On the Occurrence of Myotis Alcathoe Von Helversen and Heller, 2001 in Austria

Hystrix It. J. Mamm. (n.s.) 19 (1) (2008): 3-12

ON THE OCCURRENCE OF MYOTIS ALCATHOE VON HELVERSEN AND HELLER, 2001 IN AUSTRIA

1* 2 2 FRIEDERIKE SPITZENBERGER , IGOR PAVLINIĆ , MARTINA PODNAR

1Natural History Museum, Mammal Department, Burgring 7, 1010 Vienna, Austria *Corresponding author, e-mail: [email protected] 2Croatian Natural History Museum, Zoological Department, Demetrova 1, 10000 Zagreb, Croatia; e-mail: [email protected]; [email protected]

Received 25 March 2008; accepted 30 May 2008

ABSTRACT - In 2006, two males and one female of Myotis alcathoe were captured by mistnets at two localities in southern Burgenland, Austria. For two individuals the prelimi- nary specific identification based on external measurements was confirmed by sequencing parts of the mitochondrial ND1 gene. Across the sequenced region, the two analysed bats share a 100% identical haplotype that corresponds to the haplotype found in Hungarian bats identified as M. alcathoe, and was found also in Spanish, French and Slovakian samples. The three animals from Burgenland constitute the first records of this species in Austria. Age related differences in pelage and membrane coloration and measurements of M. alcathoe are described. A comparison of skull length measurements between M. alcathoe and Myotis mystacinus seems to indicate that the interspecific difference in external dimensions is not reflected in skull dimensions. The Austrian localities of M. alcathoe belong to the Pannonian part of the range, as do findings from Slovakia and Hungary.

Key words: M. alcathoe, Myotis mystacinus, Austria, species recognition, habitat, abundance

RIASSUNTO – Sulla presenza di Myotis alcathoe von Helversen and Heller, 2001 in Austria. Nel 2006, due maschi e una femmina di Myotis alcathoe sono stati catturati tramite mist-nets in due località del Burgenland meridionale, Austria. Per due individui, l’identificazione preliminare su basi morfologiche è stata confermata dall’analisi del gene mitocondriale ND1. Nella sequenza analizzata, gli aplotipi dei due individui coincidono al 100% e corrispondono a quelli evidenziati in soggetti spagnoli, francesi e sloveni. I tre e- semplari del Burgenland rappresentano la prima segnalazione certa di questa specie per l’Austria. Vengono descritte alcune differenze nella colorazione della pelliccia e del patagio tra adulti e subadulti. Il confronto delle misure del cranio di M. alcathoe e M. mystacinus sembra non corrispondere alle differenze riscontrate per le dimensioni corporee esterne. Le località di rinvenimento appartengono, insieme a quelle slovene e ungheresi, al sub-areale pannonico della specie.

Parole chiave: M. alcathoe, Myotis mystacinus, Austria, identificazione, habitat, abbondan- za

