I a STUDY of the MECHANISM by WHICH CD86 REGULATES Igg1

A STUDY OF THE MECHANISM BY WHICH CD86 REGULATES IgG1

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of The Ohio State University

Nicholas W. Kin, B.S.

*****

The Ohio State University 2007

Dissertation Committee: Approved by Professor Virginia M. Sanders, Advisor

Professor William Lafuse ______Professor Denis Guttridge Advisor Integrated Biomedical Science Graduate Program Professor Susheela Tridandapani

i i

ABSTRACT

The goal of this dissertation was to determine the molecular mechanism by which

CD86 (B7-2) stimulation on a CD40 ligand (CD40L)/Interleukin-4 (IL-4)-activated B cell activates NF-κB and increases the level of IgG1 produced. Our laboratory reported previously that stimulation of CD86 on a CD40L/IL-4-activated B cell increases the amount of IgG1 produced on a per cell basis, without affecting class switch recombination (CSR) or mRNA stability. In addition, CD86 stimulation increases the expression and binding of the transcription factor Oct-2 to the 3’-IgH enhancer. The

CD86-induced increase in Oct-2 expression is associated with increased activation and nuclear localization of NF-κB, specifically the p50/p65 subunits. Since NF-κB is involved in numerous biological responses, therapeutic interventions aimed at either suppressing or enhancing antibody production via CD86 signaling would need to target the specific intermediates activated by CD86 upstream of NF-κB activation. Thus, the hypothesis tested in this dissertation is that stimulation of CD86 on a CD40L/IL-4- activated B cell activates a distinct signaling pathway within the B cell to increase the activation of NF-κB and the gene transcription mediated by the 3’-IgH enhancer. The present data are the first to show the CD86 signal transduction pathway in a B cell proximal to the activation of NF-κB and the regulation of gene activity. We show that

ii CD86 stimulation on a CD40L/IL-4-activated B cell increased the activity of PI3K, as well as the phosphorylation state of PDK1, Akt, IKKα/β, PLCγ2, and PKCαβ, to increase gene activity mediated by NF-κB and the hs4 region of the 3’-IgH enhancer.

The present data also show that addition of CD28/Ig to CD40L/IL-4-activated B cells on

Wt, but not CD86- or CD19-deficient, B cells increased the level of phosphorylation of

Lyn and CD19, as well as the amount of Lyn, Vav, and PI3K proteins that immunoprecipitated with CD19. In vivo, serum IgG1 levels following immunization with a T cell-dependent antigen were decreased in mice receiving Wt-T/CD86-deficient B cells when compared to mice receiving Wt-T/Wt-B cells. The decrease in serum IgG1 was associated with a decrease in the level of B cell-associated Oct-2 mRNA and protein, but a normal level of germline IgG1 mRNA and Th2 cell-dependent IL-4. The significance of this dissertation is that it is the first study to identify the mechanism by which CD86 induces an intracellular signaling pathway directly in the B cell. The knowledge gained from this work will not only provide a molecular mechanism by which

CD86 stimulation regulates the level of an IgG1 response, but also identify potential molecular targets for therapeutic interventions to selectively regulate the level of an IgG1 response positively or negatively.

iii

ACKNOWLEDGMENTS

I am forever grateful to my mentor Dr. Virginia Sanders for all her guidance and support during my graduate training in her laboratory. She taught me how to think and ask questions like a scientist. Her commitment to teaching and dedication to her students was an inspiration to always strive to become a better scientist. She also created an excellent working environment in which I was able to ask and test novel scientific questions. I also want to thank my committee members at The Ohio State University,

Drs. Denis Guttridge, William Lafuse, and Susheela Tridandapani for their guidance and helpful discussion during meetings.

I am also thankful to the Integrated Biomedical Science Graduate Program with

Dr. Alan Yates as Director for creating an environment that fosters good science and the pursuit of excellence. In addition, I thank everyone in the Integrated Biomedical Science

Graduate Program office that helped me through the first few years of graduate school and all the paperwork associated with it.

I would also like to acknowledge both past and present members of the Sanders laboratory. Drs. Deborah Kasprowicz, Adam Kohm, and Joseph Podojil were instrumental in laying the groundwork for my dissertation research. Dr. Joseph Podojil also helped to develop my early technical skills in the laboratory. I would also like to

iv thank our laboratory manager, Scot Erbe, for his help and dedication to keeping the lab running. Finally, I would also like to thank the current members of laboratory, Kurt

Lucin, Jackie McAlees, and Alan Smith.

I am forever grateful to my parents Wayne and Denise. It was through their guidance and examples that I became the person I am today. They instilled a combination of their values, work ethic, love, pursuit of education, and a never say die attitude that helped me to achieve the goals that I set for myself.

Finally, I would like to thank my wife Amanda, who has always been there for me through the successes and the failures of this dissertation work. I will be forever grateful for her love and support throughout graduate school.

VITA

August 23, 1979 ...... Born – Findlay, Ohio

2001 ...... B.S. Biochemistry, Bowling Green State University.

2002...... Graduate Research Associate The Ohio State University.

2003 – 2006...... Integrated Immunobiology Training Grant Fellowship The Ohio State University.

2006 – 2007...... Graduate Research Associate The Ohio State University.

PUBLICATIONS

Research Publications

1. Fisher, I.B., Kin, N.W., McAlees, J.W., Sanders, V.M. Regulation of Adaptive Immunity by the Neurotransmitter Norepinephrine. Current Immunol Reviews 2006 Nov;2(4):361-70.

2. Kin, N.W. and Sanders, V.M. CD86 stimulation on a B cell activates the PI3K/Akt and PLCγ2/PKCα/β signaling pathways. J Immunol. 2006 Jun 1;176(11):6727- 35.

3. Kin, N.W. and Sanders, V.M. It takes nerve to tell T and B cells what to do. J Leukoc Biol. 2006 Jun;79(6):1093-104.

4. Podojil, J.P., Kin, N.W., Sanders, V.M. CD86 and beta2-adrenergic receptor signaling pathways, respectively, increase Oct-2 and OCA-B Expression and binding to the 3'-IgH enhancer in B cells. J. Biol. Chem. 2004 May 28;279(22):23394-404.

vi FIELDS OF STUDY

Major Field: Integrated Biomedical Science

vii

TABLE OF CONTENTS

ABSTRACT………………………………………………………………………………ii

ACKNOWLEDGMENTS………………………………………………………………..iv

VITA……………………………………………………………………………………...vi

LIST OF FIGURES……………………………………………………………………...xii

LIST OF ABBREVIATIONS……………………………………………………………xv

CHAPTERS

1. INTRODUCTION AND LITERATURE REVIEW……………………………...1

1.1 Divisions of the immune system……………………………………………..1 1.1.1 Innate immune system……………………………………………..1 1.1.2 Adaptive immune system……………………………………….….3

1.2 Effector cell populations of the acquired immune system…………………...4 1.2.1 B cell development………………………………………………...4 1.2.2 B cells and germinal centers……………………………………….6 1.2.3 B cell differentiation into an antibody-secreting cell………………8

1.3 CD40 and IL-4 receptor stimulation on a B cell……………………………10 1.3.1 IL-4 receptor stimulation on a B cell……………………………..10 1.3.2 CD40 stimulation on a B cell……………………………………..14

1.4 Cognate B and T cell interaction……………………………………………16 1.4.1 B cell expression of CD86 and costimulation of a T cell………...16 1.4.2 CD86 direct signaling to a B cell…………………………………17

1.5 Regulation of IgG1 production……………………………………………...19 1.5.1 Regulation of the IgH locus and the 3’-IgH enhancer………..…..19 1.5.2 Regulation of Oct-2 expression and transcriptional activity……...21

viii

1.6 Conclusion and hypothesis………………………………………………….22

2. MATERIALS AND METHODS………………………………………………..28

2.1 Animals……………………………………………………………………..28

2.2 Cell lines…………………………………………………………………….28

2.3 Resting B cell isolation and culture…………………………………………29

2.4 In vivo cell transfer and immunization……………………………………...30

2.5 Western blot………………………………………………………………...30

2.6 Immunoprecipitation (IP)…………………………………………………...31

2.7 Flow cytometry……………………………………………………………..31

2.8 PI3-Kinase enzyme-linked immunoassay (ELISA)………………………...32

2.9 Quantitative real-time polymerase chain reaction (PCR)…………………...32

2.10 IgG1 enzyme-linked immunoassay (ELISA)………………………………33

2.11 Chromatin immunoprecipitation (ChIP)…………………………………..34

2.12 Transient transfections…………………………………………………….35

2.13 Transfection isolation and reporter gene assay……………………………36

2.14 Statistics……………………………………………………………………36

3. RESULTS………………………………………………………………………..37

3.1 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of IKKαβ………………………...37

3.2 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of Akt and PDK1………………...42

3.3 CD86 stimulation on a CD40L/IL-4-activated B cell

ix increases the activity of PI3K……………………………………………………45

3.4 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation of PKCαβ and PLCγ2….………………………..48

3.5 CD86 induces an increase in NF-κB- and 3’-IgH enhancer- mediated gene activity…………………………………………………………...52

3.6 CD86-deficient B cells produce less IgG1 and Oct-2 in vivo…………………………………………………………...57

3.7 CD86 signaling in a B cell is CD19-dependent……………………………..63

3.8 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of CD19…………………………..70

3.9 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of Lyn…………………………….74

4. DISCUSSION…………………………………………………………………...80

4.1 Summary of results………………………………………………………….80

4.2 Possible mechanisms by which CD86 regualtes IgG1 production………….81 4.2.1 Class switch recombination versus rate of mature IgG1 mRNA production…………………………………..81 4.2.2 Cell survival……………………………………………………….83

4.3 CD86 Signaling in a B cell………………………………………………….84 4.3.1 Requirement for prior activation…………………………………..84 4.3.2 CD28/Ig stimulation of CD86……………………………………..85 4.3.3 Targets of NF-κB………………………………………………….87 4.3.4 Two signaling pathways activated………………………………...88 4.3.5 Akt activation……………………………………………………...89 4.3.6 CD19-deficient B cell phenotype………………………………….90 4.3.7 Ability of CD86 to activate CD19………………………………...91

4.4 In vivo relevance…………………………………………………………….93 4.4.1 CD86 stimulation in vivo………………………………………….93 4.4.2 Human versus murine CD86………………………………………94 4.4.3 Clinical relevance of CD86 signaling……………………………..96

4.5 Future directions…………………………………………………………….97 4.5.1 Phosphorylation of CD86…………………………………………97

x 4.5.2 Role of Lyn and other protein tyrosine kinases...…………………98 4.5.3 Role of BCR…………………...…………………………………100

4.6 Concluding remarks….……………………………………………………101

LITERATURE CITED…………………………………………………………………104

LIST OF FIGURES

Figure Page

1. The process of B cell development. ……………………………..………..5

2. B cell activation and germinal center reaction. …………………………..7

3. The process of class switch recombination to IgG1……………………...11

4. IL-4 receptor signaling pathway.………………………………………...12

5. CD40 signaling pathway.………………………………………………...13

6. Cognate B and T cell interaction..……………………………………….15

7. Transcription factor binding sites in the 3’-IgH enhancer locus.………...20

8. Proposed in vitro model system.…………………………………………24

9. Proposed in vivo model system.…………………………………………25

10. CD86 stimulation increases the phosphorylation of IKKαβ.……………38

11. IKKαβ is required for the CD86-induced increase in p-IκBα.………….40

12. IKKαβ is required for the CD86-induced increase in Oct-2...…………..41

13. CD86 stimulation increases the phosphorylation of Akt.………………..43

14. PI3K is required for the CD86-induced increase in p-Akt.……………...44

15. CD86 stimulation increases the phosphorylation of PDK1.……………..46

16. PDK1 is required for the CD86-induced increase in p-Akt.……………..47 xii

17. CD86 stimulation increases the activity of PI3K.………………………..49

18. PI3K is required for the CD86-induced increase in Oct-2.………………50

19. Lack of PI3K prevents the CD86-induced increase in Oct-2.…………...51

20. CD86 stimulation increases the phosphorylation of PKCαβ.……………53

21. CD86 stimulation increases the phosphorylation of PLCγ2.…………….54

22. CD86 stimulation increases the NF-κB-mediated gene activity.………...56

23. CD86 stimulation increases the hs4- and 3’-IgH enhancer-mediated gene activity…………………………………………58

24. CD86 stimulation increases the binding of NF-κB to the hs4 region of the 3’-IgH enhancer.…………………..………………59

25. The presence or absence of CD86 does not alter the number of B and T cells present in the spleen.………………………61

26. The lack of CD86 expression alters the level of Oct-2 and mature IgG1 mRNA in vivo, but not the level of IL-4 and germline IgG1.……………62

