Original Article Impact of Catalpol on Retinal Ganglion Cells in Diabetic Retinopathy

Int J Clin Exp Med 2016;9(9):17274-17280 www.ijcem.com /ISSN:1940-5901/IJCEM0031152

Original Article Impact of catalpol on retinal ganglion cells in diabetic retinopathy

Yi Shao1*, Ying Zhang1*, Yao Yu1,2, Ting-Ting Xu1, Rong Wei1, Qiong Zhou1

1Department of Ophthalmology, The First Affiliated Hospital of Nanchang University, Jiangxi Province Clinical Oph- thalmology and Oculopathy Institute, Nanchang, Jiangxi, People’s Republic of China; 2Nanchang Key Laboratory of Diabetes, Department of Endocrinology and Metabolism, The Third Hospital of Nanchang, Nanchang, Jiangxi, People’s Republic of China. *Equal contributors. Received April 25, 2016; Accepted July 30, 2016; Epub September 15, 2016; Published September 30, 2016

Abstract: Diabetic retinopathy (DR) is one of the most important complications of diabetes mellitus (DM), and also the main cause of blindness. Retinal ganglion cells (RGCs), the main cells forming vision in retina, are damaged in DR. It was reported that catalpol played an important role in nervous repair and remodeling. This study aims to investigate the role of catalpol in DR and provide theoretical basis and reference for DR clinical treatment and clarifying DR pathogenesis. RGCs cultured in vitro were randomly divided into normal control, high glucose group, and catalpol group. RGCs in catalpol group received 2 mm catalpol under high glucose circumstance. Cell proliferation was detected by MTT assay. LDH activity, SOD activity, and ROS content were tested by colorimetric method. Inflammatory factors TNF-α and IL-1β secretion was determined by ELISA. NF-κB expression was measured by Real time PCR and Western blot. Under high glucose circumstance, GRCs survival rate decreased, NF-κB level elevated, TNF-α and IL-1β secretion enhanced, LDH and ROS content increased, and SOD activity reduced obviously compared with normal control (P < 0.05). Catalpol significantly increased RGCs survival rate, declined LDH and ROS content, enhanced SOD activity, reduced TNF-α and IL-1β secretion, decreased NF-κB mRNA and protein expression compared with high glucose group (P < 0.05). Catalpol can prevent DR through regulating oxidation/antioxidation balance, inhibiting inflammatory factors and NF-κB signaling pathway to promote GRCs survival.

Keywords: Catalpol, diabetic retinopathy, retinal ganglion cell, antioxidation, NF-κB

Introduction (ERG) may show abnormity, weakened dark adaptation ability, and visual field damage [6, Diabetes mellitus (DM) is a type of endocrine 7]. As the earliest differentiated nerve cells in disease threatened to human health. DM com- the retina, retinal ganglion cells (RGCs) are the plication is the important factor to cause multi- main cells to form vision. Thus, GRCs death is ple organ damage and even death [1]. As one the main reason to cause visual function irre- of the most serious complications, diabetic versible damage in DR occurrence and deve- retinopathy (DR) shows high incidence. As an lopment [8]. DR has complicated pathoge- important factor of acquired blinding disease, nic factors, while RGCs oxidation by free radi- DR cause great harm to DM patients [2]. WHO cal is one of the mechanisms. Therefore, how survey demonstrated that DM incidence in- to effectively remove oxygen free radical and creased daily worldwide, and it may reach 1 maintain oxidation/antioxidation balance is a billion within 10 years [3, 4]. Several studies hotspot [9, 10]. revealed that DR was closely associated with retinal microvascular system damage caused Catalpol is the main effective component by high glucose environment [5]. It was found of rehmanniae in scrophulariaceae plants. It that retinal nerve cell damage appeared ear- belongs to the small molecular weight iridoid lier than microvascular lesions in DR. It had glycoside compound [11]. It was confirmed occurred dysfunction in DM patients without that catalpol had many biological activities, retinal microvascular lesions. Electroretinogram including anti-tumor, antifungal, antivirus, anti- Catalpol inhibits diabetic retinopathy