3 Spitzenberger et al.

INTRODUCTION tioned by the describers of M. alcathoe were on average smaller body size than The whiskered bat M. mystacinus in M. mystacinus, and proportions of (Kuhl, 1817) is widespread and com- ear and tragus. According to Benda and mon in large parts of Europe. It was Karataş (2005), cranial and dental regarded as one single species until characters do not allow differentiation careful analyses of morphology, karyo- of M. alcathoe from M. mystacinus. logy and mitochondrial DNA sequen- The assessment of the range of M. al- ces revealed that it consisted of four cathoe, recently summarised by Nier- species (Gauckler and Kraus, 1970; mann et al. (2007), was based entirely Volleth, 1987; Mayer and von Hel- on captured bats whose specific iden- versen, 2001; Ruedi and Mayer, 2001). tity was determined either by using ex- A number of molecular studies (Ruedi ternal characters in the field only or by and Mayer, 2001; Stadelmann et al., an additional genetic analysis. Until 2004, 2007) provided evidence that M. now, no specimen of M. alcathoe has mystacinus, M. brandtii and M. al- been found in museum collections. cathoe belong to highly divergent and Nevertheless, information on range and not closely related genetic clades and ecology of this recently described spe- are the products of adaptive convergent cies is growing fast. The present paper evolution. The fourth species, Myotis reports on the first records of M. al- aurascens, can be differentiated from cathoe in Austria, including informa- the other European members of the tion on species recognition and a hy- “Myotis mystacinus-morphogroup” (sen- pothesis concerning its phylogeogra- su Benda and Karataş, 2005) by karyo- phy. type, skull size and dental and bacular characters (Benda and Tsytsulina, STUDY AREA 2000; Ruedi et al., 2002), but mitochondrial DNA differences are within The study area, “Hills and terraces of Southern Burgenland”, is situated in the the range of intraspecific variation easternmost province of Austria (Bur- (Mayer and von Helversen, 2001). genland) near the Hungarian border (Fig. Therefore the phylogenetic position of 1). It is an area of approximately 142 km2 M. aurascens has not been assessed up lying between the valleys Pinka and Strem to now. (47° 04’ - 47° 13’ N; 16° 16’ - 16° 27’ E). Myotis alcathoe von Helversen and The Tertiary hill country is of moderate Heller, 2001 was the last species of the elevation descending gradually from 415 m M. mystacinus-morphogroup to be dis- in the north, to 230 m a.s.l. in the southern covered and described. Some differ- part, which forms the transition to the Lesser Hungarian Basin. Two short tribu- ences in the sequence of mitochondrial taries drain southwards to the river Strem. genes and in the pattern of active nu- The climate is characterised by hot sum- cleolus organiser regions have been mers and cold winters, typical for the Pan- reported as unambiguous characters for nonian lowland. The hills and gravel ter- species recognition (von Helversen et races are covered by a large coherent semi- al., 2001). Somatic characters men- natural forest consisting mainly of oak

4 Myotis alcathoe in Austria

Figure 1 - Study area with the two sampling sites (dots).

(Quercus petraea) and hornbeam (Carpi- Ehrensdorf (district Güssing, province nus betulus). Deciduous forests of the type Burgenland - 47° 06’N/16° 25’ E, altitude Tilio-Acerion grow on the slopes of the 233 m). Being unused, the ponds were al- hills. In valley bottoms, riverine forests most completely covered by reed and sur- (Alno-Padion, Alnion incanae and Salicion rounded by riverine and deciduous forest albae) alternate with wet meadows. The vegetation. Apart from one Pipistrellus study area is regionally protected and is pygmaeus and nine Myotis daubentonii we also a site of community interest (“SCI”) captured one male of the M. mystacinus- under the EU habitats directive. morphogroup which we preliminarily identified as M. alcathoe and collected for fur- METHODS ther examination (permit nr. 5-N- A1007/270-2006, 07.02.2006, Amt der 1. Sampling Burgenländischen Landesregierung). It is now deposited in the Mammal Collection On 19 August 2006, we set mistnets next to of the Natural History Museum Vienna two large fishponds east of Deutsch (NMW 66186).

5 Spitzenberger et al.

In mistnets set around a small fishpond 30 s at 50oC and 90 s at 72oC and a final located 1.2 km NE of Punitz (district extension step of 7 min at 72oC. Güssing, province Burgenland, 47 07’ For reamplification reactions the annealing N/16° 21’ E, altitude 248 m) we captured temperature was increased to 51oC. three specimens belonging to the M. Sequencing was carried out by Sequencing mystacinus-morphogroup on 22 August Service Ruđer Bošković Institute (Zagreb) 2006. While one of two females belonged using oligonucleotides ER70 for the speci- clearly to M. mystacinus (forearm 34.5 men NMW 66185 and H-Myot-637ND1 mm), the other female and the male had for NMW 66186 as sequencing primers. A shorter forearms (31.8 and 32.0 mm respec- BLAST search (Altschul et al., 1990) was tively) and distinctly smaller thumbs and performed in order to determine the most feet. The female was sampled (NMW similar sequences available in the Gen- 66185) to confirm its supposed identifica- Bank. tion as M. alcathoe. This fishpond is located in a mown meadow near to a road 3. Morphological analysis and is surrounded by a young forest planta- tion consisting mainly of spruce (Picea With the exception of the forearm length, abies) and pine (Pinus sylvestris) which is which was measured in the field, external intersected by no less than five forest roads. measurements (length of head and body, Nearby is a small dry valley lined by a nar- tail, hind foot and ear) were taken from the row row of Alnus incana and Salix sp. collected animals preserved in ethanol. Sixteen skull measurements were taken with dial callipers accurate to 0.01 mm. For 2. Genetic analysis comparison we used 180 subadult (young

