of NTP and NDP is any amount greater than the effective concentration of the phosphate is at least 150 mM , amount of one or more of at least one of the other NTPs or at least 160 mm , at least 170 mM , at least 180 mm , at least all of the other NTPs in the reaction mixture . For instance , 190 mM , at least 200 mM , at least 210 mM , at least 220 mm , an excess of NTP and NDP may be the combined amount or at least 230 mM phosphate . In one embodiment, the that is greater amount than the amount of at least one of the 35 effective concentration of phosphate is 180 mM . In another other NTPs in the reaction mixture . embodiment, the effective concentration of phosphate is 195 Thus , in some embodiments the IVT reaction may include mM . an equimolar amount of nucleotide triphosphate relative to In another embodiment, the buffer contains magnesium . at least one of the other nucleotide triphosphates or less than The buffer may have a ratio of the the concentration of ATP an excess of nucleotide triphosphate when it is used in 40 plus CTP plus UTP plusGTP and optionally , GDP to molar combination with a corresponding nucleotide diphosphate , concentration ofMg2 + of at least 1.0 , at least 1.1 , at least 1.2 , as long as the total amount of that nucleotide is present in at least 1.25 , at least 1.3 , at least 1.4 , at least 1.5 , at least 1.6 , excess in the reaction . A corresponding nucleotide diphos at least 1.7 , at least 1.75 , at least 1.8 , and at least 1.85 or 3 . phate refers to a nucleotide diphosphate having the same In other embodiments the ratio is 1.0 , 1.1, 1.2 , 1.25 , 1.3 , 1.4 , base as the nucleotide triphosphate . For example , the 45 1.5 , 1.6 , 1.7 , 1.75 , 1.8 , 1.85, 2 , 2.1 , 2.2 , 2.3, 2.4 , 2.5 , 2.6 , 2.7 , nucleotide triphosphate may be GTP and the nucleotide 2.8 , 2.9 , or 3 or any range of these variables. In one diphosphate may be GDP. embodiment, the ratio is 1.5 . In another embodiment , the In some embodiments , the NTP and NDP in combination ratio is 1.88 . In one embodiment, the ratio is 3 . are equimolar . In another embodiment, the amount ofNTP In exemplary aspects of the invention , the IVT reaction is greater than the amount of NDP in the combination added 50 ( reaction mixture) includes an RNA polymerase , for to the reaction mixture . The amount of NDP may be greater example , T7 , SP6 , T3 , etc. In some embodiments , the than the amount of NTP in the combination added to the polymerase , e.g., 17 polymerase is included at a concentra reaction mixture . In some embodiments , the excess of the tion of greater than 5 U /ul , greater than 10 U / ul, greater than NTP and NDP combination mixture is 2 times or fold (x ), 20 U /ul , greater than 50 U /ul , or greater than 100 U /ul . In 3x, 4x , 5x , 6x, 7x , 8X , 9X , 10x , 11x , 12x , 137 , 14x, 15x , 55 some embodiments the polymerase , e.g. , T7 polymerase , 15x - 100x , 10x - 90x , 10x -80x , 10x -70x or even greater than concentration is a range of from about 1 to about 250 U /ul the amount of the other individual NTPs in the reaction of reaction mixture , e.g. , from about 1 to about 100 U /ul or mixture. In each embodiment the other individual NTPsmay from about 100 to about 250 U /ul . In some embodiments , the be present in the same ( equimolar ) or different amounts in T7 polymerase concentration is a range of from about 30 to the reaction mixture . The fold difference described herein 60 about 60 U /ul , about60 to about 80 U /ul , about 80 to about refers to a comparison with at least one, at least two or all 100 U / ul, about 100 to about 150 U / ul or from about 150 to three of the other NTPs in the reaction mixture . about 200 U /ul . In some embodiments , the polymerase , e.g., In other embodiments , the NTP is 2 times or fold ( X ), 3x , T7 polymerase is included at a concentration of 7 , 14 , 25 , 50 , 4x , 5x , 6x, 7x , 8X , 9X , 10x , 11x , 12x , 13x , 14x , 15x , 75 , or 140 . 15x - 100x , 10x - 90x , 10x - 80x , 10x -70x or even greater than 65 As used herein , a DNA template refers to a polynucleotide the amount of the NDP in the reaction mixture . In yet other template for RNA polymerase . The DNA template useful embodiments , the NDP is 2 times or fold ( x ) , 3x , 4x , 5x , 6x , according to themethods described herein includes in some US 10,653,712 B2 21 22 embodiments a gene of interest coding for, e.g., a polypep ecule resulting from RNA - templated transcription . The tide of interest . The DNA template in some embodiments reverse complement transcription product may be in some includes a RNA polymerase promoter , e.g. , a T7 promoter embodiments is an RNA -templated transcription product . located 5' to and operably linked to the gene of interest and Without being bound in theory it is believed that the reverse optionally a sequence coding for a poly A tail located 3' to 5 complement product is predominantly or all RNA -templated the gene of interest. transcription product. If the reverse complement product RNA polymerases known in the art may be used in the were composed of DNA - templated transcription product , methods of the present invention . RNA polymerases include the product would include, for example , nucleotide but are not limited to , a phage RNA polymerase , e.g. , a T7 sequences complementary to the T7 promoter region from RNA polymerase, a T3 RNA polymerase , an SP6 RNA 10 the DNA template. The reverse complement products char polymerase , and / or mutant polymerases such as, but not acterized to date are predominantly free of sequences limited to , polymerases able to incorporate modified nucleic complementary to , for example , the 17 promoter region . In acids . As a non - limiting example , the RNA polymerase may some embodiments the reverse complement transcription be modified to exhibit an increased ability to incorporate a product is a double - stranded RNA (dsRNA ) , which may 2 ' -modified nucleotide triphosphate compared to an unmodi- 15 include one strand encoding a sequence which is a reverse fied RNA polymerase . complement of at least a portion of the IVT RNA . In other As used herein , “ gene of interest ” refers to a polynucle embodiments the reverse transcription complement product otide which encodes a polypeptide or protein of interest . may be a dsRNA with one strand comprising a polyU Depending on the context , the gene of interest refers to a sequence . Either the reverse complement strand encoding deoxyribonucleic acid , e.g. , a gene of interest in a DNA 20 the polypeptide of interest or the strand encoding the polyU template which can be transcribed to an RNA transcript, or sequence may initiate with a 5 ' triphosphate ( 5'ppp ) . The a ribonucleic acid , e.g., a gene of interest in an RNA RNA -template transcription product may include a reverse transcript which can be translated to produce the encoded complement of the 5 '- end of the IVT RNA and /or a reverse polypeptide of interest in vitro , in vivo , in situ or ex vivo. A complementof the 3 '- end of the IVT RNA . Furthermore, the polypeptide of interest includes but is not limited to , bio- 25 reverse complement of the 5 '- end of the IVT RNA may be logics , antibodies , vaccines , therapeutic proteins or peptides , complementary to all or a portion of a 5'UTR of the IVT etc. RNA . The reverse complement may comprise a sequence An “ RNA transcript ” refers to a ribonucleic acid produced complementary to the first 10-15 , the first 5-15 , the first by an IVT reaction using a DNA template and an RNA 5-20 , the first 10-20 , the first 15-25 nucleotides of the polymerase . In some embodiments the RNA transcript is an 30 S'UTR . Likewise, the reverse complement of the 3' - end of mRNA and typically includes the coding sequence for a the IVT RNA may be complementary to all or a portion of gene of interest and a poly A tail. RNA transcript includes an a polyA tail of the IVT RNA . The reverse complement mRNA . The RNA transcript can include modifications, e.g., transcription product can be templated from anywhere on modified nucleotides . As used herein , the term RNA tran the RNA and thus can be any size or complementary to any script includes and is interchangeable with mRNA ,modified 35 location on the template . For instance , the reverse comple mRNA “ mmRNA ” or modified mRNA , and primary con ment product may be a 5 -mer 10 -mer 15 -mer 20 -mer 25 -mer struct . 40 -mer 50 -mer 60 -mer 70 -mer , 100 - mer, 200 -mer , etc. all Purity the way up to the full length of the intended or desired RNA produced according to the methods of the invention product. is surprisingly pure and of high integrity . It has fewer 40 The present invention features compositions comprising contaminants than RNA preparations produced according to an IVT RNA and a pharmaceutically acceptable excipient traditional IVT methods. In some embodiments it has fewer substantially free of reverse complement transcription prod immune stimulating contaminants than RNA preparations uct . In some embodiments , in the IVT RNA that is substan produced according to traditional IVT methods. The con tially free of reverse complement transcription product taminants are RNA fragments produced by the reaction other 45 includes reverse complement transcription product that than the desired RNA . In some embodiments the RNA makes up less than about 10 % , 9 % , 8 % , 7 % , 6 % , 5 % , 4.5 % , fragment contaminants are reverse complement transcrip 4 % , 3.5 % , 3 % , 2.5 % , 2 % , 1.5 % , 1 % , 0.9 % , 0.8 % , 0.7 % , tion products and / or cytokine inducing RNA contaminants . 0.6 % , or 0.55 % , 0.5 % , 0.45 % , 0.4 % , 0.35 % , 0.3 % , 0.0.25 % , In other embodiments the RNA fragment contaminants are 0.2 % , 0.15 % , 0.1 % , 0.05 % , 0.01 % , 0.005 % , or 0.001 % of double stranded RNA or immunogenic contaminants . 50 the mass of the total RNA . The mass of the RNA compo The RNA preparations of the invention in some embodi sition may be determined by any means known in the art . ments have less contaminants than RNA preparations pro Examples ofmethods for determining the mass of the RNA duced according to traditional IVT methods. In some include liquid chromatography and mass spectrometry . embodiments the RNA preparations of the invention have at Although not bound in theory , it is believed that in some least 10 % , 20 % , 25 % , 30 % , 35 % , 40 % , 45 % , 50 % , 55 % , 55 embodiments of the invention the contaminants are single 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % 92 % , 93 % , stranded reverse complements bound to a population of the 94 % , 95 % 96 % , 97 % , 98 % , or 99 % less contaminants than IVT RNAs forming a double stranded structure in the RNA preparations produced according to traditional IVT context of longer RNAs. T7 may template off of an abortive methods. In other embodiments the RNA preparations of the ( sense strand ) nascent RNA as well as full length product invention are substantially free of contaminants . In other 60 nascent RNA . The RNA - templated transcript ( antisense) , embodiments the RNA preparations of the invention are once transcribed initiating predominantly with pppC , pppU , 100 % free of contaminants . and pppA ) , presumably remains associated with the nascent Thus, the invention in some aspects involves the prepa sense RNA . Alternatively if such constructs do form they ration of an IVT RNA that is substantially free of reverse may be intrinsically silent . The association of the 2 strands complement transcription product without the need for fur- 65 effectively is dsRNA with 5'ppp . The presence of 5'ppp on ther purification steps. As used herein , the term “ reverse one or more of the hybridized strands, renders the structure complement transcription product” refers to an RNA mol immunostimulatory . Even when the antisense RNA tem US 10,653,712 B2 23 24 plated transcript is dissociated from the RNA , the presence the first 5-20 , the first 10-20 , the first 15-25 nucleotides of of ssRNA with pppC , pppU , and pppA is still cytokine the 3'UTR . In some embodiments the reverse complement inducing. Since the methods of the invention produce RNA may comprise a sequence complementary to a range of 1-20 , devoid of dsRNA as seen in J2 ELISA and RNase III 1-30 , 1-40 , 1-50 , 1-60 , 1-70 , 1-80 , 1-90 , 1-100 , 1-200 , treatment, the products would not assume a structure of large 5 1-300 , 1-400 , 1-500 , 1-600 , 1-700 , 1-800 , 1-900 , 1-1000 , full length RNA . It is likely that the RNA is folding similarly 1-2000 , 1-2500 , 1-3000 , or 1 - full length or maximum size of if transcribed with equimolar or the inventive IVT process . the RNA nucleotides in length within the 3'UTR . In other In some embodiments the RNA preparations of the inven embodiments the reverse complement may comprise a tion are substantially free of cytokine -inducing RNA con sequence complementary to a range of 10-20 , 10-30 , 10-40 , taminant. As used herein , the term “ cytokine- inducing con- 10 10-50 , 1-60 , 10-70 , 10-80 , 10-90 , 10-100 , 10-200 , 10-300 , taminant” refers to an RNA molecule which induces 10-400 , 10-500 , 10-600 , 10-700 , 10-800 , 10-900 , 10-1000 , cytokine generation , for example , type I interferon ( IFNO/ B 10-2000 , 10-2500 , or 10-3000 nucleotides in length within induction ) , for example , as determined in a cell- based the 3'UTR . In other embodiments the reverse complement cytokine induction assay , for example, as determined in a BJ may comprise a sequence complementary to a range of fibroblast/ IFNbeta assay and / or Luminex assay as described 15 20-25, 20-30 , 20-40 , 20-50 , 20-60 , 20-70 , 20-80 , 20-90 , in the working examples of the instant specification . In 20-100 , 20-200 , 20-300 , 20-400 , 20-500 , 20-600 , 20-700 , exemplary aspects of the invention , the term " cytokine 20-800 , 20-900 , 20-1000 , 20-2000 , 20-2500 , or 20-3000 inducing ” contaminant refers to an RNA molecule which nucleotides in length within the 3'UTR . induces cytokine induction and which is substantially The present disclosure includes a composition comprising double - stranded in nature . 