Assessment of Genetic Diversity Among Cultivated Pearl Millet

Assessment of genetic diversity among cultivated Pearl millet (Pennisetum glaucum, Poaceae) accessions from Benin, West Africa Kifouli Adeoti, Gustave Djedatin, Ebenezer Ewedje, Thierry Beulé, Sylvain Santoni, Alain Rival, Estelle Jaligot

To cite this version:

Kifouli Adeoti, Gustave Djedatin, Ebenezer Ewedje, Thierry Beulé, Sylvain Santoni, et al.. Assessment of genetic diversity among cultivated Pearl millet (Pennisetum glaucum, Poaceae) accessions from Benin, West Africa. African Journal of Biotechnology, Academic Journals, 2017, 16 (15), pp.782-790. ￿10.5897/ajb2017.15898￿. ￿hal-01602666￿

HAL Id: hal-01602666 https://hal.archives-ouvertes.fr/hal-01602666 Submitted on 26 May 2020

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.

Distributed under a Creative Commons Attribution| 4.0 International License

Vol. 16(15), pp. 782-790, 12 April, 2017 DOI: 10.5897/AJB2017.15898 Article Number: 76FD90A63681 ISSN 1684-5315 African Journal of Biotechnology Copyright © 2017 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB

Full Length Research Paper

Assessment of genetic diversity among cultivated Pearl millet (Pennisetum glaucum, Poaceae) accessions from Benin, West Africa

Kifouli ADEOTI1*, Gustave DJEDATIN2, Ebenezer EWEDJE2, Thierry BEULE3, Sylvain SANTONI4, Alain RIVAL5 and Estelle JALIGOT3

1Département de Biologie Végétale, Faculté des Sciences et Techniques, Université d’Abomey-Calavi, LAMITA, Bénin. 2Faculté des Sciences et Techniques de Dassa Zoumè, Université Polytechnique d’Abomey, Bénin. 3CIRAD, UMR DIADE (IRD, UM), Montpellier, France. 4INRA, UMR AGAP (CIRAD, INRA), Montpellier, France. 5CIRAD, DGDRS, Jakarta, Indonesia.

Received 17 January, 2017; Accepted 21 March, 2017

Simple sequence repeat (SSR) molecular markers were used for genetic diversity analysis and population structure of the cultivated Pearl millet in Benin, West Africa. In order to assess the level of genetic diversity, 14 polymorphic SSR markers were used to screen 114 accessions from different agro- ecological zones in Benin. SSR markers were found to reveal a total of 57 alleles with an average of 4.071 allele per locus. Genetic diversity index varied from 0.099 to 0.633 with an average of 0.405. The average observed heterozygosity was found to reach 0.425. The analysis of molecular variance showed no real differentiation between regions. Only 5% of genetic variation was observed between samples collected from north-eastern and north-western region. A high level of variation (95%) was observed among accessions. Moreover, both principal component analysis (PCA) and the dendrogram obtained from the genetic distance among accessions revealed the absence of any specific structuration of accessions from each region under study. Our results confirmed diversity among cultivated Pearl millet in Benin and such diversity is not clustering according to geographical patterns.

Key words: Cereal, simple sequence repeat (SSR) markers, genetic variability.

INTRODUCTION

Pearl millet (Pennisetum glaucum (L.) R. Br., 2n = 2x = it is mostly used for human consumption (Loumerem et 14) is one of the most important food crops widely al., 2008). Because of its good performances in low- cultivated in the arid and semi-arid area. It is an important fertility soils such as semi-arid regions of Africa and cereal food grain in sub-Saharan Africa and India, where Southeast Asia, it is an important staple cereal cultivated

*Corresponding author. E-mail: [email protected].

Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Adeoti et al. 783

in regions severely affected by malnutrition. It has a high molecular characterization of genetic diversity in plants. nutritional value compared to other cereals and presents Among these, Single Sequence Repeat (SSR) or therefore a high potential in contributing to food and microsatellite markers, which target tandem repeats of di- nutrition security (Vanisha et al., 2011). In Benin, national tri- or tetra-nucleotide DNA motifs, are both highly production (27000 tonnes in 2013, USDA, 2013) ranks polymorphic within populations and randomly distributed fourth among cereals after rice, maize and sorghum, throughout the genome in both transcribed and non- although it ranks second in the northern part of the transcribed sequences (Saghai-Maroof et al., 1994; country. Being a drought-tolerant crop, pearl millet is Manzelli et al., 2007). SSR markers have been cultivated in dry northern regions of Benin under successfully used to evaluate genetic diversity in several increasingly short and marginal raining seasons. It is crop species such as wheat (Fufa et al., 2005), used in various local food preparations like local porridge, Pennisetum purpureum (Azevedo et al., 2012), Capsicum cakes and traditional beverage. Despite its importance in (Nicolai et al., 2013), Sorghum (Cuevas et al., 2014), the daily food supply of the northern populations of the barley (Shakhatreh et al., 2015), Vigna subterranea country, pearl millet is considered as a neglected and (Molosiwa et al., 2015), maize (Salami et al., 2016) and underutilized species (NUS) (Dansi, 2010). The some underutilized species such as buckwheat and wild combined effects of the decrease in cultivated areas melon (Roy et al., 2012; Zhang and Zao, 2013). For pearl dedicated to pearl millet versus other cereals in this part millet characterization, several SSR markers were of the country and the reduction of the rainy season as a developed (Mariac et al., 2006; Stich et al., 2010; result of climate change (MAEP, 2007), may lead to Nepolean et al., 2012) and used to evaluate its genetic either decrease or loss of genetic diversity on the long diversity at the regional scale in west Africa. In the Stich term. An international initiative aiming at securing plant et al. (2010) study, it has been proposed that Western genetic resources has recently been launched (FAO, and Central Africa (WCA) are the primary center of origin 2010), in order to help farmers to respond to climate and genetic diversity of pearl millet. Moreover, with change and to mitigate the losses due to genetic erosion. respect to Beninese accessions, few of them (22 This endeavour needs to be further supported through accessions) were included in the 2010 study since the the implementation of adequate preservation measures country is regarded as a secondary centre for pearl millet at the local scale, starting with an inventory of the existing production. diversity. A more in-depth knowledge of genetic diversity is the At this time, there is no national collection of pearl millet key for both crop breeding programme and the landraces from Benin and moreover, very little development of in situ conservation strategies. The main information is available on the diversity of cultivated pearl objectives of the present study were: (1) to evaluate the millet accessions in the northern part of the country. level of genetic diversity of cultivated millet in Benin and Overall, 22 Beninese pearl millet accessions have been (2) to evaluate genetic diversity structure in the cultivated sampled as part of larger studies targeting landraces areas, and to explore relationship between such structure spanning Western and Central Africa (Haussmann et al., and the local usages of the accessions. 2006; Stich et al., 2010), and stored in the international genebank. However, these population is insufficient to provide information of their genetic diversity. It therefore MATERIALS AND METHODS appears necessary to conduct a new sampling campaign Plant collection and DNA extraction in this region in order to close the gaps in the previous datasets and to prevent the loss of existing local pearl Pearl millet accessions were collected in December 2013 to millet diversity. Pear millet has an anemophilous January 2014 from the northern part of Benin, which is divided pollination, which contributes to the maintenance of between the northeast and the northwest covered by the Departments of Borgou-Alibori and Atacora-Donga, respectively. genetic variability through gene flow among wild and The northern region is located in arid and semi-arid agro-ecological cultivated population (Pesson, 1984; Tostain, 1993). The zones characterized by unpredictable and irregular rainfall use of agromorphological parameters for the oscillating between 800 and 950 mm/year. The overall climate is characterization of diversity is not sufficient and will not Sudanian with alternating dry (November to April) and rainy (May to provide an accurate classification of the accessions, October) seasons (Jalloh et al., 2013). Additionally, the northwest region is characterized by a particular climate called Atacorian since morphological criteria are strongly influenced by the climate. The annual mean temperatures range from 26 to 28°C and environment (Bahram et al., 2014). On the contrary, the may exceptionally reach 35 to 40°C in the far northern localities molecular markers have been proven to be a powerful (Adomou, 2005; Akoegninou et al., 2006). Figure 1 presents tool to assess the genetic varaition and to point up any distibution of the prospected villages across the northern part of the relationship among accessions in various crop species country. During these surveys, samples were collected from such as Gossypium and Broomcorn millet (Wu et al., farmers providing panicles or seeds, whenever panicles were not available. 2007; Hu et al., 2009). For genomic DNA extractions, five seeds from each accession Several molecular genetic tools based on either were germinated in a polyethylene bag and leaves from 4 week-old dominant or codominant markers can be used in the plantlets were harvested. DNA was extracted through the grinding 784 Afr. J. Biotechnol.