of the year) and adult specimens of the M. Total genomic DNA was extracted using mystacinus-morphogroup from Austria DNeasy Tissue Kit by QIAgen GmbH from housed in the mammal collection of the muscle tissue of the two ethanol preserved Natural History Museum in Vienna (NMW) museum specimens. The part of the mito- which were determined as M. mystacinus. chondrial NADH dehydrogenase subunit 1 All skull measurements were taken by the gene (ND1) was amplified via polymerase same person, Edmund Weiss. The abbre- chain reaction (PCR) using specific primer viations used are: pairs ER65 (Petit et al., 1999, Mayer and Bb – braincase breadth; Bh – braincase von Helversen 2001) and HMyot-637ND1 height; Cbl – condylobasal length; C-C – (5' - GGTCCTCCTGCATATTCTAC - 3') anterior palatal breadth; Ccl – condylo- and then re-amplified using ER70 (Petit et canine length; C-M3 – length of lower al., 1999; Mayer and von Helversen 2001) toothrow between canine and third molar; and HMyot-637ND1 primers. Amplifica- C-M3 – length of upper toothrow from ca- tions were performed in the 50 µl reaction nine to third molar; Corh – height of mixtures on a Perkin Elmer GeneAmp coronoid process; Ear – length of ear; FA – 2400 Thermocycler using the MasterTaq length of forearm; GrSl – greatest skull Kit (Eppendorf) according to the instruc- length; HBl – head and body length; HF – tions of the manufacturer. Primers concen- length of hind foot; I-M3 – length of lower trations were 0.4 µM and 1µl of total DNA toothrow from first incisor to third molar; obtained from approximately 1 mg of tissue I-M3 – length of upper toothrow from first used as a template. Amplification condi- incisor to third molar; IO – breadth of in- tions involved an initial denaturation step terorbital constriction; M – length of man- of 2 min at 94oC, 35 cycles of 30 s at 94oC, dible from symphysis to condylar process;

6 Myotis alcathoe in Austria

M3-M3 – maxillarly breadth between upper haplotypes were found only in the molars; Mb – mastoid breadth; Tl – tail samples originating from different parts length; Zb – zygomatic breadth. of Greece (von Helversen et al., 2001; Mayer and von Helversen 2001) and in RESULTS AND DISCUSSION one of the two analysed samples from Slovakia (Benda et al., 2003). The 1. Genetic analysis "Hungarian" haplotype is widespread and was recorded from Hungary (von The 561 bp and 618 bp long section of Helversen et al., 2001), Austria (this the ND1 gene was sequenced from the study), France (Ruedi et al., 2002), samples NMW 66185 and NMW Spain (Agirre-Mendi et al., 2004) and 66186, respectively. BLAST search the second Slovakian sample (Benda et revealed that, across the sequenced re- al., 2003). This leads us to assume a gion, the two analysed bats share a recent and rapid range expansion of 100% identical haplotype correspond- bats carrying the “Hungarian” hap- ing to the haplotypes of Hungarian bats logroup from a glacial refugium in identified as M. alcathoe -GenBank Western Europe (probably in Iberia) accession numbers AYO27835 and and the existence of at least one further AY027836 (von Helversen et al., refugium (probably in the Balkan pen- 2001). insula) where bats carrying the “Greek” The very small number of available M. haplogroup survived the last ice age. alcathoe mtDNA sequences does not entirely allow conclusions on the phy- 2. External characters logeography of the species. Nonethe- less, covering a large geographic range they already seem to indicate a phy- The specimens NMW 66185 and 66186 logeographic pattern showing many and a third individual were recognised similarities with that of another Euro- as M. alcathoe in the field by their pean Myotis species, M. myotis (Ruedi small and delicate feet, short forearms and Castella, 2003). All currently ana- and thumbs. With the exception of the lysed M. alcathoe belonged to one of feet, the external and cranial measure- two haplogroups described by von ments of the male M. alcathoe NMW Helversen et al. (2001) from Hungary 66186 were slightly larger than the fe- and Greece. While the "Greek" hap- male (Tab. 1 and Fig. 2). This unex- logroup encompasses three different mt pected ratio can most probably be ex- haplotypes that differ from each other plained by a difference in age of these only by a single base substitution, the two individuals. In the male, the joint st "Hungarian" haplogroup is represented between the metacarpal and the 1 pha- rd by a single mt haplotype. The sequence lanx of the 3 finger was hard when divergence between those two hap- touched between two fingers and the logroups (1.3-1.4 %) indicates that they epiphyses were completely ossified. In probably diverged in isolation in two the female this joint felt softer and the separate glacial refugia. The "Greek" metacarpal showed a light line of epi-

