High-Resolution Radiation Hybrid Mapping of Human Chromosome

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Swine Research Report, 2000 Animal Science Research Reports 2001 High-Resolution Radiation Hybrid Mapping of Human Chromosome 17 Genes to the Pig Genome Extends Gene Order Conservation with Pig Chromosome 12 and Limited Synteny with Pig Chromosome 2 X. W. Shi Iowa State University C. J. Fitzsimmons Iowa State University C. K. Tuggle Iowa State University C. Genêt Institut National de la Recherche Agronomique–Toulouse R. Prather University of Missouri–Columbia Recommended Citation Shi, X. W.; Fitzsimmons, C. J.; Tuggle, C. K.; Genêt, C.; Prather, R.; Whitworth, K.; and Green, J. A., "High-Resolution Radiation Hybrid Mapping of Human Chromosome 17 Genes to the Pig Genome Extends Gene Order Conservation with Pig Chromosome 12 and Limited Synteny with Pig Chromosome 2" (2001). Swine Research Report, 2000. 19. http://lib.dr.iastate.edu/swinereports_2000/19 This report is brought to you for free and open access by the Animal Science Research Reports at Iowa State University Digital Repository. It has been accepted for inclusion in Swine Research Report, 2000 by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. See next page for additional authors Follow this and additional works at: http://lib.dr.iastate.edu/swinereports_2000 Part of the Agriculture Commons, and the Animal Sciences Commons Extension Number: ASL R666 High-Resolution Radiation Hybrid Mapping of Human Chromosome 17 Genes to the Pig Genome Extends Gene Order Conservation with Pig Chromosome 12 and Limited Synteny with Pig Chromosome 2 Abstract A comparative study of human chromosome 17 (HSA17) and pig chromosome 12 (SSC12) and 2 (SSC2) was conducted using both somatic cell hybrid panel (SCHP) and radiation hybrid (RH) panel analysis. A cDNA library from an expressed sequence tag (EST) project in pig reproduction was examined and six genes and ESTs from HSA17 were selected for this study. The eg nes/ESTs were TATA box binding protein- associated factor (TAF2N/RBP56), plasmin inhibitor (PLI), H3 histone family 3B (H3F3B), aminopeptidase puromycin sensitive (NPEPPS/PSA), P311 protein (P311), and an expressed sequence tag (ESTMI015). SCHP analysis mapped five genes/ESTs (TAF2N , H3F3B, PLI, NPEPPS, and ESTMI015) to SSC12q11-q15 and SSC12p11-p15 with 100% concordance, and assigned P311 to SSC2 (1/2q24)-q29 with 100% concordance. RH analysis of all six genes confirmed the SCHP mapping results, with average retention frequency of 25%. An expanded comparative SSC12 RH map integrating the five new type I markers and 23 previously mapped loci was established using a LOD score threshold of 4.8. The eg ne order of the five genes/ ESTs on the SSC12 framework RH map (H3F3B-ESTMI015-PSA-RBP56-PLI) is identical to the HSA17 GB4 map but with map inversion. Although synteny conservation between HSA17 and SSC2 has not been detected by previous painting experiments, the mapping of P311 to SSC2 suggests that some synteny conservation exists between HSA17 and SSC2. Keywords ASL R666 Disciplines Agriculture | Animal Sciences Authors X. W. Shi, C. J. Fitzsimmons, C. K. Tuggle, C. Genêt, R. Prather, K. Whitworth, and J. A. Green This breeding/physiology is available at Iowa State University Digital Repository: http://lib.dr.iastate.edu/swinereports_2000/19 Iowa State University Breeding/Physiology High-Resolution Radiation Hybrid Mapping of Human Chromosome 17 Genes to the Pig Genome Extends Gene Order Conservation with Pig Chromosome 12 and Limited Synteny with Pig Chromosome 2 X. W. Shi, visiting scientist P311 to SSC2 suggests that some synteny conservation C. J. Fitzsimmons, research associate exists between HSA17 and SSC2. C. K. Tuggle, associate professor Introduction Department of Animal Science Comparative mapping is expected to be an efficient and powerful strategy in predicting gene location from the well- developed human genome map, and as a method for selecting C. Genêt, Ph.D student candidate genes for improvement of economically important Laboratoire de Genetique Cellulaire, traits in livestock species. Bidirectional painting has revealed INRA-Toulouse, 37 synteny groups conserved between the pig and human France (2). However, even within conserved synteny groups, rearrangement of gene order and distance discrepancy of adjacent loci have been documented (1, 4, 9, 13). R. Prather, professor Accumulation of comparative mapping information K. Whitworth, research associate between human and swine is helpful for understanding the J. A. Green, research assistant professor evolutionary relationship between the two genomes and in predicting gene order and location with increased certainty. Department of Animal Science, 128 linkage groups covering all porcine chromosomes (n = University of Missouri-Columbia 19) were established in a first-generation porcine whole- genome radiation hybrid (WG-RH) analysis (3). This useful map consists almost exclusively of microsatellites, thus RH ASL-R666 mapping of additional type I loci is required to fully use the RH