ORIGINAL ARTICLE Amplification at 7Q22 Targets Cyclin-Dependent Kinase 6 in T-Cell Lymphoma

Ampliﬁcation at 7q22 targets cyclin-dependent kinase 6 in T-cell lymphoma

S Nagel1, E Leich2, H Quentmeier1, C Meyer1, M Kaufmann1, HG Drexler1, A Zettl2, A Rosenwald2 and RAF MacLeod1

1Department of Human and Animal Cell Cultures, DSMZ, Braunschweig, Germany and 2Institute of Pathology, University of Wu¨rzburg, Wu¨rzburg, Germany

Recurrent chromosomal aberrations in hematopoietic tumors Organization, T-cell lymphomas include anaplastic large-cell target genes involved in pathogenesis. Their identification and lymphoma (ALCL) and peripheral T-cell lymphoma, not other- functional characterization are therefore important for the wise specified (PTCL NOS).4 ALCL is rareFrepresenting roughly establishment of rational therapies. Here, we investigated F genomic amplification at 7q22 in the T-cell lymphoma cell line 3% of all lymphomas and the clinical course differs signifi- SU-DHL-1 belonging to the subtype of anaplastic large-cell cantly between ALK-positive (ALK þ ) and ALK-negative (ALKÀ) lymphoma (ALCL). Cytogenetic analysis mapped this amplicon ALCL patients.3 The main chromosomal rearrangement in ALCL, to 86–95 Mb. Copy-number determination quantified the ampli- t(2;5)(p23;q35), fuses NPM1 to ALK, which generates a fication level at 5- to 6-fold. Expression analysis of genes constitutively active kinase-enhancing proliferation.5,6 Genes located within this region identified cyclin-dependent kinase 6 dysregulated by non-chromosomal mechanisms in ALCL cells (CDK6) as a potential amplification target. In comparison with control cell lines, SU-DHL-1 expressed considerably higher include CCND3 and CDKN1B coding for cyclin D3 and p27, levels of CDK6. Functionally, SU-DHL-1 cells exhibited reduced respectively, both key cell cycle regulators, highlighting the sensitivity to rapamycin treatment, as indicated by cell growth proliferative aspect of this disease.7,8 PTCL NOS is predomi- and cell cycle analysis. Rapamycin reportedly inhibits degrada- nantly a nodal lymphoma and comprises up to 70% of T-cell tion of the CDK inhibitor p27 with concomitant downregulation lymphomas in western countries.3 Cytogenetic abnormalities of cyclin D3, implying a proliferative advantage for CDK6 are common, although few recurrent aberrations have been overexpression. Amplification of the CDK6 locus was analyzed 9 in primary T-cell lymphoma samples and, while detected described. infrequently in those classified as ALCL (1%), was detected in Cyclin-dependent kinases (CDKs) are key regulators of the cell 23% of peripheral T-cell lymphomas not otherwise specified. cycle. Diverse CDKs are known, namely CDK1–10 in mammals. Taken together, analysis of the 7q22 amplicon identified CDK6 The G1–S phase transition of the cell cycle depends on CDK2, as an important cell cycle regulator in T-cell lymphomas, CDK4 and CDK6, which interact with D-type cyclins and representing a novel potential target for rational therapy. phosphorylate retinoblastoma protein family members.10 CDK Leukemia (2008) 22, 387–392; doi:10.1038/sj.leu.2405028; inhibitors repress the activity of CDKs and encompass INK4 and published online 8 November 2007 11 Keywords: ALCL; PTCL NOS; amplification; CDK6; BRCA1 KIP protein families, which include p27. Here, we describe the analysis of an amplicon in the ALCL- derived cell line SU-DHL-1 located at 7q22. This region is part of a larger amplicon described previously in ALCL cells. The reduced amplicon in SU-DHL-1 allows more focused analysis of Introduction genes located within this region. Accordingly, the aim of this study was the identification and characterization of candidate Recurrent chromosomal translocations and amplifications spe- genes targeted by 7q22 amplification. cifically target oncogenes involved in tumor development and maintenance. This underlines the importance of their characterization for understanding pathomechanisms of cancer develop- Materials and methods ment and uncovering rational targets for therapeutic intervention. Unlike tumor-suppressor genes and