27. The absence of CD86 does not alter the level of IL-4 produced by a CD4+ T cell………………………..……………………...64

28. The absence of CD86 expression decreases the level of Oct-2 and IgG1 in vivo.……………………………………...65

29. Expression of CD19 is required for the CD86-induced increase in PI3K…………………………………………...……………..67

30. Expression of CD19 is required for the CD86-induced increase in Oct-2.………………………………………………………...68

31. Expression of CD19 is required for the CD86-induced increase in IgG1.……………………………………………..…………...69

32. CD86 signaling is normal in TLR4-deficient B cells.…………………...71

33. CD86 stimulation increases the phosphorylation of CD19.……………...72

34. CD86 activates CD19 in TLR4-deficient B cells.……………………….73 xiii

35. CD86 stimulation induces increasd binding of signaling proteins to CD19.……………………………………………...75

36. A src-family kinase is required for CD86 stimulation to increase CD19 phosphorylation.………………………….…………...76

37. A src-family kinase is required for CD86 stimulation to increase Oct-2 mRNA.………………………………………………...78

38. CD86 stimulation increases the phosphorylation of Lyn.………………..79

39. Proposed CD86 signaling pathway in an activated B cell.………………82

xiv

LIST OF ABBREVIATIONS

Ab - antibody

Ag - antigen

APC - antigen-presenting cell

ATP - adenosine 5’-triphosphate

BCR - B cell receptor

Blr-1 - Burkitt’s lymphoma receptor-1

BSA - bovine serum albumin

BSS - balanced salt solution

BTK - Bruton’s tyrosine kinase cAMP - adenosine-3’,5’-cyclic monophosphate

CD - cluster of differentiation

CD40L - CD40 ligand

ChIP - chromatin immunoprecipitation

DNA - deoxyribonucleic acid

ELISA - enzyme-linked immunoassay

FACS - fluorescence-activated cell sorter

FCS - fetal calf serum

xv FITC - fluorescein isothiocyanate

Ig - immunoglobulin

IFN - interferon

LPS -lipopolysacchride

MAPK - mitogen-activated protein kinase

IL - interleukin

IL-4R - interleukin-4 receptor i.p. - intraperitoneal i.v. - intravenous

Jak - Janus kinase

KO - knockout

MHC - major histocompatability complex mRNA - messenger RNA

PALS - periarterial lymphoid sheath

PBS - phosphate buffered saline

PKA - protein kinase A

PKC - protein kinase C

RBC - red blood cell

RGG - rabbit gamma globulin

RNA - ribonucleic acid

RT-PCR - reverse transcriptase-polymerase chain reaction

Scid - severe combined immunodeficient sIg - surface Ig

xvi SLE - systemic lupus erythematosus

STAT - signal transducer and activator of transcription

TCR - T cell receptor

Th - T helper cell

TNP - trinitrophenyl

Wt - wildtype

xvii

CHAPTER 1

INTRODUCTION AND LITERATURE REVIEW

1.1 Divisions of the immune system

1.1.1 Innate immune system

Defense against invading bacteria and viruses is mediated by the coordination of many components and cell types that are collectively called the immune system. To ensure successful clearance of the invading pathogen, the immune system is subdivided into early non-specific reactions of the innate immune system and the later antigen- specific reactions of the adaptive immune system. The principal components of the innate immune system are (1) physical and chemical barriers, such as the skin and antimicrobial substances, (2) phagocytic cells, such as neutrophils, macrophages, dendritic cells, and natural killer (NK) cells, and (3) cytokines such as interferon-γ (IFN-

γ). Physical barriers serve as the first line of defense, producing a mechanical barrier between the pathogen and the organism, namely the skin. In addition, chemical/physiologic barriers exist, such as high body temperature, saliva, and chemical secretions including enzymes and mediators activated within the complement system.

For the purpose of this dissertation these physical and chemical barriers will not be discussed in further detail [extensively reviewed in (1, 2)].

1 The other two components of the innate immune system, phagocytosis and inflammation, intimately involve phagocytic cells, such as macrophages, dendritic cells, and neutrophils (3-5). The role of phagocytic cells in innate immunity is two-fold, i.e. to facilitate the clearance of foreign antigens (Ags) and to aid in the proper activation of the adaptive immune system. The ability of dendritic cells and machrophages to properly activate the adaptive immune system can be further divided into two mechanisms, serving as an antigen-presenting cell (APC) to endocytose and process Ag for presentation to a CD4+ T-helper cell (Th) (6), as well as through the release of inflammatory cytokines and chemokines (7-10). Upon phagocytosis of the foreign Ag by the APC, the Ag is degraded in the lysosome and presented in association with Major

Histocompatibility Complex II (MHCII) to Th cells to allow for activation (11). The activation of a Th cell by an APC during the immune response will be discussed in detail later. The second mechanism by which APCs can aid in the proper activation of the adaptive immune response is through the local production of inflammatory cytokines and chemokines, which cause the blood vessels to dilate and increase permeability as well as increase adhesion molecule expression (12, 13). The combination of these changes allows for cells of the innate and adaptive immune system to diapedes out of the blood circulation and into the site of injury/antigenic challenge (14). Thus, phagocytic cells play an integral part in the activation of the adaptive immune system by presenting foreign Ags to Th cells and aiding in the localization of the cells to the site of injury.

2 1.1.2 Adaptive immune system

The second arm of the immune system is the adaptive immune system, which consists of B and T lymphocytes. The adaptive immune system is characterized by the ability of cells to both respond in an Ag-specific manner and develop memory to that Ag so that each successive challenge to that Ag leading to a quicker and more robust response. The ability of B and T cells to respond in an Ag-specific manner is mediated by Ag-specific receptors named the B cell receptor (BCR) and T cell receptor (TCR), respectively (15). The BCR and TCR can specifically recognize either the whole Ag alone (16) or the processed Ag in association with MHCII (17, 18). Because these receptors are Ag-specific and high affinity, it allows for the clearance of low concentrations of Ag and the ability of a few Ag-specific B and T cells to adequately respond and protect the host. The second aspect of the adaptive immune response is the ability to produce memory to an Ag. Upon exposure of the adaptive immune system to an Ag for the second time, the immune response is quicker and more robust than during the first exposure (19, 20). In addition, the adaptive immune system, under normal conditions, is able to discriminate between self and non-self Ags (21-23). However, when there is a breakdown in this ability to differentiate between self and non-self Ags, autoimmune diseases develop. For example, autoimmune diseases, such as rheumatoid arthritis and multiple sclerosis, arise when the adaptive immune system starts attacking self-Ags (24, 25), illustrating the delicate balance between helpful and harmful immune responses.

3 1.2 Effector cell populations of the adaptive immune system

1.2.1 B cell development

The B cell produces high affinity antibodies against foreign Ags and is an integral part of the adaptive immune response. While mature B cells reside in the spleen and lymph nodes where they can be exposed to foreign Ags and produce Abs, B cell development primarily occurs in the bone marrow. Figure 1 summarizes the development of a B cell [extensively reviewed in (26-28)].

Common lymphoid progenitor cells (stem cells) give rise to pro-B cells in the bone marrow. During the pro-B cell stage, the Ig heavy chain loci undergoes gene rearrangement and those cells that successfully produce a functional heavy chain can express a “pre-B cell receptor,” which consists of the Ig heavy chain (IgH), a surrogate light chain, and the signaling chains Ig-α and Ig-β. Assembly of this pre-B cell receptor allows for the transition into the pre-B cell stage. During the pre-B cell stage the light chain gene rearrangement occurs and those cells that express a functional light/heavy chain in association with Ig-α/Ig-β are then considered immature B cells. Immature B cells go through a series of transitional stages in which they leave the bone marrow and go into the periphery where they reside in lymphoid organs. The IgM+ immature B cell becomes an IgM+/IgD+ mature B cell that can now respond to antigen. During the developmental process, the B cell is constantly being screened for functional heavy and/or light chain gene rearrangements that produce a BCR that is functional, but does not bind to self-Ags. This process is considered a form of positive and negative selection that allows for the induction of tolerance to self-Ags prior to export of the B cell into the

Figure 1. The process of B cell development. B cell development originates from the bone marrow where stem cells develop into pro-B cells. At the pro-B cell stage, the Ig heavy chain (IgH) loci undergoes gene rearrangement and those cells that successfully produce a functional heavy chain express a “pre-B cell receptor,” which consists of the Ig heavy chain, a surrogate light chain (S-light), and the signaling chains Ig-α and Ig-β.

Pro-B cells transition into pre-B cells as light chain gene rearrangement occurs, and once a functional BCR is expressed, the cell is considered an immature B cell. Immature B cells can then go through a series of transitional stages in which the B cell leaves the bone marrow and goes into the periphery where it will reside in lymphoid organs. The

IgM+ immature B cell becomes an IgM+/IgD+ mature B cell that can now respond to antigen. Once a mature B cell encounters its cognate antigen and cytokines, it undergoes somatic hypermutation (SHM) and class switch recombination (CSR) to become an antibody-secreting cell.

5 peripheral environment where autoimmune type reactions might occur. Taken together, the development of a B cell is a complex series of DNA rearrangements that is highly regulated to allow for the production of B cells that can recognize every Ag we might come in contact with, without reacting to our own self-Ags.

1.2.2 B cells and germinal centers

The end result of B cell development in the bone marrow is an IgM+/IgD+ mature

B cell that enters the recirculating pool of mature B cells that reside in secondary lymphoid organs such as the spleen and/or lymph nodes. After development is complete, the mature B cell can exist as either a naive B cell or an effector B cell. During a Th cell- dependent Ab response, a resting B cell must receive two signals from a Th cell to become fully activated into an effector B cell, an idea that was suggested previously by the two-signal hypothesis (29).

The primary B cell zones in the spleen and lymph nodes are the marginal zone and primary follicle, respectively (30). The B cell will remain in the B cell rich zone for several hours looking for its cognate Ag, but will move into the circulation and enter another secondary lymphoid organ if it does not come into contact with its cognate Ag

(31). This process ensures that no matter where an Ag enters the body, the Ag-specific B cell will eventually come into contact with it. Once a B cell encounters its cognate Ag, it will undergo a second type of development, an Ag-dependent development. A B cell that encounters its cognate Ag will either differentiate into an IgM-secreting cell, class switch to another isotype of Ab, such as IgG1, or enter into a germinal center reaction (see

Figure 2). The first area involved in a germinal reaction is termed the dark zone. In the

Figure 2. B cell activation and germinal center reaction. Activated B cells

(centroblasts) enter into a germinal center and undergo a burst of proliferation in the dark zone of the germinal center. The variable region of the IgH locus undergoes somatic hypermutation, producing centrocytes with either a higher or lower affinity surface immunoglobulin (sIg). In the basal light zone, centrocytes with higher affinity sIg will be able to interact with antigen-antibody complexes that are attached to the surface of follicular dendritic cells through Fc receptors. Centrocytes with high affinity sIg move to the apical light zone and interact with Th cells, where the centrocytes undergo class switch recombination (CSR) and mature into memory B cells or plasma cells.

7 dark zone, activated B cells (centroblasts) undergo a burst of proliferation and somatically hypermutate (SHM) the variable region of the Ig gene (32-34). SHM of the

Ig gene results in B cells that produce Abs that are of a higher or lower affinity for the specific antigen (35, 36). After the dark zone reaction, the centrocytes move into the basal light zone where follicular dendritic cells (FDC) reside (28, 33). The FDCs express high levels of Fc receptors that bind Ab-Ag complexes and display the Ag for the B cell to see (37). The centrocytes compete for binding to the antigen on the FDCs and the B cells with the higher affinity receptors will bind the antigen, thus allowing for the selection of the highest affinity Ab. The higher affinity centrocytes will survive and move to the apical light zone, while the lower affinity centrocytes will undergo apoptosis

(38-40). The apical light zone contains Ag-specific Th cells that interact with the B cells to form cognate interactions since the B cell presents antigenic peptides in association with MHCII (41, 42). The congnate interaction with a Th cell provides an environment in which the B cell can now differentiate into either a plasma cell that secretes high affinity Ab or a memory B cell that is poised to respond when Ag is encounted a second time (43-47).