panel for high-resolution comparative mapping. For Summary and Implications example, only a single type I locus, GH, was mapped to A comparative study of human chromosome 17 SSC12 by using the INRA-Minnesota porcine radiation (HSA17) and pig chromosome 12 (SSC12) and 2 (SSC2) hybrid (IMpRH) panel (3). Therefore, the objective in this was conducted using both somatic cell hybrid panel (SCHP) study was to provide additional comparative mapping and radiation hybrid (RH) panel analysis. A cDNA library references between human chromosome 17 (HSA17) and pig from an expressed sequence tag (EST) project in pig chromosome 12 (SSC12) using both somatic cell hybrid reproduction was examined and six genes and ESTs from panel (SCHP) and radiation hybrid (RH) panel analysis. HSA17 were selected for this study. The genes/ESTs were TATA box binding protein-associated factor (TAF2N /RBP56), plasmin inhibitor (PLI), H3 histone family 3B Materials and Methods (H3F3B), aminopeptidase puromycin sensitive As part of an expressed sequence tag (EST) project in (NPEPPS/PSA), P311 protein (P311), and an expressed pig reproduction (11), a directionally cloned cDNA library sequence tag (ESTMI015). SCHP analysis mapped five was produced from day 20 porcine embryos at University of genes/ESTs (TAF2N , H3F3B, PLI, NPEPPS, and Missouri-Columbia., The 3´-untranslated region of 220 ESTMI015) to SSC12q11-q15 and SSC12p11-p15 with clones was sequenced at Iowa State University. BLAST hits 100% concordance, and assigned P311 to SSC2 (1/2q24)-q29 were evaluated for 187 clones, and six genes/ESTs on with 100% concordance. RH analysis of all six genes HSA17 were selected for the present study (Table 1). The six confirmed the SCHP mapping results, with average genes/ESTs were TATA box binding protein-associated retention frequency of 25%. An expanded comparative factor (TAF2N), plasmin inhibitor (PLI), H3 histone family SSC12 RH map integrating the five new type I markers and 3B (H3F3B), aminopeptidase puromycin sensitive 23 previously mapped loci was established using a LOD (NPEPPS/PSA), P311 protein (P311), and an expressed tag score threshold of 4.8. The gene order of the five sequence (ESTMI015). genes/ESTs on the SSC12 framework RH map (H3F3B- The oligonucleotide primers for these genes/ESTs were ESTMI015-PSA-RBP56-PLI) is identical to the HSA17 designed using the OLIGO 5.0 program (NBI, Plymouth, GB4 map but with map inversion. Although synteny MN), and they were then PCR-tested on a panel of conservation between HSA17 and SSC2 has not been templates, including pig, mouse, and Chinese hamster detected by previous painting experiments, the mapping of genomic DNAs. All primer sets for these six genes/ESTs showed robust and porcine specific amplification. 96 Iowa State University Breeding/Physiology PCR was performed on an MJ Research PTC-200 was consistent with the recently published first-generation thermal cycler in a 15-µl reaction volume containing 1 × porcine whole-genome radiation hybrid map (3). However, PCR buffer (Promega, Madison, WI), 66 µM dNTP, 0.5 one discrepancy was observed between the two maps, µ M of each primer, 1.5 mM MgCl2, 0.25 U Taq polymerase involving Sw957, GH and Sw943. In the published map (Promega), and 25 ng of hybrid DNA. PCR reactions were (3), we notice that Sw957 and GH were inadvertently preheated at 94oC for 2 min and then followed by 35 cycles assigned to the second linkage group. The mapping of at 94oC for 30 s, 60-64oC for 30 s, and 72oC for 45 s and ESTMI015 allows us to localize GH and Sw957 to the first completed at 72oC for 5 min. The PCR products were size- linkage group. The results of our analysis are in agreement separated on a 3% agarose gel. Detailed information on with the two point analysis of the first generation map primer sequences, annealing temperature and product size for available from the Web site at each locus was submitted to http://imprh.toulouse.inra.fr/. http://fabctr.umn.edu/RHMaps/2ptdata/chr12-2pt.html A somatic cell hybrid panel (SCHP) comprised of 27 Eighteen type I genes or ESTs have been physically clones was used for regional assignments of the six mapped on SSC12 by SCHP and FISH analysis genes/ESTs on pig chromosomes (12; also see (http://www.toulouse.inra.fr/lgc/pig/cyto/gene/chromo/SSC http://www,toulouse.inra.fr/lgc/pig/pcr/pcr.htm). G12.htm). However, SSC12 gene order is unclear due to A WG-RH (whole-genome radiation hybrids) panel overlapping localizations for many of these loci. Radiation included 118 hybrid clones was used for determining the hybrid mapping can provide higher resolution, yet of these gene order. The panel was tested at least twice for each loci only GH has been mapped using the IMpRH panel (3). gene/EST. If a discrepancy occurred between the first two Assignment of these five genes/ESTs in the present study tests, then a third confirmation test was performed. thus significantly increases the density of type I markers on the SSC12 RH map.
Recommended publications
  • Genome Editing for the Understanding and Treatment of Inherited Cardiomyopathies

