DOCSLIB.ORG

Identification and Characterization of Microrna in the Lung Tissue of Pigs

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Characterization of Microrna in the Lung Tissue of Pigs Zhang et al. Vet Res (2018) 49:18 https://doi.org/10.1186/s13567-018-0512-3 RESEARCH ARTICLE Open Access Identifcation and characterization of microRNA in the lung tissue of pigs with diferent susceptibilities to PCV2 infection Ping Zhang1†, Liyuan Wang1†, Yanping Li1, Ping Jiang2, Yanchao Wang1, Pengfei Wang1, Li Kang1, Yuding Wang1, Yi Sun1* and Yunliang Jiang1* Abstract Porcine circovirus type 2 (PCV2) is the primary cause of post-weaning multisystemic wasting syndrome (PMWS) and other PCV-associated diseases. According to our previous RNA-sequencing analysis, the diferences in the suscep- tibility to PCV2 infection depended on the genetic diferences between the Laiwu (LW) and Yorkshire Landrace crossbred (YL) pigs, but the cellular microRNA (miRNA) that are diferentially expressed between the LW× and YL pigs before and after PCV2 infection remain to be determined. In this study, high-throughput sequencing was performed to determine the abundance and diferential expression of miRNA in lung tissues from PCV2-infected and PCV2-unin- fected LW and YL pigs. In total, 295 known and 95 novel miRNA were identifed, and 23 known and 25 novel miRNA were signifcantly diferentially expressed in the PCV2-infected vs. PCV2-uninfected LW pigs and/or the PCV2-infected vs. PCV2-uninfected YL pigs. The expression levels of ssc-miR-122, ssc-miR-192, ssc-miR-451, ssc-miR-486, and ssc- miR-504 were confrmed by quantitative real-time PCR (qRT-PCR). Analysis of the potential targets of the four up-reg- ulated miRNA (i.e., ssc-miR-122, ssc-miR-192, ssc-miR-451 and ssc-miR-486) identifed pathways and genes that may be important for disease resistance. Among the up-regulated miRNA, ssc-miR-122 can repress the protein expression and viral DNA replication of PCV2 and down-regulate the expression of the nuclear factor of activated T-cells 5 (NFAT5) and aminopeptidase puromycin sensitive (NPEPPS) by binding to their 3′ untranslated region (3′UTR) in PK15 cells. Therefore, ssc-miR-122 may indirectly suppress PCV2 infection by targeting genes related to the host immune system, such as NFAT5 and NPEPPS. Introduction [2, 3]. PCV2-afected pigs show wasting and progressive Porcine circovirus (PCV) was frst considered a con- weight loss, enlarged lymph nodes, and respiratory dis- taminant in a porcine kidney cell line in 1974 and was tress, jaundice, and occasional diarrhea [4]. Morbidity described in greater detail in 1982. In the late 1990s, in PCV2-afected farms is commonly 4–30% (occasion- PCV2 was found to be associated with post-weaning ally as high as 50–60%), and mortality ranges from 4 to multisystemic wasting syndrome (PMWS), which is cur- 20% [5]. Because of the increased mortality rates and rently considered one of the most important swine dis- the impact on weight gain, PCV2 has had a serious eco- eases worldwide [1]. PCV2 belongs to the Circoviridae nomic impact on the swine production industry [6]. Te family, which is characterized by a genome consisting of replication patterns of PCV2 in pulmonary alveolar mac- single-strand circular DNA with 1768-9 nucleotides (nt) rophages are diferent among macrophages derived from diferent conventional crossbred pigs [7]. MicroRNA (miRNA) are ~21–23 nt small RNA (sRNA) *Correspondence: [email protected]; [email protected] †Ping Zhang and Liyuan Wang contributed equally to this work molecules that regulate gene expression at the post- 1 Shandong Provincial Key Laboratory of Animal Biotechnology transcriptional level [8]. Currently, miRNA have been and Disease Control and Prevention, Shandong Agricultural University, 61 estimated to constitute 1–5% of animal genes and col- Daizong Street, Taian 271018, Shandong, China Full list of author information is available at the end of the article lectively regulate up to 30% of genes; therefore, miRNA © The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zhang et al. Vet Res (2018) 49:18 Page 2 of 13 are among the most abundant regulators [9]. No miRNA on both the whole genome and ORF2 sequences indi- encoded by PCV2 genomic DNA were detected in ton- cate that the genotype of PCV2-SD is PCV2b. Each pig sil and mediastinal lymph node tissues from PCV2- from LW-i and YL-i groups was intramuscularly injected 3.8 infected pigs [10]. In PK15 cells expressing PCV2 ORF1, with 3 mL PCV2-SD solution with 10 TCID50 (50% ORF2 and ORF3, 51, 74 and 32 miRNA were identifed, tissue culture infective dose)/mL. Te pigs from LW-u respectively, difering in abundance from