1.2.3 B cell differentiation into an antibody-secreting cell

As mentioned above, a resting mature B cell that has recently left the bone marrow is IgM+/IgD+. In order to become fully activated and to develop into an antibody-secreting cell, the B cell requires two signals, as suggested previously by the two-signal hypothesis of B cell activation (29). The first signal is delivered to the B cell when the BCR complex interacts with the specific Ag it recognizes. Only the B cells that

8 are specific for the antigen will respond and proliferate. The signaling cascade initiated by Ag binding to the BCR generates a multitude of signaling pathways in the B cell

[extensively reviewed in (48)]. Even though BCR signaling increases B cell activation, proliferation, and survival, the B cell will not become an antibody-secreting cell until it receives a second set of signals from an Ag-specific CD4+ Th cell (49-51). Following

BCR-Ag interaction, the B cell subsequently endocytoses the complex, processes the protein Ag into antigenic peptides within the lysosome, and expresses the peptides in association with MHCII on the B cell surface (17, 18, 52, 53). The B cell now interacts with an Ag-specific CD4+ Th cell that recognizes the MHCII-peptide complex via the

TCR that is specific for that peptide. The interaction between MHCII-peptide and TCR activates the T cell to produce soluble proteins known as cytokines, i.e., interleukin-4

(IL-4), and upregulates the surface expression of an important costimulatory molecule for the B cell, CD40L (54-56). CD40L and IL-4 interact with the CD40 and IL-4 receptors on the B cell to induce differentiation into an antibody-secreting cell. For the purpose of this dissertation, the cytokine IL-4 will be used in all experiments to differentiate B cells into Ab-secreting cells. The cytokine that Th cells produce is the determining factor for what isotype the B cell will produce. For example, IL-4 secretion by a Th2 cell induces the B cell to produce IgG1 or IgE (57, 58), while IFN-γ secretion induces the B cell to produce IgG2a (59).

9 1.3 CD40 and IL-4 receptor stimulation on a B cell

1.3.1 IL-4 receptor stimulation on a B cell

During the Ab isotype switch event (see Figure 3), a B cell changes the constant region of the Ig heavy chain (CH) DNA through a complex switch event in which CH genes are removed to place the CH region of interest next the the variable, diversity, and joining (VDJ) CH transcript. Switch regions (S), which are guanine-rich highly repetitive nucleotide sequences, control deletional recombination of the Ig gene. These switch

regions are located in the 5’ region of all heavy chain constant regions, except for Cδ (61).

As mentioned above, the cytokine signal received by a B cell from a Th cell during a T cell-dependent Ab response determines the isotype of Ab that a B cell will produce. This dissertation focuses on a Th2 cell-dependent Ab response, which requires the production of the cytokine IL-4. The commitment to undergo class switch recombination (CSR) to

IgG1 is dependent on two signals from a Th2 cell, i.e., CD40L and IL-4 (62). Stimulation of CD40 and IL-4 on a B cell activates a number of signaling pathways to induce the production of germline γ1 transcripts, also referred to as intervening γ1 (Iγ1) (62, 63). It has been hypothesized that the switch recombination event requires the expression of Iγ1 to open up the 5’ end of the γ1 constant region to the recombination machinery (64). In support of this, a positive correlation exists between the level of Iγ1 and the level of CSR

(60, 65). The germline promoter of Iγ1 contains both NF-κB and signal transducer and activator of transcription 6 (STAT6) binding sites. As shown in Figure 4 and Figure 5,

IL-4 receptor activates STAT6, while CD40 signaling activates NF-κB. In vitro, activation of a resting B cell with CD40L and IL-4 enhances the level of Iγ1 transcript and CSR to IgG1 (51, 62, 63). STAT6-deficient B cells fail to produce Iγ1 following 10

Figure 3. The process of class switch recombination to IgG1. (1) NF-κB and STAT6 activated by CD40 and IL-4R signaling, respectively, activate the γ1 germline promoter.

The amount of germline γ1 transcript, also referred to as intervening γ1 (Iγ1) produced positively correlates with the level of class switch recombination to IgG1 (60). (2)

Recombination occurs at the Sµ and Sγ1 (switch) regions. As a result of the switch recombination event, the intervening sequence of DNA is looped-out and the end product is an IgH locus where constant γ1 (Cγ1) is transcribed as the heavy chain constant region and a circular piece of DNA containing portions of Sµ and Sγ1, Cµ, Cδ, Sγ3, Cγ3, and

Iγ1 is removed. VDJ region designates the variable, diversity, and joining regions of the

IgH locus. Eµ designates the intronic enhancer region of the IgH locus.

Figure 4. IL-4 receptor signaling pathway. The IL-4 receptor (IL-4R) is composed of two chains, i.e., the IL-4Rα and the common γ (γc). Upon binding of IL-4 to the IL-4R,

JAK1 and 3 interact with the cytoplasmic tial of the IL-4R. The primary downstream transcription factor activated by the IL-4R is signal transducer and activator of transcription 6 (STAT6). STAT6 dimerizes following phosphorylation and translocates to the nucleus where it can activate transcription from promoter regions containing

STAT6 binding sites. STAT6 is required for the IL-4R-induced production of IgG1 in B cells (67). Besides STAT6, the IL-4R also activates the PI3K/Akt and Ras signaling pathways through association of adapter molecules including insulin receptor substrate

(IRS1/2) and Src Homologous and Collagen (Shc).

Figure 5. CD40 signaling pathway. Upon CD40 interaction with CD40L, TRAF 2, 3, 5 and 6 are recruited to the cytoplasmic domain of CD40. TRAF2 has been shown to cause

IKK-α/β/γ phosphorylation and the subsequent phosphorylation of IκBα. The phosphorylation of IκBα leads to its polyubiquination and degradation, leaving NF-κB free to translocate to the nucleus and regulate gene transcription. Besides the activation of NF-κB, CD40 is reported to activate JNK, p38, and Erk signaling pathways.

13 activation with CD40L and IL-4 (66), indicating that IL-4 receptor signaling and STAT6 are required for production of Iγ1 transcript and CSR to IgG1.

1.3.2 CD40 stimulation on a B cell

The Th2 cell provides a cell contact-mediated signal in the form of CD40L that interacts with CD40 on the surface of a B cell to activate the B cell and allow for differentiation into an antibody-secreting cell. The interaction of CD40-CD40L is required for a normal T cell-dependent Ab response since both CD40-deficient and

CD40L-deficient mice show deficiencies in class switch recombination and production of

IgG1 vivo [reviewed by (68)]. In vitro, CD40 can be stimulated artificially with either an anti-CD40 Ab or recombinant CD40L in the presence of IL-4 to induce B cells to proliferate and differentiate into antibody-secreting cells (69). Thus, CD40 and IL-4 receptor are sufficient to induce a B cell to differentiate into an antibody-secreting cell

(see Figure 6). However, the two-signal hypothesis of B cell activation was discussed earlier and included the activation of the BCR. The BCR provides an Ag-specific signal to only those B cells expressing a BCR of the correct specificity and plays a role in B cell activation in vivo. In vitro, stimulation with CD40L/IL-4 represents a polyclonal stimulus that activates all B cells in an Ag non-specific manner to differentiate into an

Ab-secreting cell.

CD40 is a 50 kDa transmembrane molcule that is a member of the tumor necrosis factor receptor (TNF-receptor) superfamily. It is constitutively expressed on all APCs, including B cells (56, 70). Upon interaction with CD40L, CD40 initiates a distinct signaling pathway within the B cell to help the B cell differentiate into an antibody-

Figure 6. Cognate B and T cell interaction. (1) Antigen (Ag) binds to the Ag-specific surface Ig, or B cell receptor (BCR), and induces an intracellular signaling pathway that activates the B cell. (2) The Ag is endocytosed, processed within the lysosome, and presented in the context of MHC II. The B cell also increases the level of CD86 (B7-2) expression. (3) The TCR recognizes the antigenic peptide in an MHC II restricted manner, while CD28 on the CD4+ Th2 cell interacts with CD86 on the B cell. (4) The combination of T cell receptor (TCR) and CD28 signaling causes the Th2 cell to upregulate CD40L expression and secrete the cytokine IL-4. (5) CD40L on the Th2 cell interacts with CD40 on the B cell and IL-4 secreted by the Th2 cell binds to the IL-4 receptor (IL-4R) on the B cell, respectively, inducing (6) class switch recombination to

IgG1.

15 secreting cell (see Figure 5). Similar to other TNF-receptor family members, CD40 relies on TNF-receptor-associated factors (TRAFs) to associate with its cytoplamsic tail, which allows for CD40 signaling in a B cell. To date, TRAFs 2, 3, 5, and 6 have been reported to bind to the CD40 cytoplasmic tail, although the specific roles of each TRAF member in CD40 signaling is still not fully understood (71). Following CD40-CD40L interaction, the association of TRAF2 and its phosphorylation activates NF-κB (72, 73).

The TRAF2-mediated activation of NF-κB involves the phosphorylation of the IκB kinase (IKK) complex, which includes two catalytic subunits (IKKα and β) and one regulatory subunit (IKKγ), and subsequent phosphorylation, polyubiquination, and degradation of IκBα. Once IκBα, a negative regulator of NF-κB that keeps NF-κB sequestered in the cytoplasm, is degraded, NF-κB is free to translocate to the nucleus and regulate gene transcription. CD40 stimulation primarily activates the NF-κB heterodimer comprised of the subunits p50 and RelB (74). NF-κB is reported to bind to and regulate the Iγ1 promoter, increasing the production of Iγ1 (75, 76). In addition to NF-κB activation, CD40 stimulation is also reported to activate c-jun kinase (JNK), mitogen- activated protein kinase (MAPK p38), and ERK (77-80)}.

1.4 Cognate B and T cell interaction

1.4.1 B cell expression of CD86 and costimulation of a T cell

CD86, also known as B7-2, is a costimulatory molecule belonging to the immunoglobulin superfamily (81). It is a 70-kDa glycoprotein that was cloned in 1993 as a counter receptor for CD28 and CTLA-4 (82, 83), both of which are expressed on a T cell. CD86 is primarily expressed on APCs, including B cells, dendritic cells, and 16 macrophages (82, 83). Resting naive B cells express CD86 at low levels (82), but rapidly upregulate it following stimulation of the B cell receptor (82), MHC II (84), CD40 receptor (85), IL-4 receptor (86), LPS receptor (87, 88), and the β2-adrenergic receptor

(89, 90). Investigation of the expression kinetics revealed that CD86 surface expression is detectable at 6 h and maximal at 24 - 48 h after B cell activation (88). However, to date, the promoter region of CD86 has not been cloned and characterized for neither the mouse nor human CD86 molecule, although there are data in the literature suggesting that

NF-κB regulates the expression of CD86 (90, 91).

Optimal T cell activation requires two signals originating from an APC, namely crosslinking of the TCR and costimulation of CD28 (see Figure 6). The TCR is engaged, in an antigen specific manner, by an MHCII:peptide complex while CD28 is engaged by either CD80 and/or CD86. Stimulation of the TCR and CD28 on a T cell induces a signaling pathway in the T cell that increases cell activation and expression of

CD40L and secretion of IL-4 (92). The requirement for T cell costimulation in the Ab response was suggested by the fact that CD86- and CD28-deficient mice produce less

IgG1 following immunization with a T cell-dependent antigen when compared to wildtype (Wt) mice (93, 94). This result is likely due to the loss of the CD86/CD28 interaction, which is required for costimulation of the T cell to increase CD40L and IL-4 expression during the generation of an optimal T cell-dependent antibody (Ab) response.

1.4.2 CD86 direct signaling to a B cell.

The interaction of APC-bound CD86 with T cell-bound CD28 is required for optimal T cell activation (93) and for generation of an optimal IgG1 response (94). The

17 role for CD28 costimulation of a T cell is well established, while the role for CD86 costimulation of a B cell is still being investigated. Thus, CD86 was classified as a costimulatory molecule required for CD28 stimulation, but was thought to possess no signaling potential itself due to a lack of identifiable docking sites within the cyoplasmic domain. However, CD86 possesses three putative PKC phosphorylation sites in its cytoplasmic domain (95), suggesting that it may be able to transduce a signal directly within the APC. Recent data show that stimulation of CD86 on an activated B cell increases the rate of IgG1 production (89, 96, 97), as well as the level of anti-apoptotic factors (98), CD80 expression (99), NF-κB activation (100), and Oct-2 expression and binding to the 3’-IgH enhancer (100). NF-κB, a family of transcription factors, consists of five major subunits, NF-κB1 (p105/p50), NF-κB2 (p100/p52), Rel A (p65), Rel B, and c-Rel, that form various homodimeric and heterodimeric complexes [reviewed in (101)].

