DOCSLIB.ORG

Abstracts RCMI.Indd 1 3/13/2020 12:51:25 PM PLANNING COMMITTEE

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Abstracts RCMI.Indd 1 3/13/2020 12:51:25 PM PLANNING COMMITTEE Abstracts RCMI.indd 1 3/13/2020 12:51:25 PM PLANNING COMMITTEE Planning Committee Chair Elizabeth Ofili, MD, MPH, FACC Morehouse School of Medicine Program Manager Kimberly Lawson, MPH Morehouse School of Medicine RTRN Communications Director Traci Hayes, MBA, DrPH Jackson State University Planning Committee Co-Chairs Emma Fernandez-Repollet, PhD Paul B. Tchounwou, PhD University of Puerto Rico, Medical Sciences Campus Jackson State University Daniel F.K. Sarpong, PhD Richard Yanagihara, MD, MPH Xavier University of Louisiana University of Hawaii at Manoa ABSTRACT COMMITTEE Abstract Committee Chair Richard J. Noel, Jr., PhD Ponce Health Sciences University Abstract Committee Co-Chairs Guadalupe X. Ayala, PhD, MPH David D. Lo, MD, PhD San Diego State University University of California Riverside Julie Ann Baldwin, PhD Priscilla Pemu, MD, MSCR Northern Arizona University Morehouse School of Medicine Adriana Campa, PhD, RD, MBA Brian Rivers, PhD, MPH Florida International University Morehouse School of Medicine Marcia R. Cruz-Correa, MD, PhD Daniel F.K. Sarpong, PhD University of Puerto Rico, Medical Sciences Campus Xavier University of Louisiana Deepak Kumar, PhD Bruce Shiramizu, MD North Carolina Central University University of Hawaii This conference was supported by a U13 MD014961 Award from the National Institute of Minority Health and Health Disparities (NIMHD); workshops were partially supported by a UO1 GM132771 from the National Institute of General Medical Sciences (NIGMS), and a UL1 TR002378 from the National Center for Advancing Translational Sciences (NCATS). The views expressed in written conference materials or publications are solely the responsibility of the authors and does not necessarily reflect the official views of the National Institutes of Health. 66 PRHSJ Vol. 39 No. 1 • March, 2020 Abstracts of the RCMI 2019 National Conference Abstracts RCMI.indd 2 3/13/2020 12:51:25 PM Editorial Message We are delighted to publish the abstracts from the 2019 Research Centers in Minority Institutions (RCMI) National Conference held in Bethesda, MD on December 15-17, 2019. The conference highlighted excellence and innovation in basic, behavioral and clinical research, especially from programs sponsored by the National Institute of Minority Health and Health Disparities (NIMHD). Supported by a multi-institutional cooperative U13 award, the conference focused on advances achieved by RCMI investigators on research to reduce health disparities and improve minority health. Through congressional mandate, the RCMI program was initiated by the National Institutes of Health (NIH) in 1985. The authorizing legislation called attention to the Department of Health and Human Services (DHHS) Secretary’s Task Force annual report on the status of the health of the American people and noted the disparities in the health status between minority and majority Americans. The legislation also acknowledged the important role that minority educational institutions have traditionally played in training professionals who provide health care to the minority community. Based on this mandate, the primary goals of the RCMI program are (1) to enable minority institutions that offer doctorates in the health professions and/or health-related sciences to strengthen their research environment to become more competitive in obtaining support for the conduct of biomedical and behavioral research, and (2) to foster training and development of the next generation of researchers from underrepresented populations. The 2019 RCMI National Conference was aligned with NIMHD’s vision to advance the science of minority health and health disparities research by enabling all investigators showcase their research experiences on diseases that disproportionately affect health disparity and minority populations. The conference included plenary sessions, workshops, oral and poster presentations, and concurrent sessions. Over the three-day period, there were abundant opportunities for sharing research information, attending mentoring and professional development workshops, identifying collaborators and conducting networking activities. More than two hundred participants submitted abstracts in areas related to basic and applied minority health