those in the and YL-u groups were treated similarly with an identi- controls [11]. In PCV2-infected Landrace × Yorkshire cal volume of phosphate bufered saline (PBS). During pigs, miR-126-3p, 126-5p, 129a, let-7d-3p and let-7b-3p the experimental period, clinical signs were monitored were up-regulated, while miR-193a-5p, 574-5p and 34a daily and the copy number of PCV2 DNA in serum was were down-regulated in the mediastinal lymph node detected by quantitative real-time PCR (qRT-PCR) at 0, [12]. Tese diferentially expressed miRNA are mainly 4, 7, 10, 14, 21, 28 and 35 dpi. From 7 dpi, PCV2 virus involved in the regulation of the immune system and could be detected from the serums of PCV2-infected cell proliferation. Although certain PCV2 infection- pigs, indicating that the intramuscular injection was suc- associated miRNA have been identifed, pig-breed-spe- cessful. Te mean copy number of PCV2 DNA in serum cifc miRNA that are diferentially expressed and likely signifcantly increased in both PCV2-infected LW and YL account for the resistance to PCV2 infection have not pigs at 14 dpi. PCV2-infected YL pigs exhibited serious been characterized. clinical signs typifying PMWS, while the PCV2-infected Te Laiwu (LW) pig is a Chinese indigenous pig breed LW pigs showed slightly clinical symptoms. Te lung tis- from Shandong Province that is well-known for its sue of PCV2-infected YL pigs showed serious lesions, extremely high intramuscular fat content of > 10%. Te while they were not observed in PCV2-infected LW pigs LW pig also exhibits a higher resistance to certain infec- [13]. All pigs were sacrifced at 35 dpi and tissue samples tious diseases, including PCV2. In our previous study, were frozen in liquid nitrogen or preserved by immersion PCV2-infected Yorkshire × Landrace (YL) pigs exhibited in 10% neutral-bufered formalin. serious clinical features that are typical of PCV2 disease, particularly severe lesions in the lungs, such as conges- sRNA library preparation and deep‑sequencing tion, bleeding, interstitial pneumonia and lymphocyte Four sRNA libraries of LW-u, LW-i, YL-u and YL-i were infltration, while the PCV2-infected LW pigs showed constructed using the homogenized and pooled total only a few clinical symptoms; at 35 days post-infection RNA from four individuals selected from each group as (dpi), the PCV2 DNA copy in the YL pigs was signif- previously described [15–17]. Te construction of pooled cantly higher than that in the LW pigs [13]. In this study, small RNA libraries is certainly better than pooled total using Illumina/Solexa high-throughput sequencing, we RNA before Illumina sequencing. To minimize devia- identifed the diferentially expressed miRNA in the lung tion of this procedure compared with the results com- tissues between LW and YL pigs prior to and post PCV2 ing from each individual per group, more miRNA were infection and further characterized the role of miR-122 validated by qRT-PCR in this study. Total RNA was in conferring higher resistance to PCV2 infection. extracted from the lung tissues of PCV2-infected and uninfected pigs of each breed with TRIzol ® Reagent (Inv- Materials and methods itrogen Life Technologies, Carlsbad, CA, USA). Briefy, Sample collection for each sample, 20 μg of total RNA and a Small RNA Fifteen purebred LW and 15 YL weaned pigs that were Sample Prep Kit (Illumina, San Diego, CA, USA) were validated to be free of PCV2, porcine circovirus type used for library construction according to the manufac- 1 (PCV1), porcine reproductive and respiratory syn- turer’s instructions. Ten, fractions between 18 and 30 nt drome virus (PRRSV) and porcine parvovirus (PPV) were removed and purifed using 15% Tris–borate-EDTA were raised under identical conditions on the same farm. denaturing polyacrylamide gel electrophoresis (PAGE). All pigs were randomly divided into the following four Subsequently, the 3′ and 5′ RNA adaptors were ligated groups: PCV2-infected LW pigs (LW-i, n = 10), PCV2- to the purifed fragments with T4 RNA ligase in proper uninfected LW pigs (LW-u, n = 5), PCV2-infected YL order. Te cDNA from the adaptor-ligated sRNA were pigs (YL-i, n = 10) and PCV2-uninfected YL pigs (YL-u, then amplifed by RT-PCR with 15 cycles. Te products n = 5). Te procedures used for the pig management and (90-bp sRNA + adaptors) after purifcation on 4% aga- PCV2 inoculation have been previously described [13, rose gels were used for sequencing on an Illumina 1G 14]. Briefy, the PCV2 strain (named PCV2-SD) used in Genome Analyzer at Beijing Genomics Institute (BGI, this experiment was isolated from suspected PMWS pigs Shenzhen, China). After masking and removing the in the Shandong province.
