DOCSLIB.ORG

Cloning of Two Rat PDIP1 Related Genes and Their Interactions with Proliferating Cell Nuclear Antigen

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cloning of Two Rat PDIP1 Related Genes and Their Interactions with Proliferating Cell Nuclear Antigen ____________________________________________________________________________http://www.paper.edu.cn JOURNAL OF EXPERIMENTAL ZOOLOGY 303A:227–240 (2005) Cloning of Two Rat PDIP1 Related Genes and Their Interactions With Proliferating Cell Nuclear Antigen JIANLIN ZHOU1, XIAOXIAO HU1, XIWEN XIONG1, XIN LIU, YUNHAI LIU, KAIQUN REN, TIESHAN JIANG, XIANG HU, AND JIAN ZHANGn Department of Biochemistry and Molecular Biology, College of Life Science, Hunan Normal University, Changsha, Hunan 410081, China ABSTRACT Human polymerase delta-interacting protein 1 (PDIP1) is a tumor necrosis factor a and interleukin 6 inducible protein that interacts directly with proliferating cell nuclear antigen (PCNA) and the small subunit (p50) of DNA polymerase d. PDIP1 binds PCNA and p50 simultaneously and stimulates polymerase d activity in vitro in the presence, but not the absence, of PCNA. It has been suggested that PDIP1 provides a link between cytokine activation and DNA replication in eukaryotes. Here these authors report the cloning of two rat genes homologous to human PDIP1, termed rat PDIP1 and rat tumor necrosis factor-induced protein 1 (TNFAIP1). The rat PDIP1 is mapped to chromosome 1q36 cM region, spans approximately 18.7 kb, and is organized into six exons. The rat TNFAIP1 gene is mapped to chromosome 10q25 cM, spans approximately 12.9 kb, and is composed of seven exons. The deduced proteins of rat PDIP1 and rat TNFAIP1 share 63.1% sequence identity with each other and are highly conserved in the majority of the middle portion of the two proteins, which encode a BTB/POZ domain at the N-terminus and a PCNA binding motif (QTKV-EFP) at the C-terminus, respectively. The BTB / POZ domain and the PCNA binding motif are highly conserved during the evolution. Both rat PDIP1 and rat TNFAIP1 were demonstrated to interact with PCNA via BIAcore, GST pull-down, and co-immunoprecipitation assays. Like the human PDIP1, both rat PDIP1 and rat TNFAIP1 stimulate polymerase d activity in vitro in a PCNA-dependent way. J. Exp. Zool. 303A:227–240, 2005. r 2005 Wiley-Liss, Inc. Human PDIP1 was first identified as an inter- pol d core enzyme consists of two subunits, the acting partner of the small subunit (p50) of catalytic subunit of p125 and the small subunit of eukaryotic DNA polymerase d (pol d) in a yeast p50. It has been demonstrated that the processiv- two-hybrid screening of HepG2 cDNA library ity of the recombinant 125–kDa catalytic subunit using p50 as a bait (He et al., 2001). It was further of human pol d is not responsive to PCNA, shown that PDIP1 also interacts with proliferat- whereas coexpression of the catalytic (p125) and ing cell nuclear antigen (PCNA). DNA polymerase small (p50) subunits of pol d results in the d is one of the major polymerases to replicate formation of a recombinant heterodimer whose chromosomal DNA; its processivity is markedly processivity is markedly stimulated by PCNA increased in the presence of PCNA. PCNA is a (Zhou et al., ’96). A recent report from the multifunctional protein that plays roles in a laboratory of Antero G. So showed that PCNA variety of cellular processes, including DNA directly interacts with p50, not with p125 (Lu replication, DNA repair, and cell cycle control by et al., 2002). It has been proposed that the small interacting with proteins involved in these pro- subunit functions as a bridge connecting the cesses (Prelich et al., ’87; Gulbis et al., ’96; catalytic subunit and PCNA. The human PDIP1 Tsurimoto, ’99; Kedar et al., 2002). For example, binds simultaneously to PCNA and p50, and the interaction between PCNA and DNA pol d is essential for processive DNA synthesis during DNA replication. PCNA