NF-κB remains sequestered in the cytoplasm of a resting cell in a complex with IκB proteins. Upon activation of the classical NF-κB pathway, IκB proteins are phosphorylated, polyubiquitinated, and degraded within the proteosome, causing the release of NF-κB dimers that translocate to the nucleus to regulate gene activity. Recent reports indicate that CD86 stimulation on a B cell activates the classical NF-κB pathway, leading to a PKC-independent phosphorylation and degradation of IκBα, and subsequent nuclear localization of p50/p65 (100). In addition, CD86 is reported to increase the phosphorylation of p65 in a PKC-dependent manner (100). Thus, data in the literature support the hypothesis that CD86 stimulation on a B cell generates an intracellular signaling pathway within the B cell itself, though the exact mechanism by which this is occurring remains unknown.

1.5 Regulation of IgG1 production

1.5.1 Regulation of the IgH locus and the 3’-IgH enhancer

The B cell is unique in that during development a number of highly regulated

DNA recombination events occur that allow the B cell to produce Abs that are specific to an infinite number of Ags. During development in the bone marrow from pro-B to pre-B,

B cells undergo V(D)J recombination. During this event the variable region of the heavy and light chains are generated through DNA rearrangements of the various V, D, and J gene segments (102). One region that helps to control the V(D)J recombination event is the intronic IgH enhancer, or Eµ. Eµ is located between the last J segment and the IgM constant region (see Figure 7). The V(D)J recombination event changes the specificity of the Ab, allowing B cells to produce Ab against a variety of Ags. In addition, the isotype of Ab produced determines the effector function of the Ab. CSR changes the effector function of the Ab by switching the isotype of Ab being produced, while keeping the same Ag specificity. The process of CSR was described in detail above (see Figure

3). To control the amount of antibody produced by a B cell the IgH locus also contains a

3’-IgH enhancer region located downstream of the Ab constant regions. The 3’-IgH enhancer region is composed of four DNase I hypersensitivity regions named hs3A, hs1,2, hs3B, and hs4 (103). Of the four regions, hs1,2 and hs4 appear to have the most activity in transient transfection studies (104). Importantly, it appears that CSR to IgG1 is not as dependent on the 3’-IgH enhancer region as it is for other Ab isotypes, since 3’-

IgH enhancer-deficient cells and/or mice can still class switch to IgG1, but produce less total IgG1 Ab (105). The level of mature IgG1 transcript is regulated by a CD40 and IL-

Figure 7. Transcription factor binding sites in the 3’-IgH enhancer locus. The 3’-IgH enhancer region is located downstream of the Ig heavy chain gene and is reported to regulate the rate of IgG1 production. The 3’-IgH enhancer contains multiple transcription factor binding sites including octamer (Oct), AP-1, and NF-κB sites. Activated Oct-1 and Oct-2 bind to the octamer sequences in conjunction with coactivators, such as OCA-

B, to allow for increased transactivating activity from the octamer sequence. NF-κB and

Oct-2 have been reported to synergistically activate the 3’-IgH enhancer (106).

20 4R-induced increase in the expression of Oct-2 and OCA-B transcription factors. Oct-2 and OCA-B are reported to control the activity of the 3’-IgH enhancer region and the subsequent mature IgG1 transcript production. Although the role for CD40 and IL-4R regulation of the level of CSR and mature IgG1 transcript is well established, the role for other immune cell receptors, such as CD86, in regulating the B cell are not fully understood.

1.5.2 Regulation of Oct-2 expression and transcriptional activity

The consensus octamer motif 5’-ATGCAAAT-3’ is located in the promoter region of many genes and is a recognition site for the ubiquitously expressed Oct-1 and the B cell-specific Oct-2 transcription factors (107-109). Oct-2 belongs to the pit-oct- unc (POU) family of transcription factors due to the presence of a POU domain that mediates sequence-specific DNA binding and protein-protein interactions. Illustrating the importance of Oct-2 expression, Oct-2-deficient mice are neonatal lethal (110). In addition, reconstitution of SCID or RAG-/- mice with Oct-2-/- fetal liver cells reveals that

Oct-2 is required for B-1 cell development, normal B-2 cell development, and optimal Ab responses (111, 112). Oct-2 is an inducible transcription factor whose expression is dependent on activation of the classical NF-κB pathway (113). Because the promoter of

Oct-2 is not fully characterized, it remains unknown as to whether NF-κB increases Oct-2 expression through regulation of promoter activity directly, or indirectly, through the upregulation of another factor that regulates Oct-2 promoter activity directly.

The molecular mechanisms by which Oct-2 exerts its transactivation are still being investigated. As mentioned above, octomer motifs are present in many promoter

21 regions including the IgH locus and the 3’-IgH enhancer region. An increasing amount of literature supports the hypothesis that Oct-2 plays an important role in regulating the activity of the 3’-IgH enhancer. In support of this, one study found that Oct-2 directly regulates the 3’-IgH enhancer (114, 115), while another found that Oct-2 and NF-κB synergize in the activation of the hs4 region of the 3’-IgH enhancer (106). The expression level of Oct-2 is not the only form of regulation. The activity of Oct-2 is also regulated through phosphorylation. Sharpe et al. suggest that Oct-2 is phosphorylated in a PKC-dependent manner to increase the ability to interact with OCA-B, the coactivator of Oct-2, and increase that transactivating activity (114). Therefore, the ability of Oct-2 to regulate the transcription of genes appears to depend on both the level of expression and the level of phosphorylation.

1.6 Conclusion and hypothesis

Our laboratory has reported that stimulation of CD86 on a CD40L/IL-4-activated

B cell increases the amount of IgG1 produced on a per cell basis, without affecting CSR or mRNA stability (96). In addition, CD86 stimulation induces an increase in the expression and binding of Oct-2 to the 3’-IgH enhancer (100). The CD86-induced increase in Oct-2 expression is associated with increased activation and nuclear localization of NF-κB, specifically the p50/p65 subunits (100). Because NF-κB is involved in numerous biological responses, therapeutic interventions aimed at either suppressing or enhancing antibody production via CD86 signaling would need to target the specific intermediates activated by CD86 upstream of NF-κB activation. Therefore, the present study focused on determining the molecular mechanism by which CD86

22 stimulation on a B cell activates NF-κB and whether the activation of NF-κB and Oct-2 regulate gene transcription.

Previous studies in our laboratory that addressed the ability of CD86 to signal directly within the B cell and regulate the ability to produce IgG1 used both in vitro and in vivo model systems. The in vitro model system consisted of isolating resting splenic B cells and activating them with recombinant IL-4 and Sf9 cells expressing membrane bound CD40L. 16 - 24 h later, an anti-CD86 Ab was added to the culture system to stimulate CD86 and functional assays were preformed at various times after activation.

The current study used a similar model system, except instead of using an anti-CD86 Ab to stimulate CD86, a CD28/Ig molecule was used to more closely mimic the endogenous ligand for CD86 (see Figure 8). In addition, a previous study from our laboratory used an in vivo model system in which severe-combined immunodeficient (Scid) mice were reconstituted with resting B cells alone and were activated by an intraperitoneal injection of both an anti-CD40 Ab and recombinant IL-4 plus or minus an anti-CD86 Ab.

However, in the presence of T and B cells, testing the role of CD86 signaling during a T cell-dependent IgG1 response in vivo proved more difficult since any attempt to stimulate

CD86 would interfere with T cell costimulation. Therefore, we established an adoptive transfer model system in which only the B cell would lack CD86, while all other APCs, namely dendritic cells and macrophages, would express CD86 normally and allow for optimal T cell activation to occur. CD4+ T cells and resting B cells from Wt and/or

CD86-deficient mice were adoptively transferred into Rag2-deficient mice, resulting in mice that expressed Wt-T/Wt-B or Wt-T/CD86-deficient B cells (see Figure 9).

Figure 8. Proposed in vitro model system. Sort-purified resting B cells (CD43-) were activated in the presence of CD40L-expressing Sf9 cells (1 CD40L/Sf9 cell:10 resting B cells) and IL-4 (1 ng/ml) for 16-24 hours, at which time B cell cultures received either an anti-CD86 Ab (1.0 µg/ml), CD28/Ig (1.0 µg/ml), or an isotype- and species-matched control Ab (1.0 µg/ml).

Figure 9. Proposed in vivo model system. Splenic B and T cells were isolated from WT and CD86-deficent mice. Either WT-T/WT-B (Wt) or WT-T/CD86-deficient B (CD86-/-

) cells were adoptively transferred into Rag2-deficient mice, which lack endogenous T and B cells. Seven days following cell transfer, each mouse was injected with 100 ug of

TNP-KLH intraperitoneal (i.p.). Total splenic RNA and protein was isolated on days 4 and 6. Serum was collected on day 14 and analyzed for the level of IgG1 by ELISA.

25 Therefore, in vitro and in vivo model systems were used to study the role of CD86 signaling in a B cell, as well as the ability of CD86 to regulate an IgG1 response.

Based on previous findings and preliminary data, it was hypothesized that stimulation of CD86 on a CD40L/IL-4-activated B cell activates a distinct signaling pathway within the B cell to increase the activation of NF-κB and the gene transcription mediated by the 3’-IgH enhancer. The present data are the first to show the CD86 signal transduction pathway in a B cell that is proximal to the activation of NF-κB and the regulation of gene activity by these intermediates. We show for the first time that CD86 increases the activity of PI3K, as well as the phosphorylation state of PDK1, Akt,

IKKα/β, PLCγ2, and PKCα/β, to increase gene activity mediated by NF-κB and the hs4 region of the 3’-IgH enhancer. The present data also show that addition of CD28/Ig to

CD40L/IL-4-activated B cells on Wt, but not CD86- or CD19-deficient, B cells increased the level of phosphorylation for Lyn and CD19, as well as the amount of Lyn, Vav, and

PI3K proteins that immunoprecipitated with CD19. In vivo, serum IgG1 levels were decreased in mice receiving CD86-deficient B cells when compared to mice receiving Wt

B cells. The decrease in serum IgG1 was associated with a decrease in the level of B cell- associated Oct-2 mRNA and protein, but a normal level of germline IgG1 mRNA. Thus, our findings suggest that CD86 plays a key role in regulating the level of IgG1 produced in vitro and in vivo, independently of class switch recombination. The significance of this dissertation is that it is the first to identify the mechanism by which CD86 induces an intracellular signaling pathway directly in the B cell. The knowledge gained from this work will both provide a molecular mechanism by which CD86 stimulation regulates the level of an IgG1 response and identify potential molecular targets for therapeutic 26 interventions to selectively regulate the level of an IgG1 response positively or negatively.

CHAPTER 2

MATERIALS AND METHODS

2.1 Animals - Female BALB/c and CD19-deficient (CD19-/-) mice were purchased from Taconic (Germantown, NY). CD86-deficient (CD86-/-) mice were kindly provided by Dr. Arlene Sharpe (Brigham and Woman’s Hospital, Boston, MA). Mice were bred and housed within the pathogen-free facility at Taconic. C3H/HeJ and Toll-like receptor

4-deficient mice (TLR4-/-) were purchased from Jackson Laboratory (Bar Harbor, MA).

Upon arrival at The Ohio State University, all mice were housed in microisolator cages within a laminar flow barrier and provided autoclaved food and water ad labium. Mice were used at 7-8 weeks of age and all experiments complied with the Animal Welfare

Act and the NIH guidelines for the care and use of animals in biomedical research.

2.2 Cell lines - CH12.LX is a murine B cell lymphoma line that has been described previously (116) and was kindly provided by Dr. Gail Bishop (University of Iowa; Iowa

City, Iowa). A20 (γ2b-hs1-4) is a B lymphoma cell line that has been stably transfected with a γ2b reporter gene under the control of the 3’-IgH enhancer, as described previously (117), and was kindly provided by Dr. Laurel Eckhardt (Hunter College; New

York, New York).