Load more

Recommended publications
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Ykt6 Membrane-To-Cytosol Cycling Regulates Exosomal Wnt Secretion
    bioRxiv preprint doi: https://doi.org/10.1101/485565; this version posted December 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ykt6 membrane-to-cytosol cycling regulates exosomal Wnt secretion Karen Linnemannstöns1,2, Pradhipa Karuna1,2, Leonie Witte1,2, Jeanette Kittel1,2, Adi Danieli1,2, Denise Müller1,2, Lena Nitsch1,2, Mona Honemann-Capito1,2, Ferdinand Grawe3,4, Andreas Wodarz3,4 and Julia Christina Gross1,2* Affiliations: 1Hematology and Oncology, University Medical Center Goettingen, Goettingen, Germany. 2Developmental Biochemistry, University Medical Center Goettingen, Goettingen, Germany. 3Molecular Cell Biology, Institute I for Anatomy, University of Cologne Medical School, Cologne, Germany 4Cluster of Excellence-Cellular Stress Response in Aging-Associated Diseases (CECAD), Cologne, Germany *Correspondence: Dr. Julia Christina Gross, Hematology and Oncology/Developmental Biochemistry, University Medical Center Goettingen, Justus-von-Liebig Weg 11, 37077 Goettingen Germany Abstract Protein trafficking in the secretory pathway, for example the secretion of Wnt proteins, requires tight regulation. These ligands activate Wnt signaling pathways and are crucially involved in development and disease. Wnt is transported to the plasma membrane by its cargo receptor Evi, where Wnt/Evi complexes are endocytosed and sorted onto exosomes for long-range secretion. However, the trafficking steps within the endosomal compartment are not fully understood. The promiscuous SNARE Ykt6 folds into an auto-inhibiting conformation in the cytosol, but a portion associates with membranes by its farnesylated and palmitoylated C-terminus. Here, we demonstrate that membrane detachment of Ykt6 is essential for exosomal Wnt secretion.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Modeling of Human M1 Aminopeptidases for in Silico Screening of Potential Plasmodium Falciparum Alanine Aminopeptidase (Pfa-M1) Specific Inhibitors
    open access www.bioinformation.net Hypothesis Volume 10(8) Modeling of human M1 aminopeptidases for in silico screening of potential Plasmodium falciparum alanine aminopeptidase (PfA-M1) specific inhibitors Shakti Sahi*, Sneha Rai, Meenakshi Chaudhary & Vikrant Nain* School of Biotechnology, Gautam Buddha University, Greater Noida, 201312, India; Shakti Sahi – Email: [email protected]; Vikrant Nain- Email: [email protected]; Phone: +91-120-234275; +91-120-234283 Fax: +91-120-234205; *Corresponding authors Received June 18, 2014; Accepted June 27, 2014; Published August 30, 2014 Abstract: Plasmodium falciparum alanine M1-aminopeptidase (PfA-M1) is a validated target for anti-malarial drug development. Presence of significant similarity between PfA-M1 and human M1-aminopeptidases, particularly within regions of enzyme active site leads to problem of non-specificity and off-target binding for known aminopeptidase inhibitors. Molecular docking based in silico screening approach for off-target binding has high potential but requires 3D-structure of all human M1-aminopeptidaes. Therefore, in the present study 3D structural models of seven human M1-aminopeptidases were developed. The robustness of docking parameters and quality of predicted human M1-aminopeptidases structural models was evaluated by stereochemical analysis and docking of their respective known inhibitors. The docking scores were in agreement with the inhibitory concentrations elucidated in enzyme assays of respective inhibitor enzyme combinations (r2≈0.70). Further docking analysis of fifteen potential PfA-M1 inhibitors (virtual screening identified) showed that three compounds had less docking affinity for human M1-aminopeptidases as compared to PfA-M1. These three identified potential lead compounds can be validated with enzyme assays and used as a scaffold for designing of new compounds with increased specificity towards PfA-M1.
