Stereospecificity of Myo-Inositol Hexakisphosphate Hydrolysis by a Protein Tyrosine Phosphatase-Like Inositol Polyphosphatase from Megasphaera Elsdenii

Appl Microbiol Biotechnol (2009) 82:95–103 DOI 10.1007/s00253-008-1734-5

BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS

Stereospecificity of myo-inositol hexakisphosphate hydrolysis by a protein tyrosine phosphatase-like inositol polyphosphatase from Megasphaera elsdenii

Aaron A. Puhl & Ralf Greiner & L. Brent Selinger

Received: 22 July 2008 /Revised: 24 September 2008 /Accepted: 25 September 2008 /Published online: 14 October 2008 # Springer-Verlag 2008

Abstract Inositol polyphosphatases (IPPases), particularly (a) 1D-Ins(1,2,4,5,6)P5, 1D-Ins(1,2,5,6)P4, 1D-Ins(1,2,6)P3, those that can hydrolyze myo-inositol hexakisphosphate and 1D-Ins(1,2)P2 (60%) and (b) 1D-Ins(1,2,3,5,6)P5, 1D- (Ins P6), are of biotechnological interest for their ability to Ins(1,2,3,6)P4, Ins(1,2,3)P3, and D/L-Ins(1,2)P2 (35%). reduce the metabolically unavailable organic phosphate content of feedstuffs and to produce lower inositol poly- Keywords Phytase . Protein tyrosine phosphatase . phosphates (IPPs) for research and pharmaceutical applica- myo-Inositol . Stereospecificity. Kinetics tions. Here, the gene coding for a new protein tyrosine phosphatase (PTP)-like IPPase was cloned from Mega- sphaera elsdenii (phyAme), and the biochemical properties Introduction of the recombinant protein were determined. The deduced amino acid sequence of PhyAme is similar to known PTP- myo-Inositol polyphosphates (IPPs) are ubiquitous products like IPPases (29–44% identity), and the recombinant of inositol metabolism, and their biological importance in enzyme displayed strict specificity for IPP substrates. eukaryotic cells has been well established (Sasakawa et al. Optimal IPPase activity was displayed at an ionic strength 1995; Shears 2001). IPPs have been implicated in myo- of 250 mM, a pH of 5.0, and a temperature of 60°C. In inositol, phosphate, and cation storage (Batten and Lott order to elucidate its stereospecificity of Ins P6 dephos- 1986) and numerous regulatory functions involved with cell phorylation, a combination of high-performance ion-pair proliferation (Brailoiu et al. 2003; Hanakahi et al. 2000; chromatography and kinetic studies was conducted. Orchiston et al. 2004). Moreover, IPPs have been docu- PhyAme displayed a stereospecificity that is unique among mented as having a number of novel metabolic effects enzymes belonging to this class in that it preferentially (Ohkawa et al. 1984; Ruf et al. 1994; Zhang et al. 2005). cleaved Ins P6 at one of two phosphate positions, 1D-3 or The most abundant IPPs in most cells are the higher IPPs, 1D-4. PhyAme followed two distinct and specific routes of myo-inositol hexakisphosphate (Ins P6)andmyo-inositol hydrolysis, predominantly degrading Ins P6 to Ins(2)P via: pentakisphosphate (Ins P5; Sasakawa et al. 1995). The enzymes responsible for Ins P6 hydrolysis are a special class of phosphatases that are collectively known as A. A. Puhl : L. B. Selinger (*) phytases. Four distinct classes of phosphatases have been Department of Biological Sciences, University of Lethbridge, characterized in the literature as having phytase activity; 4401 University Drive, i.e., histidine acid phosphatases, β-propeller phytases, Lethbridge, Alberta, Canada T1K 3M4 purple acid phosphatases (Mullaney and Ullah 2003), and e-mail: [email protected] most recently, protein tyrosine phosphatase (PTP)-like myo- R. Greiner inositol polyphosphatases (PTP-like IPPases; Chu et al. Department of Microbiology and Biotechnology, 2004; Puhl et al. 2007, 2008a, b). Phytases hydrolyze Ins P6 Max Rubner Institute, in a sequential and stepwise manner, yielding lower IPPs Federal Research Institute of Nutrition and Food, Haid-und-Neu-Strasse 9, which may again become substrates for further hydrolysis 76131 Karlsruhe, Germany (Konietzny and Greiner 2002). This occurs at different rates 96 Appl Microbiol Biotechnol (2009) 82:95–103 and in different orders among phytases, and may be (Priefer et al. 1984) and partially digested with HindIII. evidence of the variety of biological roles played by these Identification and isolation of the subgenomic DNA enzymes as well as their IPP substrates and products. corresponding to the approximate size of the putative IPPase- IPPases, including phytases, have been the focus of many containing fragment was performed as described previously studies due to interest in their role in cellular regulation and (Puhl et al. 2008b). Gel-purified subgenomic DNA containing proliferation, their ability to reduce the metabolically unavail- the gene of interest was ligated into the HindIII site of able organic phosphate content of livestock feedstuffs, and dephosphorylated pBluescript II SK (+) (Stratagene, La Jolla, their ability to produce lower IPPs (Greiner and Konietzny CA, USA). Polymerase chain reaction (PCR) primers were 1996; Konietzny and Greiner 2002; Sasakawa et al. 1995). generated from the known internal phyAme partial sequence The growing list of research and pharmaceutical applications (Nakashima et al. 2007) and were used in conjunction with for specific IPPs has greatly increased interest in the M13 and T7 universal primers to generate PCR products preparation of these compounds. The chemical synthesis of from the ligation product corresponding to regions of individual IPPs involves difficult