and health disparities research, behavioral and social determinants of health, capacity building, clinical and translational minority health and health disparities research, community-based participatory research and research in special populations and sub-groups. We are pleased to share this work through publication of the conference abstracts. Lastly we thank all our submitting authors and the Puerto Rico Health Sciences Journal for allowing us to share with the scientific community the knowledge and efforts of the RCMI investigators in eliminating health disparities and improving minority health. Cordially, Elizabeth Ofili, MD Richard Noel, PhD Conference Chair Abstract Committee Chair Morehouse School of Medicine Emma Fernández-Repollet, PhD Ponce Health Sciences University Conference Co-chair University of Puerto Rico Medical Sciences Campus Abstracts of the RCMI 2019 National Conference PRHSJ Vol. 39 No. 1 • March, 2020 67 Abstracts RCMI.indd 3 3/13/2020 12:51:26 PM ORAL ABSTRACTS 11.01.008 TARGETING MITOTIC REGULATORS IN BASAL BREAST │BASIC & BIOMEDICAL SCIENCE│ CANCERS HI Saavedra, Y Rivera-Rivera, S Jusino 11.01.004 Department of Basic Sciences, Program of Pharmacology (HIS and YRR) and Graduate Program in Biomedical Sciences of the VERNONIA AMYGDALINA DELILE FOR PROSTATE Ponce Health Sciences University (SJ) CANCER THERAPY Purpose: While non-Hispanic white women (NHW) are more Clement G. Yedjou and Paul B. Tchounwou prone to develop breast cancers than Hispanic/Latino (H/L) Jackson State University and African American (AA) women, H/L and AA women have Prostate cancer is one of the common cancers in males higher probabilities of dying from breast cancers. This is in and its incidence keeps increasing globally. Approximately part due to AA and H/L women with breast cancer being: (1) 81% of prostate cancer is diagnosed during the early stage more frequently diagnosed with later-stage/grade and larger of the disease. The treatment options for prostate care breast tumors, (2) more likely to develop hormone-receptor- include surgery, radiotherapy, and chemotherapy, but negative (mainly triple-negative, TNBC: ER-PR-Her2-) breast these treatments often have side effects that may result to cancers, and (3) to the aggressive nature of TNBC, which poor quality of life such as impotence or decrease bowel are more likely to be metastatic, refractive to anti-hormonal function. Our central goal is to test the anticancer activity therapies and to relapse after chemotherapy than luminal of Vernonia amygdalina Delile (an edible medicinal plant subtypes. Our laboratory is investigating the molecular drivers that is relatively inexpensive, nontoxic, and virtually of cancer disparities between AA, H/L, and NH by identifying without side effects) for the prevention of prostate cancer transcriptional networks unregulated in Her2+ and TNBC. using human adenocarcinoma (PC-3) cells as a test model. Methods: Because these subtypes display more centrosome To address our specific goal, PC-3 cells were treated with amplification (CA), proliferation, and chromosome instability Vernonia amygdalina Delile (VAD). Cell viability and cell (CIN) than luminal subtypes, we performed several expression morphology was analyzed by acridine orange and propidium screens that identified the Cdk/Rb/E2F pathway as a major iodide (AO/PI) dye using the fluorescent microscope. driver of CA/CIN in hormone-receptor-negative breast tumors. DNA damage was evaluated by the comet assay. Cell cycle That allowed us to identify Nek2, SgoI, and TTK as critical arrest and cell apoptosis was evaluated by Flow Cytometry drivers of CA/CIN in breast cancer cells. Results: Our data assessment. Nucleosomal DNA fragmentation was detected indicate that these kinases have novel functions since they by DNA ladder assay. Data obtained from the AO/PI dye signal survival, EMT, and invasion in TNBC cells and affect assessment indicated that VAD significantly reduced the patient survival. We have confirmed the relationship between number of live cells in a dose-dependent manner, showing a mitotic kinases and invasion with a tissue microarray of AA, gradual increase in the loss of viability in VAD-treated cells. H/L and NHW white women with breast cancers. Discussion: Similar result was previously obtained by the MTT assay. Our ultimate goal is to inhibit TTK, Nek2, and SgoI in TNBCs We observed a significant increase in DNA damage in VAD- in order