functions as a sliding Grant Sponsor: National Natural Science Foundation of China; Grant numbers: 30025009; 30270723 DNA clamp that forms a closed ring around duplex n Correspondence to: Jian Zhang, Department of Biochemistry and DNA. The binding of pol d to PCNA provides an Molecular Biology, College of Life Science, Hunan Normal University, elegant micromechanical solution to the biological Changsha, Hunan 410081, China. E-mail: [email protected]/ [email protected]. need to maintain an extraordinarily high level of Received 30 March 2004; Accepted 8 November 2004 processivity during the synthesis of chromosomal Published online in Wiley InterScience (www.interscience.wiley. com). DOI: 10.1002/jez.a.150 DNA (Prelich et al., ’87; Krishna et al., ’94). The 1These authors contributed equally to the work. r 2005 WILEY-LISS, INC. 中国科技论文在线___________________________________________________________________________http://www.paper.edu.cn 228 J. ZHOU ET AL. stimulates pol d activity in the presence, but not in RT-PCR the absence, of PCNA (He et al., 2001). To confirm the sequences of two contigs The 1.6 kb cDNA of PDIP1 encodes a protein of assembled by overlapping EST, two pairs of 36 kDa that is highly homologous to one of the primers were designed and used to amplify the early response genes induced by TNF-a, the B12 rat liver cDNA. One pair of primers (Forward: (Wolf et al., ‘92), lately renamed as human GCGTGGAAGTGCTCACAG, Reverse: GAC- TNFAIP1. It has been shown that the expression TAGGTCCCAGAAGCAAG) correspond to 50–end of human PDIP1 can be induced by TNF-a and IL– sequence of BE110670 and 30–end sequence of 6 (He et al., 2001). TNF-a is a multifunctional AW141960, respectively. Another pair of primers cytokine which participates in wide biological (Forward: GGTGGTGAAGCTGCTGTAC, Re- activities, such as apoptosis, proliferation, B cell verse: CAAGGAATTGTCAGGGACTC) corre- activation, and some inflammatory responses spond to 50–end sequence of BF551628 and 30– (Fiers et al., ’95). Especially, TNF-a plays im- end sequence of AI598359. Amplification was portant roles during liver regeneration. Several conducted in the Mastercycler (Eppendorf, Ger- converging lines of evidence from recent work many) using HotStarTaq polymerase (Qiagen) have established that TNF-a and IL–6 are im- for 30 cycles of 941C for 30 sec, 541C/531C for 30 portant components of the early signaling path- sec, and 721C for 1 min. The products were cloned ways triggering liver regeneration after loss of into pMD18–T vector (TaKaLa, Dalian, China) hepatic tissues (reviewed in Michalopoulos and and sequenced. All primers used in the study DeFrances, ’97; Fauto, 2000). The findings that were designed by NetPremer (http://www. PDIP1 is inducible by TNF-a and IL–6, and that it premierbiosoft.com/netprimer). physically and functionally interacts with both PCNA and the small subunit of pol d when taken together, suggest that PDIP1 may play a role in the regulation of hepatocyte replication induced by TNF-a and IL–6, probably by providing a link 30 and 50 rapid amplification of cDNA ends between cytokine activation and DNA replication (RACE) for rat PDIP1 and TNFAIP1 (He et al., 2001). The rat homologue of human PDIP1 was cloned to determine whether and how After the sequences of two contigs were con- PDIP1 is involved in the liver regeneration, using firmed, 50–RACE and 30–RACE were performed to the rat partial hepatectomy model. These data extend the 50 upstream and 30 downstream describe the cloning of two rat homologues and sequences of the contigs using the SMART RACE show that the PDIP1 and related proteins are cDNA amplification kit (Clontech, Palo Alto, CA). highly conserved. It is further demonstrated that In brief, 1 mg of total RNA extracted from rat liver these two rat homologues interact directly with tissue was reverse-transcribed with the oligo (dT)- PCNA via BIAcore, pull-down, and co-immuno- anchor primer, and with the oligo (dT) primer and precipitation assays, and stimulate pol d activity in 50–anchor oligonucleotide provided in the kit for 30 vitro in a PCNA-dependent way. and 50 RACE, respectively. 