steps and is performed at phyAme adjacent to the known partial gene fragment. The extreme conditions (Billington 1993), and the separation of PCR products were ligated into pGEM-T Easy (Promega, individual isomers is problematic with most analytical Madison, WI, USA) and sequenced by automated cycle approaches. Since phytases hydrolyze Ins P6 in an ordered sequencing at the University of Calgary Core DNA and and stepwise manner, the production of IPPs and free myo- Protein services facilities. Sequence data were analyzed with inositol using phytase is a promising alternative to chemical the aid of SequencherTM version 4.0 (Gene Codes, Ann synthesis (Greiner and Konietzny 1996). Arbor, MI, USA) and MacDNAsis version 3.2 (Hitachi A novel class of IPPase has recently been described that Software Engineering, San Bruno, CA, USA). contain a PTP-like active site signature sequence (HCX5R) Homology searches in GenBank (Fassler et al. 2000) that facilitates a classical PTP mechanism of dephosphor- were done using BLAST (Altschul et al. 1990), and ylation but is highly specific for IPP substrates (Chu et al. preliminary sequence alignments were generated using 2004; Puhl et al. 2007). While the biological function of Clustal W 1.82 (Chenna et al. 2003). Alignment optimiza- these enzymes remains unclear, the activities of many PTP tion was carried out with GeneDoc (Nicholas et al. 1997) superfamily enzymes have been found to be essential for using methods for comparative structure-based sequence regulating cellular signal transduction cascades (Cho et al. alignments (Greer 1981) and the experimentally determined 2006). A number of putative PTP-like IPPase homologues structure of a PTP-like IPPase from Selenomonas ruminan- have been partially cloned from a range of anaerobic tium (Protein Data Bank (PDB) accession: 2B4P). Second- bacteria (Nakashima et al. 2007). Here we report the ary structure predictions were generated with SSpro using cloning and sequencing of a new gene encoding PTP-like recurrent neural networks (Pollastri et al. 2002) on the IPPase from Megasphaera elsdenii, a Gram-negative Scratch web server (Cheng et al. 2005). anaerobic coccus that is a normal inhabitant of the rumen as well as the gastrointestinal tract in humans (Elsden et al. Recombinant phyAme expression construct 1956; Brancaccio and Legendre 1979;Haikaraand Helander 2006). The biochemical properties of the recom- The region coding for the mature M. elsdenii IPPase binant protein were also determined. Isomer-specific (phyAme; GeneBank accession number DQ257441; residues high-performance ion-exchange chromatography (HPIC) 26–360) was amplified from genomic DNA using PCR. The combined with kinetic analysis was used to determine the predicted signal peptide sequence was determined with stereospecificity of Ins P6 hydrolysis and the identity of the SignalP 3.0 (Bendtsen et al. 2004). PhyAme expression intermediates produced by the hydrolysis pathway. construct primers were: GCCATATGGTTTTTTCGGCC ATGGGTAT and GCGAATTCTCAACGGTTATT GACTCTCA and included an NdeIandEcoRI site (under- Materials and methods lined), respectively, for cloning and a 5′ GC cap. The PCR product was digested with NdeIandEcoRI and ligated into Gene cloning similarly digested pET28b vector (Novagen, San Diego, CA, USA). Constructs were verified with automated cycle M. elsdenii strain YR60 (Yanke et al. 1998) was cultured sequencing. anaerobically (100% CO2) at 39°C in Hungate tubes with 5 ml of modified Scott and Dehority medium (Scott and Protein production and purification Dehority 1965) containing 10% (v/v) rumen fluid, 0.2% (w/v) glucose, 0.2% (w/v) cellobiose, and 0.3% (v/v) starch. Escherichia coli BL21 (DE3) cells (Novagen) were trans- Genomic DNA was extracted using standard protocols formed with the phyAme expression construct. Over- Appl Microbiol Biotechnol (2009) 82:95–103 97 expression was carried out according to the instructions in phosphate (BCIP), O-phospho-L-tyrosine, O-phospho-L-thre- the pET Systems Manual (Novagen). Cells were induced onine, O-phospho-L-serine, adenosine triphosphate (ATP), with the addition of isopropylthiogalactoside (IPTG) to a adenosine diphosphate, pyrophosphate, D-fructose-1,6-di- final concentration of 1 mM and incubated for 4 h at 37°C. phosphate, D-fructose-6-phosphate, D-glucose-6-phosphate, Induced cells were harvested by centrifugation and resus- and D-ribose-5-phosphate. Kinetic parameters were deter- pended in lysis buffer: 25 mM KH2PO4 (pH 7), 0.6 M mined with the standard assay and a variable concentration NaCl, 15 mM imidazole, 1 mM β-mercaptoethanol (BME), (0.025–2 mM) of Ins P6 or another of the IPPs tested. and one Complete Mini, ethylenediamine tetraacetic acid Following a 3-min incubation period, the reactions were (EDTA)-free protease inhibitor tablet (Roche Applied stopped, and the liberated phosphate was quantified using a Science; Laval, Quebec, Canada). Cells were disrupted by modified ammonium molybdate method as described previ- sonication, and debris was removed by centrifugation at ously (Puhl et al. 2007, 2008b). Activity (U) was expressed 15,000×g for 15 min. The protein was purified to as μmol phosphate liberated per minute. All assays were run homogeneity using Ni2+-nitrilotriacetic acid (NTA) spin in triplicate with at least three independent replicates columns according to the supplied protocol (Qiagen). performed for each investigation, and mean values have