Table 1. Primer sequences used in PCR MTT assay Gene Forward 5’-3’ Reverse 5’-3’ The cells were seeded in 96-well plate β-actin AGTGCCAGCCTCGTCTCATAG CGTTGAACTTGCCGTGGGTAG at 3000/well with five repetition in NF-κB CTCATCTAAGCGGAACAATGG GCACATTCTCTCCGTAGCG each group. After the cell adhering to the wall, 20 μl MTT at 5 g/L was added dementia, inhibiting capillary permeability, and to each well and incubated for 4 h. 150 μl anti-inflammation [12, 13]. Catalpol played DMSO was added after removing the superna- a protective role in oxidative stress neurons tant and vibrated for 10 min. The plate was damage model caused by H2O2, thus had a criti- read at 570 nm on microplate reader for cell cal role in nerve repair and remodeling [14]. proliferation calculation. Therefore, this study explores catalpol role in DR and related mechanism, to provide theore- LDH and SOD activity detection tical basis and reference for DR clinical treatment and clarifying DR pathogenesis. SOD activity was tested according to the manual. The protein was extracted and water bathed Materials and methods at 95°C for 40 min. After cooling, the protein was centrifuged at 4000 rpm for 10 min. Tissue Reagents and instruments ethanol was extracted by ethanol-chloroform RGC-5 cells were purchased from ATCC. Ca- mixture (volume ratio 5:3) to detect LDH and talpol was from Chinese pharmaceutical and total SOD activity. biological products identification. DMEM medium, EDTA, penicillin-streptomycin were from ROS content detection Hyclone. B27, CNTF, BDNF, and glutamine were from Sigma. DMSO and MTT were from After water bathed at 95°C for 40 min and cool- Gibco. Enzyme-EDTA and epidermal growth ing, the cells were centrifuged at 4000 rpm for factor were from Sigma. PVDF membrane was 10 min. Under 37°C, the homogenate was incu- from Pall Life Science. Western blot related bated in 2’, 7’-dichlorofluorescein diacetate reagents were from Beyotime. ECL reagents (DCF-DA) for 15 min. After centrifuged at 10000 were from Amersham Biosciences. Rabbit anti- rpm for 15 min, the sediment was resuspended human NF-κB primary antibody and HRP tag- in PBS and incubated at 37°C for 60 min. ROS ged IgG secondary antibody was from Cell level was measured by spectrophotometer. Signaling. RNA extraction kit and reverse tran- scription kit were from Axygen. SOD activity ELISA detection kit was from Nanjing Jiancheng Bio- engineering institute. Other reagents were ELISA was applied to test inflammatory factors from Sangon. Labsystem Version 1.3.1 micro- TNF-α and IL-1β level in cell supernatant accord- plate reader was from Bio-Rad. ing to the manual. 50 μl standard substances were diluted and added to five repeat holes at RGC-5 cells culture and grouping each concentration to draw the standard curve. RGC-5 cells were seeded in the dish at 1×106/ 50 μl sample was added to each well with three cm2 and maintained in serum free DMEM medi- replicates. The plate was vibrated at room tem- um (100 U/ml penicillin and 100 μg/ml strepto- perature for 30 s and washed for 5 times. After mycin) together with 50 μg/L CNTF, 1:50 B27, incubated at 37°C for 30 min, the plate was 40 μg/L CNTF, and 5.6 mmol/L glucose. The washed for 5 times. 50 μl color developing medium was changed every other day, and the agent A and 50 μl color developing agent B cells were passaged every 2-3 days. RGC-5 were added and incubated at 37°C for 10 min. cells were randomly divided into three groups, After added by 50 μl stop buffer, the plate was including normal control that maintained in nor- read at 405 nm on microplate reader for OD mal condition, high glucose group that cultured value within 15 min. OD value and standard in 55 mmol/L glucose, and catalpol group treat- substance concentration were used to draw ed by 2 mm catalpol for 48 h under high glu- the standard curve for TNF-α and IL-1β content cose circumstance [15]. calculation.