28 2.3 Resting B cell isolation and activation - Murine spleens were collected, splenocytes were isolated, and red blood cells were lysed using 0.4% ammonium chloride. The splenocytes were negatively sorted with rat anti-mouse CD43 magnetic beads (Miltenyi

Biotec, Auburn, CA) following the manufacturers directions using the AutoMacs machine (Miltenyi Biotec). Resting B cells (CD43-) were cultured at 5x105 cells/ml in either a 96-, 24-, or 6-well plate (Greiner Bio-One, Monroe, NC) in a final volume of

0.2, 2.0, and 5.0 ml of culture medium, consisting of RPMI 1640 medium (CellGro,

Herndon, VA), 10% FBS (Atlas Biologicals, Colorado Springs, CO), 20 mM HEPES,

100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, and 50 µM 2- mercapoethanol, in a humidified atmosphere at 37 °C with 5% CO2. Resting B cells were activated in the presence of CD40 Ligand-expressing Sf9 cells (CD40L), prepared as described previously (96), at a B cell to Sf9 cell ratio of 10:1, and IL-4 [1ng/ml

(eBioscience, San Diego, CA)]. After 16 h, either a CD28/Ig fusion protein [R&D

Systems, Inc., Minneapolis, MN], a rat anti-mouse CD86 Ab [clone PO3 (eBioscience)], a species- and isotype-matched control Ab [rat IgG2b, κ, clone A95-1 (PharMingen; San

Diego, CA)], or a recombinant human IgG1 Fc [R&D Systems, Inc., Minneapolis, MN] was added at a final concentration of 1 µg/ml. Pharmacologic inhibitors were added 30 min prior to addition of CD28/Ig, including the protein tyrosine inhibitors SU6656 (100 nM) and PP2 (2.0 uM) (Calbiochem, La Jolla, CA). All reagents used were negative for the presence of endotoxin, as determined by Etoxate (Sigma), a Limulus lysate assay with a level of detection < 0.1U/ml.

29 2.4 In vivo cell transfer and immunization - Seven days prior to immunization, 5x106

CD4+ T cells and either 20x106 Wt B cells or CD86-deficient B cells were adoptively transferred into RAG2-deficient animals in a volume of 100 ul PBS intravenously in the lateral tail vein. One week following adoptive transfer of cells, mice were administered

100 ug TNP-KLH in Alum intraperitoneally and serum samples were collected 7 and 14 days later. The level of serum IgG1 was determined in various dilutions of serum samples using ELISA.

2.5 Western blot - Resting B cells (5-10x106 cells) were activated as described above.

Cells were collected and lysed with 250 µl of 1 X lysis buffer (20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM Sodium pyrophosphate, 1 mM Na3VO4, 1 µg/ml Leupeptin, 10 nM Okadaiac Acid, and 10 nM

Tautomycin). Protein samples (5-20 µg) were run on a denaturing 7.5% polyacrylamide gel and transferred to Immobilon-P PVDF membranes (Millipore, Bedford, MA).

Membranes were blocked with TBST (140 mM NaCl, 25 mM Tris-HCl, pH 7.5, 3 mM

KCl, and 0.05% Tween 20) + 5% dried milk for 1 h at room temperature, probed with primary antibodies diluted in TBST + 5% dried milk for 2 h at room temperature or overnight at 4° C. Membranes were probed with horseradish peroxidase (HRP)-labeled secondary antibodies diluted in TBST + 1% dried milk at room temperature for 1 h.

HRP-labeled antibodies were detected using the LumiGlo Detection Kit (Cell Signaling,

Inc., Beverly, MA) and specific bands were visualized on Kodak Biomax MS film using an intensifying screen enabled film cassette. Antibodies used were goat anti-human actin

C-11 and rabbit anti-human Oct-2 (Santa Cruz Biotechnology, Santa Cruz, CA), rabbit 30 anti-human phospho-Src Family Tyr, rabbit anti-human CD19, rabbit anti-human phospho-CD19 (Tyr513), rabbit anti-human Lyn, rabbit anti-human Vav, and rabbit anti- human p85 PI3K (Cell Signaling Technology, Beverly, MA). All rabbit anti-human antibodies crossreact with mouse.

2.6 Immunoprecipitation (IP) - Immunoprecipitations were performed using the

Profound Mammalian Co-Immunoprecipitation Kit (Pierce). Briefly, B cells were activated as described above, protein isolated, immunoprecipitated with either an anti-

Lyn or anti-CD19 (Cell Signaling) antibody following manufactures direction. The precipitates were analyzed using Western blot analysis as described above.

2.7 Flow cytometry - The number of B220+ and CD4+ cells was determined by FACS analysis as described previously (96). Total splenocytes were collected on day 6 following immunization, red blood cells were lysed using 0.4% ammonium chloride, and cells were stained with PE-conjugated rat anti-mouse B220, FITC-conjugated rat anti- mouse CD4, and APC-conjugated rat anti-mouse IL-4 (BD Biosciences, San Jose, CA).

For intracellular FACS analysis, total splenocytes on day 6 were stimulated for 4 h with phorbol 12-myristate 13-acetate (PMA) (50ng/ml) (Sigma, St. Louis, MO) and

Ionomycin (500ng/ml) (Sigma) in the presence of Brefeldin A (1µg/ml) (BD Biosciences,

San Jose, CA). Cells were then washed in PBS containing 0.1% BSA and 0.02% sodium azide, fixed, and permeablized using the Cytofix/Cytoperm (BD Biosciences) kit according to manufacturers directions. Intracellular staining for the presence of cytokines was carried out by incubating with a rat anti-mouse IL-4 (clone BVD6-24G2)

31 (eBioscience, San Diego, CA) at 4°C for 30 min, washed twice, and then resuspended in

PBS containing 0.1% BSA. All samples were analyzed using a FACSAria flow cytometer (BD Biosciences, San Jose, CA). The data were analyzed using FLOWJO software (Tree Star, Inc.).

2.8 PI3-Kinase enzyme-linked immunoassay (ELISA) – Resting naive B cells were activated as described above and total cellular protein was isolated 10-30 min after addition of CD28/Ig. Five microliters of a rabbit anti-mouse PI3K antibody (Upstate

Biotechnology, Charlottesville, VA) were added and samples were rocked for one hour at

4°C. 60 ul of a 50% Protein A-agarose beads in PBS were added and samples were rocked for one hour at 4°C. Samples were collected and wased three times with Buffer A

(137mM NaCl, 20mM Tris-HCl, pH 7.4, 1mM CaCl2, 1mM MgCl2, and 0.1mM sodium orthovanadate) plus 1% NP-40, three times with (0.1M Tris-HCl, pH 7.4, 5mM LiCl, and

0.1mM sodium orthovanadate), and two times with TNE (10mM Tris-HCl, pH 7.4,

150mM NaCl, 5mM EDTA, and 0.1 sodium orthovanadate). The immunoprecipitated proteins were used to analyze the PI3K activity using the PI3K ELISA (Echelon

BioSciences, Inc., Salt Lake City, UT). The level of PI3K activity in each treatment group was quantitated using a standard curve of known PI3K activity.

2.9 Quantitative real-time polymerase chain reaction (PCR) - Quantitative real-time

PCR was performed as described previously (96). Briefly, a common master mix

[LightCycler-FastStartDNA SYBR Green I (Roche, Mannheim, Germany), 2 mM MgCl2,

0.5 µM gene-specific primer] was used and the concentration of gene-specific cDNA was 32 quantified using a standard curve diluted 1:10 for a concentration range of 1 ng/ml to 1 fg/ml. A melting curve was generated after each real-time reaction and samples were run on a 1.0% agarose gel to ensure that only one gene-specific PCR product was generated.

Real-time PCR was preformed using the Roto-gene 2000 Real-time Cycler (Phenix

Research Products; Hayward, CA). The following primers were used. β-actin 5'-

TACAGCTTCACCACCACAGC-3' and 5'- AAGGAAGGCTGGAAAAGAGC-3'

(annealing temp 60°C, 206-bp product); Oct-2 5'- ATCAAGGCTGAAGACCCCAGTG-

3' and 5'- TGGAGGAGTTGCTGTATGTCCC-3' (annealing temp 60°C, 128-bp product); mature IgG1 transcript 5'- TATGGACTACTGGGGTCAAG-3' and 5'-

CCTGGGCACAATTTTCTTGT-3' (annealing temp 63°C, 205-bp product); and germline IgG1 transcript 5’- CATCCTATCACGGGAGATTGGG -3’ and 5’-

ATCCTCGGGGCTCAGGTTTG -3’ (annealing temperature of 65°C).

2.10 IgG1 enzyme-linked immunoassay (ELISA) - For in vitro IgG1 determination, B cell culture supernatants were collected on days 4-7 after initial activation and frozen immediately at -80°C until analysis. For in vivo IgG1 determination, serum samples were collected and frozen immediately at -80°C until analysis. Costar 96-well flexi plates

(Fisher Scientific) were coated with goat anti-mouse IgG (2 ug/ml) (BD Bioscience,

Franklin Lakes, NJ), followed by blocking with 20% FBS solution in PBS + 0.02% azide.

20 ul of each sample were incubated on the plate, a standard curve for IgG1 was prepared using known quantities of recombinant IgG1 protein in a range of 1 ug/ml – 1 ng/ml. A secondary antibody, goat anti-mouse IgG1-AP (alkaline phosphatase) (BD Bioscience) was used for detection. PNPP (p-Nitrophenyl phosphate) (Sigma) was added and color 33 development was determined on a Spectramax Plus microplate reader (Molecular

Devices, Menlo Park, CA) at a wavelength of 405 nm.

2.11 Chromatin immunoprecipitation (ChIP) - ChIP analysis was carried out as described previously with minor modification (100). Briefly, B cells (10x106 cells) were activated as described above and collected on day 3, fixed for 20 min on ice with one- tenth the volume of 11% formaldehyde solution (in 0.1 M NaCl, 1 mM EDTA, 0.5 mM

EGTA and 50 mM HEPES at pH 8.0), and cross-linking was stopped by the addition of glycine at a final concentration of 0.125 M for 5 min. Cells were rinsed with cold PBS and resuspended in 10 ml of lysis buffer (50 mM HEPES-KOH at pH 7.5, 140 mM NaCl,

1mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100 and the following protease inhibitors: 1 ng/ml Leupeptin, and 5 ng/ml Aprotinin) and were gently rocked for 10 min at 4 °C. Nuclei were pelleted, resuspended, and gently rocked for 10 min at room temperature in buffer 2 (0.2 M NaCl, 1 mM EDTA, 0.5 mM EGTA, 10 mM Tris HCl (pH

8.0) and protease inhibitors). The nuclei were pelleted again and resuspended in 6 ml of sonication buffer (1 mM EDTA, 0.5 mM EGTA and 10 mM Tris HCl at pH 8.0 and protease inhibitors). The suspension was sonicated ten times for 30 s, with a 1 min cooling period on ice in-between. Debris was removed from samples and 250 µl were adjusted to 1% Triton X-100, 0.1% sodium deoxycholate and protease inhibitors in a final volume of 500 µl of TE buffer (10 mM Tris at pH 8 and 1 mM EDTA), and precleared with protein A/protein G agarose beads that had been blocked with sonicated salmon sperm DNA and 10 mg/ml BSA for 3 h with gentle rocking at 4 °C. The beads were removed and chromatin samples were incubated at 4 °C with various antibodies

34 overnight. Immunocomplexes were precipitated for 3 h by the addition of blocked protein A/protein G agarose beads. The precipitates were washed seven times for 5 min each with 1 ml of RIPA buffer (50 nM Hepes at pH 7.6, 1 mM EDTA, 0.7% sodium deoxycholate, 1% NP-40, 0.5 M LiCl, and protease inhibitors) and resuspended in 100 µl of TE buffer. The samples were adjusted to 0.5% SDS, 100 µg/ml RNase A, and 200

µg/ml of proteinase K and incubated at 55 °C for 3 h, followed by an overnight incubation at 65 °C to reverse the formaldehyde cross-links. The DNA was purified by phenol-chloroform extraction, precipitated in the presence of 20 µg of glycogen and resuspended in 100 µl of TE buffer.