    [Show full text]
  • Goat Anti-MP100 / NPEPPS Antibody Peptide-Affinity Purified Goat Antibody Catalog # Af1679a
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Goat Anti-MP100 / NPEPPS Antibody Peptide-affinity purified goat antibody Catalog # AF1679a Specification Goat Anti-MP100 / NPEPPS Antibody - Product Information Application WB Primary Accession P55786 Other Accession NP_006301, 9520 Reactivity Human Predicted Mouse, Rat Host Goat Clonality Polyclonal Concentration 100ug/200ul Isotype IgG Calculated MW 103276 AF1679a (0.3 µg/ml) staining of Human Brain Goat Anti-MP100 / NPEPPS Antibody - Additional (Cerebral Cortex) lysate (35 µg protein in Information RIPA buffer). Primary incubation was 1 hour. Detected by chemiluminescence. Gene ID 9520 Other Names Goat Anti-MP100 / NPEPPS Antibody - Puromycin-sensitive aminopeptidase, PSA, Background 3.4.11.14, Cytosol alanyl aminopeptidase, AAP-S, NPEPPS, PSA This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which Format hydrolyzes amino acids from the N-terminus of 0.5 mg IgG/ml in Tris saline (20mM Tris its substrate. The protein has been localized to pH7.3, 150mM NaCl), 0.02% sodium azide, both the cytoplasm and to cellular membranes. with 0.5% bovine serum albumin This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is Storage involved in proteolytic events regulating the Maintain refrigerated at 2-8°C for up to 6 cell cycle. months. For long term storage store at -20°C in small aliquots to prevent Goat Anti-MP100 / NPEPPS Antibody - freeze-thaw cycles. References Precautions Involvement of puromycin-sensitive Goat Anti-MP100 / NPEPPS Antibody is for aminopeptidase in proteolysis of tau protein in research use only and not for use in cultured cells, and attenuated proteolysis of diagnostic or therapeutic procedures.
    [Show full text]
  • 1 Large-Scale Deep Multi-Layer Analysis of Alzheimer's Disease
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.05.438450; this version posted August 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Large-Scale Deep Multi-Layer Analysis of Alzheimer’s Disease Brain Reveals Strong Proteomic Disease-Related Changes Not Observed at the RNA Level Erik C.B. Johnson1,2,†,*, E. Kathleen Carter1,2,†, Eric B. Dammer1,3,†, Duc M. Duong1,3, Ekaterina S. Gerasimov2, Yue Liu4, Jiaqi Liu4, Ranjita Betarbet1,2, Lingyan Ping1,2,3, Luming Yin3, Geidy E. Serrano7, Thomas G. Beach7, Junmin Peng8,9, Philip L. De Jager10, Vahram Haroutunian11,12, Bin Zhang13, Chris Gaiteri14, David A. Bennett14, Marla Gearing1,2,6, Thomas S. Wingo1,2,4, Aliza P. Wingo1,5,15, James J. Lah1,2, Allan I. Levey1,2,* and Nicholas T. Seyfried1,2,3,* 1Goizueta Alzheimer’s Disease Research Center, Emory University School of Medicine, Atlanta, GA, USA 2Department of Neurology, Emory University School of Medicine, Atlanta, GA, USA 3Department of Biochemistry, Emory University School of Medicine, Atlanta, GA, USA 4Department of Genetics, Emory University School of Medicine, Atlanta, GA, USA 5Department of Psychiatry, Emory University School of Medicine, Atlanta, GA, USA 6Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA, USA 7Banner Sun Health Research Institute, Sun City, AZ, USA 8Departments of Structural Biology and Developmental Neurobiology, St. Jude Children’s Research Hospital, Memphis, TN, USA 9Center for Proteomics and Metabolomics, St.