7 Spitzenberger et al.

Table 1 - External and cranial measurements (mm) of two M. alcathoe captured in Bur- genland, Austria (for abbreviations see Methods - Morphological analysis).

Number NMW 66185 NMW 66186 Sex Female Male HBl 39.0 40.5 Tl 34.5 33.5 Ear 11.4 13.2 HF 6.2 5.8 FA 32.4 32.6 GrSI 13.17 13.46 Ccl 11.52 11.90 Cbl 12.19 12.64 Bh 5.71 5.84 Bb 6.16 6.30 Mb 6.96 6.98 Zb - 8.21 IO 3.19 3.41 C-C 3.29 3.35 M3-M3 5.22 5.31 I-M3 5.88 6.20 C-M3 4.78 5.13 M 9.79 10.09

I-M3 5.97 6.52

C-M3 5.19 5.39 Corh 2.78 2.89

physeal cartilage (Morris 1972). Judg- tail membranes as well as ears and feet ing from the results of an investigation were light brown in the old male and of a large series of M. daubentonii blackish brown in the subadult female. (Baagøe 1977), it can be concluded that The colour of the tragi corresponded to the female NMW 66185 was born in the colour of the ears which were summer 2006 whereas the male was transparent in the old male but opaque older. in the subadult female. The subadult female and the adult male In their field identification key, Dietz differed conspicuously in the colour- and von Helversen (2004) admit that it ation of fur and membranes. Wing and is not possible to assign all individuals

8 Myotis alcathoe in Austria of the M. mystacinus – morphogroup 3. Cranial characters unambiguously to one species. Our results seem to confirm that adult M. al- The shape of the skulls of M. alcathoe cathoe can be identified by their brown, and M. mystacinus is different (Fig. 3). Myotis daubentonii-like pelage, brown The dorsal profile of M. alcathoe is membranes and transparent ears in characterised by a distinct concavity in combination with small feet and the frontal region, the braincase tends thumbs and relatively short tragus, as to be higher, and the rostral part longer was previously suggested by other au- than in M. mystacinus. The upper ca- thors (von Helversen et al., 2001; nine is slightly shorter and weaker than Agirre-Mendi, 2004; Dietz and von in M. mystacinus. According to these Helversen, 2004). As the fur and characters, all the 180 Austrian skulls membrane colour of subadult individu- in the NMW collection previously als of both species are very similar, identified as M. mystacinus belong in- future records of M. alcathoe based deed to this species. solely on morphological field identifi- In order to test whether the smaller di- cation should be restricted to adult in- mensions of the body (e.g. length of the dividuals. forearm) of M. alcathoe compared to

6.60

6.40

6.20 3 6.00 I-M

5.80

5.60

5.40 12.00 12.20 12.40 12.60 12.80 13.00 13.20 13.40 Cbl

Figure 2 - Bivariate scatter plot of condylobasal length (Cbl) against length of upper toothrow (I-M3) of 180 skulls of M. mystacinus (circles) and M. alcathoe (dots) from Aus- tria.

9 Spitzenberger et al.

Figure 3 - Lateral aspect of skulls of male M. alcathoe (NMW 66186) and M. mystacinus (NMW 52285) with the same condylobasal length (12.6 mm) from Austria. M. alcathoe on the left side, M. mystacinus on the right side.