50 RACE and 30 RACE were performed with the PDIP1 or TNFAIP1 gene–specific primer (Table 1) and the universal primer (UPM) provided in the kit, using HotStar- MATERIALS AND METHODS Taq polymerase. The PCR condition was as follows: a pre-incubation at 951C for 2 min, initial RNA preparation and reverse five cycles of 941C for 30 sec and 721C for 3 min, transcription followed by five cycles of 941C for 30 sec, 701C for Eight week-old male Wistar rats were sacrificed 30 sec, 721C for 3 min, and ended with 27 cycles of by carbon dioxide euthanasia. The total RNA was 941C for 30 sec, 681C for 30 sec, and 721C for 3 min. isolated from the liver tissue using UNIQ–10 Total To confirm the 30 and 50 RACE products, nested RNA Minipreps Super kit (Sangon, Shanghai, PCR was performed with the nested gene-specific China). The purified RNA was used for first- primer (Table 1) and nested universal primer strand cDNA synthesis and amplification of both (NUP) provided in the kit under the same 50 and 30 cDNA ends. The first strand of cDNA was conditions. The amplified products were purified synthesized by oligo-dT priming using Sensiscript with QIAquick Gel Extraction kit (Qiagen), cloned RT Kit (Qiagen, Valencia, CA). into pMD18–T vector and sequenced. 中国科技论文在线___________________________________________________________________________http://www.paper.edu.cn TWO RAT PDIP1 HOMOLOUGES INTERACT WITH PCNA 229 TABLE 1. Gene-speci¢c primers (GSPs) and nested gene-speci¢c TNFAIP1) were transformed into E. coli BL21. primers (NGSPs) used in RACE reactions The transformant containing pT7–PCNA was Primer Sequence (50 to 30) grown at 371C until an OD600 of 0.5–0.6 was reached. Expression was induced with 1 mM IPTG PDIP1-50GSP TGGTACTCTCAGGCAGTGGCACTGACC (final concentration) at 371C. The other two PDIP1-50NGSP GGCCACTCCGGTCAATCAGCACC 0 transformants (pGEX–4T–2–PDIP1 and pGEX– PDIP1-3 GSP CCATATCACCCATGATGAGCGTCCTCA 1 PDIP1-30NGSP GGCCAACAGATTGTCTTCAAGGACTGACC 4T–2–TNFAIP1) were grown at 37 C until an TNFAIP1-50GSP GGTGATCATCAGAGTTGCTGGTGTACGAGT OD600 of 1.0 was reached.
Load more

Recommended publications
  • Transcriptional Regulation of RKIP in Prostate Cancer Progression
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Sciences Transcriptional Regulation of RKIP in Prostate Cancer Progression Submitted by: Sandra Marie Beach In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences Examination Committee Major Advisor: Kam Yeung, Ph.D. Academic William Maltese, Ph.D. Advisory Committee: Sonia Najjar, Ph.D. Han-Fei Ding, M.D., Ph.D. Manohar Ratnam, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: May 16, 2007 Transcriptional Regulation of RKIP in Prostate Cancer Progression Sandra Beach University of Toledo ACKNOWLDEGMENTS I thank my major advisor, Dr. Kam Yeung, for the opportunity to pursue my degree in his laboratory. I am also indebted to my advisory committee members past and present, Drs. Sonia Najjar, Han-Fei Ding, Manohar Ratnam, James Trempe, and Douglas Pittman for generously and judiciously guiding my studies and sharing reagents and equipment. I owe extended thanks to Dr. William Maltese as a committee member and chairman of my department for supporting my degree progress. The entire Department of Biochemistry and Cancer Biology has been most kind and helpful to me. Drs. Roy Collaco and Hong-Juan Cui have shared their excellent technical and practical advice with me throughout my studies. I thank members of the Yeung laboratory, Dr. Sungdae Park, Hui Hui Tang, Miranda Yeung for their support and collegiality. The data mining studies herein would not have been possible without the helpful advice of Dr. Robert Trumbly. I am also grateful for the exceptional assistance and shared microarray data of Dr.