oncogenes Cell culture and patient samples targeted for genomic amplification, leukemic oncogenes acti- ALCL-derived cell lines DEL, KARPAS-299, L-82, SR-786, SU- vated by translocation are often developmental and, thus, rarely DHL-1 and SUP-M2, as well as the cell lines HSB-2 and MOLT- involved in solid tumors.1 Gene amplification within chromo- 3 are held at the DSMZ, Braunschweig, Germany somal amplicons, manifesting as ‘double minute’ chromosomes (www.dsmz.de); MAC-2A was provided by M Kadin, Boston, or as ‘homogeneously staining regions’, occurs widely in solid MA, USA. Cell lines were cultured as recommended by tumors where it is believed to facilitate upregulated transcription originators. Rapamycin was obtained from Sigma, Taufkirchen, of selected genes located therein. This phenomenon is less Germany. Patient material was represented by 156 paraffin- widespread in lymphoid and myeloid neoplasia where chromo- embedded tumor samples (43 PTCL NOS, 45 ALK þ ALCL and some translocations affecting gene juxtapositions and fusions, 68 ALKÀ ALCL) from the Institute of Pathology, University of respectively, predominate.2 Wuerzburg, Germany. All tumors were classified according to T-cell lymphomas represent about 12% of the total.3 the World Health Organization criteria. This study was According to the cancer classification of the World Health authorized by the Ethics Committee of the University of Wuerzburg, Germany. Correspondence: Dr S Nagel, Department of Human and Animal Cell Cultures, DSMZ, Inhoffenstrasse 7B, Braunschweig 38124, Germany. E-mail: [email protected] Fluorescence in situ hybridization Received 9 October 2007; accepted 12 October 2007; published Fluorescence in situ hybridization (FISH) analysis was per- online 8 November 2007 formed on metaphases prepared from cell lines as described CDK6 in T-cell lymphoma S Nagel et al 388 previously12 using the following RP11 BAC clones obtained Using a BAC contig for FISH analysis, we determined both the from the Sanger Institute, Cambridge, UK (www.genome.ucs- size (9 Mb) and location (86–95 Mb) of the amplicon (Figure 1b). c.edu): 315P14, 30D21, 371H19, 90H9, 232H24 and 124G15. Our results are consistent with genomic data provided by the Primary patient samples were analyzed by interphase FISH as Sanger Institute (www.sanger.ac.uk/cgi-bin/genetics/CGP/ described previously.13 Briefly, FISH was performed in paraffin- 10kCGHviewer.cgi?dna ¼ SU-DHL-1), which show a sharp loss embedded material in a tissue microarray format. Cases showing of heterozygosity peak and concomitant copy-number gains at a gain/amplification of the CDK6 locus were subsequently B90 Mb. For precise copy-number determination at the 7q22 analyzed on whole paraffin-embedded tissue sections as well. amplicon, we used a PCR-based MLPA assay, which simulta- The following RP11 BAC clones, used as spanning probes to neously analyzed 40 genes, including CDK6 located within the detect the CDK6 locus, were purchased from the German amplicon at 92.1–92.3 Mb. Data indicated a 5- to 6-fold Resource Centre for Genome Research, Berlin, Germany amplification of this gene in SU-DHL-1 (Figure 1c). Additional (www.rzpd.de): 467N23, 332M5 and 514K1. The centromeric data obtained by this assay revealed a threefold amplification of probe cep7 (Abbott, Wiesbaden, Germany) as well as probes BRCA1 which is located at 17q21 (38.5 Mb), in keeping with detecting the region slightly telomeric of the T-cell receptor Sanger Institute SNP-array data, which also show copy number genes TRG (7p14–15) and TRB (7q35) loci were used as increase at 37–50 Mb, i.e. covering 17q21, albeit unaccompa- reference probes.14 For negative controls, CDK6 and cep7 nied by loss of heterozygosity. Furthermore, according to our probes were tested simultaneously in seven paraffin-embedded MPLA analysis, the tumor-suppressor gene CHFR (at 12q24.3), reactive lymph nodes as well as on cells from the cell lines which is reportedly hypermethylated in T-cell lymphoma,17 MOLT-3 and HSB-2. The cell line SU-DHL-1 served as a seems to be deleted in SU-DHL-1 (Figure 1c). positive control.