Protein was washed on the column with lysis buffer and been reported. The steady-state kinetic constants (KM, kcat) then with wash buffer #2 (20 mM KH2PO4 (pH 7), were calculated from Michaelis–Menton plots. The data were 300 mM NaCl, 10% (v/v) glycerol, 15 mM imidazole, and analyzed with non-linear regression using Sigma-Plot 8.0 1 mM BME). Protein was eluted with lysis buffer (Systat Software, Point Richmond, CA, USA). containing 350 mM imidazole. Homogeneity was con- firmed on a 12% (w/v) sodium dodecyl sulfate- Preparation of individual myo-inositol phosphate isomers polyacrylamide separating gel (SDS-PAGE) with a 4% (w/ v) stacking gel (Laemmli 1970) that was stained with Phytases from Aspergillus niger, E. coli, and rye were used

Coomassie Brilliant Blue R-250. Purified protein was to generate 1D-Ins(1,2,4,5,6)P5, 1D-Ins(1,2,3,4,5)P4, and dialyzed into 20 mM Tris–HCl (pH 7), 300 mM NaCl, 1D-Ins(1,2,3,5,6)P3 from Ins P6. These isomers and the Ins 0.1 mM EDTA, and 5 mM BME and stored at 4°C or P5 products generated by PhyAme were prepared as dialyzed into 50 mM NH4(CO3)2 (pH 8), lyophilized, and described previously (Greiner et al. 2002a, b). stored at −20°C. The theoretical Mr and extinction coefficients of the proteins were determined using Prot- Identification of enzymatically formed hydrolysis products Param tool (Gasteiger et al. 2005). The concentrations of protein solutions were determined with their absorbance at Standard phosphatase assays were run, and the periodically 280 nm. stopped reactions were resolved on a high-performance ion chromatography system using a Carbo Pac PA-100 (4× Assay and quantification of enzymatic activity 250 mm) analytical column (Dionex, Sunnyvale, CA, USA) and a gradient of 5–98% HCl (0.5 M, 0.8 ml/min) as previously Activity measurements were carried out at 37°C. Standard described (Skoglund et al. 1998). The eluants were mixed in a phosphatase assay mixtures consisted of a 600 μl buffered post-column reactor with 0.1% (w/v)Fe(NO3)3 in a 2% (w/v) substrate solution and 150 μlofa0.5μM enzyme solution. HClO4 solution (0.4 ml/min; Phillippy and Bland 1988). The The buffered substrate solution contained 50 mM sodium combined flow rate was 1.2 ml/min. myo-Inositol mono- acetate (pH 4.5) and 2 mM sodium phytate. Ionic strength phosphates were produced by incubation of 1.0 U of PhyAme

(I) was always held constant at 0.2 M with NaCl or, to with a limiting amount (0.1 μmol) of Ins P6 in a final volume examine the effect of I, varied from 0 to 0.8 M with NaCl. of 500 μlof50mMNH4-acetate. The end products were To determine the effect of pH, activity was measured at a identified using a gas chromatograph coupled with a mass range of pH values with overlapping buffer systems: spectrometer as previously described (Greiner et al. 2002a, b). [50 mM] glycine (pH 2–3), formate (3–4), sodium acetate (4–6), imidazole (6–7), and Tris–HCl (7–8). Activity was also measured at incremental temperatures from 10°C to Results 70°C. Substrate specificity was determined by replacing Ins

