DOCSLIB.ORG

Characterization of a Small Heat Shock Protein B3 (Hspb3)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of a Small Heat Shock Protein B3 (Hspb3) CHARACTERIZATION OF A SMALL HEAT SHOCK PROTEIN B3 (HSPB3) BY WING-HOI TAM A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENT FOR THE DEGREE OF MASTER OF PHILOSOPHY IN BIOCHEMISTRY Department of Biochemistry ©The Chinese University of Hong Kong SEP 2000 The Chinese University of Hong Kong holds the copyright of this thesis. Any person(s) intending to use a part or whole of the materials in the thesis in a proposed publication must seek copyright release from the Dean of the Graduate School. I M /y统系馆書圖i；^、 ： IQT 湖• )ii ii ~wisiiY~~I ^>4i^BRARY SYSTEM I I I '1 i i Acknowledgement Thanks to Professor Mary Waye for her guidance and inspirations, to Dr. KK Chan for his technical advice, to friends in MMW 610 and those in BMSB 414. I am very grateful for Dr. Y. Sugiyama and A. Suzuki in allowing me to present their findings on HSPB3 at the Eighth SCBA Conference held in Hong Kong August 1999. 2 Contents Title 1 Acknowledgement 2 Contents 3 Abbreviations 5 List of figures 7 List of tables 9 Primers and their sequences used in the projcet 10 Abstract 12 Introduction Small heat shock proteins 16 Human heart sequencing EST project 17 Small heat shock protein B3 (HSPB3) 18 The alpha crystallins 18 Point mutation of a conserved arginine in 19 the alpha-crystallin domain perturbs the overall alpha crystallins structure and function HSP27 Confers thermotolerance in cells 19 Chaperone properties of sHSP 20 In FzYro-chaperone function of sHSPs 21 Does the alpha-crystallin domain necessary 21 for chaperone activity? Expression HSPB3 in heart diseases patients 22 and in porcine model Small heat shock proteins in development 23 and differentiation HSPB3 role in mammalian embryogenesis 24 Structure of the small heat shock proteins 25 Crystal structure of a small heat shock protein 25 Subunit contacts 26 Muscle is the only tissue that simultaneously 26 expresses all five sHSPs Two independent sHSP systems in muscle cells, 27 to serve and to protect Methods and Materials 3 Small scale preparation of plasmid DNA 29 Large scale preparation of plasmid DNA 29 Amplification of mouse and rat HSPB3 coding region 30 Northern Blotting and Hybridisation 31 Purification of DNA fragments by GENECLEAN 31 Preparation of competent Escherichia coif for transformation 32 Transformation of DNA plasmid into 32 competent Escherichia coU 5 ’ Rapid Amplification of cDNA Ends (5，RACE) 3 3 3，Rapid Amplification of cDNA Ends (3，RACE) 3 5 Upstream and Downstream Genomic sequence 36 Isolation of genomic DNA from human tissue 3 7 Multiple tissue cDNA panel (MTC) 3 7 The yeast two hybrid screenings and confirmation 43 Isolation of total RNA from human tissues 43 Automated Sequencing 44 Alignment of DNA and amino acid sequence 44 Radiation hybrid mapping 45 Results Determination of the full length of human HSPB3 46 cDNAby5'and3'RACE Identification of human HSPB3 gene in mouse and 49 rat heart tissues Sequence homology between human, mouse and 51 rat HSPB3 Chromosomal mapping of the HSPB3 gene 60 Expression of human HSPB3 is not confined to 62 the heart and skeletal muscle ： Mouse HSPB3 expression is confined to the heart tissue 65 HSPB3 genomic PGR of downstream sequence 67 HSPB3 upstream genomic sequence 67 No intronic sequences between the open reading frame 68 ； The yeast two hybrid screening 71 HSPB3 can not form dimers 82 Expression of Prepro-CDD-ANF in human adult and fetal 83 Discussions Previously reported sequence HSPL27 is a chimera 87 HSPB3 monomers do not dimerises 88 No intronic sequence in the HSPB3 gene 89 I HSPB3 and CDD-ANF may play an important role 91 I during stress to the heart i Change of expression pattern of Prepro-CDD-ANF 93 during development 1 \ Reference 95 1 ！ 