PCR was done with 2 µl of the immunoprecipitated DNA for 30 cycles (45 s at 95

°C, 45 s at 56 °C and 2 min at 72 °C, completed by 10 min in 72 °C) with various primers. As a control, the PCR was done directly on input DNA purified from chromatin before immunoprecipitation. PCR products were resolved on 1.5% agarose gels and visualized with ethidium bromide. The antibodies used were anti-p50 and anti-p65, and anti-CREB as a control Ab (Santa Cruz Biotechnology). The following primers were used, hs4, 5'-AGAACAGGAACCACAGAGCAGAGG-3' and 5'-

GGTCATTGAAACTCATCCATAGCC-3' (225-bp product).

2.12 Transient transfections - The NF-κB-sensitive Wt and mut luciferase reporter plasmids were kindly provided by Dr. Denis Guttridge (The Ohio State University;

Columbus, OH) and the 3’-IgH enhancer plasmids were kindly provided by Dr. Laurel

Eckhardt (Hunter College; New York, New York) and were described in detail previously (104). Transfections were performed using program K-03 of the nucleofector 35 device (Amaxa Inc., Gaithersburg, MD) following manufacturers directions. Breifly,

5x106 CH12.LX cells were combined with 5 ug of experimental plasmid DNA, 1 ug of a control pRL-TK renilla plasmid (Promega), and 100 ul of transfection solution (Amaxa).

Program K-03 was used for the electroporation and cells were cultured as described above until analysis.

2.13 Transfection isolation and reporter gene assay - Cells were isolated at various time points (24 – 48 hours) after transfection using 1x lysis buffer from the Dual-

Luciferase Reporter Assay System (Promega, Madison, WI). The luciferase assays were performed following the manufactures directions. Breifly, cells were collected, washed two times with PBS and lysed with 1X Passive Lysis Buffer (Promega). 20 ul of cell lysate were combined with 100 ul of Luciferase Assay Substrate (Promega). Firefly luciferase activity was measured on a luminominar. 100 ul of the Stop & Glo Reagent

(Promega) were added and renilla luciferase activity was measured. The amount of firefly luciferase activity is normalized to the amount of renilla luciferase activity as a transfection control.

2.14 Statistics - Data with three or more groups were analyzed by a one-way ANOVA followed by post-hoc analysis, while data with two groups were analyzed by a two-tailed paired t test to determine if an overall statistically significant change existed. Statistically significant results were determined by a p value of <0.05.

CHAPTER 3

RESULTS

3.1 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of IKKαβ.

CD86 activates the classical NF-κB pathway through increased IκBα phosphorylation and degradation, and subsequent nuclear localization of p50 and p65

(100). However, the signaling intermediates activated by CD86 proximal to NF-κB activation are unknown. A hallmark of the classical NF-κB pathway is the phosphorylation, polyubiquination, and degradation of IκBα. The IκB kinase (IKK) complex, which consists of two catalytic (IKKα and IKKβ) subunits and one regulatory

(IKKγ) subunit, is responsible for IκBα phosphorylation and requires its own phosphorylation for activation [reviewed in (101)]. To determine if CD86 stimulation activates the IKK complex, B cells were activated with CD40L/IL-4 for 16 h before addition of CD28/Ig and total protein was isolated and analyzed using Western blot analysis. CD86 maximally increased the phosphorylation of IKKα/β within 5 min by approximately 2.5-fold above CD40L/IL-4 alone, and remained 2-fold above baseline throughout 30 min (see Figure 10a). In contrast, CD86-deficient B cells failed to change the phosphorylation state of IKKα/β (see Figure 10b). Thus, these data show CD86

Figure 10. CD86 stimulation increases the phosphorylation of IKKαβ. Western blot analysis of phospho-IKKα/β and total actin in (a) Wt and (b) CD86-deficient B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig from one representative experiment of three. Band density was determined using densitometry and the data represent the mean fold increase in phospho-IKKα/β normalized to actin ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the

CD40L/IL-4 alone group.

38 increases the level of IKKα/β phosphorylation, suggesting that it is the signaling intermediate proximal to, and responsible for, the increase in IκBα phosphorylation.

One downstream effect of the CD86-induced activation of the classical NF-κB pathway appears to be an increase in the expression of the B cell-specific transcription factor Oct-2 (100). Oct-2 expression is dependent on activation of the classical NF-κB pathway (113). Because the promoter of Oct-2 is not fully characterized, it remains unknown as to whether NF-κB increases Oct-2 expression through regulation of promoter activity directly, or indirectly, through the upregulation of another factor that regulates Oct-2 promoter activity directly. To determine if the IKK complex mediates the CD86-induced increase in IκBα phosphoryaltion and is required for the increase in

Oct-2 mRNA, B cells were cultured as described above, and either an IKK inhibitor peptide or a pharmacological IKK inhibitor (SC-514) was added 30 min prior to addition of CD28/Ig. Total protein or mRNA was isolated and analyzed using Western blot analysis or quantitative real-time PCR. Both inhibitors prevented the CD86-induced increase in the level of IκBα phosphorylation (see Figure 11), degradation (see Figure

11), and increase in Oct-2 mRNA (see Figure 12). In contrast, addition of a control peptide that is unable to inhibit IKK activity was unable to block the increase in Oct-2 mRNA. Taken together, these multiple lines of evidence suggest that CD86 stimulation leads to increased IKKα/β phosphorylation, which appears to be required for the phosphorylation/degradation of IκBα and the increase in Oct-2 mRNA expression.

Figure 11. IKKαβ is required for the CD86-induced increase in p-IκBα. Western blot analysis of phospho-IκBα and total IκBα in B cells activated with CD40L/IL-4 for 16 h and then pretreated with an IKK inhibitor peptide for 30 min prior to addition of

CD28/Ig. Band density was determined using densitometry and the data represent the mean fold increase in phospho-IκBα normalized to IκBα ± S.E.M. from three independent experiments.

Figure 12. IKKαβ is required for the CD86-induced increase in Oct-2. Realtime PCR analysis of Oct-2 mRNA and total actin in B cells activated with CD40L/IL-4 for 16 h and then pretreated with either an IKK inhibitor peptide, IKK control peptide, or the IKK inhibitor SC-514 for 30 min prior to addition of CD28/Ig. Data represent the mean fold increase in Oct-2 mRNA normalized to actin + S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

41 3.2 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of Akt and PDK1.

Multiple signaling intermediates are known to play a role in the phosphorylation and activation of the IKK complex, including Akt (118) and NF-κB inducing kinase

(119). CD86 stimulation activates the classical NF-κB pathway, as indicated by the activation and nuclear localization of p50/p65 (100), suggesting that Akt as opposed to the NF-κB inducing kinase is involved. The activation of Akt involves two key phosphorylation sites, serine 473 and threonine 308. To determine if CD86 activates Akt through phosphorylation of either serine 473 or threonine 308, B cells were cultured as described above and total protein was analyzed using Western blot analysis. CD86 increases the level of phospho-Akt (thr308) throughout a 30 min period to approximately

2.5-fold above CD40L/IL-4 alone (see Figure 13a), an effect not seen when CD86- deficient B cells were used (see Figure 13b). In contrast, the level of phospho-Akt

(ser473) was unchanged following stimulation of CD86 on an activated B cells (data not shown). To determine if the CD86-induced increase in phospho-Akt (thr308) is PI3K- dependent, B cells were pre-treated with Wortmannin or LY294002, PI3K inhibitors, and total protein was isolated and analyzed for phospho-Akt (thr308). Both PI3K inhibitors were able to completely inhibit the CD86-induced increase in phospho-Akt (thr308) (see

Figure 14), suggesting that the increase in the level of phospho-Akt (thr308) was PI3K- dependent. Taken together, these data show that CD86 stimulation on an activated B cell increases the level of Akt activation by targeting an increase in the phosphorylation of threonine 308 in a PI3K-dependent manner.

Figure 13. CD86 stimulation increases the phosphorylation of Akt. Western blot analysis for the level of phospho-Akt (thr308) and total Akt in (a) Wt and (b) CD86- deficient B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig from one representative experiment of three. Band density was determined using densitometry and the data represent the mean fold increase in phospho-Akt (thr308) normalized to Akt

± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

Figure 14. PI3K is required for the CD86-induced increase in p-Akt. Western blot analysis for the level of phospho-Akt (thr308) and total Akt in LY294002 pre-treated B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig from one representative experiment of three. Band density was determined using densitometry and the data represent the mean fold increase in phospho-Akt normalized to Akt ± s.e.m. from three independent experiments.

44 Phosphoinositide-dependent protein kinase 1 (PDK-1) is a serine/threonine kinase and is known to phosphorylate Akt at threonine 308 (120). To determine if CD86 stimulation activates PDK-1, B cells were cultured as described above and total protein was isolated and analyzed using Western blot analysis. The level of PDK-1 phosphorylation was increased by 5 min following stimulation of CD86 and remained elevated through 30 min

(see Figure 15a), an effect not seen when CD86-deficient B cells were used (see Figure

15b). To confirm that PDK-1 was playing a role in the CD86 signaling pathway, B cells were pre-treated with OSU-03012, a PDK-1 inhibitor, and the level of phospho-Akt

(thr308) was analyzed by Western blot analysis. PDK-1 inhibition prevented the CD86- induced increase in phospho-Akt (thr308) (see Figure 16). Furthermore, PDK-1 inhibition also prevented the CD86-induced increase in phosphorylated IKKα/β and

IκBα (data not shown). Taken together, these multiple lines of evidence show that CD86 stimulation activates both PDK-1 and Akt, and suggests that the PDK-1/Akt pathway is upstream of NF-κB activation.

3.3 CD86 stimulation on a CD40L/IL-4-activated B cell increases the activity of

PI3K.

PDK-1 and Akt, through their plectrin homology (PH) domains, are recruited to the plasma membrane to interact with PIP3. Because PI3K facilitates the conversion of

PIP2 to PIP3 and is required for Akt activation [reviewed in (121)], we sought to determine if CD86 stimulation activates PI3K. B cells were cultured as described above, protein lysates were obtained, PI3K was immunoprecipitated with an anti-PI3K antibody, and its activity was measured in vitro. CD86 stimulation induced an increase in PI3K

Figure 15. CD86 stimulation increases the phosphorylation of PDK1. Western blot analysis for the level of phospho-PDK1 and PDK1 in (a) Wt and (b) CD86-deficient B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig from one representative experiment of three. Band density was determined using densitometry and the data represent the mean-fold increase in phospho-Akt normalized to total Akt or phospho-PDK1 normalized to total PDK1 ± S.E.M. from three independent experiments.

* indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

Figure 16. PDK1 is required for the CD86-induced increase in p-Akt. Western blot analysis of phospho-Akt (thr308) and total Akt in WT B cells activated with CD40L/IL-4 for 16 h and pre-treated with a PDK-1 inhibitor (OSU-03012) for 30 min prior to addition of CD28/Ig. Band density was determined using densitometry and the data represent the mean-fold increase in phospho-Akt (thr308) normalized to total Akt ± S.E.M. from three independent experiments.

47 activity, an effect not seen when CD86-deficient B cells were used (see Figure 17).

Because the PI3K/Akt pathway appears to be required for the CD86 activation of NF-κB, and because Oct-2 expression is NF-κB-dependent (100, 113), we sought to determine if the CD86-induced increase in Oct-2 mRNA expression was also PI3K-dependent.

Wildtype or PI3K-deficient B cells were cultured as described above, and either

Wortmannin or LY294002 was added for 30 min before addition of CD28/Ig. Total

RNA was isolated and analyzed for the level of Oct-2 and actin mRNA using real-time

PCR analysis. CD86 increases Oct-2 mRNA expression approximately 2.0-fold above

CD40L/IL-4 alone (see Figure 18), as has been shown previously (100). The use of both

PI3K inhibitors (see Figure 18) and PI3K-deficient B cells (see Figure 19) blocked the

CD86-induced increase in the level of Oct-2 mRNA. Taken together, these multiple lines of evidence show that CD86 stimulation on an activated B cell appears to increase the level of Oct-2 mRNA expression in a PI3K-dependent manner, and indirectly links CD86 activation of the PI3K/Akt pathway to the NF-κB-dependent expression of Oct-2 mRNA.

3.4 CD86 stimulation on a CD40L/IL-4-activated B cell increase the phosphorylation of PKCαβ and PLCγ2.

Previous data from our laboratory suggested that CD86 stimulation on a

CD40L/IL-4-activated B cell activated two signaling pathways to increase the level of

Oct-2 expression, one that was PKC-independent and another that was PKC-dependent.