    [Show full text]
  • Proteomic Profiling of Extracellular Vesicles Derived From
    cells Article Proteomic Profiling of Extracellular Vesicles Derived from Cerebrospinal Fluid of Alzheimer’s Disease Patients: A Pilot Study Satoshi Muraoka 1, Mark P. Jedrychowski 2, Kiran Yanamandra 3, Seiko Ikezu 1, Steven P. Gygi 2 and Tsuneya Ikezu 1,4,5,* 1 Department of Pharmacology and Experimental Therapeutics, Boston University School of Medicine, Boston, MA 02118, USA; [email protected] (S.M.); [email protected] (S.I.) 2 Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA; [email protected] (M.P.J.); [email protected] (S.P.G.) 3 Abbvie Inc. Foundational Neuroscience Center, Cambridge, MA 02139, USA; [email protected] 4 Department of Neurology, Boston University School of Medicine, Boston, MA 02118, USA 5 Center for Systems Neuroscience, Boston University, Boston, MA 02215, USA * Correspondence: [email protected]; Tel.: +1-617-358-9575 Received: 26 June 2020; Accepted: 21 August 2020; Published: 25 August 2020 Abstract: Pathological hallmarks of Alzheimer’s disease (AD) are deposits of amyloid beta (Aβ) and hyper-phosphorylated tau aggregates in brain plaques. Recent studies have highlighted the importance of Aβ and tau-containing extracellular vesicles (EVs) in AD. We therefore examined EVs separated from cerebrospinal fluid (CSF) of AD, mild cognitive impairment (MCI), and control (CTRL) patient samples to profile the protein composition of CSF EV. EV fractions were separated from AD (n = 13), MCI (n = 10), and CTRL (n = 10) CSF samples using MagCapture Exosome Isolation kit. The CSF-derived EV proteins were identified and quantified by label-free and tandem mass tag (TMT)-labeled mass spectrometry.
    [Show full text]
  • NPEPPS (NM 006310) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC209037 NPEPPS (NM_006310) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: NPEPPS (NM_006310) Human Tagged ORF Clone Tag: Myc-DDK Symbol: NPEPPS Synonyms: AAP-S; MP100; PSA Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 NPEPPS (NM_006310) Human Tagged ORF Clone – RC209037 ORF Nucleotide >RC209037 representing NM_006310 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCTGGCAGCTGCCGCCCCCTCCCTCGCTCGCCGCCTGCTCTTCCTCGGCCCTCCGCCTCCTCCCC TCCTCCTTCTCGTCTTCAGCCGCTCCTCTCGCCGCCGCCTCCACAGCCTGGGCCTCGCCGCGATGCCGGA GAAGAGGCCCTTCGAGCGGCTGCCTGCCGATGTCTCCCCCATCAACTACAGCCTTTGCCTCAAGCCCGAC TTGCTGGACTTCACCTTCGAGGGCAAGCTGGAGGCCGCCGCCCAGGTGAGGCAGGCGACTAATCAGATTG TGATGAATTGTGCTGATATTGATATTATTACAGCTTCATATGCACCAGAAGGAGATGAAGAAATACATGC TACAGGATTTAACTATCAGAATGAAGATGAAAAAGTCACCTTGTCTTTCCCTAGTACTCTGCAAACAGGT ACGGGAACCTTAAAGATAGATTTTGTTGGAGAGCTGAATGACAAAATGAAAGGTTTCTATAGAAGTAAAT ATACTACCCCTTCTGGAGAGGTGCGCTATGCTGCTGTAACACAGTTTGAGGCTACTGATGCCCGAAGGGC TTTTCCTTGCTGGGATGAGCCTGCTATCAAAGCAACTTTTGATATCTCATTGGTTGTTCCTAAAGACAGA
    [Show full text]
  • Aminopeptidase Expression in Multiple Myeloma Associates with Disease Progression and Sensitivity to Melflufen