Figure 1. Geographical distribution of villages across study areas.

of 100 mg of leaf tissues sampled from 4 week-old plantlets in 750 (yellow, blue, green or red). The amplification was performed on 25 µl of extraction buffer (100 mM Tris-HCl, 1.4 M NaCl, 20 mM EDTA, ng of genomic DNA as two multiplex groups consisting of 7 primer 2% MATAB, 1% PEG 6000, 0.5% sodium sulphite, and pH 8) pre- pairs each, in a reaction mix including 2.5 mM dNTPs, 20 µM of heated at 65°C. The lysate was then decanted into a 2 ml each primer pair, Taq Hot start Q 5U/µl (QIAGEN), SolQ 5X in a Eppendorf tube and incubated at 65°C for 20 min. DNA was final volume of 10 µl. The amplification procedure consisted of an purified through two successive steps of phase separation with initial denaturation step at 95°C for 15 min followed by 35 cycles of chloroform-isoamyl alcohol (24:1, v/v) and precipitation from the 94°C for 30 s, 55°C for 1.5 min and 72°C for 1 min, followed by a supernatant with one volume of cold isopropyl alcohol, respectively, final extension cycle of 72°C for 30 min. Amplification products followed each by a centrifugation at 13,000 rpm for 10 min at 4°C were then diluted and mixed with GS 500Liz (Applied Biosystems temperature. The DNA pellet was then washed twice in 70% Inc.) internal size standard and denaturated through heating at ethanol and dried at 40°C for 1 h, before re-suspension in 150 µl of 95°C for 5 min prior to capillary electrophoresis in an ABI Prism TE 1X. RNAs were eliminated through incubation for 1 h at 37°C 3500 Genetic Analyzer sequencer (Applied Biosystems). Fragment with 6 µl of RNase A (SIGMA). The integrity of the DNA extracts analysis and allele scoring were performed using the GeneMapper was assessed through agarose gel electrophoresis and their Software version 4.1 and double-checked manually. concentration was determined through fluorimetric quantitation using the Hoechst 33258 dye with a GENios Plus fluorimeter (Tecan Scientific Instruments). Data analysis

GenAIEx software version 6.502 (Peakall and Smouse, 2012) was DNA amplification and SSR markers analysis used to perform the genetic data analysis. Total number of alleles, allele frequencies, number of alleles per locus for each locus and A total of 14 SSR primers pairs, selected from previous analyses of population, observed heterozygosity and gene diversity (He) (Nei, pearl millet genetic diversity (Mariac et al., 2006; Azevedo et al., 1973) were calculated. In order to graphically represent the 2012), were used in the present study (Table 1). For each pair, the relationships between accessions, genetic similarity indices 5' end of the forward primer was labeled with a fluorescent dye between genotypes were calculated using the DARwin 6 software Adeoti et al. 785

Table 1. List of microsatellites markers used for diversity study.

SSR marker Forward 5’ - 3’ Reverse 5’ - 3’ Psmp2201 CCCGACGTTATGCGTTAAGTT TCCATCCATCCATTAATCCACA Psmp2227 ACACCAAACACCAACCATAAAG TCGTCAGCAATCACTAATGACC Psmp2237 TGGCCTTGGCCTTTCCACGCTT CAATCAGTCCGTAGTCCACACCCCA Psmp2247 CCAAACCGTAACCTGAAAAGCTACTG GTGTCGGTTTGCTTCGTTCCTT Psmp2249 CAGTCTCTAACAAACAAACACGGC GACAGCAACCAACTCCAAACTCCA IRD12 ACTCGTTCGGATGCACTTCT CGGGGAAGAGACAGGCTACT IRD46 GAACAATTGCTTCTGTAATATTGCTT GCCGACCAAGAACTTCATACA Psmp2202 CTGCCTGTTGAGAATAAATGAG GTTCCGAATATAGAGCCCAAG Psmp2206 AGAAGAAGAGGGGGTAAGAAGGAG AGCAACATCCGTAGAGGTAGAAG Psmp2214 CGCACAGTACGTGTGAGTGAAG GATTGAGCAGCAAAAACCAGC Psmp2219 ACTGATGGAATCTGCTGTGGAA GCCCGAAGAAAAGAGAACATAGAA Psmp2220 GCATCCTTCACCATTCAAGACA TGGGAAACAGAATGGAGAAAAGAG Psmp2231 TTGCCTGAAGACGTGCAATCGTCC CTTAATGCGTCTAGAGAGTTAAGTTG IRD25 CGGAGCTCCTATCATTCCAA GCAAGCCACAAGCCTATCTC