20 an IVT RNA and a pharmaceutically acceptable excipient Without being bound in theory , it is believed that double substantially free of cytokine- inducing RNA contaminant. In stranded RNA molecules which result from aberrant poly some embodiments , the cytokine - inducing RNA contami merase transcription , for example , transcription templated nant makes up less than 0.5 % , 0.45 % , 0.4 % , 0.35 % , 0.3 % , off the desired RNA produced in an IVT reaction , induce 0.25 % , 0.2 % , 0.15 % , 0.1 % , 0.05 % , 0.01 % , 0.005 % , or cytokines via activation of an innate immune response akin 25 0.001 % of the mass of the RNA . The mass of the RNA to the natural antiviral immune response and includes two composition may be determined by any means known in the types of pathogen recognition receptors (PRRs ): the Toll art. Examples include liquid chromatography and mass like receptors ( TLRs ) and the RIG - I - like receptors (RLRs ) , spectrometry . for example , toll- like receptor 3 ( TLR3) , as well as the RNA The dsRNA of the contaminant such as the cytokine helicases, for example , RIG - I and MDA5 . Examples of 30 inducing RNA contaminant and / or the reverse complement other cytokine- inducing molecules include RNaselII sub transcription product may be 20 to 50 nucleotides in length . strates. An RNase III substrate , as used herein , refers to a In other embodiments , the dsRNA may be 20-25 , 25-30 , double stranded RNA molecule which is susceptible to 30-3 35-40 , 40-4 45-50 55 , 55-60 , 60-65 , 5-70 , cleavage by an RNase III enzyme. 70-75 , 75-80 , 80-85 , 85-90 , 90-95 , 95-100 , 100-110 , 110 In some embodiments , the cytokine - inducing RNA con- 35 120 , 120-130 , 130-140 , 140-150 , 150-160 , 160-170 , 170 taminant may be a double- stranded RNA with a reverse 180 , 180-190 , 190-200 , 200-225 , 225-250 , 250-275 , 275 sequence complementary to the IVT RNA or a polyU 300 , 300-325 , 325-350 , 350-375 , 375-400 , 400-425 , 425 sequence. The reverse complement of the IVT RNA or the 450 , 450-475 , 475-500 , 500-550 , 550-600 , 600-650 , 650 polyU sequence may initiate with a 5'ppp . 700 , 700-750 , 750-800 , 800-850 , 850-900 , 900-950 , and The cytokine - inducing RNA contaminant may include a 40 950-1000 nucleotides in length . In some embodiments , the reverse complement of the 5 ' -end of the IVT RNA and /or a mass of the dsRNA is greater than 40 base pairs and makes reverse complement of the 3 '- end of the IVT RNA . Further up less than about 0.5 % of the RNA composition . more, the reverse complement of the 5 '- end of the IVT RNA The contaminant strands may have 5'ppp ends. In some may be complementary to all or a portion of a 5'UTR of the embodiments , the contaminant strands may have a lower IVT RNA . The reverse complement may comprise a 45 abundance of pppA , pppC , and pppU , as compared to sequence complementary to the first 10-15 , the first 5-15, the equimolar process - produced RNA . In another embodiment , first 5-20 , the first 10-20 , the first 15-25 nucleotides of the the contaminant strands may have lower ratios of pppA : 5'UTR . In some embodiments the reverse complement may pppG , pppC :ppp , and /or pppU :pppG as compared to comprise a sequence complementary to a range of 1-20 , equimolar processes . pppNTPs may be detected by LC -MS 1-30 , 1-40 , 1-50 , 1-60 , 1-70 , 1-80 , 1-90 , 1-100 , 1-200 , 50 following total nuclease digestion e.g. Nuclease P1 treat 1-300 , 1-400 , 1-500 , 1-600 , 1-700 , 1-800 , 1-900 , 1-1000 , ment. Nuclease P1 digests RNA and DNA into single 1-2000 , 1-2500 , or 1-3000 nucleotides in length within the nucleotides . The only triphosphate species that should be 5'UTR . In other embodiments the reverse complement may present are for the initiating nucleotides . If no RNA tem comprise a sequence complementary to a range of 10-20 , plated transcription products are formed , 5'PPPG is the only 10-30 , 10-40 , 10-50 , 1-60 , 10-70 , 10-80 , 10-90 , 10-100 , 55 triphosphate that should be present as this is the only 10-200 , 10-300 , 10-400 , 10-500 , 10-600 , 10-700 , 10-800 , targeted site of initiation . Presence and abundance of 10-900 , 10-1000 , 10-2000 , 10-2500 , or 10-3000 nucleotides 5'pppA , 5'pppc , and /or 5'pppU as detected by LC /MS in length within the 5'UTR . In other embodiments the following Nuclease P1 digestion are indicative of RNA reverse complement may comprise a sequence complemen templated RNA transcripts . tary to a range of 20-25 , 20-30 , 20-40 , 20-50 , 20-60 , 20-70 , 60 In addition to having less impurities, particularly double 20-80 , 20-90 , 20-100 , 20-200 , 20-300 , 20-400 , 20-500 , stranded impurities, the IVT RNA compositions have a high 20-600 , 20-700 , 20-800 , 20-900 , 20-1000 , 20-2000 , proportion of full length functional RNA transcript relative 20-2500 , or 20-3000 nucleotides in length within the 5'UTR . to other RNA species in the composition , particularly when Likewise , the reverse complement of the 3 ' - end of the IVT compared to traditional purified RNA compositions pro RNA may be complementary to all or a portion of a polyA 65 duced using IVT methods combined with purification steps tail of the IVT RNA . The reverse complement may comprise such as reverse phase chromatography or RNAse III treat a sequence complementary to the first 10-15 , the first 5-15 , ment. In some embodiments greater than about 80 % , 85 % , US 10,653,712 B2 25 26 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , The single stranded RNA population within the IVT RNA 99.5 % or 99.8 % of the mass of the RNA comprises single compositions described herein typically is free or substan stranded full length transcripts . In addition to the single tially free of RNAse III insensitive fragments . An “ RNAse stranded full length transcripts , the IVT RNA composition III insensitive fragment” as used herein refers to single may include other single stranded RNA species such as 5 stranded transcripts having identity to the IVT RNA ( sense single stranded partial RNA transcripts in a sense orienta orientation ), but being of insufficient length and lacking all tion , including abortive transcripts . The IVT RNA compo required elements to encode the polypeptide of interest sition , however, is substantially free of RNAse III insensi (having less nucleotides than full length transcripts ) and tive fragments . wherein the fragment is produced by enzymatic , in particular The RNA compositions described herein may include 10 RNAse III , cleavage . The production of RNAse III insen other components besides the full length RNA transcript, sitive fragments can result, for example , in a traditional IVT e.g. , truncated transcripts and /or run -on transcripts . For process (as depicted in FIG . 40 ) coupled with an RNAse III instance , the RNA may include transcripts of different digestion . lengths , e.g. , shorter or longer than the full - length transcript. As shown in FIG . 40 a first step in a traditional IVT/ Thus , in some embodiments the RNA preparation of the 15 RNAse III purification process involves a transcription invention includes truncated and /or abortive transcripts . reaction utilizing linear dsDNA template , equimolar con RNA polymerase binds to a DNA promoter and synthesizes centrations of NTPs and RNA polymerase in the presence of the short mRNA transcripts . As used herein , the term “ trun Mg2+ . The reaction produces a mixed population of single cated transcripts ” refers to transcripts having identity to the stranded truncated /abortive transcripts , full length RNA IVT RNA, but being of insufficient length and lacking all 20 transcript, run -on transcripts and reverse complement impu required elements to encode the polypeptide of interest (eg rities . The reverse complement impurities can bind to some poly A ) . In certain instances , truncated transcripts are of the single stranded RNA or to other impurities , e.g. , released prior to the transcription complex leaving the truncated transcripts , producing double stranded RNA and / promoter , termed abortive transcripts . As used herein , the or RNA having both double and single stranded regions . It term “ abortive transcripts ” refers to transcripts having iden- 25 has been postulated in the art that RNAse III can be used to tity to the IVT RNA , but being of insufficient length and degrade the double stranded RNA from IVT compositions , lacking all required elements to encode the polypeptide of thus effectively removing it from the composition . However, interest ( eg poly A ), generally having a length of 15 nucleo RNAse III can also degrade double stranded regions of full tides or less. In exemplary aspects of the invention , the length RNA transcript and /or run -on transcripts ( e.g. , double truncated and /or abortive transcripts are present and are not 30 stranded regions resulting from reverse complements bind cytokine - inducing . In an embodiment, the truncated and /or ing within polyA tail regions ), leaving single stranded frag abortive transcripts are removed from the sample . In some ments having a length of less than the full length RNA embodiments truncated transcripts have a length of 100 transcripts . These single stranded fragments are the RNAse nucleotides or less . III insensitive fragments described herein . As a result of this The methods of the instant invention also have been 35 RNAse degradation significant amounts of full length tran determined to produce compositions having reduced 3 ' het scripts generated during the IVT process are lost , causing erogeneity or 3 ' end heterogeneity , also referred to herein as significant loss of product integrity . These compositions increased 3 ' homogeneity , or 3 ' end homogeneity . It was have significantly lower ability to express protein when determined by the present inventors that traditional equimo delivered to a cell or subject. lar IVT reaction conditions can produce transcripts termi- 40 RNAse III insensitive fragments generated following nating at different 3 ' residues ( e.g., transcription not uni RNAse III treatment of products generated according to formly terminating ). An assay featured in the Working methods such as those depicted in FIG . 40 may include a Examples was developed to detect the 3 ' end heterogeneity range of sizes. For instance , in some embodiments , at least resulting from traditional IVT reactions ( the assay differen 80 % of the population of abortive transcripts have a length tiating between non - A nucleobases occurring at the 3 ' end of 45 of greater than 100 nucleotides . In other embodiments at a particular test transcript) . Notably , the methods of the least 50 % , 60 % , 70 % , 85 % , 90 % , 95 % , 98 % or 100 % of the instant invention produce transcripts having a lower degree population of RNAse III insensitive fragments have a length of 3 ' end heterogeneity ( or more homogeneous 3 ' ends) . For of greater than 100 nucleotides . example , transcripts produced according to traditional IVT Without being bound in theory, it is believed that the reactions (e.g. , equimolar reactions) can produce composi- 50 removal of certain species or contaminants , for example , tions in which greater than 50 % of the transcripts (optionally dsRNA species or contaminants , is important in the prepa greater than 60 % , greater than 70 % , greater than 75 % , ration of IVT RNA compositions for therapeutic use . By greater that 80 % or more ) have different ends, whereas contrast, the presence of residual truncated and /or abortive transcripts produced according to the IVT reactions of the transcripts in IVT RNA compositions is not believed to be invention ( e.g., alpha reactions) can produce compositions 55 required ; such species are not believed to induce unwanted in which less than 50 % of the transcripts , i.e., greater than cytokines and /or an innate immune response to the IVT 50 % of the transcripts have the same ends, i.e. , terminate at RNA . In other embodiments the RNA preparation of the the same nucleobase ( e.g., relative to the DNA template ) invention is substantially free of truncated or abortive tran ( optionally less than 40 % , less that 30 % , less than 25 % , less scripts . than 20 % or less ) have different ends) . 