4 i ! Abbreviations Ab antibody ade adenine bp base pair C cytosine cDNA complementary DNA Da dalton DMSO dimethyl sulfoxide DNA deoxyribonucleic acid DTT dithiothreitol EDTA ethylenediaminetetraacetic acid G guanine GAPDH glyceraldehyde-3-phosphate dehydrogenase His histidine HSP heat shock protein HSPB3 heat shock protein B3 HSPL27 heat shock protein-like 27 IcDa IPTG isopropylthiogalactoside kb kilobase k kilo (10') kDa Idlodalton L liter Leu leucine m milli (10"0 M molar (mol/L) [X micro (10"^) jaM micromolar (|,imol/L) jimol micromole ITLL milliliter mm millimeter mM millimolar (mmol/L) mmol millimole mol mole ITLRNA messenger RNA I MW molecular weight I NCBI National Center for Biotechnology Information NMR nuclear magnetic resonance ONPG 0-Nitrophenyl-beta-D-galactopyranoside PAGE polyacrylamide gel electrophoresis PCR polymerase chain reaction i pi isoelectric value PI-4K Phosphatidylinositol-4-Kinase I Pol polymerase I Preppro-CDD-ANP Prepro-cardiodilatin-antrial natriuretic factor RNA ribonucleic acid : rpm revolutions per minute 5 s second SDS sodium dodecyl sulfate sec second Ser serine sHSP small heat shock protein T thymine TEMED N,N,N',N-Tetramethylethylenediamine Trp tryptophan UV ultraviolet 6 i fI:L：, List of figures Figure 1 5' RACE to isolate and deduce the 5' end of the HSPB3 cDNA 48 Figure 2 HSPB3 homologues in mouse, human and rat 50 Figure 3 Alignment of human, mouse and rat HSPB3 cDNA sequence 53 Figure 4 Alignment of human, mouse and rat HSPB3 amino acid sequence 54 Figure 5 Sequence alignment between different members of the 55 mammalian sHSPs Figure 6 Predicted protein secondary structure of human HSPB3 57 Figure 7 Isoelectric value of human, mouse and rat HSPB3 58 Figure 8 Hydrophobicity plot of human, mouse and rat HSPB3 59 Figure 9 PCR screening of HSPB3 genomic sequence 61 Figure 10 Whitehead framework map of Human Chromosome 5 62 showing the position of HSPB3 Figure 11 Detection of HSPB3 in various human adult and fetal 64 tissues by RT-PCR Figure 12 Northern blot analysis of the expression of each sHSP 66 mRNA in various adult mouse tissues Figure 13 Anchor PCR to isolate upstream and downstream 69 Genomic sequence of HSPB3 cDNA Figure 14 Results of the genomic DNA sequences obtained from 70 sequencing the genomic PCR products both upstream and downstream of the HSPB3. Figure 15 Schematic diagram showing the domains encoded by the 76 inserts in the positive clones isolated from yeast two hybrid screening with HSPB3 Figure 16 Liquid ONPG assay on various yeast transformed clones 78 Figure 17 Isolation and verification of the insert in the yeast two 80 hybrid's positive clone 7 i I Figure 18 Small scale transformation to verify the interaction 81 between the small heat shock protein B3 and Prepro-CDD-ANF Figure 19 Northern blot analysis of the Prepro-cardiodilatin-ANF 85 mRNA expression in various adult human tissues Figure 20 Detection of Prepro-CDD-ANP in various human adult and 86 fetal tissues by RT-PCR ！ 