(Perrier and Jacquemoud-Collet, 2006). The neighbor-joining average of 4.071 alleles per locus. Table 2 shows a method was used to construct the dendrogram. A principal summary of genetic values obtained for each locus. The component analysis (PCA) was also performed in order to visualize number of alleles per locus varied from 2 to 8. The lowest the distribution of the accessions according to their microsatellite diversity. Finally, an Analysis of Molecular Variance (AMOVA) was and the highest values were obtained respectively for the also performed using the GenAIEx software in order to estimate the loci Psmp2202 and Psmp2231 (Table 2). The number of total molecular variance between and within populations. private allele varied from 1 (Psmp2201, Psmp2220, Psmp2237, Psmp2247, IRD46) to 4 (Psmp2231). Genetic diversity ranged from 0.099 to 0.633 with an average of RESULTS 0.405. For the observed heterozygosity, the obtained values varied from 0.105 to 0.771 with an average of Diversity of species and vernacular names among 0.425. These values were obtained for the loci Psmp2247 area of study (for the lowest) and Psmp2220 (for the highest). Most of the loci presented an excess of heterozygosis. The During these surveys, a total of 114 accessions fixation index obtained for all loci varied from 0.303 to corresponding to 27 different popular names were 0.147 with an average of 0.050. collected through villages. The number of varieties varied from one area to another and across ethnic groups. Venacular names recorded were related to local usages Genetic relationship among and within population such as quality and quantity of flour obtained from seeds, development cycle of variety (late or early). In the east- The genetic diversity information among geographic northern part of the country, pearl millet were used mainly regions of Northern Benin was presented in the Table 3. to prepare meal and porridge for children. Nevertheless The observed allelic diversity differed from one region to in the west-northern, the second use of P. glaucum is another. The average number of alleles ranged from related to the preparation of traditional beverage. These 2.429 to 3.929. The department of Donga was found to results point out the diversity of use of pearl millet in the show the lowest average number of alleles while the Northern Benin. Indeed, traditional beverage were highest value was obtained for the Alibori. On the other consumed daily by people and represents a part of hand, the genetic diversity varied from 0.311 for the identity of most of ethnic group live in the west-northern Donga to 0.482 for Borgou Department. of the country and could justify the difference observed The fixation index values F varied from 0.132 to 0.021 for local usages in east-northern and west-northern parts. with an average of 0.050 corresponding to a deficiency of heterozygosis within the whole population. However, the values obtained for each department showed in their Microsatellite marker polymorphism and global majority an excess of heterozygosis for regions Borgou, diversity among population Atacora, and Donga. Only the region of Alibori presented a deficiency of heterozygosis. With the fourteen SSR primer pair used, 57 alleles were The Fst data translate the existing differentiation detected among the 114 pearl millet accessions with an among populations (Table 4). The values obtained for the 786 Afr. J. Biotechnol.

Table 2. Genetic diversity parameters of microsatellites loci used to evaluate the diversity of pearl millet (Pennisetum glaucum, Poaceae).

SSR marker Number of different alleles Mean of different alleles Na/locus Ne I Ho He F Psmp2201 3.000 2.500 1.450 0.501 0.284 0.287 0.022 Psmp2227 4.000 3.750 1.691 0.762 0.467 0.401 -0.157 Psmp2237 4.000 3.250 1.850 0.762 0.404 0.447 0.123 Psmp2247 3.000 2.250 1.114 0.211 0.105 0.099 -0.051 Psmp2249 3.000 3.000 1.909 0.789 0.391 0.465 0.140 IRD12 5.000 3.500 2.205 0.881 0.568 0.533 -0.093 IRD46 3.000 2.500 1.845 0.665 0.409 0.445 0.046 Psmp2202 2.000 2.000 1.872 0.655 0.607 0.463 -0.303 Psmp2206 5.000 3.500 1.868 0.740 0.402 0.411 -0.025 Psmp2214 5.000 3.000 1.288 0.406 0.201 0.209 0.010 Psmp2219 3.000 2.750 2.106 0.815 0.624 0.523 -0.202 Psmp2220 6.000 4.750 2.757 1.188 0.771 0.633 -0.218 Psmp2231 8.000 5.250 2.175 1.071 0.453 0.531 0.147 IRD25 3.000 2.500 1.335 0.414 0.266 0.224 -0.173 Mean 4.071 3.179 1.819 0.704 0.425 0.405 -0.050 SE 0.425 0.163 0.068 0.041 0.028 0.023 0.029

Ne: Number of effective alleles, I: Shannon’ information index, Ho: observed heterozygousity, He: gene diversity, F: fixation index.