P6 in the standard assay with various other phosphorester Sequence analysis containing substrates; i.e., β-glycerophosphate, D/L-α-glycerophosphate, α-naphthyl phosphate, phospho (enol) A 1.8-kbp DNA fragment (GenBank accession number, pyruvate, phenolphthalein diphosphate, o-nitophenyl-β-D- DQ257441) was isolated from the genome of M. elsdenii galactopyranoside-6-phosphate, phenyl phosphate, ρ-nitro- by cloning regions up- and downstream of a sequence phenyl phosphate (ρNPP), 5-bromo-4-chloro-3-indolyl fragment determined by Nakashima et al. (2007). BLAST 98 Appl Microbiol Biotechnol (2009) 82:95–103 analysis of the sequenced product indicated the presence of conserved PTP-like active-site signature sequence, a com- one open reading frame (ORF; phyAme) and one partial parative structure-based sequence alignment (Fig. 1) sug- ORF (orf2) with homologues in GenBank. orf2 is located gests that PhyAme contains a conserved aspartic acid 200 bp downstream of phyAme, and its predicted product is responsible for acid/base catalysis in PhyAsr (Puhl et al. similar to the N terminus of a major envelope protein of S. 2007). Also notable is the sequence and predicted structural ruminantium (GenBank accession number AB252707). similarity between the proteins in regions corresponding to phyAme encodes a 360-amino-acid polypeptide that con- the small partial β-barrel domain of PhyAsr from S. tains a PTP-like active site signature sequence, HCEA- ruminantium, a distinguishing feature from “typical” PTPs GAGR. The predicted sequence of PhyAme is similar (Chu et al. 2004; Puhl et al. 2007). (29–44% amino acid sequence identity) to known PTP-like IPPases from S. ruminantium; PhyAsr (Chu et al. 2004; Protein expression and purification Puhl et al. 2007), S. ruminantium subsp. lactilytica (Puhl et al. 2008b), and Selenomonas lacticifex (Puhl et al. 2008a). Following induction with IPTG, overproduction of a polypep-

A search of GenBank using the PhyAme sequence as a tide with an approximate Mr of 39 k was observed with SDS- probe has identified a number of homologues putatively PAGE. This is consistent with the mass predicted from the produced by Clostridial species (i.e., anaerobic Gram- sequence of the recombinant protein (predicted Mr=40 k). positive bacteria) as well as an assortment of Gram- Ni2+-NTA purification was able to produce >99% homogene- negative bacteria, including plant pathogens (Acidovorax, ity of PhyAme in a single step, as determined by SDS-PAGE Pseudomonas, Xanthomonas), a predacious bacterium and Coomassie Brilliant Blue-250 staining (data not shown). (Bdellovibrio), a human pathogen (Legionella), and a member of the fruiting, gliding bacteria (Stigmatella). Enzymatic activity and substrate specificity Consistent with other characterized bacterial PTP-like

IPPases, PhyAme contains a predicted N-terminal signal The activity of PhyAme toward Ins P6 was examined peptide suggesting it is secreted. In addition to the because of its sequence similarity with known PTP-like

Fig. 1 Amino acid sequence alignment of the M. elsdenii PTP-like GeneBank. The PTP-like signature sequence and the conserved IPPase and its characterized GeneBank homologues. Shading is upstream aspartic acid are identified by asterisks. Experimentally according to alignment consensus as given by Gene Doc with determined secondary structures are identified for PhyAsr (PDB similarity groups enabled (black 100%, dark grey 75%). The protein accession: 1DKQ) above the sequences, and those predicted for abbreviation, source and GenBank accession numbers are as follows: PhyAme according to Recurrent Neural Networks (Baldi and Pollastri PhyAsr, S. ruminantium, AAQ13669; PhyAsl, S. lacticifex, 2003) are identified below the sequences. Arrows represent β strands, ABC69367; PhyBsl, S. lacticifex, ABC69361; PhyAsrl, S. ruminan- and boxes indicate α helices. The secondary structures corresponding tium subsp. lactylitica, ABC69359; PhyAme, M. elsdenii, ABC69358. to the partial β-barrel domain of PhyAsr (Chu et al. 2004) are Numbering is according to the sequence of PhyAme found in indicated by vertical stripes Appl Microbiol Biotechnol (2009) 82:95–103 99

IPPases. PhyAme can hydrolyze Ins P6 with a maximum We tested the ability of PhyAme to hydrolyze various specific activity of 269.3 U mg−1. Thrombin cleavage of the other common phosphoester-containing substrates in order

6xHis tag had no effect on activity towards Ins P6 (data not to characterize its specificity. The compounds that were shown). The effects of ionic strength (I), pH, and hydrolyzed by PhyAme are listed in Table 1. PhyAme has temperature on the IPPase activity of PhyAme were an extremely narrow substrate specificity, showing signif- examined with Ins P6 as a substrate (Fig. 2). Optimal icant activity only towards IPP substrates. PhyAme dis- activity was at ionic strengths between 0.2 and 0.3 M. played very little activity towards the commonly used PhyAme displayed activity over a narrow range of acidic phosphatase substrates ρNPP and BCIP or towards any of pH values, and optimal activity was observed at pH 5. phosphorylated amino acids tested. PhyAme displayed maximal activity at 60°C under the The rate of PhyAme-catalyzed phosphate release can be conditions of our standard assay. saturated by increasing the concentration of any of the IPP isomers tested and remains linear over the time period of

the assay (data not shown). The apparent kcat and Km values −1 for PhyAme with Ins P6 as a substrate were 122.1 s and 64.2 μM, respectively. Kinetic parameters were also

determined for the possible PhyAme Ins P5 hydrolysis products in order to determine the specific Ins P5 isomers generated and are displayed in Table 2.