17275 Int J Clin Exp Med 2016;9(9):17274-17280 Catalpol inhibits diabetic retinopathy

ence, and the results were calculated 2-ΔCt method.

Western blot

RGC-5 cells in each group were cracked on ice for 15- 30 min and ultrasonicated for 4×5 s to extract protein. After centrifuged at 10000 g and 4°C for 15 min, the protein was moved to a new Ep tube and store at -20°C. The protein was separated Figure 1. Catalpol impact on RGC-5 survival in high glucose circumstance. by 10% SDS-PAGE electro- *P < 0.05, compared with control; #P < 0.05, compared with high glucose phoresis and transferred to group. PVDF membrane. After blo- cked by 5% skim milk for 2 h, the membrane was incubated in primary antibody at 1:1000 and 4°C over night. Then the membrane was incubated with secondary antibody at 1:2000 for 30 min and washed by PBST. At last, the membrane was treated with chemiluminescent agent for 1 min and imaged on X- ray. Protein image process- ing system and Quantity one software were used for data analysis. All experiments were Figure 2. Catalpol impact on LDH activity in RGC-5. *P < 0.05, compared with repeated for four times. control; #P < 0.05, compared with high glucose group. Statistical analysis

Table 2. Catalpol impact on oxidative stress in- SPSS16.0 was adopted for data analysis. All data were presented as mean ± standard devi- dex in RGC-5 under high glucose environment _ High glucose Catalpol ation ( x ± S). One-way ANOVA was applied for Index Control group group comparison. P < 0.05 was considered as statis- ROS 62 ± 17.15 211 ± 27.31* 153 ± 21.22*,# tical significance. SOD 121 ± 15.26 51 ± 13.2* 98 ± 16.17*,# Results *P < 0.05, compared with control; #P < 0.05, compared with high glucose group. Catalpol impact on RGC-5 survival in high glucose circumstance Real-time PCR MTT assay was applied to test catalpol impact Total RNA was extracted from LECs by Trizol on RGC-5 cell survival under high glucose cir- and reverse transcripted to cDNA using the cumstance. It was showed that RGC-5 cell sur- related primers (Table 1). Real-time PCR was vival rate significantly decreased in high glu- applied to detect the target genes. The reaction cose environment compared with normal con- consists one cycle of 52°C for 1 min, followed trol (P < 0.05). Catalpol treatment obviously by 35 cycles of 90°C for 30 s, 58°C for 50 s, enhanced RGC-5 survival rate in high glucose and 72°C for 35 s. GAPDH was used as refer- compared with high glucose group (P < 0.05)

17276 Int J Clin Exp Med 2016;9(9):17274-17280 Catalpol inhibits diabetic retinopathy

tent increased in RGC-5 after catalpol treatment compared with high glucose group (P < 0.05) (Table 2). It suggested that catalpol played a protective role on RGCs by regulating oxidative stress and cell survival.

Catalpol impact on inflammatory factor secretion in RGC-5 cells under high glucose circumstance

ELISA detection demonstrat- Figure 3. Catalpol impact on TNF-α secretion in RGC-5 cells under high glucose circumstance. *P < 0.05, compared with control; #P < 0.05, compared ed that inflammatory factors with high glucose group. TNF-α and IL-1β secreted by RGC-5 cells markedly elevated under high glucose environment (P < 0.05). Catal- pol significantly suppressed TNF-α and IL-1β secretion compared with high glucose group (P < 0.05) (Figures 3 and 4). It indicated that catalpol can weaken inflammatory factor secretion by RGC-5 in high glucose environment, so as to alleviate inflammation.