    [Show full text]
  • Systems Analysis Implicates WAVE2&Nbsp
    JACC: BASIC TO TRANSLATIONAL SCIENCE VOL.5,NO.4,2020 ª 2020 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/). PRECLINICAL RESEARCH Systems Analysis Implicates WAVE2 Complex in the Pathogenesis of Developmental Left-Sided Obstructive Heart Defects a b b b Jonathan J. Edwards, MD, Andrew D. Rouillard, PHD, Nicolas F. Fernandez, PHD, Zichen Wang, PHD, b c d d Alexander Lachmann, PHD, Sunita S. Shankaran, PHD, Brent W. Bisgrove, PHD, Bradley Demarest, MS, e f g h Nahid Turan, PHD, Deepak Srivastava, MD, Daniel Bernstein, MD, John Deanfield, MD, h i j k Alessandro Giardini, MD, PHD, George Porter, MD, PHD, Richard Kim, MD, Amy E. Roberts, MD, k l m m,n Jane W. Newburger, MD, MPH, Elizabeth Goldmuntz, MD, Martina Brueckner, MD, Richard P. Lifton, MD, PHD, o,p,q r,s t d Christine E. Seidman, MD, Wendy K. Chung, MD, PHD, Martin Tristani-Firouzi, MD, H. Joseph Yost, PHD, b u,v Avi Ma’ayan, PHD, Bruce D. Gelb, MD VISUAL ABSTRACT Edwards, J.J. et al. J Am Coll Cardiol Basic Trans Science. 2020;5(4):376–86. ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2020.01.012 JACC: BASIC TO TRANSLATIONALSCIENCEVOL.5,NO.4,2020 Edwards et al. 377 APRIL 2020:376– 86 WAVE2 Complex in LVOTO HIGHLIGHTS ABBREVIATIONS AND ACRONYMS Combining CHD phenotype–driven gene set enrichment and CRISPR knockdown screening in zebrafish is an effective approach to identifying novel CHD genes.
    [Show full text]
  • Multi-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener Erythritol
    Multi-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener Erythritol Danie¨lle M. P. H. J. Boesten1*., Alvin Berger2.¤, Peter de Cock3, Hua Dong4, Bruce D. Hammock4, Gertjan J. M. den Hartog1, Aalt Bast1 1 Department of Toxicology, Maastricht University, Maastricht, The Netherlands, 2 Global Food Research, Cargill, Wayzata, Minnesota, United States of America, 3 Cargill RandD Center Europe, Vilvoorde, Belgium, 4 Department of Entomology and UCD Comprehensive Cancer Center, University of California Davis, Davis, California, United States of America Abstract Diabetes is characterized by hyperglycemia and development of vascular pathology. Endothelial cell dysfunction is a starting point for pathogenesis of vascular complications in diabetes. We previously showed the polyol erythritol to be a hydroxyl radical scavenger preventing endothelial cell dysfunction onset in diabetic rats. To unravel mechanisms, other than scavenging of radicals, by which erythritol mediates this protective effect, we evaluated effects of erythritol in endothelial cells exposed to normal (7 mM) and high glucose (30 mM) or diabetic stressors (e.g. SIN-1) using targeted and transcriptomic approaches. This study demonstrates that erythritol (i.e. under non-diabetic conditions) has minimal effects on endothelial cells. However, under hyperglycemic conditions erythritol protected endothelial cells against cell death induced by diabetic stressors (i.e. high glucose and peroxynitrite). Also a number of harmful effects caused by high glucose, e.g. increased nitric oxide release, are reversed. Additionally, total transcriptome analysis indicated that biological processes which are differentially regulated due to high glucose are corrected by erythritol. We conclude that erythritol protects endothelial cells during high glucose conditions via effects on multiple targets.