60 Although truncated / abortive transcripts may be present in The truncated transcripts within the population of single the IVT RNA compositions or the invention , RNAse III stranded partial RNA transcripts may include a range of insensitive fragments are not present in the IVT RNA sizes. For instance , in some embodiments , at least 80 % of compositions because the composition is not treated with the population of truncated transcripts have a length of 100 RNAse III. While truncated transcripts and RNAse III nucleotides or less . In other embodiments at least 50 % , 60 % , 65 insensitive fragments both have a range of sizes or lengths , 70 % , 85 % , 90 % , 95 % , 98 % or 100 % of the population of the average length of truncated transcripts is less than the truncated transcripts have a length of 100 nucleotides or less . average length of RNAse III insensitive fragments . As such , US 10,653,712 B2 27 28 when the composition comprises a population of single are carried out al 37 ° C. for ~ 1-2 h . Washing , substrate stranded partial RNA transcripts in a sense orientation and incubation and reading of absorption are performed accord greater than 80 % of the population of single stranded partial ing to art recognized methods . RNA transcripts in a sense orientation has a nucleotide A similar assay using dot blots is described by Kariko et length of 100 nucleotides or less . In some embodiments 5 al. , Nuc. Acids Res . 2011; 39 (21 ) : e142 . The assay is per greater than 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , formed by blotting RNA (200 ng ) onto super -charged Nytran 98 % , 99 % or 100 % of the population of single stranded membranes, where it is dried and blocked with 5 % non - fat partial RNA transcripts in a sense orientation has a nucleo dried milk in TBS - T buffer (50 mM Tris -HCl , 150 mm tide length of 100 nucleotides or less . In other embodiments NaCl, 0.05 % Tween - 20 , pH 7.4 ) . The sample is then incu greater than 50 % , 55 % , 60 % , 65 % , 70 % , 75 % , 85 % , or 88 % 10 bated with a dsRNA - specific K1 or J2 monoclonal antibody of the population of single stranded partial RNA transcripts (IgG ) for one hour. The membranes may be washed with in a sense orientation has a nucleotide length of 100 nucleo TBS - T and incubated with an HRP - conjugated anti - goat tides or less . polyclonal antibody, for example . The membranes are In some embodiments the RNA preparation is a pharma washed again , and the signal is detected using TMB . The ceutical composition with a pharmaceutically acceptable 15 signal is developed with the addition of TMB. The assay is carrier . In other embodiments the RNA preparation is a useful for detecting dsRNA duplexes greater than 40 base reaction product ( e.g. , IVT reaction product ) which has not pairs in length . yet been subjected to further purification techniques. The Cytokine assays may also be used to detect RNA con RNA preparation may include a number of other compo taminants . Numerous cytokine assays are known in the art . nents in addition to the RNA. The reaction product, how- 20 The assays may test for the induction of any cytokine ever , is substantially free of reverse complement transcrip associated with impure IVT products . These cytokines tion product and /or cytokine inducing RNA contaminants . include for instance , interleukins (IL ) , interference ( IFN ) Assays alphas, beta , and gamma, and TNF. In one embodiment, an The amount of contaminant, including reverse comple IFN - ß cell- based assay may be used . Its results have been ment transcription product and / or cytokine- inducing RNA 25 shown to correlate with the presence of RNaselII substrate contaminant , may be determined by methods known in the as detected by LC -MS . Other cell- based cytokine assays , art . Many methods for determining the purity of a nucleic such as for example IL ormultiplex cytokine assays may be acid sample are known in the art. Exemplary methods used . include , but are not limited to , the following: high -perfor In exemplary BJF IFN -beta and hEPO expression assays mance liquid chromatography (such as reverse -phase chro- 30 BJ Fibroblasts cells ( ATCC ) are seeded in a cell culture matography , size -exclusion chromatography ) , gel electro plate . Approximately 24 hours after seeding, the cells are phoresis , and translational assays to assess the quality and transfected with mRNA using lipofectamine or other deliv purity of nucleic acid production . RNA preparation quality ery agent. After transfectio supernatants are collected and can also be determined using Bioanalyzer chip -based elec IFN -beta expression is measured using the human IFN -beta trophoresis system . In vitro efficacy can be analyzed by, e.g., 35 ELISA kit, High Sensitivity per manufacturer's instructions transfecting RNA transcript into a human cell line, e.g., (PBL Assay Science ). Briefly , human IFN - B is measured in HeLA , PBMC , BJ Fibroblasts , Hek 293 ). Protein expression cell supernatants by indirect enzyme linked immunosorbent of the polypeptide of interest can be quantified using meth assay (ELISA ) . Pre -coated plates are incubated with cell ods such as Enzyme- Linked Immunosorbant Assay supernatants then washed to remove non -specifically bound (ELISA ), western blot , or flow cytometry. 40 material . IFN -ß expression is analyzed by incubating the A variety of methods have been used to detect and /or wells with anti- IFN - ß antibody followed by a secondary quantitate dsRNA using dsRNA - specific antibodies . These antibody conjugated to horseradish peroxidase (HRP ) . include ELISA , for example , sandwich ELISA (Schinborn et Tetramethylbenzidine ( TMB ) is the HRP substrate used for al . (1991 ) Nucleic Acids Res 19 :2993-3000 ) , dot- blots ( for detection . Human Epo levels are measured using Epo quantitation , specificity testing ) (Kariko et al. ( 2011 ) 45 Human ELISA Kit ( Thermo Fisher ). Nucleic Acids Res 39 :e142 ) , and immunoprecipitation / im In exemplary Luminex assays , serum from mice are munoblotting . In exemplary aspects of the invention , con collected to assess the cytokine levels using Luminex taminants may be recognized using an ELISA . A K1/ J2 or screening assay technology (R & D Systems) . Briefly , ana K2/ J2 assay may be used to determine the abundance of lyte - specific antibodies are pre - coated onto color - coded dsRNA contaminants in a sample . An exemplary ELISA is 50 beads. Beads, standards, and samples are pipetted into wells a sandwich ELISA , as follows. •Blocking : Microtiter plates and the immobilized antibodies bind the analytes of interest . are pre -coated with protein , e.g. , 0.4 ug /well protein A at 4 ° After washing away any unbound substances , a biotinylated C. overnight. Free binding sites are saturated with bovine antibody cocktail specific to the analytes of interest is added serum albumin ( BSA ) ( e.g., 2 % ) in buffer (e.g. )PBS and the to each well . Following a wash to remove any unbound plates are then washed with buffer ( e.g., PBS) and stored at 55 biotinylated antibody, Streptavidin -Phycoerythrin conjugate 4 ° C. The dsRNA -specific J2 monoclonal antibody (IgG2a ) (Streptavidin - PE ) , which binds to the biotinylated detection is immobilized onto the protein A layer by incubation of antibodies , is added to each well . A final wash removes hybridoma supernatant ( e.g. 100 ul per well at 4 ° C. over unbound Streptavidin -PE and the beads are resuspended in night . The plates are washed multiple times with buffer , e.g. , buffer and read using a Luminex analyzer ( R & D Systems) . PBS plus Tween 20 ( e.g. , 0.5 % ( v / v ) Tween 20 ) and nucleic 60 A first laser is bead -specific and determines which analyte is acid samples are added in buffer ( e.g., TE buffer , 37° C., 2 being detected . A second laser determines the magnitude of h ) . After washing as above, bound nucleic acid ( i.e. , J2 the PE -derived signal, which is in direct proportion to the antigens ) are identified by successive incubation with the amount of analyte bound . diluted hybridoma supernatant (e.g. , 1 :2 ) of the dsRNA Surrogate Assays for Purity specific K2 IgM monoclonal antibody followed by an 65 In exemplary aspects of the invention , it may be desirable alkaline phosphatase conjugated secondary antibody (e.g. , to determine purity by use of a surrogate assay that is 1: 5000 diluted goat anti -mouse IgM ). Both incubation steps amenable to highly qualitative and /or quantitative detection US 10,653,712 B2 29 30 of products and / or impurities. Accordingly , the invention Mass spectrometry encompasses a broad range of tech contemplates determination of purity of an RNA composi niques for identifying and characterizing compounds in tion , e.g. , an IVT RNA , produced by a certain IVT method , mixtures . Different types of mass spectrometry - based by determining purity of a surrogate RNA ( e.g. , a model approaches may be used to analyze a sample to determine its RNA ) produced by identical conditions . In this manner , 5 composition . Mass spectrometry analysis involves convert purity can be determined indirectly via highly qualitative ing a sample being analyzed into multiple ions by an and /or quantitative detection methods in a surrogate system , ionization process . Each of the resulting ions , when placed this purity determination correlating to purity of an IVT in a force field ,moves in the field along a trajectory such that RNA produced in a production system . Furthermore , a its acceleration is inversely proportional to its mass- to reconstitution or surrogate type assay may be used to 10 charge ratio . A mass spectrum of a molecule is thus produced determine the amount and identity of contaminants in a that displays a plot of relative abundances of precursor ions given RNA preparation indirectly . Itmay be difficult in some versus their mass- to -charge ratios . When a subsequent stage instances to detect low levels of contaminants or contami ofmass spectrometry , such as tandem mass spectrometry , is nants having similar structural properties to the RNA tran used to further analyze the sample by subjecting precursor scripts .Reconstitution systems can be used to test biological 15 ions to higher energy , each precursor ion may undergo activity such as immune stimulatory activity e.g. cytokine disassociation into fragments referred to as product ions. activity associated with contaminants by adding back the Resulting fragments can be used to provide information putative contaminants which are missing from the RNA concerning the nature and the structure of their precursor preparations of the invention in comparison to biological molecule . activity by RNA compositions produced by the traditional 20 MALDI- TOF (matrix - assisted laser desorption ionization IVT methods. The reconstitution of the pure RNA prepara time of flight) mass spectrometry provides for the spectro tions of the invention with putative contaminants can dem metric determination of the mass of poorly ionizing or onstrate the lack of the contaminants in the pure RNA easily - fragmented analytes of low volatility by embedding preparations . them in a matrix of light- absorbing material and measuring Additionally , model RNAs ( surrogate mRNAs ) may be 25 the weight of the molecule as it is ionized and caused to fly used . Under the same IVT conditions used to produce the by volatilization . Combinations of electric and magnetic IVT RNA , a model RNA from a DNA template encoding the fields are applied on the sample to cause the ionized material model RNA is produced . A model RNA or surrogate mRNA , to move depending on the individualmass and charge of the as used herein , refers to a noncoding RNA transcript con molecule . U.S. Pat . No. 6,043,031 , issued to Koster et al. , sisting of only the 5 ' UTR , 3 ' UTR , and polyA tail. A short 30 describes an exemplary method for identifying single -base model RNA may also be used . A short model RNA is a mutations within DNA using MALDI- TOF and other meth shorter version ofmodel RNA (only consists of 5'UTR and ods of mass spectrometry . a shorter polyA tail (A20 )) . The