____________________________________________________________________________http://www.paper.edu.cn JOURNAL OF EXPERIMENTAL ZOOLOGY 303A:227–240 (2005) Cloning of Two Rat PDIP1 Related Genes and Their Interactions With Proliferating Cell Nuclear Antigen JIANLIN ZHOU1, XIAOXIAO HU1, XIWEN XIONG1, XIN LIU, YUNHAI LIU, KAIQUN REN, TIESHAN JIANG, XIANG HU, AND JIAN ZHANGn Department of Biochemistry and Molecular Biology, College of Life Science, Hunan Normal University, Changsha, Hunan 410081, China ABSTRACT Human polymerase delta-interacting protein 1 (PDIP1) is a tumor necrosis factor a and interleukin 6 inducible protein that interacts directly with proliferating cell nuclear antigen (PCNA) and the small subunit (p50) of DNA polymerase d. PDIP1 binds PCNA and p50 simultaneously and stimulates polymerase d activity in vitro in the presence, but not the absence, of PCNA. It has been suggested that PDIP1 provides a link between cytokine activation and DNA replication in eukaryotes. Here these authors report the cloning of two rat genes homologous to human PDIP1, termed rat PDIP1 and rat tumor necrosis factor-induced protein 1 (TNFAIP1). The rat PDIP1 is mapped to chromosome 1q36 cM region, spans approximately 18.7 kb, and is organized into six exons. The rat TNFAIP1 gene is mapped to chromosome 10q25 cM, spans approximately 12.9 kb, and is composed of seven exons. The deduced proteins of rat PDIP1 and rat TNFAIP1 share 63.1% sequence identity with each other and are highly conserved in the majority of the middle portion of the two proteins, which encode a BTB/POZ domain at the N-terminus and a PCNA binding motif (QTKV-EFP) at the C-terminus, respectively. The BTB / POZ domain and the PCNA binding motif are highly conserved during the evolution. Both rat PDIP1 and rat TNFAIP1 were demonstrated to interact with PCNA via BIAcore, GST pull-down, and co-immunoprecipitation assays. Like the human PDIP1, both rat PDIP1 and rat TNFAIP1 stimulate polymerase d activity in vitro in a PCNA-dependent way. J. Exp. Zool. 303A:227–240, 2005. r 2005 Wiley-Liss, Inc. Human PDIP1 was first identified as an inter- pol d core enzyme consists of two subunits, the acting partner of the small subunit (p50) of catalytic subunit of p125 and the small subunit of eukaryotic DNA polymerase d (pol d) in a yeast p50. It has been demonstrated that the processiv- two-hybrid screening of HepG2 cDNA library ity of the recombinant 125–kDa catalytic subunit using p50 as a bait (He et al., 2001). It was further of human pol d is not responsive to PCNA, shown that PDIP1 also interacts with proliferat- whereas coexpression of the catalytic (p125) and ing cell nuclear antigen (PCNA). DNA polymerase small (p50) subunits of pol d results in the d is one of the major polymerases to replicate formation of a recombinant heterodimer whose chromosomal DNA; its processivity is markedly processivity is markedly stimulated by PCNA increased in the presence of PCNA. PCNA is a (Zhou et al., ’96). A recent report from the multifunctional protein that plays roles in a laboratory of Antero G. So showed that PCNA variety of cellular processes, including DNA directly interacts with p50, not with p125 (Lu replication, DNA repair, and cell cycle control by et al., 2002). It has been proposed that the small interacting with proteins involved in these pro- subunit functions as a bridge connecting the cesses (Prelich et al., ’87; Gulbis et al., ’96; catalytic subunit and PCNA. The human PDIP1 Tsurimoto, ’99; Kedar et al., 2002). For example, binds simultaneously to PCNA and p50, and the interaction between PCNA and DNA pol d is essential for processive DNA synthesis during DNA replication. PCNA functions as a sliding Grant Sponsor: National Natural Science Foundation of China; Grant numbers: 30025009; 30270723 DNA clamp that forms a closed ring around duplex n Correspondence to: Jian Zhang, Department of Biochemistry and DNA. The binding of pol d to PCNA provides an Molecular Biology, College of Life Science, Hunan Normal University, elegant micromechanical solution to the biological Changsha, Hunan 410081, China. E-mail: [email protected]/ [email protected]. need to maintain an extraordinarily high level of Received 30 March 2004; Accepted 8 November 2004 processivity during the synthesis of chromosomal Published online in Wiley InterScience (www.interscience.wiley. com). DOI: 10.1002/jez.a.150 DNA (Prelich et al., ’87; Krishna et al., ’94). The 1These authors contributed equally to the work. r 2005 WILEY-LISS, INC. 