Products of Ins P6 dephosphorylation

Isomer-specific HPIC analysis was used to identify the hydrolysis products generated by PhyAme. Purified

PhyAme was incubated with excess Ins P6 for 60, 120, and 300 min, and the stopped reactions were resolved by HPIC (Fig. 3). Following 60 min of incubation, the quantity

of Ins P6 had decreased, and D/L-Ins(1,2,4,5,6)P5 and D/L- Ins(1,2,3,4,5)P5 appeared as the major Ins P5 degradation products (60% and 35%, respectively), along with very

small amounts of Ins(1,2,3,4,6)P5 (5% of Ins P5 products). Significant quantities of D/L-Ins(1,2,5,6)P4, D/L-Ins(1,2,3,4) P4, and Ins(1,2,3)P3 and/or D/L-Ins(1,2,6)P3 plus trace amounts of D/L-Ins(1,2,4,5)P4 and D/L-Ins(1,2,4,6)P4 were also found after 60 min incubation. Following 120 min of incubation, the chromatogram was similar to that after

Table 1 Substrates that were dephosphorylated by PhyAme

Substrate Specific activity Relative activity (U mg−1) (%)

Ins P6 269.30 100.00 ATP 1.37 0.51 D-Fructose-1,6-diphosphate 0.80 0.30 α-Naphthyl acid phosphate 0.79 0.29 ρNPP 0.78 0.29 Phospho (enol) pyruvate 0.76 0.28 BCIP 0.73 0.27 O-Phospho-L-tyrosine 0.69 0.26 D-Ribose-5-phosphate 0.38 0.14 O-Phospho-L-threonine 0.35 0.13 Fig. 2 Effects of pH (a), ionic strength (b), and temperature (c)on Phenolphthalein diphosphate 0.28 0.10 PhyAme activity. Values are normalized to pH 5 (a), 0.25 M ionic strength (b), and 60°C (c). The data presented are mean values with For determination of relative activity, rate of Ins P6 hydrolysis was error bars representing the standard deviation between three indepen- taken as 100%. A full list of substrates tested is presented in dent experiments “Materials and methods” 100 Appl Microbiol Biotechnol (2009) 82:95–103

Table 2 Kinetic parameters for enzymatic myo-inositol polyphos- 60 min except the overall major product had become Ins phate dephosphorylation by PhyAme, where values given represent (1,2,3)P and/or D/L-Ins(1,2,6)P , and trace amounts of D/L- the average ± standard deviation of at least three separate experimental 3 3 runs Ins(1,2)P2 and/or D/L-Ins(4,5)P2 and/or Ins(2,5)P2 had been produced. After 300 min of incubation, PhyAme had −1 Substrate Km (μM) kcat (s ) degraded all of the Ins P6 and Ins P5s. Ins(1,2,3)P3 and/or D/L-Ins(1,2,6)P3 were found as the major products in Ins(1,2,3,4,5,6)P6 64.2±0.61 122.1±1.6 D L D L D D-Ins(1,2,4,5,6)P5 61.3±0.57 134.5±1.8 addition to / -Ins(1,2,3,4)P4 and / -Ins(1,2)P2 and/or / D-Ins(1,2,3,5,6)P5 61.8±0.52 135.3±1.9 L-Ins(4,5)P2 and/or Ins(2,5)P2. The end products of Ins P6 D-Ins(1,2,3,4,5)P5 102.5±0.67 78.4±1.1 degradation were determined by incubating excess protein a — InsP5 D/l-Ins(1,2,4,5,6)P5 61.1±0.49 133.9±1.6 with a limiting substrate concentration. The results of a gas a — InsP5 D/l-Ins(1,2,3,4,5)P5 61.5±0.53 135.8±1.7 chromatography-mass spectrometry analysis revealed that a Generated by the PTP-like phytase from M. elsdenii the end product is Ins(2)P.

Fig. 3 High-perfomance ion chromatography analysis of hydrolysis products of myo-inositol polyphosphates by PhyAme. a Reference sample. The source of the reference myo-inositol phosphates is as indicated in (Skoglund et al. 1998); Peaks: 1 Ins(1,2,3,4,5,6)P6; 2 D/L-Ins (1,2,4,5,6)P5; 3 D/L-Ins (1,2,3,4,5)P5; 4 Ins(1,2,3,4,6)P5; 5 Ins(2,4,5,6)P4; 6 D/L-Ins (1,2,5,6)P4; 7 D/L-Ins(1,2,4,5)P4; 8 D/L-Ins(1,2,3,4)P4; 9 D/L-Ins (1,2,4,6)P4; 10 D/L-Ins(1,4,5)P3, D/L-Ins(2,4,5)P3; 11 Ins(1,2,3) P3, D/L-Ins(1,2,6)P3; 12 D/L-Ins (1,2,4)P3; 13 D/L-Ins(1,2)P2, D/ L-Ins(4,5)P2, Ins(2,5)P2. b PhyAme incubated with Ins P6 for 60 min. c PhyAme incubated with Ins P6 for 120 min. d PhyAme incubated with Ins P6 for 300 min Appl Microbiol Biotechnol (2009) 82:95–103 101