Reverse transcription-PCR Reverse transcription (RT)-PCR analysis was performed as described previously.15 Oligonucleotides are listed in Table 1 and were purchased from MWG, Martinsried, Germany. Quantitative real-time RT-PCR analysis was performed on an ABI 7500 SDS cycler, using commercial expression assays for CDK6 and TBP (Applied Biosystems, Darmstadt, Germany).

Immunocytology Cytospin preparation and immunodetection were performed as described previously.16 Antibody anti-CDK6 was obtained from Santa Cruz (Heidelberg, Germany).

Flow cytometry Flow cytometry and cell cycle analysis were performed as described previously.16

Multiplex ligation-dependent probe amplification Genomic copy-number determination was performed using a PCR-based multiplex ligation-dependent probe amplification (MLPA) kit, amplifying 40 cancer-related genes, including CDK6 (SALSA MS-MLPA kit ME001 tumor suppressor-1, MRC- Figure 1 (a) Karyotype analysis showing the homogeneously staining Holland, Amsterdam, The Netherlands). The mean amplification region on 7q in SU-DHL-1 cells. (b) Fluorescence in situ hybridization (FISH) analysis was used to map the amplicon at 7q22. A painting signal was set to 1. probe for chromosome 7 (red) was co-hybridized with BAC probe RP11-90H9 (green), demonstrating CDK6 amplification on der(7) in SU-DHL-1. (c) Copy numbers of 40 cancer genes were determined by Results and discussion the PCR-based multiplex ligation-dependent probe amplification (MLPA) method. Data demonstrate amplification of cyclin-dependent Classical cytogenetic analysis of ALCL cell line SU-DHL-1 kinase 6 (CDK6) (5- to 6-fold) and BRCA1 (threefold) in SU-DHL-1. revealed a homogeneously staining region on 7q (Figure 1a). The CFHR gene was not detected, indicating its deletion.

Table 1 Oligonucleotides used for reverse transcription (RT)-PCR

Gene Accession no. Forward (50–30) Reverse (50–30) PCR product (bp)

AKAP9 NM_005751 CAAACTCTGAGCCCTGATTC GAAACAGAACCTGTGACTCG 320 CDK6 NM_001259 CAAGACTTGACCACTTACTTGG AAATATGCAGCCAACACTCCAG 321 DBF4 NM_006716 ACTGCAGAAACCACTTCACC TTGTGCACCACTACCAACTC 488 GATAD1 NM_021167 ATACAAATCTGCTCCGGCTG GCACTCTTCTCGCAATACTG 252 PPP1R9A NM_017650 ATGACGAAGTTGACCCTGTG TTATCAACTGGGACAACCTCG 375 SRI NM_003130 CCGCTGTATGGTTACTTTGC TGTAGTCGTCGAAGGTGATC 379

Leukemia CDK6 in T-cell lymphoma S Nagel et al 389 Reconciling the 7q22 amplicon with the genomic map (UCSC performed immunocytology in both SU-DHL-1 and SR-786 cells Genome Bioinformatics) identified six amplified genes plausibly (Figure 2d). Positive immunostaining is visible in nucleus involved in cancer: DBF4, SRI, AKAP9, GATAD1, CDK6 and and cytoplasm, in accordance with the published cellular PPP1R9A. Comparative expression of these candidates was distribution of CDK6 protein.19 Importantly, staining appeared analyzed by RT-PCR in SU-DHL-1 and SR-786, an ALCL cell significantly brighter in SU-DHL-1 cells, confirming overexpres- line lacking any amplification at 7q22 (data not shown). All six sion of CDK6 at the protein level. genes were expressed in SU-DHL-1 and SR-786 cells, except In T-cells, CDK6 is a major factor driving proliferation.20 Both PPP1R9A, which remained silent in both cell lines (Figure 2a). CDK6 and cyclin D3 are prominent regulators in this cell type, The PCR product of CDK6 appeared slightly stronger in SU- conducting the cell cycle through G1 phase.20,21 Furthermore, DHL-1, indicating overexpression of that gene. To analyze overexpression of both genes has been described to promote CDK6 expression levels, we performed semiquantitative RT-PCR malignant transformation.22 Rapamycin has been shown to analysis, using serially diluted cDNAs (Figure 2b). The amounts inhibit the AKT pathway responsible for degradation of the CDK of PCR products from SR-786 decreased significantly in contrast inhibitor p27 and to downregulate cyclin D3 levels in ALCL and to those of SU-DHL-1, supporting higher CDK6 expression in T cells, respectively.8,23 Consequently, SU-DHL-1, SR-786 and this cell line. Recently, a more extended amplification located at L-82 cells were treated with two different concentrations of 7q21-31 was identified in ALCL cell line L-82.18 Resembling rapamycin, specifying cell growth as end point. Data indicated SU-DHL-1, MLPA analysis of L-82 demonstrated amplification an inverse correlation of rapamycin sensitivity and CDK6 of CDK6 (threefold), BRCA1 (twofold) and deletion of CHFR expression levels (Figure 3). Furthermore, cell cycle analysis of (data not shown). Although overexpression of HGF and c-MET rapamycin-treated cells demonstrated in SR-786 a cell cycle has been described as a consequence of this amplification, arrest at G1 phase in contrast to SU-DHL-1, where no effect was expression of CDK6 has not been analyzed in this cell line.18 detected (Table 2). These data suggest that SU-DHL-1 cells are We performed quantitative expression analysis of CDK6 by better able to proliferate with both reduced cyclin D3 and real-time PCR in SU-DHL-1, L-82 and five additional ALCL cell elevated p27 levels, respectively. lines, lacking 7q22 amplification (Figure 2c). These data To study CDK6 amplification in primary T-cell lymphoma demonstrated high-level CDK6 expression in SU-DHL-1 samples we performed interphase FISH analysis on paraffin- (10-fold) and L-82 (fivefold) in comparison to ALCL control embedded material in a tissue microarray format. cell lines, corresponding to their respective genomic copy First, we established the experimental conditions in cell line numbers. To analyze CDK6 expression at the protein level, we samples, using SU-DHL-1 as positive, and MOLT-3 as negative