8 List of tables Table 1 Yeast transformation efficiency and mating results 65 between the bait pAS2-l/HSBP3 and the cDNA library pGAD424/library Table 2 Identity of positive clones that showed to interact with 67 HSPB3 upon beta-galactosidase assay 9 Primers and their sequences used in the project Human Genome Walker's Primers hGW-5GSPl 5' ATAGCCGTGCCCAGACGCAATCACT 3’ hGW-5GSP2 5' TTAGGCCTGAATCATAGCACGGAAT 3’ hGW-5GSP3 5，TTCGGGAGGCTGAGGCGGGTGGA 3， hGW-5GSP4 5，CACAAAAATTAGCTGGGCATGGTGGCTTAT 3 ’ hGW-3GSPl 5，GATTCTTCCATAGCTGTGGATAAGGAGT 3， hGW-3 GSP2 5，GCCAACTCAGTAGCAGAGCTGTGACAAGAT 3， hGW-3 GSP3 5，CCACTAGCTGCTTCAACTGGTAA 3, hGW-3 GSP4 5，GCAGTGGAAGGTTGGCAGAAGGA 3 ’ Human HSPB3 cDNA primers hHSPB3-F-AS2 5' TAGGGCGAATTCATGGCAAAAATCATTTTGAGGCACCT 3’ hHSPB3-R 5，TAGGGCGTCGACTCACTTAGTCCCAACTGGATCCTTTA 3 ’ Human HSPB3 full length cDNA primers hHSPB3 -FL-For 5，TAGGGCGAATTCGCATTCCGTGCTATGATTCAGGCCTAA 3 ’ hHSPB3-FL-Rev 5' TAGGGCGTCGACTAACTGTGTATATATTTTTATTCT 3， Mouse HSPB3 5' and 3，RACE primary and nested primers mHSPB3-5GSPl 5，CCCCACCAGGATGGAAAATCTTGAGACA 3’ mHSPB3”5GSP2 5' CCCAGCATGTGCCCTTGAATCAAGCAAC 3’ mHSPB3-3GSPl 5' CTGTAAACGGCGCTGCTAGGACTAAGAA 3’ niHSPB3-3GSP2 5' AGTTTCCTGTCCCGAGTGGTCATTGTCT 3’ Mouse HSPB3 Ms-HSPB3-For 5' TAGGGCGAATTCATGGCAAAAATCATTTTGAGGCACCTCATA 3' Ms-HSPB3-Rev 5' TAGGGCGTCGACTCACTTAGTCCCAACTGGATCCTTTA 3’ Rat-HSPB3 rHSPB3-For 5，TAGGGCGAATTCATGGCAAAAATCATTTTGAGGCACCT 3， rHSPB3-Rev 5' TAGGGCGTCGACTCACTTGGTCTCTAATGGATCCTTTACTT 3’ 10 Human HSPB3 5' primers 5RACE-GSP1 5，TTTCCTCAGGTCCACGATGGTTGGC 3 ’ 5RACE-GSP2 5，TCAGGTCCACGATGGTTGGCCCAG 3, 5RACE-GSP3 5，GCATATAAAGCATGATCCAGCCTGC 3, 5RACE-GSP4 5，CGCACTGGAATCTCTATGAGGTGCC 3 ’ Abridged Anchor Primer 5' GGCCACGCGTCGACTAGTACGGGnGGOnGGGnG 3‘ Universal Adaptor Primer 5’ CUACUACUACUAGGCCACGCGTCGACTAGTAC 3， Adaptor Primer 5，GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT 3， MATCHMAKER 5' LD-Insert Screening Amplimer 5，GATAAGCTACTACTTCTATGGGGTGGTTTGGG 3 ‘ MATCHMAKER 3' LD-Insert Screening Amplimer 5, TTCACTTGAACGCCCCAAAAAGTCATATGATGC 3， 11 Abstract Numerous physical and chemical stimuli were shown to cause stress response in all organisms. This evolutionary highly conserved stress response involves shutting off the general transcription and activating the transcription of select set of genes coding for the heat shock proteins (HSPs) or stress proteins. Small heat shock proteins arose from a primordial gene and have a conserved 3' exon structure called the alpha crystallin domain. Members of this family have molecular masses below 40 IdDa. Research has focused mainly on two of its members, the alpha-B-crystallin and HSP27. Both are widely expressed in a number of tissues including muscles, liver, kidney and lens and have been implicated to play protective roles during cellular stress. On the other hand, the functional role, molecular and physical characteristics of the newly discovered member HSPB3 is less studied. In vivo studies demonstrated the upregulation of some sHSPs (HSP27 and alpha-B-crystallin) mRNA during physiological stress (for example, heat shock and cell stretch)，while others, including p20, HSPB2/MI-CBP and HSPB3 showed no significant heat inducibility in C2C12 cells under severe conditions. Immunostaining and binding assays suggested the possibility that in skeletal muscle there are two independent heat shock systems, comprising members of the small heat shock proteins. In this study, we first deduced the cDNA sequence of a new member of the mammalian small heat shock protein, small heat shock protein B3 (HSPB3).