amount of reverse comple HPLC (high performance liquid chromatography ) is used ment transcription product or cytokine- inducing species in for the analytical separation of bio -polymers , based on the composition is determined by LC -MS or other analytical 35 properties of the bio -polymers . HPLC can be used to sepa methods , as the amount ofmodel RNA indicates the amount rate nucleic acid sequences based on size charge , and base of reverse complement transcription product or cytokine composition . A nucleic acid sequence having one base pair inducing species in the composition . The amount and nature difference from another nucleic acid can be separated using of the contaminants detected in the assay correlates and HPLC . Thus, nucleic acid samples, which are identical predicts the amount and nature of the contaminants that 40 except for a single nucleotidemay be differentially separated would be obtained using the identical IVT reaction condi using HPLC , to identify the presence or absence of a tions to generate full -length mRNAs. particular nucleic acid fragments . Preferably the HPLC is The RNA preparation of the invention is a high quality HPLC -UV . preparation . In some embodiments the RNA preparation In some embodiments , the RNA may be purified without resulting directly from an IVT process may be used directly 45 using a dsRNase step . For example , RNaselII may not be as a research reagent or a diagnostic or therapeutic reagent used . The composition may be produced by a process that without further purification . In some embodiments the RNA does not use reversed -phase chromatography purification preparation may be subjected to one or more purification step . In one embodiment, the RNA composition may be steps. For instance , the RNA preparation may be purified produced without using high -performance lipid chromatog from truncated RNA , DNA template , and residual enzymes 50 raphy (HPLC ) purification . Thus, the composition is free of using oligo dT chromatography . An exemplary oligo dT residual organic reagents or contaminants associated with chromatography assay involves packing 20 mer polythymi traditional purification processes . dine Sepharose (3 ml) in a 5 mL SPE column on a solid In some instances , the methods of the invention are used phase extraction vacuum manifold . The RNA transcript is to determine the purity of an RNA sample . The term “ pure ” applied to column , followed by washing and elution . The 55 as used herein refers to material that has only the target oligo dT purified RNA transcript is diafiltered into water and nucleic acid active agents such that the presence of unrelated concentrated to 1.22 mg/ mL using 100 kDa MWCO Amicon nucleic acids is reduced or eliminated , i.e. , impurities or spin filters (EMD Millipore ) . The RNA is recovered and the contaminants , including RNA fragments. For example , a concentration may be determined using Bioanalyzer gel purified RNA sample includes one or more target or test electrophoresis . 60 nucleic acids but is preferably substantially free of other The analysis of the RNA preparation to determine purity nucleic acids detectable by methods described . As used and quality of the sample can be performed before or after herein , the term “ substantially free ” is used operationally , in capping . Alternatively , analysis can be performed before or the context of analytical testing of the material. Preferably, after poly A capture based affinity purification . In another purified material is substantially free of one or more impu embodiment , analysis can be performed before or after 65 rities or contaminants including the reverse complement optional additional purification steps , e.g., anion exchange transcription products and /or cytokine- inducing RNA con chromatography and the like . taminant described herein and for instance is at least 90 % , US 10,653,712 B2 31 32 91 % , 92 % , 93 % , 94 % , 95 % , 96 % , or 97 % pure; more A “ polyA tail ” is a region of mRNA that is downstream , preferably , at least 98 % pure , and more preferably still at e.g., directly downstream (i.e. , 3 ') , from the 3 ' UTR that least 99 % pure . In some embodiments a pure RNA sample contains multiple , consecutive adenosine monophosphates . is comprised of 100 % of the target or test RNAs and includes A polyA tail may contain 10 to 300 adenosine monophos no other RNA . 5 phates. For example , a polyA tail may contain 10 , 20 , 30 , 40 , In some embodiments , capillary electrophoresis (CE ) is 50 , 60 , 70 , 80 , 90 , 100 , 110 , 120 , 130 , 140 , 150 , 160, 170 , used to separate the RNA . An electric field is applied to the 180 , 190 , 200 , 210 , 220 , 230 , 240 , 250 , 260 , 270 , 280 , 290 , sample so that it runs through an electrolyte solution , such 300 , 350 , 400 , 450 , 500 , 550 , or 600 adenosine monophos as an aqueous buffer solution , to a destination vial via a phates. In some embodiments , a polyA tail contains 50 to capillary . The analytes migrate differently based on electro- 10 250setting adenosine ( e.g. , in cellsmonophosphates , in vivo , etc. .) theIn apoly relevant ( A ) tail biological functions phoretic mobility and are detected at the outlet end of the to protect mRNA from enzymatic degradation , e.g. , in the capillary. The output data is recorded and then displayed as cytoplasm , and aids in transcription termination , export of an electropherogram . It can be used in conjunction with the mRNA from the nucleus, and translation . mass spectrometry to determine the identity of sample 15 Thus, the polynucleotide may in some embodiments components . The capillary electrophoresis system is fully comprise (a ) a first region of linked nucleotides encoding a automated in the FRAGMENT ANALYZERTM , which can polypeptide of interest ; ( b ) a first terminal region located 5 ' detect differences as small as three base pairs . relative to said first region comprising a 5' untranslated In some embodiments , a fragment analyzer (FA ) may be region (UTR ); (c ) a second terminal region located 3' used to quantify and purify the RNA. The fragment analyzer 20 relative to said first region ; and ( d ) a tailing region. The automates capillary electrophoresis and HPLC . terms poly nucleotide and nucleic acid are used interchange In some embodiments , the RNA molecules are mRNA ably herein . molecules . As used herein , the term “ messenger RNA ” In some embodiments , the polynucleotide includes from (mRNA ) refers to any polynucleotide which encodes at least about 1 to about 3,000 , 10 to about 3,000 , 20 to about 3,000 , one peptide or polypeptide of interest and which is capable 25 30 to about 3,000 , 40 to about 3,000 , 50 to about 3,000 , 100 of being translated to produce the encoded peptide polypep to about 3,000 , 200 to about 3,000 nucleotides ( e.g., from tide of interest in vitro , in vivo , in situ or ex vivo . An mRNA 200 to 500 , from 200 to 1,000 , from 200 to 1,500 , from 200 has been transcribed from a DNA sequence by an RNA to 3,000 , from 500 to 1,000 , from 500 to 1,500 , from 500 to polymerase enzyme , and interacts with a ribosome synthe 2,000 , from 500 to 3,000 , from 1,000 to 1,500 , from 1,000 size genetic information encoded by DNA . Generally , 30 to 2,000 , from 1,000 to 3,000 , from 1,500 to 3,000 , and from mRNA is classified into two sub - classes : pre- mRNA and 2,000 to 3,000 ) . mature mRNA . Precursor mRNA ( pre- mRNA ) is mRNA IVT RNA may function as RNA but are distinguished that has been transcribed by RNA polymerase but has not from wild - type RNA in their functional and / or structural undergone any post - transcriptional processing ( e.g., 5'cap design features which serve to overcome existing problems ping , splicing , editing , and polyadenylation ). Mature mRNA 35 of effective polypeptide production using nucleic -acid based has been modified via post - transcriptional processing ( e.g. , therapeutics . For example , IVT RNA may be structurally spliced to remove introns and polyadenylated ) and is modified or chemically modified . As used herein , a “ struc capable of interacting with ribosomes to perform protein tural” modification is one in which two or more linked synthesis . mRNA can be isolated from tissues or cells by a nucleotides are inserted , deleted , duplicated , inverted or variety ofmethods . For example , a totalRNA extraction can 40 randomized in a polynucleotide without significant chemical be performed on cells or a cell lysate and the resulting modification to the nucleotides themselves . Because chemi extracted total RNA can be purified ( e.g., on a column cal bonds will necessarily be broken and reformed to effect comprising oligo - dT beads) to obtain extracted mRNA . a structural modification , structural modifications are of a Alternatively , mRNA can be synthesized in a cell- free chemical nature and hence are chemical modifications. environment, for example by in vitro transcription ( IVT) . An 45 However, structural modifications will result in a different " in vitro transcription template ” as used herein , refers to sequence of nucleotides. For example , the polynucleotide deoxyribonucleic acid (DNA ) suitable for use in an IVT “ ATCG ” may be chemically modified to “ AT -5meC - G ” . The reaction for the production of messenger RNA (mRNA ) . In same polynucleotide may be structurally modified from some embodiments , an IVT template encodes a 5 ' untrans “ ATCG ” to “ ATCCCG ” . Here , the dinucleotide “ CC ” has lated region , contains an open reading frame, and encodes a 50 been inserted , resulting in a structural modification to the 3 ' untranslated region and a polyA tail. The particular polynucleotide . nucleotide sequence composition and length of an IVT cDNA encoding the polynucleotides described herein template will depend on the mRNA of interest encoded by may be transcribed using an in vitro transcription ( IVT) the template . system . The system typically comprises a transcription buf A “ 5' untranslated region (UTR )” refers to a region of an 55 fer, nucleotide triphosphates (NTPs ) , an RNase inhibitor and mRNA that is directly upstream ( i.e., 5 ' ) from the start codon a polymerase . The NTPs may be manufactured in house , ( i.e., the first codon of an mRNA transcript translated by a may be selected from a supplier , or may be synthesized as ribosome) that does not encode a protein or peptide. described herein . The NTPs may be selected from , but are A “ Z ' untranslated region (UTR ) ” refers to a region of an not limited to , those described herein including natural and mRNA that is directly downstream ( i.e., 3' ) from the stop 60 unnatural (modified ) NTPs. The polymerase may be selected codon ( i.e., the codon of an mRNA transcript that signals a from , but is not limited to , 17 RNA polymerase , T3 RNA termination of translation ) that does not encode a protein or polymerase and mutant polymerases such as , but not limited peptide to , polymerases able to incorporate polynucleotides ( e.g. , An “ open reading frame” is a continuous stretch of DNA modified nucleic acids ). beginning with a start codon ( e.g., methionine ( ATG ) ) , and 65 Chemically -Modified RNAS ending with a stop codon (e.g. , TAA , TAG or TGA ) and Thus, in an exemplary aspect , polynucleotides of the encodes a protein or peptide . invention may include at least one chemical modification . US 10,653,712 B2 33 34 The polynucleotides can include various substitutions and /or fied nucleobases ( e.g., a combination of 2 , 3 or 4 of the insertions from native or naturally occurring polynucle aforementioned modified nucleobases .) otides. As used herein in a polynucleotide , the terms " chemi Modifications of the nucleic acids which are useful in the cal modification ” or, as appropriate , “ chemically modified ” present invention include, but are not limited to those in the refer to modification with respect to adenosine ( A ) , guanos- 5 Table below . ine ( G ) , uridine ( U ) , thymidine ( T ) or cytidine ( C ) ribo- or deoxyribnucleosides in one or more of their position , pat Natu tern , percent or population . Generally, herein , these terms rally are not intended to refer to the ribonucleotide modifications Oc in naturally occurring 5 '- terminal RNA cap moieties . 10 Name Symbol Base curring The modifications may be various distinct modifications. 