    Genome Editing for the Understanding and Treatment of Inherited Cardiomyopathies

    International Journal of Molecular Sciences Review Genome Editing for the Understanding and Treatment of Inherited Cardiomyopathies 1, 1, 1,2, Quynh Nguyen y , Kenji Rowel Q. Lim y and Toshifumi Yokota * 1 Department of Medical Genetics, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB T6G2H7, Canada; [email protected] (Q.N.); [email protected] (K.R.Q.L.) 2 The Friends of Garrett Cumming Research & Muscular Dystrophy Canada, HM Toupin Neurological Science Research Chair, Edmonton, AB T6G2H7, Canada * Correspondence: [email protected]; Tel.: +1-780-492-1102 These authors contributed equally to the work. y Received: 28 December 2019; Accepted: 19 January 2020; Published: 22 January 2020 Abstract: Cardiomyopathies are diseases of heart muscle, a significant percentage of which are genetic in origin. Cardiomyopathies can be classified as dilated, hypertrophic, restrictive, arrhythmogenic right ventricular or left ventricular non-compaction, although mixed morphologies are possible. A subset of neuromuscular disorders, notably Duchenne and Becker muscular dystrophies, are also characterized by cardiomyopathy aside from skeletal myopathy. The global burden of cardiomyopathies is certainly high, necessitating further research and novel therapies. Genome editing tools, which include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR) systems have emerged as increasingly important technologies in studying
  • Role of Tafazzin in Hematopoiesis and Leukemogenesis