Load more

Recommended publications
  • Proteomic and Metabolomic Analyses of Mitochondrial Complex I-Deficient
    THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 24, pp. 20652–20663, June 8, 2012 © 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Proteomic and Metabolomic Analyses of Mitochondrial Complex I-deficient Mouse Model Generated by Spontaneous B2 Short Interspersed Nuclear Element (SINE) Insertion into NADH Dehydrogenase (Ubiquinone) Fe-S Protein 4 (Ndufs4) Gene*□S Received for publication, November 25, 2011, and in revised form, April 5, 2012 Published, JBC Papers in Press, April 25, 2012, DOI 10.1074/jbc.M111.327601 Dillon W. Leong,a1 Jasper C. Komen,b1 Chelsee A. Hewitt,a Estelle Arnaud,c Matthew McKenzie,d Belinda Phipson,e Melanie Bahlo,e,f Adrienne Laskowski,b Sarah A. Kinkel,a,g,h Gayle M. Davey,g William R. Heath,g Anne K. Voss,a,h René P. Zahedi,i James J. Pitt,j Roman Chrast,c Albert Sickmann,i,k Michael T. Ryan,l Gordon K. Smyth,e,f,h b2 a,h,m,n3 David R. Thorburn, and Hamish S. Scott Downloaded from From the aMolecular Medicine Division, gImmunology Division, and eBioinformatics Division, Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria 3052, Australia, the bMurdoch Childrens Research Institute, Royal Children’s Hospital and Department of Paediatrics, University of Melbourne, Parkville, Victoria 3052, Australia, the cDépartement de Génétique Médicale, Université de Lausanne, 1005 Lausanne, Switzerland, the dCentre for Reproduction and Development, Monash Institute of Medical Research, Clayton, Victoria 3168, Australia, the hDepartment of Medical Biology
    [Show full text]
  • Consequences of Disease-Causing Small Heat Shock Protein Mutations on ARE-Mediated
    Consequences of disease-causing small heat shock protein mutations on ARE-mediated mRNA decay Senior Honors Thesis By Nicole Naiman Undergraduate Biomedical Science Major School of Allied Medical Professions The Ohio State University 2011 Choose an item. Committee: Dr. Stephen Kolb, M.D., Ph.D, Advisor Dr. Daniel Battle, Ph.D. Dr. Margaret Teaford, Ph.D. Copyright by Nicole Naiman 2011 ii Abstract Motor neuron diseases (MNDs) are neurodegenerative diseases that involve loss of motor neurons in the brain and spinal cord. MNDs are debilitating and often fatal. Distal hereditary motor neuropathies (dHMNs) are a category of MND characterized by progressive, distal weakness without loss of sensation. The primary focus of our laboratory is to understand the functional consequences of mutations in small heat shock proteins (sHSPs) that result in dHMN. sHSPs comprise a family of 10 homologous proteins that are characterized by a central alpha-crystallin domain, are expressed ubiquitously, serve neuroprotective functions, and are upregulated by cell stress. To date, mutations in three sHSPs: HSPB1, HSPB3 and HSPB8, have been associated with dHMN. These mutations include HSPB1(R136W) and HSPB3(R7S). We propose that mutations reported in these proteins affect the same cellular pathway because they all lead to the same clinical phenotype and loss of motor neurons. HSPB1 is the best characterized sHSP and is required for AU-rich element (ARE)-dependent mRNA decay. AREs are adenosine and uridine rich regions that are present in the 3’ untranslated region of a subset of mRNAs that signal for their rapid decay. We hypothesize that dHMN-associated mutations result in dysregulation of this critical mRNA decay pathway, and that mutations in HSPB1 and in HSPB3 result in an increased half-life of ARE-containing mRNAs.
