On the Occurrence of Myotis Alcathoe Von Helversen and Heller, 2001 in Austria
Total Page：16
File Type：pdf, Size：1020Kb
Hystrix It. J. Mamm. (n.s.) 19 (1) (2008): 3-12 ON THE OCCURRENCE OF MYOTIS ALCATHOE VON HELVERSEN AND HELLER, 2001 IN AUSTRIA 1* 2 2 FRIEDERIKE SPITZENBERGER , IGOR PAVLINIĆ , MARTINA PODNAR 1Natural History Museum, Mammal Department, Burgring 7, 1010 Vienna, Austria *Corresponding author, e-mail: [email protected] 2Croatian Natural History Museum, Zoological Department, Demetrova 1, 10000 Zagreb, Croatia; e-mail: [email protected]; [email protected] Received 25 March 2008; accepted 30 May 2008 ABSTRACT - In 2006, two males and one female of Myotis alcathoe were captured by mistnets at two localities in southern Burgenland, Austria. For two individuals the prelimi- nary specific identification based on external measurements was confirmed by sequencing parts of the mitochondrial ND1 gene. Across the sequenced region, the two analysed bats share a 100% identical haplotype that corresponds to the haplotype found in Hungarian bats identified as M. alcathoe, and was found also in Spanish, French and Slovakian samples. The three animals from Burgenland constitute the first records of this species in Austria. Age related differences in pelage and membrane coloration and measurements of M. al- cathoe are described. A comparison of skull length measurements between M. alcathoe and Myotis mystacinus seems to indicate that the interspecific difference in external dimensions is not reflected in skull dimensions. The Austrian localities of M. alcathoe belong to the Pannonian part of the range, as do findings from Slovakia and Hungary. Key words: M. alcathoe, Myotis mystacinus, Austria, species recognition, habitat, abun- dance RIASSUNTO – Sulla presenza di Myotis alcathoe von Helversen and Heller, 2001 in Austria. Nel 2006, due maschi e una femmina di Myotis alcathoe sono stati catturati tramite mist-nets in due località del Burgenland meridionale, Austria. Per due individui, l’identificazione preliminare su basi morfologiche è stata confermata dall’analisi del gene mitocondriale ND1. Nella sequenza analizzata, gli aplotipi dei due individui coincidono al 100% e corrispondono a quelli evidenziati in soggetti spagnoli, francesi e sloveni. I tre e- semplari del Burgenland rappresentano la prima segnalazione certa di questa specie per l’Austria. Vengono descritte alcune differenze nella colorazione della pelliccia e del patagio tra adulti e subadulti. Il confronto delle misure del cranio di M. alcathoe e M. mystacinus sembra non corrispondere alle differenze riscontrate per le dimensioni corporee esterne. Le località di rinvenimento appartengono, insieme a quelle slovene e ungheresi, al sub-areale pannonico della specie. Parole chiave: M. alcathoe, Myotis mystacinus, Austria, identificazione, habitat, abbondan- za 3 Spitzenberger et al. INTRODUCTION tioned by the describers of M. alcathoe were on average smaller body size than The whiskered bat M. mystacinus in M. mystacinus, and proportions of (Kuhl, 1817) is widespread and com- ear and tragus. According to Benda and mon in large parts of Europe. It was Karataş (2005), cranial and dental regarded as one single species until characters do not allow differentiation careful analyses of morphology, karyo- of M. alcathoe from M. mystacinus. logy and mitochondrial DNA sequen- The assessment of the range of M. al- ces revealed that it consisted of four cathoe, recently summarised by Nier- species (Gauckler and Kraus, 1970; mann et al. (2007), was based entirely Volleth, 1987; Mayer and von Hel- on captured bats whose specific iden- versen, 2001; Ruedi and Mayer, 2001). tity was determined either by using ex- A number of molecular studies (Ruedi ternal characters in the field only or by and Mayer, 2001; Stadelmann et al., an additional genetic analysis. Until 2004, 2007) provided evidence that M. now, no specimen of M. alcathoe has mystacinus, M. brandtii and M. al- been found in museum collections. cathoe belong to highly divergent and Nevertheless, information on range and not closely related genetic clades and ecology of this recently described spe- are the products of adaptive convergent cies is growing fast. The present paper evolution. The fourth species, Myotis reports on the first records of M. al- aurascens, can be differentiated from cathoe in Austria, including informa- the other European members of the tion on species recognition and a hy- “Myotis mystacinus-morphogroup” (sen- pothesis concerning its phylogeogra- su Benda and Karataş, 2005) by karyo- phy. type, skull size and dental and bacular characters (Benda and Tsytsulina, STUDY AREA 2000; Ruedi et al., 2002), but mito- chondrial DNA differences are within The study area, “Hills and terraces of Southern Burgenland”, is situated in the the range of intraspecific variation easternmost province of Austria (Bur- (Mayer and von Helversen, 2001). genland) near the Hungarian border (Fig. Therefore the phylogenetic position of 1). It is an area of approximately 142 km2 M. aurascens has not been assessed up lying between the valleys Pinka and Strem to now. (47° 