中国科技论文在线___________________________________________________________________________http://www.paper.edu.cn 228 J. ZHOU ET AL. stimulates pol d activity in the presence, but not in RT-PCR the absence, of PCNA (He et al., 2001). To confirm the sequences of two contigs The 1.6 kb cDNA of PDIP1 encodes a protein of assembled by overlapping EST, two pairs of 36 kDa that is highly homologous to one of the primers were designed and used to amplify the early response genes induced by TNF-a, the B12 rat liver cDNA. One pair of primers (Forward: (Wolf et al., ‘92), lately renamed as human GCGTGGAAGTGCTCACAG, Reverse: GAC- TNFAIP1. It has been shown that the expression TAGGTCCCAGAAGCAAG) correspond to 50–end of human PDIP1 can be induced by TNF-a and IL– sequence of BE110670 and 30–end sequence of 6 (He et al., 2001). TNF-a is a multifunctional AW141960, respectively. Another pair of primers cytokine which participates in wide biological (Forward: GGTGGTGAAGCTGCTGTAC, Re- activities, such as apoptosis, proliferation, B cell verse: CAAGGAATTGTCAGGGACTC) corre- activation, and some inflammatory responses spond to 50–end sequence of BF551628 and 30– (Fiers et al., ’95). Especially, TNF-a plays im- end sequence of AI598359. Amplification was portant roles during liver regeneration. Several conducted in the Mastercycler (Eppendorf, Ger- converging lines of evidence from recent work many) using HotStarTaq polymerase (Qiagen) have established that TNF-a and IL–6 are im- for 30 cycles of 941C for 30 sec, 541C/531C for 30 portant components of the early signaling path- sec, and 721C for 1 min. The products were cloned ways triggering liver regeneration after loss of into pMD18–T vector (TaKaLa, Dalian, China) hepatic tissues (reviewed in Michalopoulos and and sequenced. All primers used in the study DeFrances, ’97; Fauto, 2000). The findings that were designed by NetPremer (http://www. PDIP1 is inducible by TNF-a and IL–6, and that it premierbiosoft.com/netprimer). physically and functionally interacts with both PCNA and the small subunit of pol d when taken together, suggest that PDIP1 may play a role in the regulation of hepatocyte replication induced by TNF-a and IL–6, probably by providing a link 30 and 50 rapid amplification of cDNA ends between cytokine activation and DNA replication (RACE) for rat PDIP1 and TNFAIP1 (He et al., 2001). The rat homologue of human PDIP1 was cloned to determine whether and how After the sequences of two contigs were con- PDIP1 is involved in the liver regeneration, using firmed, 50–RACE and 30–RACE were performed to the rat partial hepatectomy model. These data extend the 50 upstream and 30 downstream describe the cloning of two rat homologues and sequences of the contigs using the SMART RACE show that the PDIP1 and related proteins are cDNA amplification kit (Clontech, Palo Alto, CA). highly conserved. It is further demonstrated that In brief, 1 mg of total RNA extracted from rat liver these two rat homologues interact directly with tissue was reverse-transcribed with the oligo (dT)- PCNA via BIAcore, pull-down, and co-immuno- anchor primer, and with the oligo (dT) primer and precipitation assays, and stimulate pol d activity in 50–anchor oligonucleotide provided in the kit for 30 vitro in a PCNA-dependent way. and 50 RACE, respectively. 50 RACE and 30 RACE were performed with the PDIP1 or TNFAIP1 gene–specific primer (Table 1) and the universal primer (UPM) provided in the kit, using HotStar- MATERIALS AND METHODS Taq polymerase. The PCR condition was as follows: a pre-incubation at 951C for 2 min, initial RNA preparation and reverse five cycles of 941C for 30 sec and 721C for 3 min, transcription followed by five cycles of 941C for 30 sec, 701C for Eight week-old male Wistar rats were sacrificed 30 sec, 721C for 3 min, and ended with 27 cycles of by carbon dioxide euthanasia. The total RNA was 941C for 30 sec, 681C for 30 sec, and 721C for 3 min. isolated from the liver tissue using UNIQ–10 Total To confirm the 30 and 50 RACE products, nested RNA Minipreps Super kit (Sangon, Shanghai, PCR was performed with the nested gene-specific China). The purified RNA was used for first- primer (Table 1) and nested universal primer strand cDNA synthesis and amplification of both (NUP) provided in the kit under the same 50 and 30 cDNA ends. The first strand of cDNA was conditions. The amplified products were purified synthesized by oligo-dT priming using Sensiscript with QIAquick Gel Extraction kit (Qiagen), cloned RT Kit (Qiagen, Valencia, CA). into pMD18–T vector and sequenced. 中国科技论文在线___________________________________________________________________________http://www.paper.edu.cn TWO RAT PDIP1 HOMOLOUGES INTERACT WITH PCNA 229 TABLE 1. Gene-speci¢c primers (GSPs) and nested gene-speci¢c TNFAIP1) were transformed into E. coli BL21. primers (NGSPs) used in RACE reactions The transformant containing pT7–PCNA was Primer Sequence (50 to 30) grown at 371C until an OD600 of 0.5–0.6 was reached. Expression was induced with 1 mM IPTG PDIP1-50GSP TGGTACTCTCAGGCAGTGGCACTGACC (final concentration) at 371C. The other two PDIP1-50NGSP GGCCACTCCGGTCAATCAGCACC 0 transformants (pGEX–4T–2–PDIP1 and pGEX– PDIP1-3 GSP CCATATCACCCATGATGAGCGTCCTCA 1 PDIP1-30NGSP GGCCAACAGATTGTCTTCAAGGACTGACC 4T–2–TNFAIP1) were grown at 37 C until an TNFAIP1-50GSP GGTGATCATCAGAGTTGCTGGTGTACGAGT OD600 of 1.0 was reached.