    [Show full text]
  • Burden of Rare Variants in ALS and Axonal Hereditary Neuropathy Genes Influence Survival In
    International Journal of Molecular Sciences Article Burden of Rare Variants in ALS and Axonal Hereditary Neuropathy Genes Influence Survival in ALS: Insights from a Next Generation Sequencing Study of an Italian ALS Cohort Stefania Scarlino 1, Teuta Domi 1, Laura Pozzi 1 , Alessandro Romano 1, Giovanni Battista Pipitone 2, Yuri Matteo Falzone 1,3, Lorena Mosca 4, Silvana Penco 4, Christian Lunetta 5, Valeria Sansone 5,6, Lucio Tremolizzo 7, Raffaella Fazio 3, Federica Agosta 8, 3,8,9,10 2 1,3, , 1, Massimo Filippi , Paola Carrera , Nilo Riva * y and Angelo Quattrini y 1 Experimental Neuropathology Unit, Institute of Experimental Neurology (INSPE), Division of Neuroscience, San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] (S.S.); [email protected] (T.D.); [email protected] (L.P.); [email protected] (A.R.); [email protected] (Y.M.F.); [email protected] (A.Q.) 2 Laboratory of Clinical Molecular Biology, Unit of Genomics for Human Disease Diagnosis, Division of Genetics and Cell Biology, San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] (G.B.P.); [email protected] (P.C.) 3 Neurology Unit, San Raffaele Scientific Institute, 20132 Milan, Italy; fazio.raff[email protected] (R.F.); fi[email protected] (M.F.) 4 Medical Genetic Unit, Department of Laboratory Medicine, Niguarda Hospital, 20132 Milan, Italy; [email protected] (L.M.); [email protected] (S.P.) 5 NEuroMuscular Omnicentre (NEMO), Fondazione Serena Onlus, Milan 20132, Italy; [email protected]
    [Show full text]
  • High Resolution Physical and Comparative Maps of Horse
    HIGH RESOLUTION PHYSICAL AND COMPARATIVE MAPS OF HORSE CHROMOSOMES 14 (ECA14) AND 21 (ECA21) A Thesis by GLENDA GOH Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 2005 Major Subject: Genetics HIGH RESOLUTION PHYSICAL AND COMPARATIVE MAPS OF HORSE CHROMOSOMES 14 (ECA14) AND 21 (ECA21) A Thesis by GLENDA GOH Submitted to Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: _________________________ _________________________ Bhanu P. Chowdhary Loren C. Skow (Chair of Committee) (Member) _________________________ _________________________ James N. Derr James E. Womack (Member) (Member) _________________________ _________________________ Geoffrey Kapler Evelyn Tiffany-Castiglioni (Chair of Genetics Faculty) (Head of Department) May 2005 Major Subject: Genetics iii ABSTRACT High Resolution Physical and Comparative Maps of Horse Chromosomes 14 (ECA14) and 21 (ECA21). (May 2005) Glenda Goh, B.S. (Hons.), Flinders University of South Australia Chair of Advisory Committee: Dr. Bhanu P. Chowdhary In order to identify genes or markers responsible for economically important traits in the horse, the development of high resolution gene maps of individual equine chromosomes is essential. We herein report the construction of high resolution physically ordered radiation hybrid (RH) and comparative maps for horse chromosomes 14 and 21 (ECA14 and ECA21). These chromosomes predominantly share correspondence with human chromosome 5 (HSA5), though a small region on the proximal part of ECA21 corresponds to a ~5Mb region from the short arm of HSA19. The map for ECA14 consists of 128 markers (83 Type I and 45 Type II) and spans a total of 1828cR.Compared to this, the map of ECA21 is made up of 90 markers (64 Type I and 26 Type II), that segregate into two linkage groups spanning 278 and 760cR each.