    Role of Tafazzin in Hematopoiesis and Leukemogenesis

    Role of Tafazzin in Hematopoiesis and Leukemogenesis by Ayesh Seneviratne A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto © Copyright by Ayesh Seneviratne 2020 Role of Tafazzin in Hematopoiesis and Leukemogenesis Ayesh Seneviratne Doctor of Philosophy Institute of Medical Science University of Toronto 2020 Abstract Tafazzin (TAZ) is a mitochondrial transacylase that remodels the mitochondrial cardiolipin into its mature form. Through a CRISPR screen, we identified TAZ as necessary for the growth and viability of acute myeloid leukemia (AML) cells. Genetic inhibition of TAZ reduced stemness and increased differentiation of AML cells both in vitro and in vivo. In contrast, knockdown of TAZ did not impair normal hematopoiesis under basal conditions. Mechanistically, inhibition of TAZ decreased levels of cardiolipin but also altered global levels of intracellular phospholipids, including phosphatidylserine, which controlled AML stemness and differentiation by modulating toll-like receptor (TLR) signaling (Seneviratne et al., 2019). ii Acknowledgments Firstly, I would like to thank Dr. Aaron Schimmer for his guidance and support during my PhD studies. I really enjoyed our early morning meetings where he provided much needed perspective to navigate the road blocks of my project, whilst continuing to push me. It was a privilege to be mentored by such an excellent clinician scientist. I hope to continue to build on the skills I learned in Dr. Schimmer’s lab as I progress on my path to become a clinician scientist. Working in the Schimmer lab was a wonderful learning environment. I would like to especially thank Dr.
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation

    (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation

    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
  • Ykt6 Membrane-To-Cytosol Cycling Regulates Exosomal Wnt Secretion

    Ykt6 Membrane-To-Cytosol Cycling Regulates Exosomal Wnt Secretion

    bioRxiv preprint doi: https://doi.org/10.1101/485565; this version posted December 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ykt6 membrane-to-cytosol cycling regulates exosomal Wnt secretion Karen Linnemannstöns1,2, Pradhipa Karuna1,2, Leonie Witte1,2, Jeanette Kittel1,2, Adi Danieli1,2, Denise Müller1,2, Lena Nitsch1,2, Mona Honemann-Capito1,2, Ferdinand Grawe3,4, Andreas Wodarz3,4 and Julia Christina Gross1,2* Affiliations: 1Hematology and Oncology, University Medical Center Goettingen, Goettingen, Germany. 2Developmental Biochemistry, University Medical Center Goettingen, Goettingen, Germany. 3Molecular Cell Biology, Institute I for Anatomy, University of Cologne Medical School, Cologne, Germany 4Cluster of Excellence-Cellular Stress Response in Aging-Associated Diseases (CECAD), Cologne, Germany *Correspondence: Dr. Julia Christina Gross, Hematology and Oncology/Developmental Biochemistry, University Medical Center Goettingen, Justus-von-Liebig Weg 11, 37077 Goettingen Germany Abstract Protein trafficking in the secretory pathway, for example the secretion of Wnt proteins, requires tight regulation. These ligands activate Wnt signaling pathways and are crucially involved in development and disease. Wnt is transported to the plasma membrane by its cargo receptor Evi, where Wnt/Evi complexes are endocytosed and sorted onto exosomes for long-range secretion. However, the trafficking steps within the endosomal compartment are not fully understood. The promiscuous SNARE Ykt6 folds into an auto-inhibiting conformation in the cytosol, but a portion associates with membranes by its farnesylated and palmitoylated C-terminus. Here, we demonstrate that membrane detachment of Ykt6 is essential for exosomal Wnt secretion.
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation

    Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation

    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
  • Modeling of Human M1 Aminopeptidases for in Silico Screening of Potential Plasmodium Falciparum Alanine Aminopeptidase (Pfa-M1) Specific Inhibitors

    Modeling of Human M1 Aminopeptidases for in Silico Screening of Potential Plasmodium Falciparum Alanine Aminopeptidase (Pfa-M1) Specific Inhibitors