04’ - 47° 13’ N; 16° 16’ - 16° 27’ E). Myotis alcathoe von Helversen and The Tertiary hill country is of moderate Heller, 2001 was the last species of the elevation descending gradually from 415 m M. mystacinus-morphogroup to be dis- in the north, to 230 m a.s.l. in the southern covered and described. Some differ- part, which forms the transition to the Lesser Hungarian Basin. Two short tribu- ences in the sequence of mitochondrial taries drain southwards to the river Strem. genes and in the pattern of active nu- The climate is characterised by hot sum- cleolus organiser regions have been mers and cold winters, typical for the Pan- reported as unambiguous characters for nonian lowland. The hills and gravel ter- species recognition (von Helversen et races are covered by a large coherent semi- al., 2001). Somatic characters men- natural forest consisting mainly of oak 4 Myotis alcathoe in Austria Figure 1 - Study area with the two sampling sites (dots). (Quercus petraea) and hornbeam (Carpi- Ehrensdorf (district Güssing, province nus betulus). Deciduous forests of the type Burgenland - 47° 06’N/16° 25’ E, altitude Tilio-Acerion grow on the slopes of the 233 m). Being unused, the ponds were al- hills. In valley bottoms, riverine forests most completely covered by reed and sur- (Alno-Padion, Alnion incanae and Salicion rounded by riverine and deciduous forest albae) alternate with wet meadows. The vegetation. Apart from one Pipistrellus study area is regionally protected and is pygmaeus and nine Myotis daubentonii we also a site of community interest (“SCI”) captured one male of the M. mystacinus- under the EU habitats directive. morphogroup which we preliminarily iden- tified as M. alcathoe and collected for fur- METHODS ther examination (permit nr. 5-N- A1007/270-2006, 07.02.2006, Amt der 1. Sampling Burgenländischen Landesregierung). It is now deposited in the Mammal Collection On 19 August 2006, we set mistnets next to of the Natural History Museum Vienna two large fishponds east of Deutsch (NMW 66186). 5 Spitzenberger et al. In mistnets set around a small fishpond 30 s at 50oC and 90 s at 72oC and a final located 1.2 km NE of Punitz (district extension step of 7 min at 72oC. Güssing, province Burgenland, 47 07’ For reamplification reactions the annealing N/16° 21’ E, altitude 248 m) we captured temperature was increased to 51oC. three specimens belonging to the M. Sequencing was carried out by Sequencing mystacinus-morphogroup on 22 August Service Ruđer Bošković Institute (Zagreb) 2006. While one of two females belonged using oligonucleotides ER70 for the speci- clearly to M. mystacinus (forearm 34.5 men NMW 66185 and H-Myot-637ND1 mm), the other female and the male had for NMW 66186 as sequencing primers. A shorter forearms (31.8 and 32.0 mm respec- BLAST search (Altschul et al., 1990) was tively) and distinctly smaller thumbs and performed in order to determine the most feet. The female was sampled (NMW similar sequences available in the Gen- 66185) to confirm its supposed identifica- Bank. tion as M. alcathoe. This fishpond is lo- cated in a mown meadow near to a road 3. Morphological analysis and is surrounded by a young forest planta- tion consisting mainly of spruce (Picea With the exception of the forearm length, abies) and pine (Pinus sylvestris) which is which was measured in the field, external intersected by no less than five forest roads. measurements (length of head and body, Nearby is a small dry valley lined by a nar- tail, hind foot and ear) were taken from the row row of Alnus incana and Salix sp. collected animals preserved in ethanol. Sixteen skull measurements were taken with dial callipers accurate to 0.01 mm. For 2. Genetic analysis comparison we used 180 subadult (young of the year) and adult specimens of the M. Total genomic DNA was extracted using mystacinus-morphogroup from Austria DNeasy Tissue Kit by QIAgen GmbH from housed in the mammal collection of the muscle tissue of the two ethanol preserved Natural History Museum in Vienna (NMW) museum specimens. The part of the mito- which were determined as M. mystacinus. chondrial NADH dehydrogenase subunit 1 All skull measurements were taken by the gene (ND1) was amplified via polymerase same person, Edmund Weiss. The abbre- chain reaction (PCR) using specific primer viations used are: pairs ER65 (Petit et al., 1999, Mayer and Bb – braincase breadth; Bh – braincase von Helversen 2001) and HMyot-637ND1 height; Cbl – condylobasal length; C-C – (5' - GGTCCTCCTGCATATTCTAC - 3') anterior palatal breadth; Ccl – condylo- and then re-amplified using ER70 (Petit et canine length; C-M3 – length of lower al., 1999; Mayer and von Helversen 2001) toothrow between canine and third molar; and HMyot-637ND1 primers. Amplifica- C-M3 – length of upper toothrow from ca- tions were performed in the 50 µl reaction nine to third molar; Corh – height of mixtures on a Perkin Elmer GeneAmp coronoid process; Ear – length of ear; FA – 2400 Thermocycler using the MasterTaq length of forearm; GrSl – greatest skull Kit (Eppendorf) according to the instruc- length; HBl – head and body length; HF – tions of the manufacturer.