    [Show full text]
  • Autosomal Dominant Late-Onset Spinal Motor Neuronopathy Is Linked to a New Locus on Chromosome 22Q11.2-Q13.2
    European Journal of Human Genetics (2012) 20, 1193–1196 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg SHORT REPORT Autosomal dominant late-onset spinal motor neuronopathy is linked to a new locus on chromosome 22q11.2-q13.2 Sini Penttila¨*,1, Manu Jokela2, Peter Hackman3, Anna Maija Saukkonen4, Jari Toivanen4 and Bjarne Udd1,3,5 Spinal muscular atrophies (SMAs) are hereditary disorders characterized by degeneration of lower motor neurons. Different SMA types are clinically and genetically heterogeneous and many of them show significant phenotypic overlap. We recently described the clinical phenotype of a new disease in two Finnish families with a unique autosomal dominant late-onset lower motor neuronopathy. The studied families did not show linkage to any known locus of hereditary motor neuron disease and thus seemed to represent a new disease entity. For this study, we recruited two more family members and performed a more thorough genome-wide scan. We obtained significant linkage on chromosome 22q, maximum LOD score being 3.43 at marker D22S315. The linked area is defined by flanking markers D22S686 and D22S276, comprising 18.9 Mb. The region harbours 402 genes, none of which is previously known to be associated with SMAs. This study confirms that the disease in these two families is a genetically distinct entity and also provides evidence for a founder mutation segregating in both pedigrees. European Journal of Human Genetics (2012) 20, 1193–1196; doi:10.1038/ejhg.2012.76; published online 25 April 2012 Keywords: motor neuron disease; spinal muscular atrophy; linkage analysis INTRODUCTION LMNA16 and TRPV417 or to be linked to 3q13.118 or 14q32.19 Spinal muscular atrophies (SMAs) are hereditary disorders character- Mutations in many of these genes cause several allelic disorders.
    [Show full text]
  • Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis
    Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis Ugo Ala1., Rosario Michael Piro1., Elena Grassi1, Christian Damasco1, Lorenzo Silengo1, Martin Oti2, Paolo Provero1*, Ferdinando Di Cunto1* 1 Molecular Biotechnology Center, Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy, 2 Department of Human Genetics and Centre for Molecular and Biomolecular Informatics, University Medical Centre Nijmegen, Nijmegen, The Netherlands Abstract Background: Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings: We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion: Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. Citation: Ala U, Piro RM, Grassi E, Damasco C, Silengo L, et al.
    [Show full text]
  • Double Homeobox 4 Activates Germline Genes, Endogenous Retroelements and Immune Modulators: Implications for Facioscapulohumeral Muscular Dystrophy
    Double homeobox 4 activates germline genes, endogenous retroelements and immune modulators: Implications for facioscapulohumeral muscular dystrophy Linda N. Geng A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2011 Stephen J. Tapscott, Chair Edith H. Wang Muneesh Tewari Program Authorized to Offer Degree: Molecular and Cellular Biology University of Washington Abstract Double homeobox 4 activates germline genes, endogenous retroelements and immune modulators: Implications for facioscapulohumeral muscular dystrophy Linda N. Geng Chair of Supervisory Committee: Professor Stephen J. Tapscott Department of Neurology Double homeobox 4 (DUX4) is a candidate disease gene for causing facioscapulohumeral dystrophy (FSHD), a condition characterized by progressive degeneration of specific skeletal muscle groups. While the genetic lesion associated with the disease has been known for decades, the molecular mechanism(s) leading to muscular dystrophy remained unclear. DUX4 was detected in FSHD muscle, but the abundance was extremely low and the downstream consequence of DUX4 in human muscle cells was not known. This work demonstrates that the low level of DUX4 expression in a population of FSHD muscle cells represents a relatively high expression of DUX4 mRNA and protein in a subset of cells at any given point in time. While the full length DUX4 induces toxicity in muscle cells, the shorter isoform without the C-terminal end, DUX4-s, exhibited no obvious detrimental effects on muscle cells. Genome-wide binding studies revealed that DUX4 protein binds to a DNA target sequence that contains two closely-spaced canonical homeodomain binding sequences TAAT in tandem. These binding sites are present in both unique regions of the genome as well as within LTRs of a family of endogenous retrotransposons called MaLR.