    open access www.bioinformation.net Hypothesis Volume 10(8) Modeling of human M1 aminopeptidases for in silico screening of potential Plasmodium falciparum alanine aminopeptidase (PfA-M1) specific inhibitors Shakti Sahi*, Sneha Rai, Meenakshi Chaudhary & Vikrant Nain* School of Biotechnology, Gautam Buddha University, Greater Noida, 201312, India; Shakti Sahi – Email: [email protected]; Vikrant Nain- Email: [email protected]; Phone: +91-120-234275; +91-120-234283 Fax: +91-120-234205; *Corresponding authors Received June 18, 2014; Accepted June 27, 2014; Published August 30, 2014 Abstract: Plasmodium falciparum alanine M1-aminopeptidase (PfA-M1) is a validated target for anti-malarial drug development. Presence of significant similarity between PfA-M1 and human M1-aminopeptidases, particularly within regions of enzyme active site leads to problem of non-specificity and off-target binding for known aminopeptidase inhibitors. Molecular docking based in silico screening approach for off-target binding has high potential but requires 3D-structure of all human M1-aminopeptidaes. Therefore, in the present study 3D structural models of seven human M1-aminopeptidases were developed. The robustness of docking parameters and quality of predicted human M1-aminopeptidases structural models was evaluated by stereochemical analysis and docking of their respective known inhibitors. The docking scores were in agreement with the inhibitory concentrations elucidated in enzyme assays of respective inhibitor enzyme combinations (r2≈0.70). Further docking analysis of fifteen potential PfA-M1 inhibitors (virtual screening identified) showed that three compounds had less docking affinity for human M1-aminopeptidases as compared to PfA-M1. These three identified potential lead compounds can be validated with enzyme assays and used as a scaffold for designing of new compounds with increased specificity towards PfA-M1.
  • Goat Anti-MP100 / NPEPPS Antibody Peptide-Affinity Purified Goat Antibody Catalog # Af1679a

    Goat Anti-MP100 / NPEPPS Antibody Peptide-Affinity Purified Goat Antibody Catalog # Af1679a

    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Goat Anti-MP100 / NPEPPS Antibody Peptide-affinity purified goat antibody Catalog # AF1679a Specification Goat Anti-MP100 / NPEPPS Antibody - Product Information Application WB Primary Accession P55786 Other Accession NP_006301, 9520 Reactivity Human Predicted Mouse, Rat Host Goat Clonality Polyclonal Concentration 100ug/200ul Isotype IgG Calculated MW 103276 AF1679a (0.3 µg/ml) staining of Human Brain Goat Anti-MP100 / NPEPPS Antibody - Additional (Cerebral Cortex) lysate (35 µg protein in Information RIPA buffer). Primary incubation was 1 hour. Detected by chemiluminescence. Gene ID 9520 Other Names Goat Anti-MP100 / NPEPPS Antibody - Puromycin-sensitive aminopeptidase, PSA, Background 3.4.11.14, Cytosol alanyl aminopeptidase, AAP-S, NPEPPS, PSA This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which Format hydrolyzes amino acids from the N-terminus of 0.5 mg IgG/ml in Tris saline (20mM Tris its substrate. The protein has been localized to pH7.3, 150mM NaCl), 0.02% sodium azide, both the cytoplasm and to cellular membranes. with 0.5% bovine serum albumin This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is Storage involved in proteolytic events regulating the Maintain refrigerated at 2-8°C for up to 6 cell cycle. months. For long term storage store at -20°C in small aliquots to prevent Goat Anti-MP100 / NPEPPS Antibody - freeze-thaw cycles. References Precautions Involvement of puromycin-sensitive Goat Anti-MP100 / NPEPPS Antibody is for aminopeptidase in proteolysis of tau protein in research use only and not for use in cultured cells, and attenuated proteolysis of diagnostic or therapeutic procedures.
  • Genetics of Recombination Rate Variation in the Pig 2 3 Martin Johnsson1,2*, Andrew Whalen1*, Roger Ros-Freixedes1,3, Gregor Gorjanc1, Ching-Yi 4 Chen4, William O

    Genetics of Recombination Rate Variation in the Pig 2 3 Martin Johnsson1,2*, Andrew Whalen1*, Roger Ros-Freixedes1,3, Gregor Gorjanc1, Ching-Yi 4 Chen4, William O