2 -methylthio - N6-( cis ms2i6A YES In some embodiments , the regions may contain one , two , or hydroxyisopentenyl )adenosine more ( optionally different ) nucleoside or nucleotide modi 2 -methylthio - N6 -methyladenosine ms2m6A YES fications. In some embodiments , a modified polynucleotide , 2 -methylthio -N6 - threonyl ms2t6A YES introduced to a cell may exhibit reduced degradation in the 15 N6carbamoyladenosine - glycinylcarbamoyladenosine g6A A YES cell, as compared to an unmodified polynucleotide. N6 - isopentenyladenosine i6A A YES Modifications of the polynucleotides include , but are not N6 -methyladenosine m6A A YES limited to those listed in detail below . The polynucleotide N6 -threonylcarbamoyladenosine t6A YES may comprise modifications which are naturally occurring , 1,2-0 - dimethyladenosine mlAm YES 1 -methyladenosine m1A YES non - naturally occurring or the polynucleotide can comprise 20 2' - O -methyladenosine Am A YES both naturally and non -naturally occurring modifications. 2 ' - O - ribosyladenosine ( phosphate ) Ar( p ) YES The polynucleotides of the invention can include any 2 -methyladenosine m2A A YES useful modification , such as to the sugar , the nucleobase , or 2 -methylthio - N6 isopentenyladenosine ms2i6A A YES 2 -methylthio - N6 -hydroxynorvalyl ms2hn6A A YES the internucleotide linkage ( e.g. to a linking phosphate / to a carbamoyladenosine phosphodiester linkage/ to the phosphodiester backbone) . 25 2 ' - O -methyladenosine meth m6A YES One or more atoms of a pyrimidine nucleobase may be 2 '- O - ribosyladenosine (phosphate ) Aríp ) YES replaced or substituted with optionally substituted amino , Isopentenyladenosine Iga YES N6-( cis -hydroxyisopentenyl ) adenosine io6A A YES optionally substituted thiol, optionally substituted alkyl N6,2' -O -dimethyladenosine m6Am YES ( e.g. , methyl or ethyl) , or halo ( e.g., chloro or fluoro ) . In N6,2-0 -dimethyladenosine m6Am YES certain embodiments , modifications ( e.g., one or more modi- 30 N6, N6,2 ' - O -trimethyladenosine m62 Am A YES fications) are present in each of the sugar and the internucle N6 ,N6 - dimethyladenosine m62A A YES N6 -acetyladenosine ???A A YES otide linkage. Modifications according to the present inven N6 hn6A A YES tion may be modifications of ribonucleic acids (RNAs ) to hydroxynorvalylcarbamoyladenosine deoxyribonucleic acids (DNAs ) , threose nucleic acids N6 -methyl - N6 mát6A YES ( TNAs) , glycol nucleic acids (GNAs ) , peptide nucleic acids 35 threonylcarbamoyladenosine 2 -methyladenosine m2A YES (PNAs ) , locked nucleic acids (LNAs ) or hybrids thereof) . 2 -methylthio - N6 - isopentenyladenosine ms2i6A A YES Additional modifications are described herein . 7 - deaza -adenosine A NO Non -natural modified nucleotides may be introduced to N1- methyl - adenosine A NO polynucleotides during synthesis or post - synthesis of the N6 , N6 (dimethyl ) adenine A NO N6 - cis -hydroxy - isopentenyl- adenosine A NO chains to achieve desired functions or properties. The modi- 40 a - thio - adenosine ? NO fications may be on internucleotide lineage, the purine or 2 (amino )adenine A NO pyrimidine bases, or sugar. The modification may be intro 2 (aminopropyl ) adenine A NO NO duced at the terminal of a chain or anywhere else in the 2(isopentenyl (methylthio ) adenine) N6 chain ; with chemical synthesis or with a polymerase 2- (alkyl ) adenine A NO enzyme. Any of the regions of the polynucleotides may be 45 2- (aminoalkyl ) adenine ? NO chemically modified . 2-( aminopropyl) adenine A NO The present disclosure provides for polynucleotides com 2- (halo )adenine A NO 2- (halo )adenine A NO prised of unmodified or modified nucleosides and nucleo 2-( propyl ) adenine ? NO tides and combinations thereof. As described herein 2 ' - Amino - 2 ' -deoxy - ATP NO “ nucleoside ” is defined as a compound containing a sugar 50 2' - Azido - 2' - deoxy -ATP A NO molecule ( e.g., a pentose or ribose ) or a derivative thereof in 2 '- Deoxy - 2 ' - a - aminoadenosine TP NO 2 -Deoxy - 2' - a -azidoadenosine TP A NO combination with an organic base ( e.g., a purine or pyrimi 6 (alkyl )adenine A NO dine ) or a derivative thereof ( also referred to herein as 6 (methyl ) adenine A NO “ nucleobase” ). As described herein , " nucleotide ” is defined 6- (alkyl ) adenine A NO as a nucleoside including a phosphate group . The modified 55 6-( methyl ) adenine A NO 7 ( deaza ) adenine A NO nucleotides may by synthesized by any useful method , as 8 (alkenyl )adenine A NO described herein ( e.g. , chemically , enzymatically , or recom 8 (alkynyl )adenine A NO binantly to include one or more modified or non - natural 8 ( amino adenine NO nucleotides ). The polynucleotides may comprise a region or 8 ( thioalkyl) adenine NO 8-( alkenyl) adenine NO regions of linked nucleotides. Such regions may have vari- 60 8-( alkyl ) adenine A NO able backbone linkages. The linkages may be standard 8-( alkynyl ) adenine A NO phosphodiester linkages , in which case the polynucleotides 8- ( amino jadenine A NO would comprise regions of nucleotides. Any combination of 8- (halo ) adenine A NO 8 - hydroxyl) adenine A NO base /sugar or linker may be incorporated into the polynucle 8- (thioalkyl ) adenine ? NO otides of the invention . 65 8-( thiol )adenine A NO In some embodiments , an RNA of the invention includes 8 - azido - adenosine ? NO a combination of one or more of the aforementioned modi US 10,653,712 B2 35 36 -continued -continued Natu Natu rally rally Oc 5 Oc Name Symbol Base curring Name Symbol Base curring aza adenine A NO N4 ,N4 - Dimethyl- 2 '- OMe- Cytidine TP YES deaza adenine NO 4 -methylcytidine NO N6 (methyl ) adenine A NO 5 - aza - cytidine NO N6-( isopentyl ) adenine A NO Pseudo -iso - cytidine NO 7 -deaza - 8 - aza -adenosine A NO 10 pyrrolo -cytidine NO 7 -methyladenine A NO a - thio -cytidine NO 1 - Deazaadenosine TP A NO 2-( thio ) cytosine NO 2'Fluoro -N6 - Bz -deoxyadenosine TP A NO 2 ' - Amino - 2 '- deoxy - CTP NO 2 ' - Me- 2 - Amino -ATP A NO 2 ' - Azido - 2 '- deoxy - CTP NO 2'O -methyl - N6 - Bz -deoxyadenosine NO 2' - Deoxy -2 ' - a - aminocytidine TP NO ?? 15 2' -Deoxy - 2' - a - azidocytidine TP NO 2 '- a - Ethynyladenosine TP A NO 3 ( deaza ) 5 ( aza ) cytosine NO 2 -aminoadenine A NO 3 (methyl ) cytosine NO 2 - Aminoadenosine TP A NO 3-( alkyl ) cytosine NO 2 - Amino - ATP A NO 3-( deaza ) 5 (aza ) cytosine NO 2 '- a- Trifluoromethyladenosine TP A NO 3- (methyl ) cytidine NO 2 - Azidoadenosine TP A NO 20 4,2 '- 0 - dimethylcytidine NO 2 '- b - Ethynyladenosine TP A NO 5 (halo )cytosine NO 2 - Bromoadenosine TP A NO 5 (methyl ) cytosine NO 2 '- b - Trifluoromethyladenosine TP A NO 5 (propynyl )cytosine NO 2 -Chloroadenosine TP NO 5 (trifluoromethyl ) cytosine NO 2 '- Deoxy - 2 ', 2 '- difluoroadenosine TP A NO 5-( alkyl) cytosine NO 2' - Deoxy - 2' - a - mercaptoadenosine TP ? NO 5-( alkynyl ) cytosine NO 2 '- Deoxy - 2 '- a - thiomethoxyadenosine A NO 25 5- (halo )cytosine NO ?? 5-( propynyl ) cytosine NO 2' - Deoxy - 2 -b - aminoadenosine TP A NO 5- (trifluoromethyl )cytosine NO 2 ' - Deoxy - 2 '- b - azidoadenosine TP A NO 5 -bromo - cytidine NO 2 - Deoxy - 2 ' - b -bromoadenosine TP A NO 5 - iodo -cytidine NO 2 '- Deoxy - 2' - b - chloroadenosine TP A NO 5 -propynyl cytosine NO 2 '- Deoxy - 2' -b - fluoroadenosine TP A NO 30 6-( azo )cytosine NO 2 '- Deoxy - 2 '- b - iodoadenosine TP A NO 6 -aza -cytidine NO 2 '- Deoxy - 2' - b -mercaptoadenosine TP NO aza cytosine NO 2 '- Deoxy - 2 ' -b - thiomethoxyadenosine A NO deaza cytosine NO ?? N4 (acetyl )cytosine NO 2 - Fluoroadenosine TP A NO 1 -methyl - 1 -deaza -pseudoisocytidine NO 2 - Iodoadenosine TP A NO 35 1- methyl - pseudoisocytidine NO 2 -Mercaptoadenosine TP A NO 2 -methoxy - 5 -methyl - cytidine NO 2 -methoxy - adenine A NO 2 -methoxy -cytidine NO 2 -methylthio -adenine NO 2 - thio - 5 -methyl - cytidine NO 2 - Trifluoromethyladenosine TP A NO 4 -methoxy - 1 -methyl NO 3 -Deaza - 3- bromoadenosine TP A NO pseudoisocytidine 000000 3 - Deaza - 3 - chloroadenosine TP A NO 40 4 -methoxy -pseudoisocytidine NO 3 -Deaza - 3 - fluoroadenosine TP A NO 4 - thio - 1 -methyl - 1 - deaza C NO 3 -Deaza - 3 - iodoadenosine TP NO pseudoisocytidine 3 - Deazaadenosine TP A NO 4- thio - 1 -methyl -pseudoisocytidine NO 4 '- Azidoadenosine TP A NO 4 - thio -pseudoisocytidine TO 4 '- Carbocyclic adenosine TP A NO 5 -aza -zebularine NO 4 '- Ethynyladenosine TP A NO 5 -methyl - zebularine NO 5 ' -Homo - adenosine TP NO 45 pyrrolo -pseudoisocytidine NO 8 -Aza - ATP ? NO Zebularine NO 8 -bromo - adenosine TP ? NO ( E ) -5-( 2 - Bromo- vinyl ) cytidine TP NO 8 - Trifluoromethyladenosine TP NO 2,2 ' -anhydro - cytidine TP NO 9 - Deazaadenosine TP A NO hydrochloride 2 -aminopurine AIG NO 2'Fluor- N4 - BZ- cytidine TP NO 7 -deaza - 2,6 - diaminopurine AG NO 50 2'Fluoro -N4 - Acetyl - cytidine TP NO 7 -deaza - 8 -aza -2,6 -diaminopurine A / G NO 2 '- O -Methyl - N4 - Acetyl- cytidine TP NO 7 - deaza - 8 - aza- 2 -aminopurine A / G NO 2'O -methyl -N4 - Bz -cytidine TP NO 2,6 -diaminopurine A / G NO 2 ' - a - Ethynylcytidine TP NO 7 -deaza - 8 -aza - adenine , 7 - deaza - 2 A / G NO 2 '- a - Trifluoromethylcytidine TP NO aminopurine 2 '- b - Ethynylcytidine TP NO 2 - thiocytidine s20 ? YES 55 2 '- b - Trifluoromethylcytidine TP NO 3 -methylcytidine m3C C YES 2 '- Deoxy - 2 ', 2 ' -difluorocytidine TP C NO 5 -formylcytidine f5C YES 2 '- Deoxy -2 ' - a -mercaptocytidine TP NO 5 -hydroxymethylcytidine hm5C YES 2 ' -Deoxy - 2 '- a - thiomethoxycytidine TP NO 5 -methylcytidine m5C YES 2 ' -Deoxy - 2 '- b - aminocytidine TP NO N4 - acetylcytidine ac4C YES 2' - Deoxy - 2 '- b -azidocytidine TP NO 2 ' - O -methylcytidine Cm YES 60 2 ' -Deoxy - 2' - b -bromocytidine TP NO 2 ' - O -methylcytidine Cm YES 2 ' -Deoxy - 2 '- b - chlorocytidine TP ? NO 5,2' -O - dimethylcytidine m5 Cm YES 2 '- Deoxy - 2' - b - fluorocytidine TP NO 5 - formyl- 2 '- O -methylcytidine f5Cm C YES 2 '- Deoxy - 2 '- b - iodocytidine TP NO Lysidine k2c YES 2 '- Deoxy - 2' - b -mercaptocytidine TP NO N4,2 '- O -dimethylcytidine m4Cm YES 2 '- Deoxy - 2 '- b -thiomethoxycytidine TP ? NO N4- acetyl - 2' - O -methylcytidine ac4Cm ? YES 65 2 - O -Methyl - 5- ( 1 -propynyl )cytidine ? NO N4 -methylcytidine m4C ? YES ?? US 10,653,712 B2 37 38 -continued -continued Natu Natu rally rally Oc 5 Oc Name Symbol Base curring Name Symbol Base curring 3 '- Ethynylcytidine TP ? NO 6 -methoxy - guanosine NO 4 '- Azidocytidine TP ? NO 6 - thio -7 -deaza - 8 - aza - guanosine NO 4 '- Carbocyclic cytidine TP C NO 6 - thio - 7 -deaza -guanosine NO 4 '- Ethynylcytidine TP NO 6 -thio - 7 -methyl - guanosine QQQQ NO 5-( 1 -Propynyl ) ara -cytidine TP ? NO 10 7 -deaza - 8 - aza - guanosine NO 5-( 2 - Chloro -phenyl ) -2 - thiocytidine TP C NO 7 -methyl - 8 -oxo - guanosine NO 5-( 4 - Amino -phenyl ) -2 - thiocytidine TP ? NO N2 ,N2 - dimethyl- 6 -thio -guanosine NO 5 - Aminoallyl- CTP ? NO N2 -methyl - 6 - thio - guanosine G NO 5 - Cyanocytidine TP NO 1 -Me -GTP NO 5 - Ethynylara -cytidine TP NO 2'Fluoro -N2 -isobutyl - guanosine TP NO 5 - Ethynylcytidine TP NO 15 2'O -methyl - N2 - isobutyl- guanosine TP NO 5 '- Homo- cytidine TP NO 2 '- a - Ethynylguanosine TP NO 5 -Methoxycytidine TP NO 2 ' - a - Trifluoromethylguanosine TP NO 5 - Trifluoromethyl- Cytidine TP NO 2 '- b - Ethynylguanosine TP NO N4 -Amino -cytidine TP NO 2 '- b - Trifluoromethylguanosine TP NO N4 -Benzoyl -cytidine TP ? NO 2 ' -Deoxy - 2' , 2 '- difluoroguanosine TP NO Pseudoisocytidine NO 20 2 '- Deoxy - 2 '- a -mercaptoguanosine TP NO 7 -methylguanosine m7G G YES 2 - Deoxy - 2' -a - thiomethoxyguanosine G NO N2,2-0 - dimethylguanosine m2Gm G YES TP N2 -methylguanosine m2G G YES 2 '- Deoxy - 2 '- b - aminoguanosine TP G NO Wyosine im G YES 2' - Deoxy - 2' - b -azidoguanosine TP G NO 1,2-0 - dimethylguanosine mlGm G YES 2 '- Deoxy - 2 '- b -bromoguanosine TP NO 1 -methylguanosine miG G YES 2 '- Deoxy - 2 '- b -chloroguanosine TP NO 2 '- O -methylguanosine Gm YES 25 2 '- Deoxy - 2 '- b - fluoroguanosine TP NO 2 '- O - ribosylguanosine (phosphate ) Gr (p ) G YES 2 '- Deoxy - 2' - b - iodoguanosine TP NO 2 '- O -methylguanosine Gm G YES 2 '- Deoxy - 2 '- b -mercaptoguanosine TP NO 2 ' - O - ribosylguanosine (phosphate ) Gr( p ) G YES 2 ' - Deoxy - 2 '- b -thiomethoxyguanosine G NO 7 -aminomethyl - 7 -deazaguanosine preQ1 G YES ?? 