Table 3. Genetic diversity parameters among geographical group of Pearl millet (Pennisetum glaucum, Poaceae).

Population Number of accessions Average number of alleles per locus Ho He F ALIBORI 50 3.929 0.432 0.448 0.021 BORGOU 16 3.357 0.494 0.482 -0.036 ATACORA 29 3.000 0.412 0.380 -0.056 DONGA 19 2.429 0.362 0.311 -0.136 Mean - 3.179 0.425 0.405 -0.050 standard error - 0.163 0.028 0.023 0.029

Ho: Observed heterozygousity, He: gene diversity, F: fixation index.

Table 4. Estimates of Pairwise Fst values (below diagonal) geographical proximity of such regions. Indeed, Borgou among the different collection regions. and Alibori represent the north eastern part of Benin, while Atacora and Donga represent the north western Region Alibori Borgou Atacora Donga one. It is then understandable that seeds exchange could ALIBORI 0.000 have happened between Borgou and Alibori on one hand BORGOU 0.000 0.000 and between Atacora and Donga on the other hand. The ATACORA 0.035 0.043 0.000 only and moderate differentiation observed was found to DONGA 0.060 0.079 0.008 0.000 occur between Alibori and Donga and Borgou and Donga. This situation could be probably explained by the relative geographical isolation of these regions. An AMOVA was also performed among regions, index of differentiation Fst among pairs of geographical populations, accessions and within accessions (Table 5). groups varied from 0 (between Borgou and Alibori) to The results of AMOVA showed that variations could be 0.079 (between Borgou and Donga). The obtained values observed at two levels: firstly within accessions and then showed a very low level of differentiation among the among regions. This analysis revealed that the widest various geographical groups. No differentiation could be variation (95%) was observed within accessions and not observed between Borgou and Alibori on one hand and a between accessions. No variation was captured among very low level between Atacora and Donga on the other populations and among accessions. However, little hand. This result could be justified by the close variation (5%) was observed between geographical Adeoti et al. 787

Table 5. Results from analysis of molecular variance (AMOVA) using two regions and 4 groups of populations.

Parameter df SS MS Estimated variance Variation (%) Among regions 1 19.509 19.509 0.150 5 Among populations 2 5.687 2.844 0.000 0 Among accessions 110 321.366 2.922 0.000 0 Within accessions 114 338.623 2.970 2.970 95 Total 227 685.185 - 3.121 100

df: Degrees of freedom; SS: sum of squares; MS: mean square.

Figure 2. Neighbour joining dendrogram from 114 pearl millet accessions obtained from the UPGMA method. Accessions from Alibori, Borgou, Atacora and Donga are respectively shown in orange, green, blue and red.

regions. dendrogram, a PCA was also performed (Figure 3). The first two axes of PCA explained respectively 22.19 and 7.69% with a cumulative variation of 29.88%. However, The structure of accessions under study and PCA neither a clear pattern nor a geographical separation could be evidenced. A compact homogeneity was The graphical representation of genetic relationships observed from the PCA representation. The PCA showed among accessions was drawn with a dendrogram taking a similar result when an analysis of the dendrogram into account the various genetic distances of Nei. The based on the genetic similarity among accession was analysis of this dendrogram revealed that there is no performed; also, it indeed revealed the absence of any particular structuration of the diversity of accessions geographical structuration among accessions. according to their geographical origin. Even if three clusters were obtained from the dendrogram (Figure 2), each of them was found to gather accessions originating DISCUSSION from each of the four regions. In order to better visualize the distribution of variability The northern where Pearl millet was cultivated, its and to point out any genetic information related to the consumption differed from one region to another. Indeed, 114 accessions under study from the previous in the part of the north east, it is used mainly to prepare 788 Afr. J. Biotechnol.