Catalpol impact on NF-κB mRNA expression in RGC-5 cells under high glucose cir- Figure 4. Catalpol impact on IL-1β secretion in RGC-5 cells under high glu- cumstance cose circumstance. *P < 0.05, compared with control; #P < 0.05, compared with high glucose group. Real time PCR results showed that NF-κB mRNA overex- pressed in RGC-5 cells under (Figure 1). It indicated that catalpol can pro- high glucose circumstance (P < 0.05). Catalpol mote RGCs proliferation and survival in high treatment markedly inhibited NF-κB mRNA ex- glucose circumstance. pression compared with high glucose group (P < 0.05) (Figure 5). Catalpol impact on LDH activity in RGC-5 Catalpol impact on NF-κB protein level in RGC- LDH activity detection revealed that neuron 5 cells under high glucose circumstance damage induced LDH activity obviously enhanced in high glucose environment (P < 0.05). Western blot was further adopted to test NF-κB Catalpol markedly reduced LDH activity indu- protein expression. Similar with NF-κB mRNA ced by high glucose (P < 0.05) (Figure 2). expression, NF-κB protein level significantly Catalpol impact on oxidative stress index in increased in RGC-5 cells under high glucose RGC-5 under high glucose environment circumstance (P < 0.05). Catalpol obviously downregulated NF-κB protein level compared ROS and SOD content measurement showed with high glucose group (P < 0.05) (Figures 6 that under high glucose circumstance, ROS and 7). It confirmed that catalpol can improve level significantly elevated, while SOD content DR as it downregulated NF-κB mRNA and pro- declined in RGC-5 cells (P < 0.05). ROS produc- tein expression in RGC-5 under high glucose tion was obviously restrained, while SOD con- environment.

17277 Int J Clin Exp Med 2016;9(9):17274-17280 Catalpol inhibits diabetic retinopathy

medical technology continu- ous progresses, DR treatment effect still fails to achieve sat- isfactory results. High blood glucose environment in DM patients may affect optic nerve function lesions and injury at first. RGCs mainly fo- cus on visual signal process- ing, transmission and pro- cessing. However, because of its special structural fea- tures, RGCs axon is easily damaged in the disease, Figure 5. Catalpol impact on NF-κB mRNA expression in RGC-5 cells under leading to irreversible retinal high glucose circumstance. *P < 0.05, compared with control; #P < 0.05, damage, thus resulting in re- compared with high glucose group. tina and other organs structure and function abnormali- ties [17, 18]. DR belongs to chronic inflammatory disease, and RGCs oxidation by free radicals is one of its patho- geneses. On the other hand, high blood glucose can make RGCs dysfunction through regulating inflammatory factors. Neuron damage may release Figure 6. Catalpol impact on NF-κB protein level in RGC-5 cells under high a large amount of inflamma- glucose circumstance. tory factors, further broke the balance between pro-inflammation and anti-inflammation which aggravates neuron damage [19].

Our results confirmed that high glucose may cause RGCs damage, decrease cell survival, and enhance NF-κB expression. NF-κB expression may activate corresponding target genes, including im- mune receptors, adhesion molecules, inflammatory cyto- kines, and acute reactive protein, so as to regulate im- Figure 7. Catalpol impact on NF-κB protein level in RGC-5 cells under high # mune reaction and amplify glucose circumstance analysis. *P < 0.05, compared with control; P < 0.05, inflammatory response [20]. compared with high glucose group. High glucose can enhance ROS and LDH production, and Discussion decrease SOD activity. Increased ROS produ- ced may lead to tissues and organs oxidative DR is a common DM microvascular complica- damage, while SOD is an important antioxidant tion. It seriously impairs DM patients healthy enzyme to scavenge oxygen free radicals. It and brings heavy burden to family and society plays a vital role in oxidation/antioxidation bal- by causing progressive lesions [16]. Though ance, thus its vitality indirectly reflects organ-