    cancers Article Aminopeptidase Expression in Multiple Myeloma Associates with Disease Progression and Sensitivity to Melflufen Juho J. Miettinen 1,† , Romika Kumari 1,†, Gunnhildur Asta Traustadottir 2 , Maiju-Emilia Huppunen 1, Philipp Sergeev 1, Muntasir M. Majumder 1, Alexander Schepsky 2 , Thorarinn Gudjonsson 2 , Juha Lievonen 3, Despina Bazou 4, Paul Dowling 5, Peter O‘Gorman 4, Ana Slipicevic 6, Pekka Anttila 3, Raija Silvennoinen 3 , Nina N. Nupponen 6, Fredrik Lehmann 6 and Caroline A. Heckman 1,* 1 Institute for Molecular Medicine Finland-FIMM, HiLIFE–Helsinki Institute of Life Science, iCAN Digital Precision Cancer Medicine Flagship, University of Helsinki, 00290 Helsinki, Finland; juho.miettinen@helsinki.fi (J.J.M.); romika.kumari@helsinki.fi (R.K.); maiju-emilia.huppunen@helsinki.fi (M.-E.H.); philipp.sergeev@helsinki.fi (P.S.); muntasir.mamun@helsinki.fi (M.M.M.) 2 Stem Cell Research Unit, Biomedical Center, University of Iceland, 101 Reykjavik, Iceland; [email protected] (G.A.T.); [email protected] (A.S.); [email protected] (T.G.) 3 Department of Hematology, Helsinki University Hospital Comprehensive Cancer Center, 00290 Helsinki, Finland; juha.lievonen@hus.fi (J.L.); pekka.anttila@hus.fi (P.A.); raija.silvennoinen@helsinki.fi (R.S.) 4 Department of Hematology, Mater Misericordiae University Hospital, D07 Dublin, Ireland; [email protected] (D.B.); [email protected] (P.O.) 5 Department of Biology, Maynooth University, National University of Ireland, Citation: Miettinen, J.J.; Kumari, R.; W23 F2H6 Maynooth, Co. Kildare, Ireland; [email protected] Traustadottir, G.A.; Huppunen, M.-E.; 6 Oncopeptides AB, 111 53 Stockholm, Sweden; [email protected] (A.S.); Sergeev, P.; Majumder, M.M.; [email protected] (N.N.N.); [email protected] (F.L.) Schepsky, A.; Gudjonsson, T.; * Correspondence: caroline.heckman@helsinki.fi; Tel.: +358-50-415-6769 † These authors equally contributed to this work.
    [Show full text]
  • High-Resolution Radiation Hybrid Mapping of Human Chromosome
    Swine Research Report, 2000 Animal Science Research Reports 2001 High-Resolution Radiation Hybrid Mapping of Human Chromosome 17 Genes to the Pig Genome Extends Gene Order Conservation with Pig Chromosome 12 and Limited Synteny with Pig Chromosome 2 X. W. Shi Iowa State University C. J. Fitzsimmons Iowa State University C. K. Tuggle Iowa State University C. Genêt Institut National de la Recherche Agronomique–Toulouse R. Prather University of Missouri–Columbia Recommended Citation Shi, X. W.; Fitzsimmons, C. J.; Tuggle, C. K.; Genêt, C.; Prather, R.; Whitworth, K.; and Green, J. A., "High-Resolution Radiation Hybrid Mapping of Human Chromosome 17 Genes to the Pig Genome Extends Gene Order Conservation with Pig Chromosome 12 and Limited Synteny with Pig Chromosome 2" (2001). Swine Research Report, 2000. 19. http://lib.dr.iastate.edu/swinereports_2000/19 This report is brought to you for free and open access by the Animal Science Research Reports at Iowa State University Digital Repository. It has been accepted for inclusion in Swine Research Report, 2000 by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. See next page for additional authors Follow this and additional works at: http://lib.dr.iastate.edu/swinereports_2000 Part of the Agriculture Commons, and the Animal Sciences Commons Extension Number: ASL R666 High-Resolution Radiation Hybrid Mapping of Human Chromosome 17 Genes to the Pig Genome Extends Gene Order Conservation with Pig Chromosome 12 and Limited Synteny with Pig Chromosome 2 Abstract A comparative study of human chromosome 17 (HSA17) and pig chromosome 12 (SSC12) and 2 (SSC2) was conducted using both somatic cell hybrid panel (SCHP) and radiation hybrid (RH) panel analysis.