Figure 3. Principal component analysis performed on the 114 pearl millet accessions under study.

local beverage and meal with its flour. In the north west, it Mariac et al. (2006) 0.49 among landraces from Niger is used principally for beverage. This difference in usage and 0.77 for Sudanese cultivated accessions (Bashir et could also be observed in the choice of the varieties al., 2015). Although the number of samples and markers cultivated throughout the various regions. used did vary from one study to another, the estimated Our study aimed to assess the level of genetic diversity genetic diversity cannot be a function of the size of our among cultivated pearl millet accessions collected in sample. This explanation had been also underlined by Northern Benin using SSR molecular markers. Using this Stich et al. (2010). The obtained value could be explained approach, no significant variations were found among by a relatively weak polymorphism in our pearl millet pearl millet accessions for most of the studied samples when compared with others’ studies. This agromophological parameters (Bahir et al., 2014). These remark was also supported by the number of alleles variations showed some limitations such as phenotype obtained per marker. However, our results revealed a modifications due to environmental influence, when level of diversity among local pearl millet landraces that compared with molecular markers (Ferreira, 2006). The could be considered as useful for improving existing SSR molecular markers are known to be efficient for landraces and the development of local conservations genetic diversity studies of pearl millet (Mariac et al., strategies for biodiversity. As mentioned by Wang et al. 2006; Bashir et al., 2015; Shakhatreh et al., 2015). The (2012), high genetic diversity is favourable for genetic current study showed a lower average (4.071) number of marker development, construction of segregating alleles per locus compared to that reported by Mariac et populations and provides enriched gene resources for al. (2006) which was 6.2 for 421 cultivated accessions gene mining in the grass family. from Niger, and 16.4 for accessions from a wide However, the AMOVA and Fst pairwise comparison geographic range in West and Central Africa (Stich et al., revealed that no differentiation was observed within 2010). Other authors reported the analysis of 214 geographical regions. The lack of differentiation among Sudanese pearl millet accessions in which they found a populations could be explained by the closeness of high level of alleles was reported with an average of 13.3 populations of the northeast and the northwest which per locus (Bashir et al., 2015). The low number of alleles contributed to the high rate of pollen-mediated gene flow observed in the present study could be explained by (1) and by a high frequency of seeds exchange among the limited number of markers involved and (2) a smaller farmers. Moreover, the possibility of alleles sharing and sample size when compared to previous studies. exchange contributed also to that situation. Similar Genetic variability contributes to a long term selection results were reported by Bashir et al. (2015). According (Allard, 1960). According to our results, there is a to Stich et al. (2010), the lack of regional differentiation moderate genetic diversity level among accessions. The could be explained by the fact that pearl millet is a highly average gene diversity (He = 0.405) obtained for the 114 allogamous plant with an out-crossing rate exceeding cultivated accessions was lower than those reported in 85%. The little variation observed among the regions others pearl millet genetic diversity studies based on SSR could be attributed probably to the climatic conditions molecular maker. Indeed Stich et al. (2010) reported on a existing in the north-eastern and the north-western part of He = 0.74 across west and central pearl millet inbreds, Benin. Indeed, the northwest is characterized by a high Adeoti et al. 789