    [Show full text]
  • Nutrient Health and EROEN Compounds Resegsterixsteextics: Production * Gets Cartrai, Agairaxxxix
    US 2011 O153221A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0153221 A1 Stefanon et al. (43) Pub. Date: Jun. 23, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING (52) U.S. Cl. .......................................................... 702/19 NUTRITION AND PHARMACOLOGICAL PRODUCTS FOR ANIMALS (57) ABSTRACT (76) Inventors: Bruno Stefanon, Martignacco (IT): W.Year Jean Dodds.Odds, Santa Monica,IVIon1ca, CA An analysis of the profile of a non-human animal comprises: a) providing a genotypic database to the species of the non (21) Appl. No.: 12/927,769 human animal Subject or a selected group of the species; b obtaining animal data; c) correlating the database of a) with (22) Filed:1-1. Nov. 19, 2010 the data ofb) to determinea relationshipp between the database of a) and the data of b); c) determining the profile of the Related U.S. Application Data animal based on the correlating step; and d) determining a (63)63) ContinuationConti offaroplication application No. 12/316.824,:4'. filed'O geneticmolecular profile dietary based signature on the being molecular a variation dietary of signature, expression the of Dec. 16, 2008, now Pat. No. 7,873,482. a set of genes which may differ for the genotype of each O O animal or a group of animals Nutrition and pharmalogical Publication Classification assessments are made. Reporting the determination is by the (51) Int. Cl. Internet, and payment for the report is obtained through the G06F 9/00 (2011.01) Internet. 38s. 4 gas registics, $88's *.icisixxxiiserscies: 8 texrigixi exsix * processire statisy • Essex: 88& goEffect onXXXXWWYYX Nutrient health and EROEN Compounds resegsterixsteextics: production * gets cartrai, agairaxxxix.
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • POLDIP2 Antibody (Center) Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap7626c
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 POLDIP2 Antibody (Center) Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP7626c Specification POLDIP2 Antibody (Center) - Product Information Application WB,E Primary Accession Q9Y2S7 Other Accession Q91VA6 Reactivity Human Predicted Mouse Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 42033 Antigen Region 105-133 POLDIP2 Antibody (Center) - Additional Information Western blot analysis of POLDIP2 antibody (Center) (Cat.#AP7626c) in A375 cell line Gene ID 26073 lysates (35ug/lane). POLDIP2 (arrow) was Other Names detected using the purified Pab. Polymerase delta-interacting protein 2, 38 kDa DNA polymerase delta interaction protein, p38, POLDIP2, PDIP38, POLD4 POLDIP2 Antibody (Center) - Background Target/Specificity POLDIP2 is a protein that interacts with the This POLDIP2 antibody is generated from DNA polymerase delta p50 subunit. This rabbits immunized with a KLH conjugated protein also interacts with proliferating cell synthetic peptide between 105-133 amino nuclear antigen. Some transcripts of POLDIP2 acids from the Central region of human gene overlap in a tail-to-tail orientation with POLDIP2. the gene for tumor necrosis factor, alpha-induced protein 1 (TNFAIP1). Dilution WB~~1:1000 POLDIP2 Antibody (Center) - References Format Cheng,X., Kanki,T. J. Biochem. 138 (6), Purified polyclonal antibody supplied in PBS 673-678 (2005) with 0.09% (W/V) sodium azide. This Liu,L., Rodriguez-Belmonte,E.M. J. Biol. Chem. antibody is prepared by Saturated 278 (12), 10041-10047 (2003) Ammonium Sulfate (SAS) precipitation followed by dialysis against PBS. Storage Maintain refrigerated at 2-8°C for up to 2 weeks.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
    US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al.
    [Show full text]
  • Integration of Molecular Interactome and Targeted Interaction Analysis To
    www.nature.com/scientificreports OPEN Integration of Molecular Interactome and Targeted Interaction Analysis to Identify a Received: 2 November 2017 Accepted: 20 August 2018 COPD Disease Network Module Published: xx xx xxxx Amitabh Sharma1,3,4,5, Maksim Kitsak4, Michael H. Cho 1,2,3, Asher Ameli1,10, Xiaobo Zhou1,3, Zhiqiang Jiang1, James D. Crapo6, Terri H. Beaty 7, Jörg Menche8, Per S. Bakke9, Marc Santolini 1,4,5 & Edwin K. Silverman1,2,3 The polygenic nature of complex diseases ofers potential opportunities to utilize network-based approaches that leverage the comprehensive set of protein-protein interactions (the human interactome) to identify new genes of interest and relevant biological pathways. However, the incompleteness of the current human interactome prevents it from reaching its full potential to extract network-based knowledge from gene discovery eforts, such as genome-wide association studies, for complex diseases like chronic obstructive pulmonary disease (COPD). Here, we provide a framework that integrates the existing human interactome information with experimental protein- protein interaction data for FAM13A, one of the most highly associated genetic loci to COPD, to fnd a more comprehensive disease network module. We identifed an initial disease network neighborhood by applying a random-walk method. Next, we developed a network-based closeness approach (CAB) that revealed 9 out of 96 FAM13A interacting partners identifed by afnity purifcation assays were signifcantly close to the initial network neighborhood. Moreover, compared to a similar method (local radiality), the CAB approach predicts low-degree genes as potential candidates. The candidates identifed by the network-based closeness approach were combined with the initial network neighborhood to build a comprehensive disease network module (163 genes) that was enriched with genes diferentially expressed between controls and COPD subjects in alveolar macrophages, lung tissue, sputum, blood, and bronchial brushing datasets.