7 -cyano - 7 - deazaguanosine prego G YES 4 '- Azidoguanosine TP G NO Archaeosine G + G YES 30 4 '- Carbocyclic guanosine TP G NO Methylwyosine mim G YES 4 '- Ethynylguanosine TP G NO N2,7 - dimethylguanosine m2,76 G YES 5 '- Homo- guanosine TP NO N2, N2,2 ' - O - trimethylguanosine m22Gm G YES 8 -bromo - guanosine TP NO N2 ,N2,7 - trimethylguanosine m2,2,76 G YES 9 - Deazaguanosine TP NO N2 , N2- dimethylguanosine m22G YES N2- isobutyl- guanosine TP G NO N2,7,2' - O - trimethylguanosine m2,7Gm G YES 35 1 -methylinosine mll I YES 6 -thio - guanosine G NO Inosine I I YES 7 -deaza -guanosine G NO 1,2-0 - dimethylinosine mlIm I YES 8 -oxo - guanosine G NO 2 '- O -methylinosine Im I YES N1-methyl - guanosine G NO 7 -methylinosine I NO a - thio - guanosine G NO 2 '- O -methylinosine Im I YES 2 (propyl ) guanine G NO 40 Epoxyqueuosine OQ YES 2- (alkyl ) guanine G NO galactosyl- queuosine galQ YES 2 '- Amino - 2' -deoxy -GTP G NO Mannosylqueuosine manQ YES 2 '- Azido - 2 '- deoxy -GTP G NO Queuosine Q YES 2 '- Deoxy - 2 '- a -aminoguanosine NO allyamino - thymidine NO 2 -Deoxy - 2 '- a -azidoguanosine TP G NO aza thymidine T NO 6 (methyl ) guanine G NO 45 deaza thymidine T NO 6 - alkyl) guanine G NO deoxy -thymidine T NO G 6-( methyl ) guanine NO U YES G 2 '- O -methyluridine 6 -methyl - guanosine NO s2U YES 7 (alkyl ) guanine G NO 2 - thiouridine 7 (deaza )guanine G NO 3 -methyluridine m3U YES 7 (methyl ) guanine G NO 5 - carboxymethyluridine cm5U YES 7-( alkyl ) guanine G NO 50 5 -hydroxyuridine ho5U YES 7-( deaza ) guanine G NO 5 -methyluridine m5U U YES 7-( methyl ) guanine G NO 5 -taurinomethyl - 2- thiouridine Tm5s2U YES 8 ( alkyl ) guanine G NO 5 -taurinomethyluridine Tm5U YES 8 (alkynyl )guanine G NO Dihydrouridine d U YES 8 (halo )guanine G NO Pseudouridine YES 8 (thioalkyl )guanine G NO 55 ( 3-( 3 -amino - 3 - carboxypropyl) uridine acp3U YES 8-( alkenyl ) guanine G NO 1 -methyl - 3- ( 3 - amino - 5 mlacp34 CCC YES 8-( alkyl) guanine G NO carboxypropyl) pseudouridine 8-( alkynyl ) guanine G NO 1- methylpseduouridine mly U YES 8-( amino )guanine G NO 1 -methyl - pseudouridine U YES 8-( halo ) guanine G NO 2 ' - O -methyluridine Um YES 8-( hydroxyl ) guanine G NO 60 2 - O -methylpseudouridine Wm YES 8-( thioalkyl) guanine G NO 2 '- O -methyluridine Um U YES 8-( thiol ) guanine G NO 2 - thio - 2 '- O -methyluridine s2Um U YES aza guanine G NO 3- ( 3 -amino - 3 -carboxypropyl ) uridine acp3U YES deaza guanine NO 3,2-0 - dimethyluridine m3Um YES N (methyl ) guanine G NO 3 -Methyl - pseudo -Uridine TP YES N-( methyl )guanine G NO 65 4 - thiouridine S4U U YES 1 -methyl - 6 - thio - guanosine G NO 5-( carboxyhydroxymethyl )uridine chm5U U YES US 10,653,712 B2 39 40 -continued -continued Natu Natu rally rally Oc 5 Oc Name Symbol Base curring Name Symbol Base curring 5-( carboxyhydroxymethyl) uridine mchm50 U YES 1 -Methyl - 3- ( 3 - amino - 3 U NO methyl ester carboxypropyl) pseudouridine TP 5,2 '- O - dimethyluridine m5Um U YES 1 -Methyl - 3- ( 3 - amino - 3 ?. NO 5,6 -dihydro -uridine U YES carboxypropyl) pseudo -UTP 5 -aminomethyl - 2 -thiouridine nm5s2U U YES 10 1 -Methyl - pseudo -UTP U NO 5 -carbamoylmethyl - 2' - O ncm5Um U YES 2 ( thio )pseudouracil NO methyluridine 2 ' deoxy uridine NO 5 -carbamoylmethyluridine ncm5U U YES 2 ' fluorouridine NO 5 -carboxyhydroxymethyluridine U YES 2-( thio )uracil U NO 5 -carboxyhydroxymethyluridine U YES 2,4 - dithio )psuedouracil U NO methyl ester 15 2 ' methyl, 2'amino , 2'azido , 2'fluro NO 5 -carboxymethylaminomethyl - 2-0 cmnm5Um U YES guanosine methyluridine 2 ' - Amino - 2 '- deoxy -UTP NO 5 - carboxymethylaminomethyl- 2 cmnm5s2U ?. YES 2 ' - Azido - 2 '- deoxy -UTP NO thiouridine 2 '- Azido - deoxyuridine TP NO 5 - carboxymethylaminomethyl -2 U YES 2 - O -methylpseudouridine NO thiouridine 20 2 ' deoxy uridine 2 ' dU ECCCC NO 5 -carboxymethylaminomethyluridine cmnm5U U YES 2 ' fluorouridine NO 5 - carboxymethylaminomethyluridine U YES 2 '- Deoxy - 2' - a -aminouridine TP U NO 5 - Carbamoylmethyluridine TP U YES 2 '- Deoxy - 2' - a - azidouridine TP NO 5 -methoxycarbonylmethyl - 2-0 mcm5Um U YES 2 -methylpseudouridine m3y U NO methyluridine 3 (3 amino - 3 carboxypropyl )uracil NO 5 -methoxycarbonylmethyl - 2 mcm5s2U .? YES 4 (thio )pseudouracil NO thiouridine 25 4-( thio )pseudouracil NO 5 -methoxycarbonylmethyluridine mcm50 U YES 4- ( thio )uracil NO 5 -methoxyuridine mo5U U YES 4 - thiouracil NO 5 -methyl - 2 - thiouridine m5s2U U YES 5 ( 1,3 - diazole - 1 - alkyl )uracil NO 5 -methylaminomethyl - 2 - selenouridine mnm5se2U U YES 5 ( 2 - aminopropyl) uracil NO 5 -methylaminomethyl - 2 - thiouridine mnm5s2U U YES 5 (aminoalkyl ) uracil NO 5 -methylaminomethyluridine mnm5U U YES 30 5 (dimethylaminoalkyl ) uracil NO 5 -Methyldihydrouridine U YES 5 (guanidiniumalkyl )uracil NO 5 - Oxyacetic acid- Uridine TP U YES 5 (methoxycarbonylmethyl ) -2 CCCC NO 5 - Oxyacetic acid -methyl ester- Uridine U YES ( thio ) uracil ?? 5 (methoxycarbonyl - methyl ) uracil NO N1 -methyl - pseudo - uridine U YES 5 (methyl ) 2 ( thio )uracil NO uridine 5 - oxyacetic acid cmo5U U YES 35 5 (methyl ) 2,4 (dithio Juracil NO uridine 5 -oxyacetic acid methyl ester mcmo5U U YES 5 (methyl ) 4 (thio )uracil NO 3-( 3 - Amino - 3 - carboxypropyl) -Uridine U YES 5 (methylaminomethyl ) -2 ( thio )uracil NO ?? 5 (methylaminomethyl )-2,4 NO 5 - iso - Pentenylaminomethyl )-2 U YES ( dithio )uracil CCCCCC thiouridine TP 5 (methylaminomethyl )-4 ( thio Juracil NO 5-( iso - Pentenylaminomethyl )-2-0 U YES 40 5 (propynyl ) uracil NO methyluridine TP 5 ( trifiuoromethyl) uracil NO 5-( iso -Pentenylaminomethyl )uridine U YES 5- (2 - aminopropyl) uracil NO ?? 5-( alkyl ) -2-( thio )pseudouracil NO 5 -propynyl uracil NO 5-( alkyl )-2,4 (dithio )pseudouracil NO a -thio -uridine U NO 5-( alkyl) -4 ( thio )pseudouracil CCCCCC NO 1 ( aminoalkylamino U NO 5-( alkyl )pseudouracil NO carbonylethylenyl) -2 ( thio ) 45 5-( alkyl ) uracil NO pseudouracil 5-( alkynyl) uracil NO U NO 5-( allylamino )uracil NO ( aminoalkylaminocarbonylethylenyl) 5-( cyanoalkyl )uracil NO 2,4 - dithio )pseudouracil 5- (dialkylaminoalkyl )uracil NO 1 .? NO 5-( dimethylaminoalkyl) uracil NO (aminoalkylaminocarbonylethylenyl ) -4 50 5- ( guanidiniumalkyl) uracil NO ( thio )pseudouracil 5-( halo ) uracil NO 1 U NO 5-( 1,3 - diazole - 1 - alkyl )uracil NO (aminoalkylaminocarbonylethylenyl ) 5- (methoxyluracil NO pseudouracil 5-( methoxycarbonylmethyl ) -2 CCC NO 1 ( aminocarbonylethylenyl) -2 ( thio ) U NO ( thio ) uracil pseudouracil 55 5- (methoxycarbonyl -methyl ) uracil NO 1 (aminocarbonylethylenyl ) -2,4 U NO 5-( methyl ) 2 ( thio )uracil NO (dithio )pseudouracil 5-( methyl ) 2,4 ( dithio Juracil NO 1 ( aminocarbonylethylenyl) -4 U NO 5-( methyl ) 4 ( thio )uracil NO ( thio )pseudouracil 5-( methyl ) -2- ( thio )pseudouracil NO 1 (aminocarbonylethylenyl ) ?. NO 5-( methyl ) -2,4 ( dithio )pseudouracil NO pseudouracil 60 5- (methyl ) -4 (thio )pseudouracil NO 1 substituted 2 (thio ) -pseudouracil U NO 5-( methyl ) pseudouracil NO 1 substituted 2,4 - dithio )pseudouracil U NO 5-( methylaminomethyl ) -2 (thio ) uracil NO 1 substituted 4 ( thio )pseudouracil U NO 5-( methylaminomethyl ) -2,4 (dithio ) NO 1 substituted pseudouracil U NO uracil 1-( aminoalkylamino U NO 5-( methylaminomethyl ) -4-( thio )uracil CCCCCCCCCCU NO carbonylethylenyl ) -2-( thio ) 65 5-( propynyl )uracil U NO pseudouracil 5-( trifluoromethyl) uracil U NO US 10,653,712 B2 41 42 -continued -continued Natu Natu rally rally Oc 5 Oc Name Symbol Base curring Name Symbol Base curring 5 -aminoallyl - uridine U NO 1-( 4- Azidobenzyl ) pseudouridine TP NO 5 -bromo - uridine U NO 1-( 4 -Bromobenzyl ) pseudouridine TP NO 5 - iodo - uridine U NO 1- ( 4- Chlorobenzyl) pseudouridine TP NO 5 - uracil U NO 1-( 4 - Fluorobenzyl) pseudouridine TP NO 6 (azo )uracil U NO 10 1- (4 - Iodobenzyl) pseudouridine TP NO 6- ( azo )uracil U NO 1- ( 4 NO 6 -aza - uridine U NO Methanesulfonylbenzyl) pseudouridine CCCCCC allyamino -uracil U NO ?? aza uracil U NO 1-( 4 -Methoxybenzyl ) pseudouridine TP NO deaza uracil U NO 1-( 4 -Methoxy -benzyl ) pseudo -UTP NO N3 (methyl ) uracil U NO 15 1- (4 -Methoxy - phenyl) pseudo -UTP ECC NO Pseudo -UTP - 1-2 - ethanoic acid U NO 1- ( 4- Methylbenzyl ) pseudouridine TP NO Pseudouracil U NO 1- ( 4 -Methyl - benzyl ) pseudo -UTP NO 4 - Thio -pseudo -UTP U NO 1-( 4 - Nitrobenzyl ) pseudouridine TP NO 1 - carboxymethyl- pseudouridine U NO 1-( 4 - Nitro -benzyl ) pseudo -UTP NO 1 -methyl - 1- deaza -pseudouridine U NO 1 (4 -Nitro -phenyl ) pseudo -UTP NO 1 -propynyl - uridine U NO 20 1- ( 4 CCCC NO 1 - taurinomethyl- 1 -methyl -uridine U NO Thiomethoxybenzyl) pseudouridine TP 1 - taurinomethyl- 4 - thio -uridine U NO 1- (4 U NO 1 - taurinomethyl- pseudouridine U NO Trifluoromethoxybenzyl )pseudouridine 2 -methoxy - 4 -thio -pseudouridine U NO ?? 2 - thio - 1 -methyl - 1 -deaza -pseudouridine U NO 1- ( 4 - U NO 2 - thio - 1 -methyl - pseudouridine U NO Trifluoromethylbenzyl) pseudouridine 2 -thio - 5 -aza - uridine U NO 25 ?? 2 -thio -dihydropseudouridine U NO 1-( 5 - Amino -pentyl ) pseudo -UTP U NO 2 - thio -dihydrouridine U NO 1-( 6 - Amino -hexyl ) pseudo -UTP U NO 2 - thio -pseudouridine U NO 1,6 -Dimethyl -pseudo -UTP NO 4 -methoxy - 2 - thio -pseudouridine U NO 1-[ 3- ( 2- { 2-[ 2- ( 2 - Aminoethoxy ) U NO 4 -methoxy -pseudouridine U NO ethoxy ] -ethoxy } -ethoxy ) U NO || 4 - thio - 1- methyl - pseudouridine 30 propionyl ]pseudouridine TP 4 - thio -pseudouridine U NO 1- { 3- [2- (2 - Aminoethoxy) -ethoxy ] U NO 5 - aza -uridine U NO propionyl } pseudouridine TP Dihydropseudouridine U NO 1 - Acetylpseudouridine TP U NO ( + )1- ( 2 - Hydroxypropyl )pseudouridine U NO 1 - Alkyl- 6- ( 1 -propynyl ) -pseudo -UTP NO TP 1 -Alkyl - 6- (2 -propynyl ) -pseudo -UTP NO (2R )-1- ( 2 U NO 35 1 - Alkyl- 6 - allyl- pseudo -UTP NO Hydroxypropyl) pseudouridine TP 1 - Alkyl- 6 -ethynyl - pseudo -UTP NO (2S )-1- ( 2 U NO 1 - Alkyl- 6 -homoallyl -pseudo -UTP NO Hydroxypropyl) pseudouridine TP 1 - Alkyl- 6 -vinyl - pseudo -UTP NO ( E ) -5-( 2 - Bromo -vinyl ) ara -uridine TP U NO 1- Allylpseudouridine TP NO ( E ) -5-( 2 - Bromo- vinyl ) uridine TP U NO 1 - Aminomethyl- pseudo -UTP NO ( Z ) -5-( 2 - Bromo -vinyl ) ara -uridine TP U NO 40 1- Benzoylpseudouridine TP NO ( Z ) -5- ( 2 - Bromo- vinyl )uridine TP U NO 1 -Benzyloxymethylpseudouridine TP NO 1- (2,2,2 - Trifluoroethyl ) -pseudo -UTP U NO 1 -Benzyl - pseudo -UTP NO 1- ( 2,2,3,3,3 U NO 1- Biotinyl- PEG2 - pseudouridine TP NO Pentafluoropropyl) pseudouridine TP 1 -Biotinylpseudouridine NO 1-( 2,2 - Diethoxyethyl) pseudouridine U NO 1 -Butyl - pseudo -UTP NO ?? 1 - Cyanomethylpseudouridine TP NO 1- ( 2,4,6 U NO 45 1- Cyclobutylmethyl- pseudo -UTP NO Trimethylbenzyl) pseudouridine TP 1 - Cyclobutyl -pseudo - UTP NO 1- (2,4,6 - Trimethyl- benzyl ) pseudo U NO 1 -Cycloheptylmethyl - pseudo -UTP NO UTP 1 - Cycloheptyl- pseudo -UTP NO 1- (2,4,6 - Trimethyl -phenyl ) pseudo U NO 1 - Cyclohexylmethyl- pseudo -UTP NO UTP 1 - Cyclohexyl- pseudo - UTP NO 1-( 2 - Amino -2 -carboxyethyl ) pseudo ?. NO 50 1 - Cyclooctylmethyl- pseudo -UTP NO UTP 1- Cyclooctyl- pseudo -UTP NO 1- (2 -Amino - ethyl )pseudo - UTP U NO 1 - Cyclopentylmethyl- pseudo -UTP NO 1-( 2 -Hydroxyethyl ) pseudouridine TP U NO 1 - Cyclopentyl- pseudo -UTP NO 1-( 2 -Methoxyethyl ) pseudouridine TP U NO 1 - Cyclopropylmethyl- pseudo -UTP NO 1-( 3,4 - Bis U NO 1 - Cyclopropyl- pseudo -UTP CCC NO trifluoromethoxybenzyl) pseudouridine 55 1 - Ethyl- pseudo -UTP NO ?? 1- Hexyl - pseudo - UTP NO 1- ( 3,4 U NO 1 -Homoallylpseudouridine TP NO Dimethoxybenzyl) pseudouridine TP 1 -Hydroxymethylpseudouridine TP U NO 1-( 3 - Amino - 3 -carboxypropyl ) pseudo U NO 1 -iso -propyl -pseudo -UTP NO UTP 1 -Me - 2 - thio -pseudo -UTP NO 1-( 3 - Amino -propyl ) pseudo -UTP U NO 601-Me - 4 - thio -pseudo -UTP NO 1-( 3 - Cyclopropyl- prop - 2 U NO 1 -Me -alpha - thio -pseudo -UTP U NO ynyl) pseudouridine TP 1 U NO 1- (4 - Amino - 4 -carboxybutyl ) pseudo U NO Methanesulfonylmethylpseudouridine UTP TP 1-( 4 - Amino -benzyl ) pseudo -UTP U NO 1 -Methoxymethylpseudouridine TP U NO 1-( 4 - Amino -butyl ) pseudo -UTP U NO 65 1 -Methyl - 6- ( 2,2,2 U NO 1-( 4 - Amino -phenyl ) pseudo -UTP U NO Trifluoroethyl) pseudo -UTP US 10,653,712 B2 43 44 -continued -continued Natu Natu rally rally Oc 5 Oc Name Symbol Base curring Name Symbol Base curring 1 -Methyl - 6- ( 4 -morpholino ) -pseudo U NO 3 - Alkyl -pseudo -UTP U NO UTP 4 ' - Azidouridine TP NO 1 -Methyl - 6- ( 4 -thiomorpholino ) U NO 4 '- Carbocyclic uridine TP NO pseudo -UTP 4 ' - Ethynyluridine TP NO 1 -Methyl -6- ( substituted U NO 10 5-( 1 - Propynyl )ara -uridine TP NO phenyl) pseudo -UTP 5- ( 2 -Furanyl ) uridine TP NO 1 -Methyl - 6 -amino -pseudo -UTP U NO 5 - Cyanouridine TP NO 1 -Methyl - 6 - azido -pseudo -UTP U NO 5 - Dimethylaminouridine TP NO 1 -Methyl - 6 -bromo - pseudo -UTP U NO 5 '- Homo- uridine TP U NO 1 -Methyl - 6 -butyl - pseudo -UTP U NO 5 - iodo - 2 - fluoro - deoxyuridine TP U NO 1 -Methyl - 6 -chloro -pseudo -UTP U NO 15 5 - Phenylethynyluridine TP NO 1 -Methyl - 6 -cyano -pseudo -UTP U NO 5 - Trideuteromethyl- 6 -deuterouridine U NO 1 -Methyl - 6 -dimethylamino -pseudo U NO ?? UTP 5 - Trifluoromethyl - Uridine TP NO 1 -Methyl - 6 -ethoxy -pseudo -UTP U NO 5 - Vinylarauridine TP NO 1 -Methyl - 6 -ethylcarboxylate -pseudo U NO 6- (2,2,2 - Trifluoroethyl) -pseudo -UTP NO UTP 6-( 4 -Morphoiino ) -pseudo -UTP NO 20 CCCC 1 -Methyl - 6 - ethyl- pseudo -UTP U NO 6-( 4 - Thiomorpholino ) -pseudo -UTP NO 1 -Methyl - 6 - fluoro - pseudo -UTP U NO 6-( Substituted -Phenyl ) -pseudo -UTP U NO 1 -Methyl - 6 - formyl- pseudo -UTP U NO 6 - Amino - pseudo -UTP U NO 1 -Methyl - 6 -hydroxyamino -pseudo U NO 6 - Azido -pseudo -UTP U NO UTP 6 - Bromo -pseudo -UTP NO 1 -Methyl - 6 -hydroxy -pseudo -UTP U NO 6 - Butyl- pseudo -UTP NO 1- Methyl -6 -iodo -pseudo -UTP U