to prevent progression into metastatic stages or to treated cells compared to the control group. Flow cytometry specifically target metastatic cells. data showed that VAD induced cell cycle arrest at the G0/ G1 checkpoint. Flow cytometry data also showed that VAD 11.01.001 induced caspase-3 activation in treated cells compared to the control group. We observed the formation of the DNA ladder KDM5B IS ESSENTIAL FOR PI3K/AKT SIGNALING IN in gel electrophoresis by induction of apoptosis in PC-3 cells PROSTATE CANCER treated with VAD. These results suggest that inhibition of G LI; T Kanagasabai; W Lu; SI Celada; M Izban; BR cancer cell growth, induction of DNA damage, cell cycle arrest Ballard; Q Yan; RJ Matusik; and Z Chen at the G0/G1 checkpoint, and apoptosis through caspase-3 MEHARRY MEDICAL COLLEGE (GL, TK, WL, SIC, MI, activation and nucleosomal DNA
Load more

Recommended publications
  • (12) United States Patent (10) Patent No.: US 8,829,205 B2 Jeon Et Al
    USOO8829205B2 (12) United States Patent (10) Patent No.: US 8,829,205 B2 Jeon et al. (45) Date of Patent: Sep. 9, 2014 (54) METHOD FOR PREPARING COUMESTROL (58) Field of Classification Search AND COUMESTROL PREPARED BY SAME USPC ........................................... 549/279; 435/119 See application file for complete search history. (75) Inventors: Hee Young Jeon, Yongin-si (KR); Dae Bang Seo, Yongin-si (KR); Si Young (56) References Cited Cho, Seoul (KR); Sang Jun Lee, U.S. PATENT DOCUMENTS Seongnam-si (KR) 3,564,019 A * 2/1971 Holmlund et al. ............ 549,279 (73) Assignee: Amorepacific Corporation, Seoul (KR) 6,129,937 A 10/2000 Zurbriggen et al. (*) Notice: Subject to any disclaimer, the term of this FOREIGN PATENT DOCUMENTS patent is extended or adjusted under 35 EP 1357,807 B1 3, 2007 U.S.C. 154(b) by 226 days. JP 2008-120729. A 5/2008 KR 10-0360306 B1 11, 2002 (21) Appl. No.: 13/575,267 KR 10-0706279 B1 4/2007 KR 10-0778.938 B1 11, 2007 (22) PCT Filed: Jan. 31, 2011 WO WOO1f97769 A1 12/2001 OTHER PUBLICATIONS (86). PCT No.: PCT/KR2O11AOOO673 S. M. Boué et al., “Induction of the Soybean Phytoalexins S371 (c)(1), Coumestrol and Glyceollin by Aspergillus,” J. Agric. Food Chem. (2), (4) Date: Jul. 25, 2012 vol. 48, No. 6, pp. 2167-2172, 2000. X. Hao et a... "Analysis of Coumestrol Content in Soybean.” Journal (87) PCT Pub. No.: WO2011/093686 of Beijing University of Agriculture, vol. 23, No. 3, pp. 7-9, 2008. PCT Pub. Date: Aug.
    [Show full text]
  • Nutraceuticals: Chemoradiation Sensitizers Oroma B
    Research Article iMedPub Journals Herbal Medicine: Open Access 2017 http://www.imedpub.com ISSN 2472-0151 Vol. 3 No. 2: 5 DOI: 10.21767/2472-0151.100025 Nutraceuticals: Chemoradiation Sensitizers Oroma B and Adverse Effect Resolvers Obstetrics and Gynecology Locum Tenens, PO Box 59, Salinas, CA 93902- 0059, USA Abstract Corresponding author: Oroma Nwanodi B Background: Conventional cancer treatment is associated with resistant cancer development, treatment and quality of life limiting adverse effects, and patients’ inability to complete intended treatment plans. Conventional cancer treatment’s [email protected] adverse effects lead 36.1% of cancer patients to seek integrative cancer treatments, which can provide a 15 percentage-point improvement in their health status. Obstetrics and Gynecology Locum Tenens, Therefore, a review of the extent of nutraceuticals applicable to conventional PO Box 59, Salinas, CA 93902-0059, USA. chemoradiation sensitization and adverse effect amelioration, as well as, for chemoprevention is valuable. Tel: 3143042946 Methods: PubMed searches in September 2016 and January 2017, and hand searches in August 2016 and January 2017 were performed for English language, free full text articles published from 2012 onwards. Search terms were combinations of Citation: Nwanodi OB. Nutraceuticals: the key words: Homeopathy, nutraceuticals, phytochemicals, cancer, breast cancer, Chemoradiation Sensitizers and Adverse cervical cancer, endometrial cancer, ovarian cancer, prevention, and treatment. Effect Resolvers. Herb Med. 2017, 3:2. Adjuvant characteristics, adverse effects, and chemoradiation sensitization treatments were taken from these searches. Findings: Organosulphurs are immunologic chemosensitizers. Terpenes can inhibit or reverse drug resistance. Epigallocatechin modulates estrogen receptor expression. Polyunsaturated fatty acids are cancer cell membrane chemoradiation sensitizers.