M. mystacinus are reflected also in their three bats captured in 2006 in the dis- skull size, we performed a bivariate trict Güssing in Burgenland represent scatter plot of Cbl against the length of the first records of M. alcathoe in Aus- the upper toothrow (I-M3) of 180 skulls tria. of Austrian M. mystacinus specimens M. alcathoe may be missing in medium in the NMW collection and the skulls and high elevations of the Alps. Until of the two genetically identified M. now, it was recorded north-west of the alcathoe (Fig. 2). The condylobasal Alps for the Swiss Jura mountains length of the adult male M. alcathoe (Stadelmann et al., 2004) and east of occupied a position near the arithmetic the Alps at the foot of the mountains mean of this measurement of M. surrounding the Pannonian Basin and mystacinus, the subadult female clus- on hills rising above this plain. The tered with subadult specimens of M. Austrian localities lie on the eastern mystacinus. Craniological analyses of foothills of the Alps, the only known more genetically identified museum Slovakian finding (Benda et al., 2003) material of M. alcathoe and M. on the southern slopes of the Carpa- mystacinus will show whether the de- thian mountains. The Hungarian re- scribed differences in skull shape and cords (Estók, 2007) come from the different ratios of skull/forearm length Hungarian secondary chain of moun- suggested by our results will provide tains (Bükk, Mátra and Bakony) which useful characters for separating these divides the Lesser and Greater Hungar- two species. ian Basins. The distance between Ba- kony mountains (highest peak 704 m) 4. Distribution, habitat and abundance and the Austrian localities in the district Güssing is little more than 100 km. As we could not find M. alcathoe Thus, the Austrian records belong to among the previously collected Aus- the Pannonian part of the range of M. trian specimens determined as M. alcathoe. mystacinus in the collection of the The typical habitat of M. alcathoe in Natural History Museum in Vienna, the the Pannonian part of the range is hilly

10 Myotis alcathoe in Austria country covered by warm oak-horn- Alessandro Balestrieri and an anony- beam forests in elevations between 200 mous referee for valuable comments on and 600 m a.s.l. where surface water is the first version of the manuscript. available also in the summer months (see also Estók, 2007). REFERENCES There are contradictory statements concerning the abundance of M. al- Agirre-Mendi P., García-Mudarra J., Juste cathoe in its European range. Niermann J. and Ibanez C. 2004. Presence of et al. (2007) listed 221 records of Myotis alcathoe Helversen and Heller, which almost two thirds lie in France 2001 (Chiroptera: Vespertilionidae) in whereas the remaining 65 findings are the Iberian Peninsula. Acta Chirop- terologica, 6: 49-57. distributed over 10 other countries. Altschul S.F., Gish W., Miller W., Myers Estók (2007) reported that M. alcathoe E.W. and Lipman D.J. 1990. Basic lo- was mistnetted in Hungary at 30 locali- cal alignment search tool. J. Mol. Biol., ties. In other parts of the range, how- 215:403-410. ever, M. alcathoe seems to be a rare Baagøe H. 1977. Age determination in species in most places (Dietz et al., bats. Vodensk. Meddr. dansk. naturh. 2007; Niermann et al., 2007 and this Foren., 140: 53-92. paper). As only some of the records Benda P. and Karataş A. 2005. On some listed by Niermann et al. (2007) were mediterranean populations of bats of confirmed by genetic analyses, it is the Myotis mystacinus morpho-group (Chiroptera: Vespertilionidae). Lynx possible that the results of this paper do (Praha) n.s., 36: 9-38. not depict the actual distribution of Benda P., Ruedi M. and Uhrin M. 2003. abundance of M. alcathoe in its range. First record of Myotis alcathoe (Chi- The difficulty with identifying cryptic roptera: Vespertilionidae) in Slovakia. bat species without using genetic mark- Folia zool., 52: 359-365. ers has probably peaked in the M. Benda P. and Tsytsulina K. 2000. Taxo- mystacinus-morphogroup. Only careful nomic revision of the Myotis mysta- morphological comparison of numer- cinus group (Mammalia: Chiroptera) ous genetically identified museum in the western Palearctic. Acta soc. specimens of M. mystacinus, M. brand- zool. bohemoslov. 64: 331-398. Dietz Ch. and von Helversen O. 2004. Il- tii, M. alcathoe and M. ausrascens can lustrated identification key of the bats provide diagnostic characters for effec- of Europe. Electronic publication Ver- tive species identification in the field. sion 1.0. Dietz Ch., von Helversen O. and Nill D. ACKNOWLEDGMENTS 2007. Handbuch der Fledermäuse Eu- ropas und Nordwestafrikas. Kosmos. We are grateful to Edmund Weiss for Estók P. 2007. Nimfadenevér Myotis alcathoe von Helversen and Heller, help with the field work, taking all 2001. In: Bihari Z., Csorba G. and Hel- skull measurements and producing the tai M. (eds), Magyország emlöseinek figures, Franz Boroviczény for transla- atlasza. Kossuth Kiadó, Budapest, 107- tion from Hungarian, Simon Engelber- 108. ger for help with finding literature and Gauckler A. and Kraus M. 1970. Kennzei-