NO 25 6 - Chloro -pseudo -UTP NO 1 -Methyl - 6 -iso -propyl - pseudo -UTP U NO 6 -Cyano -pseudo -UTP NO 1 -Methyl - 6 -methoxy - pseudo -UTP U NO 6 - Dimethylamino -pseudo -UTP NO 1 -Methyl - 6 -methylamino -pseudo -UTP U NO 6 - Ethoxy -pseudo -UTP NO 1 -Methyl - 6 -phenyl -pseudo -UTP U NO 6 - Ethylcarboxylate -pseudo -UTP NO 1 -Methyl - 6 -propyl - pseudo -UTP U NO 6 - Ethyl- pseudo -UTP U NO 1 -Methyl - 6 -tert - butyl - pseudo -UTP U NO 30 6 - Fluoro -pseudo -UTP NO 1 -Methyl - 6 - trifluoromethoxy -pseudo U NO 6 -Formyl - pseudo -UTP NO UTP 6 -Hydroxyamino -pseudo -UTP NO 1 -Methyl - 6 - trifluoromethyl- pseudo U NO 6 - Hydroxy -pseudo -UTP NO UTP 6 -Iodo -pseudo -UTP NO 1- Morpholinomethylpseudouridine TP U NO 6 -iso - Propyl -pseudo -UTP NO 1 - Pentyl- pseudo -UTP U NO 35 6 -Methoxy -pseudo -UTP NO 1 - Phenyl- pseudo -UTP U NO 6 -Methylamino - pseudo -UTP NO 1 - Pivaloylpseudouridine TP U NO 6 -Methyl - pseudo -UTP NO 1 -Propargylpseudouridine TP U NO 6 - Phenyl -pseudo - UTP NO 1 -Propyl - pseudo -UTP U NO 6 - Phenyl -pseudo - UTP NO 1 -propynyl - pseudouridine U NO 6 - Propyl- pseudo -UTP NO 1 -p - tolyl- pseudo -UTP U NO 40 6 -tert - Butyl -pseudo -UTP NO 1 - tert - Butyl- pseudo -UTP U NO 6 - Trifluoromethoxy - pseudo -UTP NO 1 - Thiomethoxymethylpseudouridine U NO 6 - Trifluoromethyl- pseudo -UTP NO ?? Alpha- thio -pseudo -UTP NO 1 NO Pseudouridine 1- ( 4 CCCC NO Thiomorpholinomethylpseudouridine methylbenzenesulfonic acid ) TP ?? Pseudouridine 1-( 4 -methylbenzoic U NO 1 - Trifluoroacetylpseudouridine TP U NO 45 acid ) TP 1 - Trifluoromethyl -pseudo -UTP U NO Pseudouridine TP 1-[ 3- ( 2 U NO 1 - Vinylpseudouridine TP U NO ethoxy) ]propionic acid 2,2' - anhydro -uridine TP U NO Pseudouridine TP 1- [ 3- { 2- (2- [2- ( 2 U NO 2 '- bromo - deoxyuridine TP U NO ethoxy )-ethoxy ] -ethoxy ) 2 '- F - 5 -Methyl - 2 '- deoxy - UTP U NO ethoxy } ] propionic acid 2 - OMe- 5 -Me -UTP U NO 50 Pseudouridine TP 1-[ 3- { 2- ( 2- [ 2- { 2 ( 2 U NO 2 '- OMe - pseudo -UTP U NO ethoxy )-ethoxy }-ethoxy ]-ethoxy ) 2 '- a - Ethynyluridine TP U NO ethoxy } ]propionic acid 2 '- a - Trifluoromethyluridine TP U NO Pseudouridine TP 1-[ 3- { 2-( 2- [ 2 -ethoxy ] ?. NO 2 '- b - Ethynyluridine TP U NO ethoxy ) -ethoxy } ]propionic acid 2 '- b - Trifluoromethyluridine TP U NO Pseudouridine TP 1-[ 3- { 2-( 2 - ethoxy ) ?. NO 2' - Deoxy - 2' , 2' - difluorouridine TP U NO 55 ethoxy } ] propionic acid 2 - Deoxy - 2' - a- mercaptouridine TP U NO Pseudouridine TP 1 -methylphosphonic ?. NO 2 '- Deoxy -2 ' - a -thiomethoxyuridine TP U NO acid 2 ' -Deoxy - 2' - b - aminouridine TP U NO Pseudouridine TP 1 -methylphosphonic U NO 2 '- Deoxy - 2' -b - azidouridine TP U NO acid diethyl ester 2 '- Deoxy - 2 ' - b - bromouridine TP U NO Pseudo - UTP -N1-3 -propionic acid U NO 2 ' - Deoxy - 2 '- b - chlorouridine TP U NO 60 Pseudo -UTP -N1-4 -butanoic acid U NO 2 -Deoxy - 2' - b - fluorouridine TP U NO Pseudo -UTP -N1-5 - pentanoic acid U NO 2 '- Deoxy - 2 '- b - iodouridine TP U NO Pseudo -UTP -N1-6 - hexanoic acid U NO 2 '- Deoxy -2 ' - b -mercaptouridine TP U NO Pseudo -UTP -N1-7 -heptanoic acid NO 2 '- Deoxy - 2 '- b - thiomethoxyuridine TP U NO Pseudo -UTP -N1 -methyl - p -benzoic NO 2 -methoxy - 4 - thio -uridine U NO acid 2 -methoxyuridine U NO 65 Pseudo - UTP - N1- p -benzoic acid U NO 2 '- O -Methyl -5- ( 1- propynyl ) uridine TP U NO Wybutosine yW W YES US 10,653,712 B2 45 46 -continued In some embodiments, the modified nucleobase is a modified uridine. Exemplary nucleobases , nucleosides , and Natu nucleotides having a modified uridine include 5 -cyano uri rally dine or 4 ' -thio uridine . Oc 5 In some embodiments , the modified nucleobase is a Name Symbol Base curring modified adenine . Exemplary nucleobases , nucleosides , and Hydroxywybutosine OHyW W YES nucleotides having a modified adenine include 7 -deaza Isowyosine img2 W YES Peroxywybutosine o2yW W YES adenine, 1 -methyl -adenosine (m1A ), 2 -methyl - adenine undermodified hydroxywybutosine OHyW * W YES (m2A ), N6 -methyl - adenosine mA( ) , and 2,6 - Diaminopu 4 -demethylwyosine img - 14 YES 10 rine . In some embodiments , the modified nucleobase is a In some embodiments , the modified nucleobase is modified guanine . Exemplary nucleobases , nucleosides , and pseudouridine ( V ), N1- methylpseudouridine (m'y ) , 2 - thio nucleotides having a modified guanine include inosine (I ), uridine, 4' - thiouridine , 5- methylcytosine , 2- thio -1 - methyl- 15 (1mimG -methyl ), - inosine7- deaza -(m1I guanosine ), wyosine , 7- cyano ( img - 7 )- ,deaza methylwyosine -guanosine 1 -deaza - pseudouridine , 2 - thio - 1 -methyl - pseudouridine , (preQo ), 7 - aminomethyl- 7 -deaza - guanosine (preQ1 ) , 2 - thio - 5 -aza -uridine , 2 - thio - dihydropseudouridine , 2 - thio 7 -methyl - guanosine (m7G ), 1 -methyl - guanosine (m1G ) , dihydrouridine, 2 - thio -pseudouridine , 4 -methoxy -2 - thio 8 -oxo - guanosine , 7 -methyl - 8 -oxo - guanosine. pseudouridine , 4 -methoxy - pseudouridine, 4 - thio - 1 -methyl In one embodiment, the polynucleotides of the present pseudouridine, 4 - thio - pseudouridine , 5 - aza -uridine , 20 invention , such as IVT polynucleotides, may have a uniform dihydropseudouridine , 5 -methoxyuridine , or 2 - O -methyl chemical modification of all or any of the same nucleotide uridine . In some embodiments , an RNA of the invention type or a population of modifications produced by mere includes a combination of one or more of the aforemen downward titration of the same startingmodification in all or tioned modified nucleobases ( e.g., a combination of 2 , 3 or any of the same nucleotide type , or a measured percent of a 4 of the aforementioned modified nucleobases .) 25 chemical modification of any of the same nucleotide type In some embodiments , the modified nucleobase is but with random incorporation , such as where all uridines 1 -methyl - pseudouridine (my ) , 5 -methoxy -uridine (mo®U ) , are replaced by a uridine analog , e.g. , pseudouridine. In 5 -methyl -cytidine mC( ) , pseudouridine ( W ) , a -thio - guanos another embodiment , the polynucleotides may have a uni ine, or a - thio -adenosine . In some embodiments , an mRNA form chemical modification of two , three, or four of the of the invention includes a combination of one or more of 30 same nucleotide type throughout the entire polynucleotide the aforementioned modified nucleobases (e.g. , a combina ( such as all uridines and all cytosines, etc. are modified in tion of 2 , 3 or 4 of the aforementioned modified nucle the same way ). When the polynucleotides of the present obases. ) invention are chemically and /or structurally modified the In some embodiments , the RNA comprises pseudouridine polynucleotides may be referred to as “ modified polynucle (W ) and 5 -methyl - cytidine (mC ) . In some embodiments , the 35 otides .” RNA comprises 1 -methyl - pseudouridine (my ) . In some Generally , the length of the IVT polynucleotide ( e.g. , IVT embodiments , the RNA comprises 1 - methyl- pseudouridine RNA ) encoding a polypeptide of interest is greater than (m'y ) and 5 -methyl - cytidine mC( ) . In some embodiments , about 30 nucleotides in length ( e.g., at least or greater than the RNA comprises 2 - thiouridine ( s’U ) . In some embodi about 35 , 40 , 45 , 50 , 55 , 60 , 70 , 80 , 90 , 100 , 120 , 140 , 160 , ments , the RNA comprises 2 - thiouridine and 5 -methyl- 40 180 , 200 , 250 , 300 , 350 , 400 , 450 , 500 , 600 , 700 , 800 , 900 , cytidine (mºC ). In some embodiments , the RNA comprises 1,000 , 1,100 , 1,200 , 1,300 , 1,400 , 1,500 , 1,600 , 1,700 , 5 -methoxy - uridine (mo?U ). In some embodiments , the RNA 1,800 , 1,900 , 2,000 , 2,500 , and 3,000 , 4,000 , 5,000 , 6,000 , comprises 5 -methoxy - uridine (mo?U ) and 5 -methyl - cyti 7,000,8,000 , 9,000 , 10,000 , 20,000 , 30,000,40,000 , 50,000 , dine (m®C ). In some embodiments , the RNA comprises 60,000 , 70,000 , 80,000 , 90,000 or up to and including 2 - O -methyl uridine . In some embodiments , the RNA com- 45 100,000 nucleotides ) . prises 2 - O -methyl uridine and 5 -methyl - cytidine (mC ) . In In some embodiments , the IVT polynucleotide (e.g. , IVT some embodiments , the RNA comprises comprises RNA ) includes from about 30 to about 100,000 nucleotides N6 -methyl - adenosine (m?A ). In some embodiments , the ( e.g., from 30 to 50 , from 30 to 100 , from 30 to 250 , from RNA comprises N6 -methyl - adenosine mA( ) and 5 -methyl 30 to 500 , from 30 to 1,000 , from 30 to 1,500 , from 30 to cytidine mC( ) . 50 3,000 , from 30 to 5,000 , from 30 to 7,000 , from 30 to In certain embodiments , an RNA of the invention is 10,000 , from 30 to 25,000 , from 30 to 50,000 , from 30 to uniformly modified ( i.e. , fully modified , modified through 70,000 , from 100 to 250 , from 100 to 500 , from 100 to out the entire sequence ) for a particular modification . For 1,000 , from 100 to 1,500 , from 100 to 3,000 , from 100 to example , an RNA can be uniformly modified with 5 -methyl 5,000 , from 100 to 7,000 , from 100 to 10,000 , from 100 to cytidine (m®C ) , meaning that all cytosine residues in the 55 25,000 , from 100 to 50,000 , from 100 to 70,000 , from 100 RNA sequence are replaced with 5 -methyl - cytidine mC( ) . to 100,000 , from 500 to 1,000 , from 500 to 1,500 , from 500 Similarly , RNAs of the invention can be uniformly modified to 2,000 , from 500 to 3,000 , from 500 to 5,000 , from 500 to for any type ofnucleotide residue present in the sequence by 7,000 , from 500 to 10,000 , from 500 to 25,000 , from 500 to replacement with a modified residue such as those set forth 50,000 , from 500 to 70,000 , from 500 to 100,000 , from above . 60 1,000 to 1,500 , from 1,000 to 2,000 , from 1,000 to 3,000 , In some embodiments , the modified nucleobase is a from 1,000 to 5,000 , from 1,000 to 7,000 , from 1,000 to modified cytosine . Exemplary nucleobases, nucleosides , and 10,000 , from 1,000 to 25,000 , from 1,000 to 50,000 , from nucleotides having a modified cytosine include N4 -acetyl 1,000 to 70,000 , from 1,000 to 100,000 , from 1,500 to 3,000 , cytidine ( ac4C ), 5 -methyl - cytidine (m5C ) , 5 - halo - cytidine from 1,500 to 5,000 , from 1,500 to 7,000 , from 1,500 to ( e.g., 5 - iodo -cytidine ) , 5 -hydroxymethyl - cytidine (hm5C ) , 65 10,000 , from 1,500 to 25,000 , from 1,500 to 50,000 , from 1 -methyl -pseudoisocytidine , 2 -thio -cytidine (s2C ) , 2 - thio - 5 1,500 to 70,000 , from 1,500 to 100,000 , from 2,000 to 3,000 , methyl- cytidine . from 2,000 to 5,000 , from 2,000 to 7,000 , from 2,000 to US 10,653,712 B2 47 48 10,000 , from 2,000 to 25,000 , from 2,000 to 50,000 , from production may be demonstrated by increased cell transfec 2,000 to 70,000 , and from 2,000 to 100,000 ) . tion , increased protein translation from the polynucleotide , In some embodiments , a nucleic acid as described herein decreased nucleic acid degradation ( as demonstrated , e.g., is a chimeric polynucleotide. Chimeric polynucleotides or by increased duration of protein translation from a modified RNA constructs maintain a modular organization similar to 5 polynucleotide) , or altered peptide production in the host IVT polynucleotides , but the chimeric polynucleotides com cell . prise one or more structural and /or chemical modifications The RNA of the present invention may be designed to or alterations which impart useful properties to the poly encode polypeptides of interest selected from any of several nucleotide . As such , the chimeric polynucleotides which are target categories including, but not limited to , biologics , modified RNAmolecules of the present invention are termed 10 antibodies , vaccines, therapeutic proteins or peptides , cell “ chimeric modified RNA ” or “ chimeric RNA . ” Chimeric penetrating peptides , secreted proteins, plasma membrane polynucleotides have portions or regions which differ in size proteins, cytoplasmic or cytoskeletal proteins, intracellular and / or chemicalmodification pattern , chemical modification membrane bound proteins, nuclear proteins, proteins asso position , chemical modification percent or chemical modi ciated with human disease, targeting moieties or those fication population and combinations of the foregoing . 