    [Show full text]
  • ABSTRACT Title of Document: BIOLOGICAL
    ABSTRACT Title of Document: BIOLOGICAL EFFICACY, MECHANISMS OF ACTIONS OF SOY-DERIVED PHYTOALEXIN GLYCEOLLINS IN PREVENTION OF CHRONIC DISEASES Haiqiu Huang, Doctor of Philosophy, 2014 Directed By: Professor Liangli (Lucy) Yu Department of Nutrition and Food Science Cardiovascular disease (CVD) is the leading cause of deaths worldwide. Prostate cancer is the most prevalent cancer in U.S. male population. Diet-induced hypercholesterolemia and chronic inflammation promote the development of both CVD and prostate cancer. Glyceollins are a group of soy phytoalexins possessing a variety of biological activities. This research project focused on characterizing glyceollins’ bioactivities in alleviating cholesterol dysregulation, prevention of prostate cancer, and regulating gut microbiome. The first part of the project aimed to evaluate glyceollins’ cholesterol- lowering effect in-vivo. Male golden Syrian hamsters were fed high-fat diet with or without glyceollins supplementation for 28 days. Glyceollins supplementation led to a significant reduction of plasma VLDL, hepatic cholesterol esters and total lipid content. Consistent with changes in circulating cholesterol, glyceollins supplementation also altered expression of the genes related to cholesterol metabolism in the liver. The second part of the study aimed to evaluate glyceollins’ effect in reducing prostate cancer tumor growth in a xenograft model. An initial delayed appearance of tumor was observed in a PC-3 xenograft model. However, no difference in tumor sizes was observed in a LNCaP xenograft model. Extrapolation analysis of tumor measurements indicated that no difference in sizes was expected for both PC-3 and LNCaP tumors. Glyceollins had no effect on the androgen responsive pathway, its proliferation, cell cycle, or on angiogenesis genes in tumor and xenobiotic metabolism, cholesterol transport, and inflammatory cytokine genes in liver.
    [Show full text]
  • PAQR6 Antibody (C-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PAQR6 Antibody (C-term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B Specification PAQR6 Antibody (C-term) - Product Information Application WB,E Primary Accession Q6TCH4 Other Accession NP_940798.1, NP_079173.2 Reactivity Human Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 37989 Antigen Region 283-312 PAQR6 Antibody (C-term) - Additional Information PAQR6 Antibody (C-term) (Cat. #AP13667b) Gene ID 79957 western blot analysis in Jurkat cell line lysates (35ug/lane).This demonstrates the PAQR6 Other Names antibody detected the PAQR6 protein (arrow). Progestin and adipoQ receptor family member 6, Progestin and adipoQ receptor family member VI, PAQR6 PAQR6 Antibody (C-term) - Background Target/Specificity The function of this protein remains unknown. This PAQR6 antibody is generated from rabbits immunized with a KLH conjugated PAQR6 Antibody (C-term) - References synthetic peptide between 283-312 amino acids from the C-terminal region of human PAQR6. Kamatani, Y., et al. Nat. Genet. 42(3):210-215(2010) Dilution Smith, J.L., et al. Steroids WB~~1:1000 73(11):1160-1173(2008) Tang, Y.T., et al. J. Mol. Evol. Format 61(3):372-380(2005) Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C in small aliquots to prevent freeze-thaw cycles. Precautions PAQR6 Antibody (C-term) is for research Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 use only and not for use in diagnostic or therapeutic procedures.