Discussion for the PhyAme-catalyzed hydrolysis of 1D-Ins(1,2,4,5,6) −1 P5 (134.5 s and 61.3 μM, respectively) and suggests that Enzymatic activity and substrate specificity they are the same isomer. Similarly, the kcat and Km for the hydrolysis of the D/L-Ins(1,2,3,4,5)P5 intermediate pro- Under the conditions of our standard assay, the specific duced by PhyAme were 135.8 s−1 and 61.5 μM, respec- −1 activity of PhyAme towards Ins P6 (269.3 U mg ) falls tively. These values are most similar to the kcat and Km for −1 within the range of other characterized PTP-like IPPases the hydrolysis of 1D-Ins(1,2,3,5,6)P5 (135.3 s and that have displayed a range of activities; from 12 U mg−1 61.8 μM, respectively). Thus, PhyAme initiates hydrolysis

(PhyB from S. lacticifex; Puhl et al. 2008a) to 668.11 U of Ins P6 primarily at the 1D-3 (60%) and 1D-4 (35%) mg−1 (PhyAsr from S. ruminantium; Puhl et al. 2007). phosphate positions. Other known PTP-like IPPases have Similar to other characterized PTP-like IPPases, PhyAme been shown to exclusively hydrolyze (>90%) either the 1D- activity was very sensitive to slight changes in I. The 3 or 1D-5-phosphate positions of Ins P6 (Puhl et al. 2007, substantial charge carried by IPP substrates and the 2008a, b). A similar mixed-position specificity was previ- corresponding highly charged substrate-binding pocket of ously identified for non-PTP-like phytases cloned from the the enzyme likely exacerbates the salt dependence that is basidiomycete fungi Agrocybe pediades, Ceriporia sp., and expected of all enzymes over some range (Puhl et al. 2007). Trametes pubescens (Lassen et al. 2001), but no distinction

For this reason, ionic strength was strictly controlled in all was made between the enantiomers of their Ins P6 components of this study. Similar responses to ionic hydrolysis products. strength were reported for PTP-like IPPases from S. Many acid IPPases have been found to liberate all five ruminantium; PhyAsr (Chu et al. 2004; Puhl et al. 2007), equatorial phosphate groups of Ins P6 (Konietzny and S. ruminantium subsp. lactilytica (Puhl et al. 2008b), and S. Greiner 2002), including the known PTP-like IPPases (Puhl lacticifex (Puhl et al. 2008a). The ionic strength of rumen et al. 2007, 2008a, b). PhyAme also displays the ability to fluid depends on diet and has been reported in the range of cleave all five equatorial phosphates, resulting in a final 0.085 to 0.15 M (Wohlt et al. 1973; Koppolu and Clements, product of Ins(2)P. HPIC and kinetic analysis indicate that, 2004). The observed effect of ionic strength on these enzymes may be an adaptation to the rumen environment. PhyAme exhibits a very narrow substrate specificity; this is similar to other known PTP-like IPPases (Puhl et al. 2007, 2008a, b) but unlike most non-PTP-like acid IPPases that exhibit a broad specificity for substrates with phosphate esters (Konietzny and Greiner, 2002). Among the IPPs tested, PhyAme has a slight catalytic preference for the pentakisphosphate substrates, consistent with most characterized PTP-like IPPases (Puhl et al. 2007, 2008a, b).