11 Spitzenberger et al.

chen und Verbreitung von Myotis Evolution, 53: 1247-1258. brandti (Eversmann, 1845). Z. f. Säu- Ruedi M. and Castella V. 2003. Genetic getierkunde, 35: 113-124. consequences of the ice ages on nurs- von Helversen O. 2001. Myotis alcathoe eries of the bat Myotis myotis: a mito- von Helversen und Heller, 2001 - chondrial and nuclear survey. Molecu- Nymphenfledermaus. In: Krapp F. lar Ecology, 12: 1527-1540. (ed.), Handbuch der Säugetiere Euro- Ruedi M., Jourde Ph., Giosa P., Barataud pas. 4/II. Aula Verlag, Wiebelsheim, M. and Roué S. 2002. DNA reveals the 1158-1167. existence of Myotis alcathoe in France von Helversen O., Heller K., Mayer F., (Chiroptera, Vespertilionidae). Rev. Nemeth A., Volleth M. and Gombkötö Suisse Zool., 109: 643-652. P. 2001. Cryptic mammalian species: a Ruedi M. and Mayer F. 2001. Molecular new species of whiskered bat (Myotis Systematics of Bats of the genus alcathoe n. sp.) in Europe. Naturwis- Myotis (Vespertilionidae) suggests de- senschaften, 88: 217-223. terministic ecomorphological conver- Mayer, F. and von Helversen, O. 2001. gences. Molec. Phylogenetics and Evo- Cryptic diversity in European bats. lution, 21: 436-448. Proc. R. Soc. Lond. B: 1825-1832. Sauerbier W., Schorcht W. and Hörning L. Morris P. 1972. A review of mammalian 2006. Nymphen am Kyffhäuser. Beitr. age determination methods. Mammal z. Kyffhäuserlandschaft, 20: 58-61. review, 2: 69-104. Stadelmann B., Jacobs D., Schoeman C. Niermann I., Biedermann M., Bogda- and Ruedi M. 2004. Phylogeny of Af- nowicz W., Brinkmann R., Le Bris Y., rican Myotis bats (Chiroptera, Vesper- Ciechanowski M., Dietz M., Dietz Ch., tilionidae) inferred from cytochrome b Estók P., von Helversen O., le sequences. Acta Chiropterologica, 6: Houédec A., Paksuz S., Petrov B., Öz- 177-192. kan B., Piksa K., Rachwald A., Roué Stadelmann B., Lin L.-K., Kunz T. and S., Sachanowicz K., Schorcht W., Ruedi M. 2007. Molecular phylogeny Tereba A. and Mayer F. 2007. Bio- of New World Myotis (Chiroptera, geography of the recently described Vespertilionidae) inferred from mito- Myotis alcathoe von Helversen and chondrial and nuclear DNA genes. Heller, 2001. Acta Chiropterologica, Molecular phylogenetics and evolu- 9: 361-378. tion, 43: 32-48. Petit E., Excoffier L. and Mayer F. 1999. Volleth M. 1987. Differences in the loca- No evidence for the bottleneck in the tion of nucleolus organizer regions in postglacial recolonization of Europe European vespertilionid bats. Cytoge- by the noctule bat (Nyctalus noctula). net Cell Genet, 44: 186-197.