    [Show full text]
  • PAQR6 (NM 001272108) Human Tagged ORF Clone – RG236776
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG236776 PAQR6 (NM_001272108) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: PAQR6 (NM_001272108) Human Tagged ORF Clone Tag: TurboGFP Symbol: PAQR6 Synonyms: PRdelta Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG236776 representing NM_001272108. Sequence: Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCAGTCTCAAGCTGCCCCAACTTCTTCAAGTCCACCAGGTCCCCCGGGTGTTCTGGGAAGATGGC ATCATGTCTGGCTACCGCCGCCCCACCAGCTCGGCTTTGGACTGTGTCCTCAGCTCCTTCCAGATGACC AACGAGACGGTCAACATCTGGACTCACTTCCTGCCCACCTGTTTCCTGGAGCTGGAAAGCCCTGGGCTC AGTAAGGTCCTCCGCACAGGAGCCTTCGCCTATCCATTCCTGTTCGACAACCTCCCACTCTTTTATCGG CTCGGGCTGTGCTGGGGCAGGGGCCACGGCTGTGGGCAGGAGGCCCTGAGCACCAGCCATGGCTACCAT CTCTTCTGCGCGCTGCTCACTGGCTTCCTCTTCGCCTCCCACCTGCCTGAAAGGCTGGCACCAGGACGC TTTGATTACATCGGCCACAGCCACCAGTTATTCCACATCTGTGCAGTGCTGGGCACCCACTTCCAGCTG GAGGCAGTGCTGGCTGATATGGGATCACGCAGAGCCTGGCTGGCCACACAGGAACCTGCCCTGGGCCTG GCAGGCACAGTGGCCACACTGGTCTTGGCTGCAGCTGGGAACCTACTCATTATTGCTGCTTTCACAGCC ACCCTGCTTCGGGCCCCCAGTACATGCCCTCTGCTGCAGGGTGGCCCACTGGAGGGGGGTACCCAGGCC AAACAACAG ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAAAC This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View
    [Show full text]
  • Glyphosate Poisoning
    Toxicol Rev 2004; 23 (3): 159-167 REVIEW ARTICLE 1176-2551/04/0003-0159/$31.00/0 © 2004 Adis Data Information BV. All rights reserved. Glyphosate Poisoning Sally M. Bradberry, Alex T. Proudfoot and J. Allister Vale National Poisons Information Service (Birmingham Centre) and West Midlands Poisons Unit, City Hospital, Birmingham, UK Contents Abstract ...............................................................................................................159 1. Epidemiology .......................................................................................................160 2. Mode of Action .....................................................................................................161 3. Mechanisms of Toxicity ..............................................................................................161 3.1 Glyphosate ....................................................................................................161 3.1.1 Acute Toxicity ............................................................................................161 3.1.2 Chronic Toxicity ...........................................................................................161 3.2 Surfactants .....................................................................................................161 3.2.1 Polyoxyethyleneamine ....................................................................................162 3.2.2 Surfactants Derived from Plant Fats .........................................................................162 3.2.3 Other Surfactants
    [Show full text]
  • Neuroprotection in Perimenopause New Insights for Hormone Therapy
    ISSN: 2573-9565 Review Article Journal of Clinical Review & Case Reports Neuroprotection in Perimenopause New Insights for Hormone Therapy Manuela Cristina Russu MD, Ph.D *Corresponding author Manuela Cristina Russu: “Dr I Cantacuzino” Clinic of Obstetrics and Gynecology; “Carol Davila” University of Medicine and Pharmacy, Bucharest, 5-7 Ion Movilă Professor of Obstetrics and Gynecology Street, District 2, zip code 020745. Romania Submitted: 18 Mar 2020; Accepted: 25 Mar 2020; Published: 03 Apr 2020 Abbreviations a demented status to progress from early stages of endocrine aging FMP: Final Menstrual Period process [1]. HPOA: Hypothalamic-Pituitary-Ovarian Axis MT: Menopausal Transition Update on the importance of Hormone Therapy in perimenopause VMS: Vasomotor Symptoms The menopausal transition (MT) or perimenopause– 4 to 6 years MHT: Menopausal Hormone Therapy duration [2]. with reproductive and dynamic critical changes in ERT: Estrogen Replacement Therapy hypothalamic-pituitary-ovarian axis (HPOA), and entire women’s PCC: Posterior Cingulate Cortex body, biology and psychology, starts with menstrual irregularities MCI: Mild Cognitive Impairment from the stage -3b/-3a in the late reproductive ages, with ethnic AD: Alzheimer ’s disease differences in symptoms, hormones and their receptors and actions PD: Parkinson’s Disease [3, 4]. Aβ: Beta Amyloid CVD: Cerebrovascular Disease CAA: Cerebral Amyloid Angiopathy HS: Hippocampal Sclerosis 17ß-E2: 17ß-Estradiol CEE: Conjugated Equine Estrogens ERs: Estrogen Receptors Pg: Progesterone PRs:
    [Show full text]
  • Lactic Acid Bacteria Mediated Phenolic Bioactive Modulation from Fruit Systems for Health Benefits Chandrakant Ankolekar University of Massachusetts Amherst
    University of Massachusetts Amherst ScholarWorks@UMass Amherst Open Access Dissertations 2-2013 Lactic Acid Bacteria Mediated Phenolic Bioactive Modulation From Fruit Systems For Health Benefits Chandrakant Ankolekar University of Massachusetts Amherst Follow this and additional works at: https://scholarworks.umass.edu/open_access_dissertations Part of the Food Science Commons Recommended Citation Ankolekar, Chandrakant, "Lactic Acid Bacteria Mediated Phenolic Bioactive Modulation From Fruit Systems For Health Benefits" (2013). Open Access Dissertations. 678. https://doi.org/10.7275/hbya-c596 https://scholarworks.umass.edu/open_access_dissertations/678 This Open Access Dissertation is brought to you for free and open access by ScholarWorks@UMass Amherst. It has been accepted for inclusion in Open Access Dissertations by an authorized administrator of ScholarWorks@UMass Amherst. For more information, please contact [email protected]. LACTIC ACID BACTERIA MEDIATED PHENOLIC BIOACTIVE MODULATION FROM FRUIT SYSTEMS FOR HEALTH BENEFITS A Dissertation Presented By CHANDRAKANT R. ANKOLEKAR Submitted to the Graduate School of the University of Massachusetts Amherst in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY February 2013 Department of Food Science © Copyright by CHANDRAKANT R. ANKOLEKAR 2013 All Rights Reserved LACTIC ACID BACTERIA BASED PHENOLIC BIOACTIVE MODULATION FROM FRUIT SYSTEMS FOR HEALTH BENEFITS A Dissertation Presented By CHANDRAKANT R. ANKOLEKAR Approved as to style and content by: ____________________________________ Kalidas Shetty, Chair ____________________________________ Ronald Labbè, Member ____________________________________ Young-Cheul Kim, Member ____________________________________ Hang Xiao, Member Eric Decker, Department Head Food Science DEDICATION To my parents, my brother and Gitanjeli who have made this possible ACKNOWLEDGMENTS I would like to thank God for all the opportunities given to me and my family.
    [Show full text]
  • Molecular Pathways of Estrogen Receptor Action
    International Journal of Molecular Sciences Molecular Pathways of Estrogen Receptor Action Edited by Farzad Pakdel Printed Edition of the Special Issue Published in International Journal of Molecular Sciences www.mdpi.com/journal/ijms Molecular Pathways of Estrogen Receptor Action Molecular Pathways of Estrogen Receptor Action Special Issue Editor Farzad Pakdel MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade Special Issue Editor Farzad Pakdel University of Rennes France Editorial Office MDPI St. Alban-Anlage 66 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal International Journal of Molecular Sciences (ISSN 1422-0067) from 2017 to 2018 (available at: https: //www.mdpi.com/journal/ijms/special issues/estrogen) For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Article Number, Page Range. ISBN 978-3-03897-296-9 (Pbk) ISBN 978-3-03897-297-6 (PDF) Articles in this volume are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles even for commercial purposes, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications. The book taken as a whole is c 2018 MDPI, Basel, Switzerland, distributed under the terms and conditions of the Creative Commons license CC BY-NC-ND (http://creativecommons.org/licenses/by-nc-nd/4.0/). Contents About the Special Issue Editor ...................................... vii Farzad Pakdel Molecular Pathways of Estrogen Receptor Action Reprinted from: Int.