    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.17.995969; this version posted March 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Genetics of recombination rate variation in the pig 2 3 Martin Johnsson1,2*, Andrew Whalen1*, Roger Ros-Freixedes1,3, Gregor Gorjanc1, Ching-Yi 4 Chen4, William O. Herring4, Dirk-Jan de Koning2, John M. Hickey1† 5 6 1 The Roslin Institute and Royal (Dick) School of Veterinary Studies, The University of 7 Edinburgh, Midlothian, EH25 9RG, Scotland, United Kingdom. 8 2 Department of Animal Breeding and Genetics, Swedish University of Agricultural 9 Sciences, Box 7023, 750 07 Uppsala, Sweden. 10 3 Departament de Ciència Animal, Universitat de Lleida-Agrotecnio Center, Lleida,Spain. 11 4 Genus plc, 100 Bluegrass Commons Blvd., Ste122200, Hendersonville, TN 37075, USA. 12 13 * Equal contributions 14 † Corresponding author 15 [email protected] 16 17 Abstract 18 Background 19 In this paper, we estimated recombination rate variation within the genome and between 20 individuals in the pig using multiocus iterative peeling for 150,000 pigs across nine 21 genotyped pedigrees. We used this to estimate the heritability of recombination and perform 22 a genome-wide association study of recombination in the pig. 23 24 Results 25 Our results confirmed known features of the pig recombination landscape, including 26 differences in chromosome length, and marked sex differences.
  • 1 Large-Scale Deep Multi-Layer Analysis of Alzheimer's Disease

    1 Large-Scale Deep Multi-Layer Analysis of Alzheimer's Disease

    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.05.438450; this version posted August 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Large-Scale Deep Multi-Layer Analysis of Alzheimer’s Disease Brain Reveals Strong Proteomic Disease-Related Changes Not Observed at the RNA Level Erik C.B. Johnson1,2,†,*, E. Kathleen Carter1,2,†, Eric B. Dammer1,3,†, Duc M. Duong1,3, Ekaterina S. Gerasimov2, Yue Liu4, Jiaqi Liu4, Ranjita Betarbet1,2, Lingyan Ping1,2,3, Luming Yin3, Geidy E. Serrano7, Thomas G. Beach7, Junmin Peng8,9, Philip L. De Jager10, Vahram Haroutunian11,12, Bin Zhang13, Chris Gaiteri14, David A. Bennett14, Marla Gearing1,2,6, Thomas S. Wingo1,2,4, Aliza P. Wingo1,5,15, James J. Lah1,2, Allan I. Levey1,2,* and Nicholas T. Seyfried1,2,3,* 1Goizueta Alzheimer’s Disease Research Center, Emory University School of Medicine, Atlanta, GA, USA 2Department of Neurology, Emory University School of Medicine, Atlanta, GA, USA 3Department of Biochemistry, Emory University School of Medicine, Atlanta, GA, USA 4Department of Genetics, Emory University School of Medicine, Atlanta, GA, USA 5Department of Psychiatry, Emory University School of Medicine, Atlanta, GA, USA 6Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA, USA 7Banner Sun Health Research Institute, Sun City, AZ, USA 8Departments of Structural Biology and Developmental Neurobiology, St. Jude Children’s Research Hospital, Memphis, TN, USA 9Center for Proteomics and Metabolomics, St.
  • Proteomic Profiling of Extracellular Vesicles Derived From

    Proteomic Profiling of Extracellular Vesicles Derived From

    cells Article Proteomic Profiling of Extracellular Vesicles Derived from Cerebrospinal Fluid of Alzheimer’s Disease Patients: A Pilot Study Satoshi Muraoka 1, Mark P. Jedrychowski 2, Kiran Yanamandra 3, Seiko Ikezu 1, Steven P. Gygi 2 and Tsuneya Ikezu 1,4,5,* 1 Department of Pharmacology and Experimental Therapeutics, Boston University School of Medicine, Boston, MA 02118, USA; [email protected] (S.M.); [email protected] (S.I.) 2 Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA; [email protected] (M.P.J.); [email protected] (S.P.G.) 3 Abbvie Inc. Foundational Neuroscience Center, Cambridge, MA 02139, USA; [email protected] 4 Department of Neurology, Boston University School of Medicine, Boston, MA 02118, USA 5 Center for Systems Neuroscience, Boston University, Boston, MA 02215, USA * Correspondence: [email protected]; Tel.: +1-617-358-9575 Received: 26 June 2020; Accepted: 21 August 2020; Published: 25 August 2020 Abstract: Pathological hallmarks of Alzheimer’s disease (AD) are deposits of amyloid beta (Aβ) and hyper-phosphorylated tau aggregates in brain plaques. Recent studies have highlighted the importance of Aβ and tau-containing extracellular vesicles (EVs) in AD. We therefore examined EVs separated from cerebrospinal fluid (CSF) of AD, mild cognitive impairment (MCI), and control (CTRL) patient samples to profile the protein composition of CSF EV. EV fractions were separated from AD (n = 13), MCI (n = 10), and CTRL (n = 10) CSF samples using MagCapture Exosome Isolation kit. The CSF-derived EV proteins were identified and quantified by label-free and tandem mass tag (TMT)-labeled mass spectrometry.
  • NPEPPS (NM 006310) Human Tagged ORF Clone Product Data