mountainous landscape which probably influenced the thank Christine TOULON from Institut National de genetic adaptability of landraces. Most of the Recherches Agronomiques (INRA-Montpellier –FRANCE) differentiation (95%) was present within accessions. This for technical assistance during laboratory jobs; Cedric could be due to the natural selection and gene flow as it MARIAC and Marie COUDERC from Dynadiv for primers had been reported in many studies (Turpeinen et al., providing. 2003; Nevo et al., 2004; Shakhatreh et al., 2015). According to Nevo et al. (1998), natural selection appears to be a major differentiating and orienting force of REFERENCES regional evolutionary change, maintaining genetic Adomou AC (2005). Vegetation patterns and environmental gradients in polymorphisms under conditions of environmental Benin: implications for biogeography and conservation. PhD thesis heterogeneity and stress. Wageningen University, Wageningen; ISBN 908504-308-5; 150 p. The PCA showed no clear regional structuration of Akoegninou A, van der Burg WJ, van der Maesen LJG (2006). Flore landraces. Moreover, the dendrogram obtained from a analytique de Benin. Backhuys Publishers, Leiden, 1034 p. Allard RW (1960). Principles of plant breeding. Edition, John Wiley. neighbour joining revealed also a similar result. These ISBN 0471023159, 9780471023159; 485 p. observations confirmed the previous results reported Azevedo ALS, Costa PP, Machado JC, Machado MA, Pereira AV, da earlier and suggested that there is a great genetic Silva Lédo FJ (2012). Cross Species Amplification of Pennisetum similarity among cultivated regions of pearl millet in the glaucum, Microsatellite Markers in Pennisetum purpureum and Genetic Diversity of Napier Grass Accessions. Crop Sci. 52:1776- Benin northern. It could be related to seeds exchange 1785. among regions which highly contributed to intermixture of Bahram M, Mohsen K, Ezzat K, Salar S (2014). Variation in Agro- accessions as mentioned earlier. Similar results were morphological Characters in Iranian Garlic Landraces. Int. J. Veg. reported among the cultivated landraces in Niger (Mariac Sci. 20:202-215. Bashir EM A, Abdelbagi MA, Adam MA, Albrecht EM, Heiko KP, et al., 2006) and Sudanese (Bashir et al., 2015). Our Haussmann BIG (2014). Characterization of Sudanese pearl millet results will contribute highly in the development of the germplasm for agro-morphological traits and grain nutritional values. pearl millet conservation strategies in the Northern Benin. Plant Genet. Resour. 12:35-47. Cuevas HE, Prom LK, Erpelding JE, Brotons V (2014). Assessments of genetic diversity and anthracnose disease response among Conclusion Zimbabwe sorghum germplasm. Plant Breed. 133:234-242. Dansi A (2010). Overview of the research on Neglected and Underutilized crops in West Africa. Oral communication, Cotonou, Conclusively, the present study revealed the genetic Benin. relationship and diversity among cultivated pearl millet FAO (2010). The second report on the state of the world’s plant genetic accession in Northern Benin. Our results revealed a resources for food and agriculture. Rome, 370 p. Ferreira ME (2006). Molecular analysis of gene banks for sustainable moderate genetic diversity and the weak extent of conservation and increased use of crop genetic resources. In. Ruane differentiation between regions. Given the number of J, Sonnino A (eds) The role of biotechnology in exploring and alleles obtained per locus, the local plant material could protecting agricultural genetic resources. pp. 121-127. be useful for the genetic improvement of existing Fufa H, Baenziger PS, Beecher BS, Dweikat I, Graybosch RA, Eskridge KM (2005). Comparison of phenotypic and molecular marker-based varieties. However, an agromorphological characterization classifications of hard red winter wheat cultivars. Euphytica 145:133- of accessions must be conducted and combined with 146. genetic information in order to identify the best Haussmann BIG, Boubacar A, Boureima SS, Vigouroux Y (2006). accessions which could be integrated into future plant Multiplication and preliminary characterization of West and Central African pearl millet landraces. International Sorghum and Millets breeding programs. Newsletter. 47:110-112. Hu X, Wang J, Lu P, Zhang H (2009). Assessment of genetic diversity in broomcorn millet (Panicum miliaceum L.) using SSR markers. J. CONFLICT OF INTERESTS Genet. Genomics 36:491-500. Jalloh A, Nelson GC, Thomas TS, Zougmoré R, Roy-Macauley H The authors have not declared any conflict of interests. (2013). West African agriculture and climate change: a comprehensive analysis. Int. Food Policy Res. Inst.

Loumerem M, Van Damme P, Reheul D, Behaegh T (2008). Collection

and evaluation of pearl millet (Pennisetum glaucum) germplasm from Abbreviations the arid regions of Tunisia. Genet. Resour. Crop Ev. 55:1017-1028. MAEP (2007). Rapport sur l’état des ressources phytogénétiques pour AMOVA, Analysis of molecular variance; MATAB, mixed l’alimentation et la nutrition. 57 p. alkyltrimethylammonium bromide; SSR, simple sequence Manzelli M, Pileri L, Lacerenza N, Stefano B, Vincenzo V (2007). Genetic diversity assessment in Somali sorghum (Sorghum bicolor repeat. (L.) Moench) accessions using microsatellite markers. Biodivers. Conserv. 16:1715-1730. Mariac C, Luong V, Kapran I, Mamadou A, Sagnard F, Deu M, ACKNOWLEDGMENTS Chantereau J, Gerard B, Ndjeunga J, Bezancon G, Pham JL, Vigouroux Y (2006). Diversity of wild and cultivated pearl millet The authors would like to thank Islamic Development accessions (Pennisetum glaucum [L.] R. Br.) in Niger assessed by microsatellite markers. Theor. Appl. Genet. 114:49-58. Bank (IDB) for funding through the Merit Scholarship Molosiwa OO, Aliyu S, Stadler F, Mayes K, Massawe F, Kiian A, Mayes Program attributed to the first author. We also wish to S (2015). SSR marker development, genetic diversity and population 790 Afr. J. Biotechnol.