    [Show full text]
  • Phytoestrogens in Foods in the Nordic Market
    TemaNord 2017:541 Phytoestrogens in foods on the Nordic market the Nordic on foods in 2017:541 Phytoestrogens TemaNord Nordic Council of Ministers Nordens Hus Ved Stranden 18 DK-1061 Copenhagen K www.norden.org Phytoestrogens in foods on the Nordic market Phytoestrogens are plant-derived compounds that may bind to estrogen receptors, but with less affinity than the natural ligand estradiol. They may be biologically active as such or after metabolization in our body. To investigate the occurrence and level of phytoestrogens, scientific literature was screened for data on isoflavones, lignans, stilbenes and coumestans in raw and processed foods of plant origin. The review presents data based both on analytical methods hydrolysing glucosides and non-destructive methods. Many phytoestrogens are phytoalexins. Their production is induced when plants are exposed to abiotic and/or biotic stress. This could explain the rather different levels reported in plants by various investigators, and indicates that many samples are required to describe the levels generally occurring in foodstuffs. The influence of food processing was also considered. Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson TemaNord 2017:541 Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson ISBN 978-92-893-5046-4 (PRINT) ISBN 978-92-893-5047-1 (PDF) ISBN 978-92-893-5048-8 (EPUB) http://dx.doi.org/10.6027/TN2017-541 TemaNord 2017:541 ISSN 0908-6692 Standard: PDF/UA-1 ISO 14289-1 © Nordic Council of Ministers 2017 Cover photo: Unsplash.com Print: Rosendahls Printed in Denmark Although the Nordic Council of Ministers funded this publication, the contents do not necessarily reflect its views, policies or recommendations.
    [Show full text]
  • Primary and Secondary Metabolites Variation of Soybean Contaminated with Aspergillus Sojae
    Food Research International 54 (2013) 487–494 Contents lists available at SciVerse ScienceDirect Food Research International journal homepage: www.elsevier.com/locate/foodres Primary and secondary metabolites variation of soybean contaminated with Aspergillus sojae K.M. Maria John a,EunSungJunga,SarahLeea, Jong-Sang Kim b, Choong Hwan Lee a,⁎ a Department of Bioscience and Biotechnology, Konkuk University, Seoul 143-701, Republic of Korea b School of Food Science and Biotechnology, Kyungpook National University, Daegu 702-701, Republic of Korea article info abstract Article history: Time-dependent primary and secondary metabolite changes of soybean contaminated with Aspergillus sojae and Received 23 April 2013 their associations were discussed. Partial least squares discriminant analysis showed that the patterns of fungus Accepted 15 July 2013 infected soybean were clearly distinguished from untreated samples based on its time intervals. A. sojae depends Available online 22 July 2013 on soybean for its carbon source resulting gradual decrease in the glucose, fructose and myo-inositol levels. The stimulation in L-phenylalanine by A. sojae increases the accumulation of naringenin from days 1 to 6, leading Keywords: to the changes in genistein pool. Even though the level of glucosides like daidzin, genistin and glycitin decreased Aspergillus sojae fl Gas chromatography–time of flight–mass during treatment, other iso avones and coumestan levels enhanced. Due to the increase in glycinol, the resulting spectrometry (GC-TOF-MS) phytoalexins such as glyceollin I and glyceollin II augmented by fungal treatment. The changes in secondary Isoflavones metabolites reflects in total phenolic content and because of the increase in glyceollin I, II and glyceofuran re- Phytoalexins flect their radical scavenging capacity; A.
    [Show full text]
  • WO 2013/184908 A2 12 December 2013 (12.12.2013) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2013/184908 A2 12 December 2013 (12.12.2013) P O P C T (51) International Patent Classification: Jr.; One Procter & Gamble Plaza, Cincinnati, Ohio 45202 G06F 19/00 (201 1.01) (US). HOWARD, Brian, Wilson; One Procter & Gamble Plaza, Cincinnati, Ohio 45202 (US). (21) International Application Number: PCT/US20 13/044497 (74) Agents: GUFFEY, Timothy, B. et al; c/o The Procter & Gamble Company, Global Patent Services, 299 East 6th (22) Date: International Filing Street, Sycamore Building, 4th Floor, Cincinnati, Ohio 6 June 2013 (06.06.2013) 45202 (US). (25) Filing Language: English (81) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (30) Priority Data: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, 61/656,218 6 June 2012 (06.06.2012) US DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (71) Applicant: THE PROCTER & GAMBLE COMPANY HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KN, KP, KR, [US/US]; One Procter & Gamble Plaza, Cincinnati, Ohio KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 45202 (US). MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, (72) Inventors: XU, Jun; One Procter & Gamble Plaza, Cincin SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, nati, Ohio 45202 (US).
    [Show full text]