    [Show full text]
  • Microrna-372 Maintains Oncogene Characteristics by Targeting TNFAIP1 and Affects Nfκb Signaling in Human Gastric Carcinoma Cells
    INTERNATIONAL JOURNAL OF ONCOLOGY 42: 635-642, 2013 microRNA-372 maintains oncogene characteristics by targeting TNFAIP1 and affects NFκB signaling in human gastric carcinoma cells CHANG ZHOU*, XIAOFENG LI*, XIAOTING ZHANG, XIZHI LIU, ZHIWEN TAN, CELI YANG and JIAN ZHANG Key Laboratory of Protein Chemistry and Developmental Biology of State Education Ministry of China, College of Life Science, Hunan Normal University, Changsha, Hunan 410081, P.R. China Received September 19, 2012; Accepted November 23, 2012 DOI: 10.3892/ijo.2012.1737 Abstract. Aberrant microRNA (miRNA) expression has been and carcinogenesis (4). Thus, deregulation of miRNA expres- investigated in gastric cancer, which is one of the most common sion may lead to a variety of disorders, including human malignancies. However, the roles of miRNAs in gastric cancer cancer. Emerging evidence indicates that several miRNAs are remain largely unknown. In the present study, we found that deregulated in human malignancies and it has been proposed microRNA-372 (miR-372) directly targets tumor necrosis that some miRNAs may have oncogenic or tumor suppressor factor, α-induced protein 1 (TNFAIP1), and is involved in the functions (5). For instance, the miR-17-92 cluster is markedly regulation of the NFκB signaling pathway. Furthermore, over- overexpressed in B-cell lymphomas and miR-124 has been expression of TNFAIP1 induced changes in AGS cells similar documented as a tumor suppressor capable of inhibiting cell to those in AGS cells treated with miR-372-ASO. Collectively, proliferation of glioma (6,7). these findings demonstrate an oncogenic role for miR-372 in Gastric cancer is one of the most common malignancies controlling cell growth and apoptosis through downregulation and the second leading cause of cancer-related mortality of TNFAIP1.
    [Show full text]
  • Identification of Potential Core Genes in Sevoflurance Induced Myocardial
    Identication of Potential core genes in Sevourance induced Myocardial Energy Metabolism in Patients Undergoing Off-pump Coronary Artery Bypass Graft Surgery using Bioinformatics analysis Hua Lin ( [email protected] ) Tianjin Medical University General Hospital Airport Site Research article Keywords: sevourane, Myocardial Energy Metabolism, Off-pump Coronary Artery Bypass Graft Surgery Posted Date: November 18th, 2019 DOI: https://doi.org/10.21203/rs.2.17434/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Background: Myocardial ischemia-reperfusion injury always happened after Off-pump coronary artery bypass graft(OPCABG), and this can not be avoided altogether. In this study, we tried to detect potential genes of sevourane-induced myocardial energy metabolism in patients undergoing OPCABG using bioinformatics analysis. Methods: We download and analyze the gene expression prole data from the Gene Expression Omnibus(GEO) database using bioinformatics methods. We downloded the gene expression data from the Gene Expression Omnibus(GEO) database using bioinformatics methods. Gene Ontology(GO) functional annotation analysis and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis were used to analysis the screened differentially expressed genes(DEGs). Then, we established a protein–protein interaction (PPI) network to nd hub genes associated with myocardial energy metabolism. Results: Through PPI network, we nd ten hub genes, including JUN, EGR1, ATF3, FOSB, JUNB, DUSP1, EGR2, NR4A1, BTG2, NR4A2. Conclusions: In conclusion, the proteins encoded by EGR1ATF3c-FosBtg2JunBDUSP1NR4A1BTG2 and NR4A2 were related to cardiac function. ATF3, FOSB, JUNB, DUSP1, NR4A1, NR4A2 are related to apoptosis of cardiomyocytes. The protein encoded by BTG2 is related to hypertrophy.