17278 Int J Clin Exp Med 2016;9(9):17274-17280 Catalpol inhibits diabetic retinopathy ism ability of removing oxygen free radicals References [21]. Catalpol is extracted from traditional Chinese medicine with many pharmacologi- [1] Park YH, Shin JA, Han JH, Park YM, Yim HW. cal activities. It has critical role in anti-inflam- The association between chronic kidney dis- mation and redox balance, and also provides ease and diabetic retinopathy: the Korea National Health and Nutrition Examination neuron protective effect in the nervous sys- Survey 2008-2010. PLoS One 2015; 10: tem diseases, such as senile dementia and e0125338. Parkinson’s disease [22]. However, the role [2] Antonetti DA, Klein R, Gardner TW. Diabetic of catalpol on DR and related mechanism has retinopathy. N Engl J Med 2012; 366: 1227- not been elucidated. Our results demonstra- 1239. ted that catalpol can decrease LDH and ROS [3] Jia WC, Liu G, Zhang CD, Zhang SP. Formo- content, enhance SOD activity, promote oxi- nonetin attenuates hydrogen peroxide (H2O2)- dation/antioxidation balance recover, decline induced apoptosis and NF-kappaB activation TNF-α, IL-1β, and NF-κB expression, and incre- in RGC-5 cells. Eur Rev Med Pharmacol Sci 2014; 18: 2191-2197. ase RGCs survival. [4] Mysona BA, Matragoon S, Stephens M, Mohamed IN, Farooq A, Bartasis ML, Fouda In conclusion, our study verified catalpol can AY, Shanab AY, Espinosa-Heidmann DG, El- prevent DR through regulating oxidation/anti- Remessy AB. Imbalance of the nerve grow- oxidation balance, inhibiting inflammatory fac- th factor and its precursor as a potential bio- tors and NF-κB signaling pathway to promote marker for diabetic retinopathy. Biomed Res GRCs survival. It provides reference and new Int 2015; 2015: 571456. target selection for DR prevention in clinic. [5] Boynton GE, Stem MS, Kwark L, Jackson GR, Farsiu S, Gardner TW. Multimodal character- Acknowledgements ization of proliferative diabetic retinopathy re- veals alterations in outer retinal function and This study was supported by the National Na- structure. Ophthalmology 2015; 122: 957- 967. tural Science Foundation of China (81160118, [6] Hao M, Li Y, Lin W, Xu Q, Shao N, Zhang Y, 81460092, 81660158 and 81400372); Clini- Kuang H. Estrogen prevents high-glucose-in- cal Medicine Research Special-purpose Foun- duced damage of retinal ganglion cells via mi- dation of China (L2012052); Jiangxi Province tochondrial pathway. Graefes Arch Clin Exp Voyage Project (2014022); Natural Science Ophthalmol 2015; 253: 83-90. Key Project of Jiangxi Province (No: 20161- [7] Kim SJ, Yoo WS, Choi M, Chung I, Yoo JM, Choi ACB21017); Science and Technology Platform WS. Increased O-GlcNAcylation of NF-kappaB Construction Project of Jiangxi Province (201- Enhances Retinal Ganglion Cell Death in 3116); Youth Science Foundation of Jiangxi Streptozotocin-induced Diabetic Retinopathy. Curr Eye Res 2016; 41: 249-57. Province (20151BAB215016); Technology and [8] Isshiki T, Sakamoto S, Kinoshita A, Sugino K, Science Foundation of Jiangxi Province (2015- Kurosaki A, Homma S. Recombinant human 1BBG70223); Jiangxi Province Education De- soluble thrombomodulin treatment for acute partment Scientific Research Foundation (GJJ- exacerbation of idiopathic pulmonary fibrosis: 14170); Health Development Planning Commi- a retrospective study. Respiration 2015; 89: ssion Science Foundation of Jiangxi Province 201-207. (20155154); Scholar Project of Ganjiang River [9] Behl T, Kaur I, Kotwani A. Implication of oxida- (2015). tive stress in progression of diabetic retinopathy. Surv Ophthalmol 2016; 61: 187-96. Disclosure of conflict of interest [10] Monaghan K, McNaughten J, McGahon MK, Kelly C, Kyle D, Yong PH, McGeown JG, Curtis None. TM. Hyperglycemia and Diabetes Downregulate the Functional Expression of TRPV4 Channels Address correspondence to: Dr. Qiong Zhou, De- in Retinal Microvascular Endothelium. PLoS One 2015; 10: e0128359. partment of Ophthalmology, The First Affiliated [11] Hedna VS, Ansari S, Shahjouei S, Cai PY, Ah- Hospital of Nanchang University, 17 Yongwaizheng mad AS, Mocco J, Qureshi AI. Validity of Laser Street, Donghu District, Nanchang 330006, Jiangxi Doppler Flowmetry in Predicting Outcome in Province, People’s Republic of China. Tel: +86-791- Murine Intraluminal Middle Cerebral Artery 88596614; Fax: +86-791-88692520; E-mail: qiong- Occlusion Stroke. J Vasc Interv Neurol 2015; 8: [email protected] 74-82.