Ins P6 hydrolysis pathway

Based on the position of the first phosphate hydrolyzed, three types of phytases are recognized by the Enzyme Nomenclature Committee of the International Union of Biochemistry; i.e., 3-phytase (EC 3.1.3.8), 4-phytase (EC 3.1.3.26), and 5-phytase (EC 3.1.3.72). To date, most of the known phytases are 1D-3-, 1D-4-, or 1D-6-phytases (Konietzny and Greiner 2002). Here, HPIC analysis indicated that D/L-Ins(1,2,4,5,6)P5 and D/L-Ins(1,2,3,4,5)P5 were the major Ins P5 degradation products of PhyAme- catalyzed Ins P6 hydrolysis. To determine the specific Ins P5 isomers generated, kinetic parameters were determined for the possible Ins P5 hydrolysis products and compared to Fig. 4 Degradation pathways of Ins P6 by PhyAme. Larger arrows those for the actual intermediates generated by PhyAme. indicate major pathways, smaller arrows indicate minor pathways. Solid arrows represent routes verified by HPIC and kinetic data; open The kcat and Km for the hydrolysis of the D/L-Ins(1,2,4,5,6) −1 arrows designate possible routes of hydrolysis as predicted from HPIC P5 intermediate generated by PhyAme were 133.9 s and data. Values (%) above respective major pathways indicate proportion 61.1 μM. These values are very similar to the kcat and Km of hydrolysis products generated by that route 102 Appl Microbiol Biotechnol (2009) 82:95–103 following initial hydrolysis at the 1D-3- or 1D-4-phosphate Cho CY, Koo SH, Wang Y, Callaway S, Hedrick S, Mak PA, Orth AP, positions, PhyAme follows distinct and specific routes of Peters EC, Saez E, Montminy M, Schultz PG, Chanda SK (2006) Identification of the tyrosine phosphatase ptp-meg2 as an hydrolysis with each subsequent product. PhyAme can antagonist of hepatic insulin signaling. Cell Metab 3:367–378 produce Ins(2)P via the routes indicated in Fig. 4. PhyAme Chu HM, Guo RT, Lin TW, Chou CC, Shr HL, Lai HL, Tang TY, Cheng KJ, Selinger BL, Wang AHJ (2004) Structures of predominantly degrades Ins P6 to Ins(2)P via: (A) 1D-Ins (1,2,4,5,6)P , 1D-Ins(1,2,5,6)P , 1D-Ins(1,2,6)P , and 1D- Selenomonas ruminantium phytase in complex with persulfated 5 4 3 phytate: DSP-phytase fold and mechanism for sequential sub- Ins(1,2)P2 and (B) 1D-Ins(1,2,3,5,6)P5, 1D-Ins(1,2,3,6)P4, strate hydrolysis. Structure 12:2015–2024 Ins(1,2,3)P3, and D/L-Ins(1,2)P2 (60% and 35% respective- Elsden SR, Volcani BE et al (1956) Properties of a fatty acid forming ly). The two major pathways are nearly identical except in organism isolated from the rumen of sheep. J Bacteriol 72:681–689 the order of removal of the 1D-3 phosphate, i.e., the first Fassler J, Nadel C, Richardson N, McEntyre J, Schuler G, McGinnis S, Pongor S (2000) NCBI website. from http://www.ncbi.nlm.nih.gov/ phosphate removed or the fourth removed, respectively. All Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel characterized PTP-like IPPases to date use very ordered and RD, Bairoch A (2005) Protein identification and analysis tools on stereospecific routes of Ins P hydrolysis. Moreover, with the expasy server. In: Walker JM (ed) The proteomics protocols 6 – the characterization of PhyAme, this class includes repre- handbook. Humana Press, New York, pp 571 607 Greer J (1981) Comparative model-building of the mammalian serine sentatives that can dephosphorylate the 1D-3, 4, or 5 proteases. J Mol Biol 153:1027–1042 phosphate positions of Ins P6, and could thus offer a Greiner R, Konietzny U (1996) Construction of a bioreactor to produce convenient means of producing any number of specific special breakdown products of phytate. J Biotechnol 48:153–159 lower IPPs. Further analysis of the relationship between Greiner R, Alminger ML, Carlsson NG, Muzquiz M, Burbano C, Cuadrado C, Pedrosa MM, Goyoaga C (2002a) Pathway of specific residues or other structural features and the dephosphorylation of myo-inositol hexakisphosphate by phytases stereospecificity of members of this novel class of IPPase of legume seeds. J Agric Food Chem 50:6865–6870 are currently underway by our group and ideally would lead Greiner R, Farouk A, Alminger ML, Carlsson NG (2002b) The to the ability to modify an enzyme from this class that could pathway of dephosphorylation of myo-inositol hexakisphosphate by phytate-degrading enzymes of different Bacillus spp. Can J dephosphorylate Ins P6 to any desired IPP. Microbiol 48:986–994 Haikara A, Helander I (2006) Pectinatus, Megasphaera and Zymo- Acknowledgements L. Brent Selinger receives funding from the philus. In: Dworkin M, Falkow S, Rosenberg E, Schleifer K-H, Natural Sciences and Engineering Research Council (NSERC) and the Stackebrandt E (eds) The prokaryotes: a handbook on the biology Advanced Foods and Materials Network (AFMNet). Thanks to L. J. of bacteria, volume 4. Springer Science & Business Media, New Yanke, Agriculture and Agri-Food Canada (Lethbridge, Alberta), for York, pp 965–981 supplying the M. elsdenii cultures. Analysis of the isomers of the Hanakahi LA, Bartlet-Jones M, Chappell C, Pappin D, West SC individual myo-inositol phosphate derivatives by N.-G. Carlsson, (2000) Binding of inositol phosphate to DNA-pk and stimulation Chalmers University of Technology (Göteborg, Sweden), is also of double-strand break repair. Cell 102:721–729 gratefully acknowledged. Konietzny U, Greiner R (2002) Molecular and catalytic properties of phytate-degrading enzymes (phytases). Int J Food Sci Technol 37:791–812 Koppolu A, Clements LD (2004) Ruminal waste stream as a source of References industrial chemicals. Resour Conserv Recycl 41:215–226 Laemmli UK (1970) Cleavage of structural proteins during the Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic assembly of the head of bacteriophage T4. Nature 227:680–685 local alignment search tool. J Mol Biol 215:403–410 Lassen SF, Breinholt J, Ostergaard PR, Brugger R, Bischoff A, Wyss Baldi P, Pollastri G (2003) The principled design of large-scale M, Fuglsang CC (2001) Expression, gene cloning, and charac- recursive neural network architectures-dag-rnns and the protein terization of five novel phytases from four basidiomycete fungi: structure prediction problem. J Mach Learn Res 4:575–603 Peniophora lycii, Agrocybe Pediades, ceriporia sp., and Tra- Batten GD, Lott JNA (1986) The influence of phosphorus nutrition on metes pubescens. Appl Environ Microbiol 67:4701–4707 the appearance and composition of globoid crystals in wheat Mullaney EJ, Ullah AHJ (2003) The term phytase comprises several aleurone cells. Cereal Chem 63:14–18 different classes of enzymes. Biochem Biophys Res Commun Bendtsen JD, Nielson H, Von Heijne G, Brunak S (2004) Improved 312:179–184 prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795 Nakashima BA, McAllister TA, Sharma R, Selinger LB (2007) Billington DC (1993) The inositol phosphates. Chemical synthesis and Diversity of phytases in the rumen. Microb Ecol 53:82–88 biological significance. VCH, New York, NY Nicholas KB, Nicholas HB Jr, Deerfield DW II (1997) GeneDoc: Brailoiu E, Miyamoto MD, Dun NJ (2003) Inositol derivatives Analysis and visualization of genetic variation. from http://www. modulate spontaneous transmitter release at the frog neuromus- psc.edu/biomed/genedoc cular junction. Neuropharmacology 45:691–701 Ohkawa T, Ebisuno S, Kitagawa M, Morimoto S, Miyazaki Y, Brancaccio M, Legendre GG (1979) Megasphaera elsdenii Endocar- Yasukawa S (1984) Rice bran treatment for patients with ditis. J Clin Microbiol 10:72–74 hypercalciuric stones: experimental and clinical studies. J Urol Cheng J, Randall AZ, Sweredoski MJ, Baldi P (2005) Scratch: a 132:1140–1145 protein structure and structural feature prediction server. Nucl Orchiston EA, Bennett D, Leslie NR, Clarke RG, Winward L, Acids Res 33:W72–W76 Downes CP, Safrany ST (2004) Pten m-cbr3, a versatile and Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, selective regulator of inositol 1,3,4,5,6-pentakisphosphate (ins Thompson JD (2003) Multiple sequence alignment with the (1,3,4,5,6)p-5)—evidence for Ins(1,3,4,5,6)p-5 as a proliferative clustal series of programs. Nucl Acids Res 31:3497–3500 signal. J Biol Chem 279:1116–1122 Appl Microbiol Biotechnol (2009) 82:95–103 103