Figure 2 (a) By reverse transcription (RT)-PCR analysis expression of candidate genes was examined. A slightly stronger signal for cyclin- dependent kinase 6 (CDK6) in SU-DHL-1 suggests overexpression. (b) Semiquantitative RT-PCR analysis of CDK6 using serially diluted cDNA template indicates higher expression levels in SU-DHL-1 than in SR-786 cells, lacking CDK6 amplification. (c) Quantitative real-time PCR analysis of CDK6 expression in anaplastic large-cell lymphoma (ALCL) cell lines confirms overexpression in SU-DHL-1 (10-fold) and L-82 (fivefold) with respect to KARPAS-299. (d) Immunofluorescence of CDK6 protein revealed significantly higher expression in SU-DHL-1 compared to SR-786 cells. In both cell lines, CDK6 shows both nuclear and cytoplasmatic distribution.

Leukemia CDK6 in T-cell lymphoma S Nagel et al 390 MOLT-4 SU-DHL-1

ALCL (ALK-), case 11

Figure 3 Anaplastic large-cell lymphoma (ALCL) cell lines SU-DHL- PTCL (NOS), case 2 1, SR-786 and L-82 were treated with two concentrations of the AKT pathway inhibitor rapamycin (50 and 500 ng mlÀ1 for 18 h). In contrast to SU-DHL-1, the number of viable SR-786 cells was decreased. This experiment was performed twice with similar results.

Table 2 Cell cycle analysis of rapamycin-treated cells

Cell line SU-DHL-1 SR-786 PTCL (NOS), case 18 Rapamycin À (%) + (%) À (%) + (%)