    [Show full text]
  • Transcriptome Profiling Reveals the Complexity of Pirfenidone Effects in IPF
    ERJ Express. Published on August 30, 2018 as doi: 10.1183/13993003.00564-2018 Early View Original article Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska, Anna Gungl, Jochen Wilhelm, Leigh M. Marsh, Helene Thekkekara Puthenparampil, Katharina Sinn, Miroslava Didiasova, Walter Klepetko, Djuro Kosanovic, Ralph T. Schermuly, Lukasz Wujak, Benjamin Weiss, Liliana Schaefer, Marc Schneider, Michael Kreuter, Andrea Olschewski, Werner Seeger, Horst Olschewski, Malgorzata Wygrecka Please cite this article as: Kwapiszewska G, Gungl A, Wilhelm J, et al. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF. Eur Respir J 2018; in press (https://doi.org/10.1183/13993003.00564-2018). This manuscript has recently been accepted for publication in the European Respiratory Journal. It is published here in its accepted form prior to copyediting and typesetting by our production team. After these production processes are complete and the authors have approved the resulting proofs, the article will move to the latest issue of the ERJ online. Copyright ©ERS 2018 Copyright 2018 by the European Respiratory Society. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska1,2, Anna Gungl2, Jochen Wilhelm3†, Leigh M. Marsh1, Helene Thekkekara Puthenparampil1, Katharina Sinn4, Miroslava Didiasova5, Walter Klepetko4, Djuro Kosanovic3, Ralph T. Schermuly3†, Lukasz Wujak5, Benjamin Weiss6, Liliana Schaefer7, Marc Schneider8†, Michael Kreuter8†, Andrea Olschewski1,
    [Show full text]
  • A Yeast-Based Model for Hereditary Motor and Sensory Neuropathies: a Simple System for Complex, Heterogeneous Diseases
    International Journal of Molecular Sciences Review A Yeast-Based Model for Hereditary Motor and Sensory Neuropathies: A Simple System for Complex, Heterogeneous Diseases Weronika Rzepnikowska 1, Joanna Kaminska 2 , Dagmara Kabzi ´nska 1 , Katarzyna Bini˛eda 1 and Andrzej Kocha ´nski 1,* 1 Neuromuscular Unit, Mossakowski Medical Research Centre Polish Academy of Sciences, 02-106 Warsaw, Poland; [email protected] (W.R.); [email protected] (D.K.); [email protected] (K.B.) 2 Institute of Biochemistry and Biophysics Polish Academy of Sciences, 02-106 Warsaw, Poland; [email protected] * Correspondence: [email protected] Received: 19 May 2020; Accepted: 15 June 2020; Published: 16 June 2020 Abstract: Charcot–Marie–Tooth (CMT) disease encompasses a group of rare disorders that are characterized by similar clinical manifestations and a high genetic heterogeneity. Such excessive diversity presents many problems. Firstly, it makes a proper genetic diagnosis much more difficult and, even when using the most advanced tools, does not guarantee that the cause of the disease will be revealed. Secondly, the molecular mechanisms underlying the observed symptoms are extremely diverse and are probably different for most of the disease subtypes. Finally, there is no possibility of finding one efficient cure for all, or even the majority of CMT diseases. Every subtype of CMT needs an individual approach backed up by its own research field. Thus, it is little surprise that our knowledge of CMT disease as a whole is selective and therapeutic approaches are limited. There is an urgent need to develop new CMT models to fill the gaps.
    [Show full text]
  • Gnomad Lof Supplement
    1 gnomAD supplement gnomAD supplement 1 Data processing 4 Alignment and read processing 4 Variant Calling 4 Coverage information 5 Data processing 5 Sample QC 7 Hard filters 7 Supplementary Table 1 | Sample counts before and after hard and release filters 8 Supplementary Table 2 | Counts by data type and hard filter 9 Platform imputation for exomes 9 Supplementary Table 3 | Exome platform assignments 10 Supplementary Table 4 | Confusion matrix for exome samples with Known platform labels 11 Relatedness filters 11 Supplementary Table 5 | Pair counts by degree of relatedness 12 Supplementary Table 6 | Sample counts by relatedness status 13 Population and subpopulation inference 13 Supplementary Figure 1 | Continental ancestry principal components. 14 Supplementary Table 7 | Population and subpopulation counts 16 Population- and platform-specific filters 16 Supplementary Table 8 | Summary of outliers per population and platform grouping 17 Finalizing samples in the gnomAD v2.1 release 18 Supplementary Table 9 | Sample counts by filtering stage 18 Supplementary Table 10 | Sample counts for genomes and exomes in gnomAD subsets 19 Variant QC 20 Hard filters 20 Random Forest model 20 Features 21 Supplementary Table 11 | Features used in final random forest model 21 Training 22 Supplementary Table 12 | Random forest training examples 22 Evaluation and threshold selection 22 Final variant counts 24 Supplementary Table 13 | Variant counts by filtering status 25 Comparison of whole-exome and whole-genome coverage in coding regions 25 Variant annotation 30 Frequency and context annotation 30 2 Functional annotation 31 Supplementary Table 14 | Variants observed by category in 125,748 exomes 32 Supplementary Figure 5 | Percent observed by methylation.