structure analysis of Bambara groundnut [Vigna subterranean (L.) Shakhatreh Y, Baum M, Haddad N, Alrababah M, Ceccarelli S (2015). Verdc.] landraces. Genet. Resour. Crop Evol. 62:1225-1243. Assessment of genetic diversity among Jordanian wild barley Nei M (1973). Analysis of gene diversity in subdivided populations. (Hordeum spontaneum) genotypes revealed by SSR markers. Genet. Proc. Natl. Acad. Sci. 70:3321-3323. Resour. Crop. Evol. 63:813-822. Nepolean T, Gupta SK, Dwivedi SL, Bhattacharjee R, Rai KN, Hash CT Stich B, Haussmann BIG, Pasam R, Bhosale S, Hash CT, Melchinger (2012). Genetic diversity in maintainer and restorer lines of pearl AE, Parzies HK (2010). Patterns of molecular and phenotypic millet. Crop Sci. 52:2555-2563. diversity in pearl millet [Pennisetum glaucum (L.) R. Br.] from West Nevo E, Baum B, Beiles A, Johnson D (1998). Ecological correlates of and Central Africa and their relation to geographical and RAPD DNA diversity of wild barley, Hordeum spontaneum, in the environmental parameters. BMC Plant Biol. 10(1):216. Fertile Crescent. Genet. Resour. Crop Evol. 45:151-159. Tostain S (1993). Evaluation of the genetic diversity of diploid penicillary Nevo E, Chen G, Suprunova T, Krugman T, Fahima T (2004). millets (Pennisetum glaucum (L.) R. Br.) using enzymatic markers. Ecogeographic and genetic determinates of kernel weight. Seed Sci. Study of the relations between wild and cultivated species. PhD Res. 14:137-146. thesis, 331 p. Nicolai M, Cantet M, Sage-Palloix AM, Lefebvre V, Palloix A (2013). Turpeinen T, Vanhala T, Nevo E, Nissila E (2003). AFLP genetic Genotyping a large collection of pepper (Capsicum spp.) with SSR polymorphism in wild barley (Hordeum spontaneum) populations in loci brings new evidence for the wild origin of cultivated C. annuum Israel. Theor. Appl. Genet. 106:1333-1339. and the structuring of genetic diversity by human selection of cultivar Vanisha SN, Dhaduk JJ, Sareen N, Shahu T, Desai R (2011). Potential types. Genet. Resour. Crop Evol. 60:2375-2390. Functional Implications of Pearl millet (Pennisetum glaucum) in Peakall R, Smouse PE (2012). GenAlEx 6.5: genetic analysis in Excel. Health and Disease. J. Appl. Pharm. Sci. 1(10):62-67. Population genetic software for teaching and researchan update. Wang C, Jia G, Zhi H, Niu Z, Chai Y, Li W, Wang Y, Li H, Lu P, Zhao B, Bioinformatics 28:2537-2589. Diao X (2012). Genetic diversity and population structure of chinese Perrier X, Jacquemoud-Collet JP (2006). DARwin software foxtail millet [Setaria italica (L.) Beauv.] landraces. G3 Genes http://darwin.cirad.fr. Genomes Genetics 2:769-777. Pesson P (1984). Pollination and crop production; Ed. Quae, ISBN Wu YX, Daud MK, Chen L, Zhu SJ (2007). Phylogenetic diversity and 2853404811. 683 p. relationship among Gossypium germplasm using SSRs markers. Roy A, Bal SS, Fergany M, Kaur S, Singh H, Malik AA, Singh J, Monfort Plant Syst. Evol. 268:199-208. AJ, Dhillon NPS (2012). Wild melon diversity in India (Punjab State). Zhang Z, Zhao L (2013). Molecular characterization of genetic diversity Genet. Resour. Crop Evol. 59:755-767. of underutilized crops: Buckwheat as an example. Acta Hortic. Saghai-Maroof MA, Biyashev RM, Yang GP, Zhang Q, Allard W (1994). 979:407-419. Extraordinary polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proc. Natl. Acad. Sci. USA. 91:5466-5470. Salami HA, Chabi Sika K, Padonou W, Aly D, Adjanohoun A, Kotchoni S, Baba-Moussa L, Yallou C (2016). Genetic Diversity of Maize Accessions (Zea mays L.) Cultivated from Benin Using Microsatellites Markers. Am. J. Mol. Biol. 6:12-24.