G1 60 61 60 78 S 20212915 G2/M 18 15 10 7 SU-DHL-1 and SR-786 cells were treated with and without 500 ng/ml rapamycin for 18 h before cell cycle analysis. Data indicate G1-phase arrest for SR-786 in comparison with SU-DHL-1 cells. Figure 4 Amplification of cyclin-dependent kinase 6 (CDK6) was analyzed by interphase fluorescence in situ hybridization (FISH), using controls, respectively (Figure 4a). Hybridizing the CDK6 probes BAC probes for CDK6 (red), a centromeric probe for chromosome 7 in SU-DHL-1 cells, the results confirmed exclusive and (cep7 in green) as well as green probes located slightly telomeric of the unequivocal amplification in contrast to the centromeric TRG (7p14–15) and TRB (7q35) loci. (a) In contrast to the negative chromosome 7 probe (cep7), showing wild-type configuration. control cell line MOLT-3, SU-DHL-1 cells demonstrate enhanced CDK6 staining, confirming amplification. (b) Case 11 (ALKÀ ALCL) Next we analyzed 64 ALCL samples of which 30 were ALK þ shows a gain/amplification of the CDK6 locus, in addition to a gain/ and 34 ALKÀ. Of these, only one sample (ALKÀ, case 11) amplification of cep7 and 7q35, indicating an extended amplicon. showed a gain of CDK6 (Figure 4b). In addition to cep7, probe (c) Case 2 (peripheral T-cell lymphoma, not otherwise specified; PTCL 7q35 detecting the TRB locus also indicated gain of material in NOS) shows a gain of CDK6 only, whereas (d) case 18 (PTCL NOS) contrast to probe 7p14–15 (hybridizing slightly telomeric of the shows a gain of the CDK6 locus, in addition to that corresponding to TRG locus), showing wild-type configuration. These results from cep7 and 7q35, indicating an extended amplicon. ALCL patient samples indicated a low frequency (B1%) of CDK6 amplification potentially involved in a more extended at the CDK6 locus. These results indicate that CDK6 gain/ amplicon at 7q. amplification seldom occurs in ALCL but rather more frequently In contrast to ALCL, PTCL NOS samples have been shown to in PTCL NOS, corresponding to previous reports of 7q gains in possess gains at 7q.9 To test if these gains include CDK6,we PTCL exceeding those in ALCL samples.9 subsequently examined patient samples of this T-cell lymphoma Overexpression of CDK6 has been described in both T-cell subtype for CDK6 amplification in the same way. In 2/22 (9%) leukemia and lymphoma, albeit without gene amplification,24,25 PTCL NOS samples, gain/amplification of the CDK6 locus was indicating additional mechanisms underlying aberrant acti- detected as exemplified by Figure 4c. Out of the cases vation. Furthermore, in Hodgkin lymphoma, CDK6 overexpression hybridized successfully with the CDK6 and cep7 probes, 20 occurs in concert with other cell cycle checkpoint-associated PTCL NOS cases were co-hybridized with probes for CDK6 and genes26 and in splenic marginal zone lymphoma, the CDK6 7p14–15. This hybridization strategy led to three additional locus is juxtaposed with the immunoglobulin kappa locus via PTCL NOS cases revealing gain of CDK6. Assuming that a larger t(2;7)(p12;q22) driving overexpression.27 Similarly, CDK6 over- part of the 7q arm was affected in these cases, we applied a FISH expression in chronic lymphocytic leukemia occurs rarely by assay, detecting both the CDK6 locus and the chromosomal juxtaposition with IGH via formation of t(7;14)(q21;q32),28 region 7q35 (TRB), which confirmed our hypothesis (Figure 4d). while juxtaposition with TLX3 via t(5;7)(q35;q21) in T-cell Taken together, we identified 5/22 (23%) PTCL NOS cases and leukemia has been reported.29 These data, together with reports of 1/44 (2%) ALKÀ ALCL cases, demonstrating gain/amplification CDK6 overexpression in solid tumors, including glioblastoma,30