    [Show full text]
  • Characterization of Poldip2 Knockout Mice: Avoiding Incorrect Gene Targeting
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.02.429447; this version posted February 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Characterization of Poldip2 knockout mice: avoiding incorrect gene targeting Bernard Lassègue1*, Sandeep Kumar2, Rohan Mandavilli1, Keke Wang1, Michelle Tsai1, Dong-Won Kang2, Marina S. Hernandes1, Alejandra San Martín1, Hanjoong Jo1,2, W. Robert Taylor1,2,3 and Kathy K. Griendling1 1Division of Cardiology, Department of Medicine, Emory University, Atlanta, GA 2Wallace H. Coulter Department of Biomedical Engineering, Emory University and Georgia Institute of Technology, Atlanta, GA 3Division of Cardiology, Atlanta VA Medical Center, Decatur, GA Running title: Poldip2 knockout mice Keywords: Poldip2, mouse, conditional knockout, constitutive knockout, gene targeting, ectopic targeting, gene duplication, unexpected mutation *Corresponding author: Bernard Lassègue Division of Cardiology Emory University School of Medicine 101 Woodruff Circle WMB 308B Atlanta, GA 30322 [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.02.02.429447; this version posted February 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract POLDIP2 is a multifunctional protein whose roles are only partially understood. Our laboratory previously reported physiological studies performed using a mouse gene trap model, which suffered from two limitations: perinatal lethality in homozygotes and constitutive Poldip2 inactivation. To overcome these limitations, we developed a new conditional floxed Poldip2 model. The first part of the present study shows that our initial floxed mice were affected by an unexpected mutation, which was not readily detected by Southern blotting and traditional PCR.
    [Show full text]
  • Spatial Maps of Prostate Cancer Transcriptomes Reveal an Unexplored Landscape of Heterogeneity
    ARTICLE DOI: 10.1038/s41467-018-04724-5 OPEN Spatial maps of prostate cancer transcriptomes reveal an unexplored landscape of heterogeneity Emelie Berglund1, Jonas Maaskola1, Niklas Schultz2, Stefanie Friedrich3, Maja Marklund1, Joseph Bergenstråhle1, Firas Tarish2, Anna Tanoglidi4, Sanja Vickovic 1, Ludvig Larsson1, Fredrik Salmeń1, Christoph Ogris3, Karolina Wallenborg2, Jens Lagergren5, Patrik Ståhl1, Erik Sonnhammer3, Thomas Helleday2 & Joakim Lundeberg 1 1234567890():,; Intra-tumor heterogeneity is one of the biggest challenges in cancer treatment today. Here we investigate tissue-wide gene expression heterogeneity throughout a multifocal prostate cancer using the spatial transcriptomics (ST) technology. Utilizing a novel approach for deconvolution, we analyze the transcriptomes of nearly 6750 tissue regions and extract distinct expression profiles for the different tissue components, such as stroma, normal and PIN glands, immune cells and cancer. We distinguish healthy and diseased areas and thereby provide insight into gene expression changes during the progression of prostate cancer. Compared to pathologist annotations, we delineate the extent of cancer foci more accurately, interestingly without link to histological changes. We identify gene expression gradients in stroma adjacent to tumor regions that allow for re-stratification of the tumor micro- environment. The establishment of these profiles is the first step towards an unbiased view of prostate cancer and can serve as a dictionary for future studies. 1 Department of Gene Technology, School of Engineering Sciences in Chemistry, Biotechnology and Health, Royal Institute of Technology (KTH), Science for Life Laboratory, Tomtebodavägen 23, Solna 17165, Sweden. 2 Department of Oncology-Pathology, Karolinska Institutet (KI), Science for Life Laboratory, Tomtebodavägen 23, Solna 17165, Sweden. 3 Department of Biochemistry and Biophysics, Stockholm University, Science for Life Laboratory, Tomtebodavägen 23, Solna 17165, Sweden.
    [Show full text]