17279 Int J Clin Exp Med 2016;9(9):17274-17280 Catalpol inhibits diabetic retinopathy

[12] Xue B, Ma B, Zhang Q, Li X, Zhu J, Liu M, Wu X, [18] Wei H, Wang S, Zhen L, Yang Q, Wu Z, Lei X, Lv Wang C, Wu Z. Pharmacokinetics and tissue J, Xiong L, Xue R. Resveratrol attenuates the distribution of aucubin, ajugol and catalpol in blood-brain barrier dysfunction by regulation rats using a validated simultaneous LC-ESI- of the MMP-9/TIMP-1 balance after cerebral MS/MS assay. J Chromatogr B Analyt Technol ischemia reperfusion in rats. J Mol Neurosci Biomed Life Sci 2015; 1002: 245-253. 2015; 55: 872-879. [13] Wang JM, Yang LH, Zhang YY, Niu CL, Cui Y, [19] Nguyen TM, Seigneurin F, Froment P, Com- Feng WS, Wang GF. BDNF and COX-2 partici- barnous Y, Blesbois E. The 5’-AMP-activated pate in anti-depressive mechanisms of catal- protein kinase (AMPK) Is Involved in the aug- pol in rats undergoing chronic unpredictable mentation of antioxidant defenses in cryopre- mild stress. Physiol Behav 2015; 151: 360- served chicken sperm. PLoS One 2015; 10: 368. e0134420. [14] Xu Z, Zhang L, Li X, Jiang Z, Sun L, Zhao G, [20] Zhou M, Ren H, Han J, Wang W, Zheng Q, Zhou G, Zhang H, Shang J, Wang T. Mito- Wang D. Protective Effects of kaempferol chondrial fusion/fission process involved in against myocardial ischemia/reperfusion inju- the improvement of catalpol on high glucose- ry in isolated rat heart via antioxidant activity induced hepatic mitochondrial dysfunction. and inhibition of glycogen synthase kinase- Acta Biochim Biophys Sin (Shanghai) 2015; 47: 3beta. Oxid Med Cell Longev 2015; 2015: 730-740. 481405. [15] Zhao S, Li J, Wang N, Zheng B, Li T, Gu Q, Xu X, [21] Zhu J, Chen X, Wang H, Yan Q. Catalpol pro- Zheng Z. Fenofibrate suppresses cellular met- tects mice against renal ischemia/reperfusion abolic memory of high glucose in diabetic reti- injury via suppressing PI3K/Akt-eNOS signal- nopathy via a sirtuin 1-dependent signalling ing and inflammation. Int J Clin Exp Med 2015; pathway. Mol Med Rep 2015; 12: 6112-6118. 8: 2038-2044. [16] Jie R, Xu L, Wang YX, Zhang L, You QS, Yang H, [22] Yang SM, Liu J, Li CX. Intermedin protects Jonas JB. Ten-year incidence of retinal nerve against myocardial ischemia-reperfusion inju- fiber layer defects: The Beijing Eye Study ry in hyperlipidemia rats. Genet Mol Res 2014; 2001/2011. Invest Ophthalmol Vis Sci 2015; 13: 8309-8319. 56: 5118-5124. [17] Romero-Aroca P, Sagarra-Alamo R, Pareja- Rios A, Lopez M. Importance of telemedicine in diabetes care: Relationships between family physicians and ophthalmologists. World J Dia- betes 2015; 6: 1005-1008.

17280 Int J Clin Exp Med 2016;9(9):17274-17280