15 proteins encoded by the human genome for which no Polypeptides of Interest therapeutic indication has been identified but which none In some embodiments of the invention the is one or more theless have utility in areas of research and discovery. of the following : mRNA , modified mRNA , unmodified “ Therapeutic protein ” refers to a protein that, when admin RNA , IncRNA , self - replicating RNA , circular RNA , istered to a cell has a therapeutic , diagnostic , and /or pro CRISPR guide RNA , and the like . In embodiments the RNA 20 phylactic effect and /or elicits a desired biological and /or is RNA that encodes a polypeptide , such as mRNA or pharmacological effect . self - replicating RNA . The RNA disclosed herein , may encode one or more In exemplary aspects of the invention , highly pure RNAs biologics. As used herein , a “ biologic " is a polypeptide compositions are used to produce polypeptides of interest , based molecule produced by the methods provided herein e.g., therapeutic proteins, vaccine antigen , and the like . In 25 and which may be used to treat, cure , mitigate , prevent, or some embodiments , the nucleic acids are therapeutic RNAs. diagnose a serious or life - threatening disease or medical As used herein , the term “ therapeutic mRNA ” refers to an condition . Biologics, according to the present invention mRNA that encodes a therapeutic protein . Therapeutic pro include , but are not limited to , allergenic extracts ( e.g. for teins mediate a variety of effects in a host cell or a subject allergy shots and tests ), blood components , gene therapy in order to treat a disease or ameliorate the signs and 30 products , human tissue or cellular products used in trans symptoms of a disease . For example , a therapeutic protein plantation , vaccines, monoclonal antibodies , cytokines , can replace a protein that is deficient or abnormal, augment growth factors , enzymes , thrombolytics, and immunomodu the function of an endogenous protein , provide a novel lators, among others . function to a cell (e.g. , inhibit or activate an endogenous According to the present invention, one or more biologics cellular activity , or act as a delivery agent for another 35 currently being marketed or in developmentmay be encoded therapeutic compound (e.g. , an antibody -drug conjugate ). by the RNA of the present invention . While not wishing to Therapeutic mRNA may be useful for the treatment of the be bound by theory, it is believed that incorporation of the following diseases and conditions: bacterial infections , viral encoding polynucleotides of a known biologic into the RNA infections , parasitic infections , cell proliferation disorders, of the invention will result in improved therapeutic efficacy genetic disorders , and autoimmune disorders . 40 due at least in part to the specificity , purity and / or selectivity Thus , the polynucleotides of the invention can be used as of the construct designs. therapeutic or prophylactic agents . They are provided for use The RNA disclosed herein , may encode one or more in medicine . For example , the RNA described herein can be antibodies or fragments thereof. The term “ antibody ” administered to a subject , wherein the polynucleotides are includes monoclonal antibodies (including full length anti translated in vivo to produce a therapeutic peptide . Provided 45 bodies which have an immunoglobulin Fc region ), antibody are compositions, methods, kits , and reagents for diagnosis , compositions with polyepitopic specificity , multispecific treatment or prevention of a disease or condition in humans antibodies (e.g. , bispecific antibodies , diabodies, and single and other mammals . The active therapeutic agents of the chain molecules ), as well as antibody fragments . The term invention include the polynucleotides , cells containing poly “ immunoglobulin ” (Ig ) is used interchangeably with “ anti nucleotides or polypeptides translated from the polynucle- 50 body” herein . As used herein , the term “monoclonal anti otides . body ” refers to an antibody obtained from a population of The polynucleotides may be induced for translation in a substantially homogeneous antibodies , i.e., the individual cell, tissue or organism . Such translation can be in vivo , ex antibodies comprising the population are identical except for vivo , in culture , or in vitro . The cell , tissue or organism is ossible naturally occurring mutations and / or post - transla contacted with an effective amount of a composition con- 55 tion modifications ( e.g. , isomerizations, amidations ) that taining a polynucleotide which contains the RNA polynucle may be present in minor amounts . Monoclonal antibodies otides . are highly specific , being directed against a single antigenic An “ effective amount ” of the polynucleotides are pro site . vided based , at least in part, on the target tissue , target cell The monoclonal antibodies herein specifically include type, means of administration , physical characteristics of the 60 “ chimeric ” antibodies ( immunoglobulins) in which a portion polynucleotide ( e.g., size , and extent of modified nucleo of the heavy and / or light chain is identical with or homolo tides) and other components of the polynucleotides , and gous to corresponding sequences in antibodies derived from other determinants. In general, an effective amount of the a particular species or belonging to a particular antibody polynucleotides provides an induced or boosted peptide class or subclass , while the remainder of the chain ( s ) is (are ) production in the cell, preferably more efficient than a 65 identical with or homologous to corresponding sequences in composition containing a corresponding unmodified poly antibodies derived from another species or belonging to nucleotide encoding the same peptide. Increased peptide another antibody class or subclass, as well as fragments of US 10,653,712 B2 49 50 such antibodies , so long as they exhibit the desired biologi gp41. The amino acid and nucleotide sequences of HIV - 1 cal activity . Chimeric antibodies of interest herein include , gp120 or gp41 are described in , e.g. , Kuiken et al. , (2008 ) . but are not limited to , “ primatized ” antibodies comprising “ HIV Sequence Compendium , ” Los Alamos National Labo variable domain antigen -binding sequences derived from a ratory . non -human primate ( e.g. , Old World Monkey, Ape etc.) and 5 In some embodiments , the anti -microbial polypeptide human constant region sequences. may have at least about 75 % , 80 % , 85 % , 90 % , 95 % , 100 % An “ antibody fragment” comprises a portion of an intact sequence homology to the corresponding viral protein antibody, preferably the antigen binding and /or the variable sequence . In some embodiments , the anti -microbial poly region of the intact antibody. Examples of antibody frag peptide may have at least about 75 % , 80 % , 85 % , 90 % , 95 % , ments include Fab , Fab' , F (ab ' ) 2 and Fv fragments ; diabod- 10 or 100 % sequence homology to the corresponding viral ies ; linear antibodies ; nanobodies; single -chain antibody protein sequence . molecules and multispecific antibodies formed from anti In other embodiments , the anti -microbial polypeptide body fragments . may comprise or consist of a synthetic peptide correspond Any of the five classes of immunoglobulins, IgA , IgD , ing to a region , e.g., a consecutive sequence of at least about IgE , IgG and IgM , may be encoded by the RNA of the 15 5 , 10 , 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , or 60 amino acids invention , including the heavy chains designated alpha , of the binding domain of a capsid binding protein . In some delta , epsilon , gamma and mu, respectively . Also included embodiments , the anti- microbial polypeptide may have at are polynucleotide sequences encoding the subclasses , least about 75 % , 80 % , 85 % , 90 % , 95 % , or 100 % sequence gamma and mu. Hence any of the subclasses of antibodies homology to the corresponding sequence of the capsid may be encoded in part or in whole and include the follow- 20 binding protein . ing subclasses : IgG1, IgG2, IgG3, IgG4 , IgAl and IgA2. The anti -microbial polypeptides described herein may According to the present invention , one or more antibodies block protease dimerization and inhibit cleavage of viral or fragments currently being marketed or in development proproteins (e.g. , HIV Gag - pol processing ) into functional may be encoded by the RNA of the present invention . proteins thereby preventing release of one or more envel Antibodies encoded in the RNA of the invention may be 25 oped viruses (e.g. , HIV , HCV ) . In some embodiments , the utilized to treat conditions or diseases in many therapeutic anti- microbial polypeptide may have at least about 75 % , areas such as, but not limited to , blood , cardiovascular , CNS , 80 % , 85 % , 90 % , 95 % , 100 % sequence homology to the poisoning ( including antivenoms) , dermatology, endocrinol corresponding viral protein sequence . ogy, gastrointestinal , medical imaging, musculoskeletal, In other embodiments , the anti -microbial polypeptide can oncology, immunology, respiratory , sensory and anti- infec- 30 comprise or consist of a synthetic peptide corresponding to tive. a region , e.g. , a consecutive sequence of at least about 5 , 10 , In one embodiment, RNA disclosed herein may encode 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , or 60 amino acids of the monoclonal antibodies and /or variants thereof. Variants of binding domain of a protease binding protein . In some antibodies may also include , but are not limited to , substi embodiments , the anti -microbial polypeptide may have at tutional variants , conservative amino acid substitution , 35 least about 75 % , 80 % , 85 % , 90 % , 95 % , 100 % sequence insertional variants , deletional variants and / or covalent homology to the corresponding sequence of the protease derivatives. In one embodiment, the RNA disclosed herein binding protein . may encode an immunoglobulin Fc region . In another A non - limiting list of infectious diseases that the RNA embodiment, the RNA may encode a variant immunoglobu vaccine antigens or anti -microbial peptides may treat is lin Fc region. 40 presented below : human immunodeficiency virus (HIV ), ThemRNA disclosed herein , may encode one or more HIV resulting in mycobacterial infection , AIDS related vaccine antigens. As used herein , a " vaccine antigen ” is a Cacheixa , AIDS related Cytomegalovirus infection , HIV biological preparation that improves immunity to a particu associated nephropathy, Lipodystrophy, AID related crypto lar disease or infectious agent. According to the present coccal meningitis, AIDS related neutropaenia , Pneumocysi invention , one or more vaccine antigens currently being 45 tis jiroveci (Pneumocystis carinii) infections, AID related marketed or in development may be encoded by the RNA of toxoplasmosis , hepatitis A , B , C , D or E , herpes, herpes the present invention . zoster ( chicken pox ), German measles ( rubella virus ) , yel Vaccine antigens encoded in the RNA of the invention low fever , dengue fever etc. ( flavi viruses) , flu (influenza may be utilized to treat conditions or diseases in many viruses ), haemorrhagic infectious diseases (Marburg or therapeutic areas such as, but not limited to , cancer, allergy 50 Ebola viruses) , bacterial infectious diseases such as Legion and infectious disease . In some embodiments the cancer naires ' disease (Legionella ), gastric ulcer (Helicobacter ), vaccines may be personalized cancer vaccines in the form of cholera (Vibrio ), E. coli infections, staphylococcal infec a concatemer or individual RNAs encoding peptide epitopes tions, salmonella infections or streptococcal infections, teta or a combination thereof. nus ( Clostridium tetani) , protozoan infectious diseases (ma The RNA of the present invention may be designed to 55 laria , sleeping sickness , leishmaniasis , toxoplasmosis , i.e. encode on or more antimicrobial peptides (AMP ) or antiviral infections caused by Plasmodium , trypanosomes, Leishma peptides ( AVP ). AMPs and AVPs have been isolated and nia and Toxoplasma) , diphtheria , leprosy , measles , pertussis , described from a wide range of animals such as, but not rabies , tetanus, tuberculosis , typhoid , varicella , diarrheal limited to , microorganisms, invertebrates, plants , amphib infections such as Amoebiasis , Clostridium difficile -associ ians, birds, fish , and mammals . The anti- microbial polypep- 60 ated diarrhea (CDAD ), Cryptosporidiosis , Giardiasis , tides described herein may block cell fusion and /or viral Cyclosporiasis and Rotaviral gastroenteritis , encephalitis entry by one or more enveloped viruses ( e.g. , HIV, HCV) . such as Japanese encephalitis , Wester equine encephalitis For example , the anti -microbial polypeptide can comprise or and Tick -borne encephalitis ( TBE ), fungal skin diseases consist of a synthetic peptide corresponding to a region , e.g. , such as candidiasis , onychomycosis , Tinea captis/ scal ring a consecutive sequence of at least about 5 , 10 , 15 , 20 , 25 , 30 , 65 worm , Tinea corporis/ body ringworm , Tinea cruris / jock itch , 35 , 40 , 45 , 50 , 55 , or 60 amino acids of the transmembrane sporotrichosis and Tinea pedis / Athlete's foot, Meningitis subunit of a viral envelope protein , e.g. , HIV - 1 gp120 or such as Haemophilus influenza type b (Hib ) , Meningitis ,