Although the use of pharmacological inhibitors provided indirect evidence to indicate a role for PKC (100), we sought to determine if CD86 stimulation on an activated B cell increased the level of PKC phosphorylation and activation. B cells were activated, as

Figure 17. CD86 stimulation increases the activity of PI3K. PI3K ELISA analysis of the PI3K activity in WT and CD86-deficient B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig. Data represent the mean fold increase in PI3K activity ±

S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

Figure 18. PI3K is required for the CD86-induced increase in Oct-2. Realtime PCR analysis of Oct-2 and actin mRNA levels in WT B cells activated with CD40L/IL-4 for

16 h in the absence or presence of either PI3K inhibitor, LY294002 or Wortmannin.

Data represent the mean fold increase in Oct-2 mRNA normalized to total actin mRNA ±

S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

Figure 19. Lack of PI3K prevents the CD86-induced increase in Oct-2.

Realtime PCR analysis of Oct-2 and actin mRNA levels on day 2 in PI3K-deficient B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig. Data represent the mean-fold increase in Oct-2 mRNA normalized to total actin mRNA ± S.E.M. from three independent experiments.

51 described above and total protein was isolated and analyzed using Western blot analysis.

CD86 stimulation increased the level of PKCα/β phosphorylation approximately 2.0–fold above CD40L/IL-4 alone to a maximal level by 15 min after stimulation, and returned to baseline level by 30 min (see Figure 20a). This effect was lost when CD86-deficient B cells were used (see Figure 20b). Thus, CD86 stimulation on an activated B cell increases the level of PKCα/β phosphorylation and activation.

The activation of classical PKC isoforms are dependent on the activation of phospholipase C (PLC), which cleaves phosphoinositides into inositol-3-phosphate (IP3) and diacylglycerol (DAG), leading to increased intracellular Ca2+ and PKC activation

(122). PLCγ2 is the predominant form of PLC in a B cell and requires phosphorylation for full activation (123). To determine if CD86 stimulation increases the level of phosphorylation and activation of PLCγ2, B cells were cultured as described above and total protein was isolated and analyzed using Western blot analysis. CD86 increases phospho-PLCγ2 approximately 2.0-fold above CD40L/IL-4 alone by 5 and 15 min, and returns to baseline by 30 min (see Figure 21a). This effect was lost when CD86- deficient B cells were used (see Figure 21b). Thus, CD86 stimulation on an activated B cell increases the level of PLCγ2 phosphorylation and activation.

3.5 CD86 induces an increase in NF-κB- and 3’-IgH enhancer-mediated gene activity.

Because data from our laboratory showed that CD86 stimulation on an activated

B cell increased nuclear localization of p50/p65 dimers (100), we sought to determine if

CD86 induced a subsequent increase in gene activity that was mediated by NF-κB. A 52

Figure 20. CD86 stimulation increases the phosphorylation of PKCαβ. Western blot analysis for the level of phospho-PKCαβ and total PKCαβ in (a) Wt and (b) CD86- deficient B cells activated with CD40L/IL-4 for 16 h before addition of CD28/Ig. The data represent the mean fold increase in the band density of phospho-PKCα/β normalized to total PKCα/β ± S.E.M. from three independent experiments. * indicates a p value of <

0.05 in comparison to the CD40L/IL-4 alone group.

Figure 21. CD86 stimulation increases the phosphorylation of PLCγ2. Western blot analysis for the level of phospho-PLCγ2 and total PLCγ2 in (a) Wt and (b) CD86- deficient B cells activated with CD40L/IL-4 for 16 h before addition of CD28/Ig.

The data represent the mean fold increase in the band density of phospho-PLCγ2 normalized to total PLCγ2 ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

54 transient transfection system was used in which a B lymphoma cell line, CH12.LX, was transfected with an NF-κB-sensitive luciferase reporter plasmid, controlled by κB- binding sites within the promoter region. CH12.LX cells were cultured as described for normal B cells. As shown in Figure 22, a baseline level of NF-κB gene activity was induced by CD40L and IL-4 alone, as has been reported previously (124), and addition of

CD28/Ig increased luciferase gene activity approximately 2.0-fold above CD40L/IL-4 alone. In contrast, luciferase activity was undetectable when a plasmid containing mutated NF-κB binding sites was used, indicating that NF-κB regulates the transcription of the luciferase reporter gene specifically. Thus, CD86 stimulation on an activated B cell increases the level of NF-κB-mediated gene activity within the B cell.

Previous data from our laboratory also showed that CD86 increases Oct-2 expression and binding to the hs1,2 and hs4 region of the 3’-IgH enhancer (100). Of the four hs regions that comprise the 3’-IgH enhancer, hs1,2 and hs4 regions appear to exert the most enhancer activity in transient transfection studies (104), although a synergistic effect is evident when all four hs regions are activated (125). The hs4 region contains both κB and octamer binding sites that play a role in regulating its activity (115), and the

3’-IgH enhancer is known to regulate the level of mature IgG1 transcript (105). CD86 stimulation on an activated B cell is reported to upregulate the rate of mature IgG1 transcription per B cell, which is associated with an increase in Oct-2 binding to the hs1,2 and hs4 regions of the 3’-IgH enhancer (96, 100), suggesting that CD86 is able to regulate 3’-IgH enhancer activity. Therefore, we sought to determine directly if CD86 stimulation increases 3’-IgH enhancer activity of the hs4 region. A transient transfection system was used in which CH12.LX cells were transfected with a plasmid containing the 55

Figure 22. CD86 stimulation increases the NF-κB-mediated gene activity. CH12.LX B cells were co-transfected with plasmid constructs of either an NF-κB binding element

(black bar) or a mutated NF-κB binding element (cross-hatched bar) all containing the firefly luciferase gene, and a control plasmid containing the renilla luciferase gene (pRL-

TK). The cells were activated with CD40L/IL-4 for 16 h before addition of either a control Ig (-) or CD28/Ig. Data represent the mean fold increase in firefly luciferase activity normalized to renilla luciferase activity ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

56 hs4 region followed by a luciferase reporter gene. In addition, to determine if CD86 increases the activity of the entire 3’-IgH enhancer region, another transfection system was used in which a B lymphoma cell line, A20, was stably transfected with the entire 3’-

IgH enhancer region followed by a γ2b reporter gene, as described previously (117).

A20/CH12.LX cells were activated and CD86 was stimulated as described for normal B cells. When compared to the level induced by CD40L/IL-4 alone, CD86 increased the level of hs4-mediated gene activity by approximately 2.0-fold (see Figure 23a) and increased the entire 3’-IgH enhancer-mediated gene activity by approximately 2.5-fold

(see Figure 23b). To determine if NF-κB was playing a role in the CD86-induced regulation of 3’-IgH enhancer activity, Chromatin Immunoprecipitation assay (ChIP) was performed. When the level of p50 or p65 bound to κB sites located within the hs4 region were analyzed, CD86 stimulation increased the level of bound p50 and p65 as compared to the CD40L/IL-4 alone group (see Figure 24). In contrast, a control antibody showed no difference with addition of CD28/Ig (data not shown). Taken together, these data show that CD86 stimulation increases the level of gene activity that is regulated by NF-

κB and/or the 3’-IgH enhancer. The increase in p50/p65 binding to the hs4 region suggests that NF-κB plays a role in the regulation of 3’-IgH enhancer transcriptional activity.

3.6 CD86-deficient B cells produce less IgG1 and Oct-2 in vivo.

Although the in vitro data to date show that direct stimulation of CD86 on a B cell regulates the amount of IgG1 produced, without affecting class switch recombination, animal models are required to prove in vivo relevance. A previous study from our 57

Figure 23. CD86 stimulation increases the hs4- and 3’-IgH enhancer-mediated gene activity. (a) CH12.LX B cells were co-transfected with a plasmid construct containing the hs4 region of the 3’-IgH enhancer containing the firefly luciferase gene, and a control plasmid containing the renilla luciferase gene (pRL-TK). The cells were activated with

CD40L/IL-4 for 16 h before addition of either a control Ig (-) or CD28/Ig. Data represent the mean fold increase in firefly luciferase activity normalized to renilla luciferase activity ± S.E.M. from three independent experiments. (b) A20 cells, stably transfected with a plasmid construct containing the entire 3’-IgH enhancer followed by a γ2b reporter gene, were activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig. Cells were lysed on day 5 following initial activation and the lysate was analyzed for the level of γ2b by ELISA. Data represent the mean fold increase in γ2b ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the

CD40L/IL-4 alone group.

Figure 24. CD86 stimulation increases the binding of NF-κB to the hs4 region of the 3’-

IgH enhancer. Resting naive B cells were activated with CD40L/IL-4 for 16 h before addition of CD28/Ig. Three days after activation, cells were fixed, nuclei isolated, and the DNA sheared into 200-500 base pair fragments by sonication. p50 or p65 bound to the DNA were immunoprecipitated using either an anti-p50 or anti-p65 Ab. The amount of p50 and p65 bound to κB sites contained within the hs4 region were analyzed using semi-quantitative PCR. The amount of p50 or p65-specific PCR product for each sample was determined by subtracting out the non-specific PCR product from samples that received no Ab during the immunoprecipitation and normalized to the amount of in-put

DNA. Data represent the mean fold increase in p50 or p65 binding ± S.E.M. from three independent experiments with a representative gel inlay. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

59 laboratory used scid mice reconstituted with resting B cells alone that were activated by the intraperitoneal injection of both an anti-CD40 Ab and recombinant IL-4 plus or minus an anti-CD86 Ab. Serum levels of IgG1 on day 14 following activation were approximately 3-fold higher in the presence of an anti-CD86 Ab as compared to anti-

CD40/IL-4 alone (100), suggesting that CD86 stimulation on some CD86-expressing cell affected the level of IgG1 produced. However, testing whether CD86 signals directly in a

B cell when T cells are present to provide B cell help during a T cell-dependent IgG1 response in vivo proved more difficult since any attempt to stimulate CD86 would interfere with T cell costimulation. Therefore, we established an adoptive transfer model system in which only the B cell would lack CD86, while all other APCs, namely dendritic cells and macrophages, would express CD86 normally and allow for optimal T cell activation to occur. CD4+ T cells and resting B cells from Wt and/or CD86-deficient mice were adoptively transferred to Rag2-deficient mice, resulting in mice that expressed

Wt-T/Wt-B or Wt-T/CD86-deficient B cells (see Figure 9). To determine whether equal numbers of T and B cells were localized in the spleens of these mice 6 days following immunization with TNP-KLH, FLOW cytometry was performed and the percentage of

B220+ and CD4+ cells was found to be equivalent between the mice receiving Wt-T/Wt-B

(see Figure 25a) or Wt-T/CD86-deficient B cells (see Figure 25b). To determine whether a similar level of T cell activation occurred in the two groups of mice, the level of IL-4 mRNA produced by splenocytes was measured using realtime PCR, and was found to be equivalent (see Figure 26).

Figure 25. The presence or absence of CD86 does not alter the number of B and T cells present in the spleen. Wt CD4+ T cells and Wt-B cells (Wt) or Wt CD4+ T cells and

CD86-deficient B cells (CD86-/-) were adoptively transferred to RAG2-deficient mice.

One week later, all mice received one intraperitoneal injection of 100 ug TNP-KLH in

Alum. The percentage of total splenic B cells (B220+) and CD4+ T cells (CD4+) in the

(a) WT and (b) CD86-/- reconstituted mice was determined by FACS analysis. Data are shown as a dot plot of cells stained for B220 and CD4. One representative dot plot from two independent experiments is shown.

Figure 26. The lack of CD86 expression alters the level of Oct-2 and mature IgG1 mRNA in vivo, but not the level of IL-4 and germline IgG1. Total splenocytes were isolated from mice receiving Wt B cells (white bars) or CD86-/- B cells (black bars) and the level of

Oct-2, IL-4, and germline IgG1 mRNA on day 4 and mature IgG1 mRNA on day 6 was determined using real-time PCR. Data represent the mean-fold increase in a specific gene normalized to total actin ± S.E.M. from two independent experiments. * indicates a p value of < 0.05 in comparison between the Wt and CD86-deficient groups.

62 Likewise, FLOW cytometry was performed on single CD4+ T cells stained for intracellular IL-4 expression, and the data showed that the number of cells expressing IL-

4 and the amount expressed per cell were equivalent (see Figure 27). Because the induction of germline IgG1 mRNA is dependent on the presence of IL-4 (74, 76), and was not dependent on CD86 stimulation (126), the level of germline IgG1 mRNA was measured in splenocytes using realtime PCR, and was also found to be equivalent (see

Figure 26). Thus, all findings indicated that the level of T cell activation was equivalent in both adoptive transfer groups.