    [Show full text]
  • The Genetics, Structure and Function of the M1 Aminopeptidase Oxytocinase Subfamily and Their Therapeutic Potential in Immune-Mediated Disease T
    Human Immunology 80 (2019) 281–289 Contents lists available at ScienceDirect Human Immunology journal homepage: www.elsevier.com/locate/humimm The genetics, structure and function of the M1 aminopeptidase oxytocinase subfamily and their therapeutic potential in immune-mediated disease T Aimee L. Hansona,b, Craig J. Mortonc,d, Michael W. Parkerc,d, Darrell Bessetteb,e, ⁎ Tony J. Kennab,e, a University of Queensland Diamantina Institute, Brisbane, Queensland, Australia b Translational Research Institute, Princess Alexandra Hospital, Brisbane, Queensland, Australia c Department of Biochemistry and Molecular Biology, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, Victoria, Australia d Australian Cancer Research Foundation Rational Drug Discovery Centre, St. Vincent's Institute of Medical Research, Fitzroy, VIC, Australia e Institute of Health and Biomedical Innovation, Faculty of Health, Queensland University of Technology, Brisbane, Queensland, Australia ARTICLE INFO ABSTRACT Keywords: The oxytocinase subfamily of M1 aminopeptidases plays an important role in processing and trimming of Aminopeptidase peptides for presentation on major histocompatibility (MHC) Class I molecules. Several large-scale genomic Antigen presentation studies have identified association of members of this family of enzymes, most notably ERAP1 and ERAP2, with Autoimmunity immune-mediated diseases including ankylosing spondylitis, psoriasis and birdshot chorioretinopathy. Much is Inhibitor now known about the genetics of these enzymes and how genetic variants alter their function, but how these variants contribute to disease remains largely unresolved. Here we discuss what is known about their structure and function and highlight some of the knowledge gaps that affect development of drugs targeting these en- zymes. 1. M1 aminopeptidase oxytocinase subfamily – protein structure disturbed in ways that lead to immune system evasion or to auto- and function immune reactions.
    [Show full text]
  • The M1 Aminopeptidase NPEPPS Is a Novel Regulator of Cisplatin
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.04.433676; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 The M1 aminopeptidase NPEPPS is a 2 novel regulator of cisplatin sensitivity 3 4 Robert T. Jones1,15, Andrew Goodspeed1,3,15, Maryam C. Akbarzadeh2,4,16, Mathijs Scholtes2,16, 5 Hedvig Vekony1, Annie Jean1, Charlene B. Tilton1, Michael V. Orman1, Molishree Joshi1,5, 6 Teemu D. Laajala1,6, Mahmood Javaid7, Eric T. Clambey8, Ryan Layer7,9, Sarah Parker10, 7 Tokameh Mahmoudi2,11, Tahlita Zuiverloon2,*, Dan Theodorescu12,13,14,*, James C. Costello1,3,* 8 9 1Department of Pharmacology, University of Colorado Anschutz Medical Campus, Aurora, CO, 10 USA 11 2 Department of Urology, Erasmus MC Cancer Institute, Erasmus University Medical Center 12 Rotterdam, Rotterdam, The Netherlands 13 3University of Colorado Comprehensive Cancer Center, University of Colorado Anschutz 14 Medical Campus, Aurora, CO, USA 15 4Stem Cell and Regenerative Medicine Center of Excellence, Tehran University of Medical 16 Sciences, Tehran, Iran 17 5Functional Genomics Facility, University of Colorado Anschutz Medical Campus, Aurora, CO, 18 USA 19 6Department of Mathematics and Statistics, University of Turku, Turku, Finland. 20 7Computer Science Department, University of Colorado, Boulder 21 8Department of Anesthesiology, University
    [Show full text]