Phillippy BQ, Bland JM (1988) Gradient ion chromatography of Ruf JC, Ciavatti M, Gustafsson T, Renaud S (1994) In-vitro effect of inositol phosphates. Anal Biochem 175:162–166 D-myo-inositol 1,2,6-trisphosphate (PP-56) on aggregation of Pollastri G, Przybylski D, Rost B, Baldi P (2002) Improving the platelets from normal and diabetic rats—relationship to malon- prediction of protein secondary structure in three and eight dialdehyde release and phosphoinositide pathway. Can J Physiol classes using recurrent neural networks and profiles. Proteins Pharmacol 72:644–649 47:228–235 Sasakawa N, Sharif M, Hanley MR (1995) Metabolism and Priefer U, Simon R, Pühler A (1984) Cloning with cosmids. In: Pühler biological-activities of inositol pentakisphosphate and inositol A, Timmis KN (eds) Advanced molecular genetics. Springer, hexakisphosphate. Biochem Pharmacol 50:137–146 New York, pp 190–201 Scott HW, Dehority BA (1965) Vitamin requirements of several Puhl AA, Gruninger RJ, Greiner R, Janzen TW, Mosimann SC, cellulolytic bacteria. J Bacteriol 89:1169–1175 Selinger LB (2007) Kinetic and structural analysis of a bacterial Shears SB (2001) Assessing the omnipotence of inositol hexaki- protein tyrosine phosphatase-like myo-inositol polyphosphatase. sphosphate. Cell Signal 13:151–158 Protein Sci 16:1368–1378 Skoglund E, Carlsson NG, Sandberg AS (1998) High-performance Puhl AA, Greiner R, Selinger LB (2008a) Kinetics, substrate chromatographic separation of inositol phosphate isomers on strong specificity, and stereospecificity of two new protein tyrosine anion exchange columns. J Agric Food Chem 46:1877–1882 phosphatase-like inositol polyphosphatases from Selenomonas Wohlt JF-, Sniffen CJ, Hoover WH (1973) Measurement of protein lacticifex. Biochem Cell Biol 86:322–330 solubility in common feedstuffs. J Dairy Sci 56:1052–1057 Puhl AA, Greiner R, Selinger LB (2008b) A protein tyrosine Yanke LJ, Bae HD, Selinger LB, Cheng K-J (1998) Survey of phytase phosphatase-like inositol polyphosphatase from Selenomonas activity in anaerobic rumen bacteria. Microbiol 144:1565–1573 ruminantium subsp. lactilytica has specificity for the 5-phosphate Zhang Z, Song Y, Wang XL (2005) Inositol hexaphosphate-induced of myo-inositol hexakisphosphate. Int J Biochem Cell Biol enhancement of natural killer cell activity correlates with suppression 40:2053–2064 of colon carcinogenesis in rats. World J Gastroenterol 11:5044–5046