    [Show full text]
  • Systematic Detection of Brain Protein-Coding Genes Under Positive Selection During Primate Evolution and Their Roles in Cognition
    Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Title: Systematic detection of brain protein-coding genes under positive selection during primate evolution and their roles in cognition Short title: Evolution of brain protein-coding genes in humans Guillaume Dumasa,b, Simon Malesysa, and Thomas Bourgerona a Human Genetics and Cognitive Functions, Institut Pasteur, UMR3571 CNRS, Université de Paris, Paris, (75015) France b Department of Psychiatry, Université de Montreal, CHU Ste Justine Hospital, Montreal, QC, Canada. Corresponding author: Guillaume Dumas Human Genetics and Cognitive Functions Institut Pasteur 75015 Paris, France Phone: +33 6 28 25 56 65 [email protected] Dumas, Malesys, and Bourgeron 1 of 40 Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The human brain differs from that of other primates, but the genetic basis of these differences remains unclear. We investigated the evolutionary pressures acting on almost all human protein-coding genes (N=11,667; 1:1 orthologs in primates) based on their divergence from those of early hominins, such as Neanderthals, and non-human primates. We confirm that genes encoding brain-related proteins are among the most strongly conserved protein-coding genes in the human genome. Combining our evolutionary pressure metrics for the protein- coding genome with recent datasets, we found that this conservation applied to genes functionally associated with the synapse and expressed in brain structures such as the prefrontal cortex and the cerebellum. Conversely, several genes presenting signatures commonly associated with positive selection appear as causing brain diseases or conditions, such as micro/macrocephaly, Joubert syndrome, dyslexia, and autism.
    [Show full text]
  • Junl;G.~~ Assistant Professor Department of Mechanical Engineering Rice University
    RICE UNIVERSITY Novel Exogenous Agents for Improving Articular Cartilage Tissue Engineering by Donald Joseph Responte A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE Doctor of Philosophy APPROVED, THESIS COMMITTEE: Kyriacos thanas u, PH. ., Thesis Director Distinguis ed Professor Department of Biomedical Engineering University of California, Davis Antonios Mikos, Ph.D., Committee Chair Louis Calder Professor Department of Bioengineering Rice University Junl;G.~~ Assistant Professor Department of Mechanical Engineering Rice University HOUSTON, TEXAS OCTOBER 2011 ii ABSTRACT Novel Exogenous Agents for Improving Articular Cartilage Tissue Engineering by Donald Joseph Responte This thesis demonstrated the effects of exogenous stimuli on engineered articular cartilage constructs and elucidated mechanisms underlying the responses to these agents. In particular, a series of studies detailed the effects of chondroitinase-ABC (C-ABC), hyaluronic acid (HA), and TGF-~1 on the biochemical and biomechanical properties of self-assembled articular cartilage. Work with C-ABC showed that this catabolic agent can be employed to improve the tensile properties of constructs. When constructs were cultured for 6 weeks, treating with C-ABC at 2 weeks enhanced the tensile stiffness. Furthermore, treating at 2 and 4 weeks synergistically increased tensile properties and allowed compressive stiffness to recover to control levels. Another study showed that combining C-ABC and TGF-~1 synergistically enhanced the biochemical and biomechanical properties of neotissue. Microarray analysis demonstrated that TGF-~1 increased MAPK signaling in self-assembled neocartilage whereas C­ ABC had minimal effects on gene expression. SEM analysis showed that C-ABC increased collagen fibril diameter and fibril density, indicating that C-ABC potentially acts via a biophysical mechanism.
    [Show full text]