Leukemia CDK6 in T-cell lymphoma S Nagel et al 391 gastric cancer31 and squamous cell carcinoma32 indicate a wide routine paraffin-embedded tissue sections. J Pathol 2002; 198: role for CDK6 in cancerogenesis. 163–170. The fusion protein NPM-ALK activates the AKT pathway that 14 Leich E, Haralambieva E, Zettl A, Chott A, Ru¨diger T, Ho¨ller S et al. is involved in degradation of the CDK inhibitor p27, subse- Tissue microarray-based screening for chromosomal breakpoints 8 affecting the T-cell receptor gene loci in mature T-cell lymphomas. quently expressed at low levels in ALCL cells. Forced J Pathol 2007; 213: 99–105. overexpression of CDKN1B (coding for p27), results in cell 15 Nagel S, Scherr M, Quentmeier H, Kaufmann M, Zaborski M, cycle arrest of SU-DHL-1 cells; however, in unexpected contrast Drexler HG et al. HLXB9 activates IL6 in Hodgkin lymphoma cell to KARPAS-299 cells.33 Furthermore, overexpression of cyclin lines and is regulated by PI3K signalling involving E2F3. Leukemia D3 has been described in ALCL cells,7 supporting the 2005; 19: 841–846. pathogenic potential of dysregulated CDKs in this tumor type. 16 Nagel S, Burek C, Venturini L, Scherr M, Quentmeier H, Meyer C et al. Comprehensive analysis of homeobox genes in Hodgkin Underpinning the significance of these factors in T-cell lymphoma cell lines identifies dysregulated expression of HOXB9 lymphoma, treatment with HSP90 inhibitor forcing degradation mediated via ERK5 signaling and BMI1. Blood 2007; 109: of CDK6 and other cell cycle regulators has shown promise in 3015–3023. treatment of T-cell lymphoma.34 17 van Doorn R, Zoutman WH, Dijkman R, de Menezes RX, In conclusion, 7q22 amplification combined with CDK6 Commandeur S, Mulder AA et al. Epigenetic profiling of cutaneous overexpression highlights this gene as a key regulator of cell T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73. J Clin Oncol cycle progression and the pathogenic significance of CDK 2005; 23: 3886–3896. dysregulation in T-cell lymphoma in general. CDK6 is one of a 18 Merz H, Lange K, Gaiser T, Muller A, Kapp U, Bittner C et al. minority of oncogenes chromosomally rearranged in leukemia– Characterization of a novel human anaplastic large cell lymphoma lymphoma, which is also dysregulated in solid tumors. Hence, cell line tumorigenic in SCID mice. Leuk Lymphoma 2002; 43: ALCL cell lines SU-DHL-1 and L-82 represent unique tools with 165–172. which to investigate both the pathogenic role of CDK6 and its 19 Mahony D, Parry DA, Lees E. Active cdk6 complexes are potential to serve as a therapeutic target in T-cell lymphoma predominantly nuclear and represent only a minority of the cdk6 in T cells. Oncogene 1998; 16: 603–611. and, more generally, in other types of cancers. 20 Veiga-Fernandes H, Rocha B. High expression of active CDK6 in the cytoplasm of CD8 memory cells favors rapid division. Nat Immunol 2004; 5: 31–37. 21 Tam SW, Theodoras AM, Shay JW, Draetta GF, Pagano M. References Differential expression and regulation of cyclin D1 protein in normal and tumor human cells: association with Cdk4 is required 1 Futreal PA, Coin L, Marshall M, Down T, Hubbard T, Wooster R for cyclin D1 function in G1 progression. Oncogene 1994; 9: et al. A census of human cancer genes. Nat Rev Cancer 2004; 4: 2663–2674. 177–183. 22 Chen Q, Lin J, Jinno S, Okayama H. Overexpression of Cdk6- 2 Gebhart E. Double minutes, cytogenetic equivalents of gene cyclin D3 highly sensitizes cells to physical and chemical amplification, in human neoplasiaFa review. Clin Transl Oncol transformation. Oncogene 2003; 22: 992–1001. 2005; 7: 477–485. 23 Hleb M, Murphy S, Wagner EF, Hanna NN, Sharma N, Park J et al. 3 Rizvi MA, Evens AM, Tallman MS, Nelson BP, Rosen ST. T-cell Evidence for cyclin D3 as a novel target of rapamycin in human non-Hodgkin lymphoma. Blood 2006; 107: 1255–1264. T lymphocytes. J Biol Chem 2004; 279: 31948–31955. 4 Jaffe ES, Harris NL, Stein H, Vardiman JW (eds). World Health 24 Chilosi M, Doglioni C, Yan Z, Lestani M, Menestrina F, Sorio C Organization Classification of Tumors. Pathology and Genetics of et al. Differential expression of cyclin-dependent kinase 6 in Tumours of Haematopoetic and Lymphoid Tissues. IARC Press: cortical thymocytes and T-cell lymphoblastic lymphoma/leuke- Lyon, 2001. mia. Am J Pathol 1998; 152: 209–217. 