    NPEPPS (NM 006310) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC209037 NPEPPS (NM_006310) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: NPEPPS (NM_006310) Human Tagged ORF Clone Tag: Myc-DDK Symbol: NPEPPS Synonyms: AAP-S; MP100; PSA Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 NPEPPS (NM_006310) Human Tagged ORF Clone – RC209037 ORF Nucleotide >RC209037 representing NM_006310 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCTGGCAGCTGCCGCCCCCTCCCTCGCTCGCCGCCTGCTCTTCCTCGGCCCTCCGCCTCCTCCCC TCCTCCTTCTCGTCTTCAGCCGCTCCTCTCGCCGCCGCCTCCACAGCCTGGGCCTCGCCGCGATGCCGGA GAAGAGGCCCTTCGAGCGGCTGCCTGCCGATGTCTCCCCCATCAACTACAGCCTTTGCCTCAAGCCCGAC TTGCTGGACTTCACCTTCGAGGGCAAGCTGGAGGCCGCCGCCCAGGTGAGGCAGGCGACTAATCAGATTG TGATGAATTGTGCTGATATTGATATTATTACAGCTTCATATGCACCAGAAGGAGATGAAGAAATACATGC TACAGGATTTAACTATCAGAATGAAGATGAAAAAGTCACCTTGTCTTTCCCTAGTACTCTGCAAACAGGT ACGGGAACCTTAAAGATAGATTTTGTTGGAGAGCTGAATGACAAAATGAAAGGTTTCTATAGAAGTAAAT ATACTACCCCTTCTGGAGAGGTGCGCTATGCTGCTGTAACACAGTTTGAGGCTACTGATGCCCGAAGGGC TTTTCCTTGCTGGGATGAGCCTGCTATCAAAGCAACTTTTGATATCTCATTGGTTGTTCCTAAAGACAGA
  • Li Et Al: Comprehensive Variation Discovery and Recovery of Missing Sequence in the Pig Genome Using Multiple De Novo Assemblies

    Li Et Al: Comprehensive Variation Discovery and Recovery of Missing Sequence in the Pig Genome Using Multiple De Novo Assemblies

    Li et al: Comprehensive variation discovery and recovery of missing sequence in the pig genome using multiple De Novo assemblies Supplemental references 1 Wang LY, Wang AG, Wang LX, Li K, Yang GS, He RG, Qian L, Xu NY, Huang RH, Peng ZZ, et al. 2011. Animal genetic resources in China: pigs. (ed. China National Commission of Animal Genetic Resources) , pp. 18-470. China Agricultural Press, Beijing. 2 Chen, K., Baxter, T., Muir, W. M., Groenen, M. A. & Schook, L. B. Genetic resources, genome mapping and evolutionary genomics of the pig (Sus scrofa). Int. J. Biol. Sci. 3, 153-165 (2007). 3 Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079 (2009). 4 McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 20, 1297-1303 (2010). 5 Saeed, A. I. et al. TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34, 374-378 (2003). 6 Tajima, F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123, 585-595 (1989). 7 Maillet, N., Lemaitre, C., Chikhi, R., Lavenier, D. & Peterlongo, P. Compareads: comparing huge metagenomic experiments. BMC Bioinformatics 13 Suppl 19, S10 (2012). 8 Sennoune, S. R. & Martinez-Zaguilan, R. Vacuolar H(+)-ATPase signaling pathway in cancer. Curr. Protein Pept. Sc. 13, 152-163 (2012). 9 Yang, D. Q. et al. V-ATPase subunit ATP6AP1 (Ac45) regulates osteoclast differentiation, extracellular acidification, lysosomal trafficking, and protease exocytosis in osteoclast‐mediated bone resorption. J. Bone Miner. Res.