5 Morris SW, Kirstein MN, Valentine MB, Dittmer KG, Shapiro DN, 25 Lien HC, Lin CW, Huang PH, Chang ML, Hsu SM. Expression of Saltman DL et al. Fusion of a kinase gene, ALK, to a nucleolar cyclin-dependent kinase 6 (cdk6) and frequent loss of CD44 in protein gene, NPM, in non-Hodgkin’s lymphoma. Science 1994; nasal-nasopharyngeal NK/T-cell lymphomas: comparison with 263: 1281–1284. CD56-negative peripheral T-cell lymphomas. Lab Invest 2000; 6 Piva R, Chiarle R, Manazza AD, Taulli R, Simmons W, Ambrogio C 80: 893–900. et al. Ablation of oncogenic ALK is a viable therapeutic approach 26 Garcia JF, Camacho FI, Morente M, Fraga M, Montalban C, for anaplastic large-cell lymphomas. Blood 2006; 107: 689–697. Alvaro T et al. Hodgkin and Reed–Sternberg cells harbor 7 Thompson MA, Stumph J, Henrickson SE, Rosenwald A, Wang Q, alterations in the major tumor suppressor pathways and cell-cycle Olson S et al. Differential gene expression in anaplastic lymphoma checkpoints: analyses using tissue microarrays. Blood 2003; 101: kinase-positive and anaplastic lymphoma kinase-negative anaplas- 681–689. tic large cell lymphomas. Hum Pathol 2005; 36: 494–504. 27 Corcoran MM, Mould SJ, Orchard JA, Ibbotson RE, Chapman RM, 8 Rassidakis GZ, Feretzaki M, Atwell C, Grammatikakis I, Lin Q, Lai Boright AP et al. Dysregulation of cyclin dependent kinase 6 R et al. Inhibition of Akt increases p27Kip1 levels and induces cell expression in splenic marginal zone lymphoma through chromo- cycle arrest in anaplastic large cell lymphoma. Blood 2005; 105: some 7q translocations. Oncogene 1999; 18: 6271–6277. 827–829. 28 Hayette S, Tigaud I, Callet-Bauchu E, Ffrench M, Gazzo S, Wahbi 9 Zettl A, Rudiger T, Konrad MA, Chott A, Simonitsch-Klupp I, K et al. In B-cell chronic lymphocytic leukemias, 7q21 transloca- Sonnen R et al. Genomic profiling of peripheral T-cell lymphoma, tions lead to overexpression of the CDK6 gene. Blood 2003; 102: unspecified, and anaplastic large T-cell lymphoma delineates 1549–1550. novel recurrent chromosomal alterations. Am J Pathol 2004; 164: 29 Su XY, Busson M, Della Valle V, Ballerini P, Dastugue N, Talmant 1837–1848. P et al. Various types of rearrangements target TLX3 locus in T-cell 10 Malumbres M, Barbacid M. Mammalian cyclin-dependent kinases. acute lymphoblastic leukemia. Genes Chromosomes Cancer 2004; Trends Biochem Sci 2005; 30: 630–641. 41: 243–249. 11 Ekholm SV, Reed SI. Regulation of G(1) cyclin-dependent 30 Costello JF, Plass C, Arap W, Chapman VM, Held WA, Berger MS kinases in the mammalian cell cycle. Curr Opin Cell Biol 2000; et al. Cyclin-dependent kinase 6 (CDK6) amplification in human 12: 676–684. gliomas identified using two-dimensional separation of genomic 12 MacLeod RA, Kaufmann M, Drexler HG. Cytogenetic harvesting of DNA. Cancer Res 1997; 57: 1250–1254. commonly used tumor cell lines. Nat Protoc 2007; 2: 372–382. 31 Takada H, Imoto I, Tsuda H, Sonoda I, Ichikura T, Mochizuki H 13 Haralambieva E, Kleiverda K, Mason DY, Schuuring E, Kluin PM. et al. Screening of DNA copy-number aberrations in gastric cancer Detection of three common translocation breakpoints in non- cell lines by array-based comparative genomic hybridization. Hodgkin’s lymphomas by fluorescence in situ hybridization on Cancer Sci 2005; 96: 100–110.

Leukemia CDK6 in T-cell lymphoma S Nagel et al 392 32 Timmermann S, Hinds PW, Munger K. Elevated activity of cyclin- the different sensitivity to the antiproliferative effect of p27(Kip1). dependent kinase 6 in human squamous cell carcinoma lines. Cell Oncogene 2001; 20: 4466–4475. Growth Differ 1997; 8: 361–370. 34 Georgakis GV, Li Y, Rassidakis GZ, Medeiros LJ, Younes A. The 33 Turturro F, Frist AY, Arnold MD, Seth P, Pulford K. Biochemical HSP90 inhibitor 17-AAG synergizes with doxorubicin and U0126 differences between SUDHL-1 and KARPAS 299 cells derived from in anaplastic large cell lymphoma irrespective of ALK expression. t(2;5)-positive anaplastic large cell lymphoma are responsible for Exp Hematol 2006; 34: 1670–1679.

Leukemia