When the reconstituted Rag2-deficient mice were immunized with the T cell- dependent antigen, TNP-KLH, mice receiving CD86-deficient B cells produced approximately 2-fold less of both serum IgG1 (see Figure 28a) and splenocyte mature

IgG1 mRNA (see Figure 26), but equivalent amounts of germline IgG1 when compared to mice that received Wt B cells. Similarly, total splenocyte Oct-2 mRNA (see Figure

26) and protein (see Figure 28b), which were reported to increase in CD86-stimulated B cells (100), were also approximately 2-fold less in the mice receiving CD86-deficient B cells as compared to Wt B cells. Taken together, these findings in vivo suggest that

CD86 stimulation on a B cell during a T cell-dependent Ab response is needed to activate an intracellular signaling pathway in the B cell to upregulate the level of IgG1 above the level induced by B cell activation alone, but independently of class switch recombination.

3.7 CD86 signaling in a B cell is CD19-dependent.

The signaling pathway activated by CD86 proximal to NF-κB activation was recently identified to include PI3K/PDK1/Akt and PLCγ2/PKCαβ (127). CD86,

Figure 27. The absence of CD86 does not alter the level of IL-4 produced by a CD4+ T cell. Total splenocytes were isolated from mice receiving Wt-T and Wt-B cells (Wt) or

Wt-T and CD86-/- B cells (CD86-/-) and stained for total CD4+ T cells by FACS analysis. The level of intracellular IL-4 produced by these CD4+ T cells was detected by intracellular FACS analysis and one representative histogram is shown from two independent experiments.

Figure 28. The absence of CD86 expression decreases the level of Oct-2 and IgG1 in vivo. Wt CD4+ T cells and Wt-B cells (Wt) or Wt CD4+ T cells and CD86-deficient B cells (CD86-/-) were adoptively transferred to RAG2-deficient mice. One week later, all mice received one intraperitoneal injection of 100 ug TNP-KLH in Alum. (a) Serum was collected on day 14 following immunization and the level of IgG1 was determined by

ELISA. (b) Protein was isolated from total splenocytes on day 6 following immunization and the level of Oct-2 and actin was determined by Western blot analysis. One representative blot is shown from two independent experiments. * indicates a p value of

< 0.05 in comparison between the Wt and CD86-deficient groups.

65 however, does not contain a tyrosine residue in the cytoplasmic domain, which is critical for the binding and activation of PI3K. The finding that CD86 signaling in a dendritic cell was limited to only those dendritic cells that expressed CD19 (128), suggested to us that CD86 might require CD19 to activate PI3K. Therefore, to determine if CD19 was required for CD86 stimulation to increase PI3K activity, Wt, CD86-, and CD19-deficient

B cells were stimulated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig. As shown in Figure 29, exposure of CD28/Ig to Wt B cells increased PI3K activity approximately 3-fold above that induced by CD40L/IL-4 alone, while CD86- and CD19- deficient B cells produced equivalent baseline levels of PI3K activity, but were unable to regulate PI3K activity in response to CD28/Ig. Previous data using a PI3K inhibitor showed that stimulation of CD86 on an activated B cell required PI3K to increase the level of Oct-2 mRNA (127). Consequently, Wt, CD86-, and CD19-deficient B cells were activated as described above and the level of Oct-2 mRNA was measured on day 2.

CD86- and CD19-deficient B cells exposed to CD28/Ig failed to upregulate Oct-2 mRNA, while Wt B cells exposed to CD28/Ig increased the level of Oct-2 mRNA approximately 2-fold (see Figure 30). The level of IgG1 mRNA (see Figure 31a) and protein (see Figure 31b) induced by addition of CD28/Ig on Wt, but not CD86- and

CD19-deficient B cells, was approximately 2-fold higher when compared to the level induced by CD40L/IL-4 alone. Since the CD40L/IL-4-induced levels of PI3K activity,

Oct-2, and IgG1 appeared to be equivalent between the Wt, CD86-, and CD19-deficient

B cells, we concluded that the inability of CD28/Ig to regulate these signaling pathways was due to a lack of CD86 signaling and not an inherent defect in the CD86-or CD19- deficient B cells. When TLR4-deficient B cells were activated with CD40L/IL-4, the

Figure 29. Expression of CD19 is required for the CD86-induced increase in PI3K. Wt

(white bars), CD86-deficient (gray bars), and CD19-deficient (black bars) B cells were activated in vitro with CD40L/IL-4 for 16 h prior to addition of CD28/Ig or isotype control Ab. The level of PI3K activity was measured using an in vitro ELISA based kinase assay. Data represent the mean (ng of PIP3) ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

Figure 30. Expression of CD19 is required for the CD86-induced increase in Oct-2. Wt

(white bars), CD86-deficient (gray bars), and CD19-deficient (black bars) B cells were activated in vitro with CD40L/IL-4 for 16 h prior to addition of CD28/Ig or isotype control Ab. The level of Oct-2 mRNA on day 2 was determined using realtime PCR analysis and normalization to total actin. Data represent the mean ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the

CD40L/IL-4 alone group.

Figure 31. Expression of CD19 is required for the CD86-induced increase in IgG1.

Wt (white bars), CD86-deficient (gray bars), and CD19-deficient (black bars) B cells were activated in vitro with CD40L/IL-4 for 16 h prior to addition of CD28/Ig or isotype control Ab. The level of (a) mature IgG1 mRNA on Day 5 was determined using realtime

PCR analysis and normalization to total actin. (b) Cell supernatants were collected on day 7 and analyzed for total IgG1 by ELISA. Data represent the mean (ng/ml of IgG1) ±

S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

69 level of Oct-2 and mature IgG1 mRNA (see Figure 32a) and protein (see Figure 32b) induced by addition of CD28/Ig was similar to that seen in Wt cells (see Figure 30-31).

Thus, collectively, these data show that CD86 stimulation on an activated B cell requires the presence of CD19 to increase the level of PI3K activity, Oct-2 expression, and IgG1 produced, suggesting that CD19 is a potential link between CD86 stimulation and the activation of PI3K in a B cell.

3.8 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of CD19.

Because CD86 failed to signal in a CD19-deficient B cell, the question remained as to the mechanism by which CD86 activated CD19. CD19 contains 9 tyrosine residues in the cytoplasmic domain that are phosphorylated to promote CD19 interaction with a number of SH2 domain-containing proteins, including Lyn, Vav, Grb2, and p85α PI3K

[reviewed in (129)]. To determine if CD86 stimulation increased tyrosine phosphorylation of CD19, Western blot analysis was performed on whole cell lysates from B cells activated as described above. The level of tyrosine phophorylation of CD19

(Tyr513), which is the critical residue for CD19 activation of PI3K (130), was increased at 5 and 15 min following addition of CD28/Ig to Wt B cells (see Figure 33a), but not when added to CD86-deficient B cells (see Figure 33b). When TLR4-deficient B cells were used, the data showed that the level of phosphorylated CD19 was increased to a similar level as seen using Wt B cells (see Figure 34). Because tyrosine phosphorylation of the CD19 cytoplasmic domain promotes the binding of SH2 domain-containing proteins such as PI3K, it was possible that CD86 activated CD19 to bind and activate

Figure 32. CD86 signaling is normal in TLR4-deficient B cells. TLR4-deficient B cells were activated with CD40L/IL-4 for 16 h prior to the addition of CD28/Ig. (a) The level of Oct-2 mRNA on day 2 and mature IgG1 mRNA on day 5 was determined in TLR4- deficient B cells activated with CD40L/IL-4 in the absence (white bars) or presence

(black bars) of CD28/Ig using real-time PCR analysis. (b) Supernatants were collected on day 7 and the level of total IgG1 was determined using ELISA. The data represent mean ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

Figure 33. CD86 stimulation increases the phosphorylation of CD19. The level of phospho-CD19 (Tyr513) and total actin was analyzed using Western Blot analysis from

(a) Wt and (b) CD86-deficient B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig. Band density was determined using densitometry and the data represent the mean fold increase in phospho-CD19 normalized to actin ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the

CD40L/IL-4 alone group.

Figure 34. CD86 activates CD19 in TLR4-deficient B cells. The level of phospho-CD19

(Tyr513) and total actin was analyzed using Western Blot analysis in TLR4-deficient B cells activated with CD40L/IL-4 for 16 h prior to addition of CD28/Ig. Band density was determined using densitometry and the data represent the mean fold increase in phospho-

CD19 normalized to actin ± S.E.M. from three independent experiments. * indicates a p value of < 0.05 in comparison to the CD40L/IL-4 alone group.

73 PI3K. B cells were activated as described above and total protein was isolated and immunoprecipitated with an anti-CD19 antibody, after which time the precipitates were analyzed by Western blot analysis. The amount of Lyn, Vav, and p85α PI3K that immunoprecipitated with CD19 increased following addition of CD28/Ig (see Figure

35). The blots were also probed for the presence of CD86, but failed to show an interaction with CD19 (data not shown), suggesting that CD86 activates CD19 through a mechanism other than direct interaction. Thus, these results suggest that CD86 stimulation on a B cell activates CD19 to potentially mediate the activation of PI3K.

3.9 CD86 stimulation on a CD40L/IL-4-activated B cell increases the phosphorylation and activation of Lyn.

Lyn is a src-family protein tyrosine kinase reported to be capable of phosphorylating CD19 (131). However, Lyn kinase must first be activated through tyrosine phosphorylation. Y397, which is located in the kinase domain of Lyn, positively regulates activity, while Y508, which is located in the regulatory domain of Lyn, negatively regulates Lyn activity [reviewed in (132)]. To determine if CD86 stimulation requires a protein tyrosine kinase to positively regulate the phosphorylation of CD19, we designed three experiments. First, B cells were activated as described above and two different Src-family kinase inhibitors, SU6656 and PP2, were added 30 min prior to addition of CD28/Ig. Pretreatment with either one of the src-family kinase inhibitors prevented the CD86-induced increase in phospho-CD19 (see Figure 36). Second, to further confirm that a protein tyrosine kinase was involved in the CD86-induced signaling pathway, B cells were activated as described above in the presence or absence

Figure 35. CD86 stimulation induces increasd binding of signaling proteins to CD19.

Protein samples from resting, CD40L/IL-4-activated, and CD40L/IL-4/CD28/Ig-activated

B cells were immunoprecipitated (IP) with an anti-CD19 antibody and the precipitates were analyzed for the presence of CD19, phospho-CD19, Vav, p85α PI3K, and Lyn by

Western blot analysis. One representative gel from three independent experiments is shown.

Figure 36. A Src-family kinase is required for CD86 stimulation to increase CD19 phosphorylation. Western blot analysis of phospho-CD19 (Tyr513) and total actin in B cells activated with CD40L/IL-4 for 16 h and then pretreated with an Src-family kinase inhibitor, SU6656 [100 nM], for 30 min prior to addition of CD28/Ig. Band densities were determined using densitometry and the data represent the mean fold increase in phospho-CD19 normalized to total actin ± S.E.M. from three independent experiments.

One representative gel from three independent experiments is shown.

76 of a Src-family kinase inhibitor. In the presence of the Src-family kinase inhibitor,

CD28/Ig failed to increase the level of Oct-2 mRNA (see Figure 37) above that induced by CD40L/IL-4 alone. And third, since the protein tyrosine kinase Lyn was immunoprecipitated with CD19 (see Figure 35), it was possible that CD86 stimulation regulated the phosphorylation of Lyn. To test this possibility, B cells were activated as described above and total protein was isolated and immunoprecipitated with an anti-Lyn antibody. The level of phospho-Lyn (Y397) that positively regultes Lyn activity was increased at 5 min following CD86 stimulation on Wt B cells (see Figure 38). Thus, these results suggest that Lyn is the protein tyrosine kinase that is activated by CD86 stimulation to increase the phosphorylation of CD19.

Figure 37. A src-family kinase is required for CD86 stimulation to increase Oct-2

mRNA. Realtime PCR analysis of Oct-2 and actin mRNA in B cells activated with

CD40L/IL-4 for 16 h and then pretreated with an Src-family kinase inhibitor, SU6656

[100 nM], for 30 min prior to addition of CD28/Ig. Data represent the mean fold increase

in Oct-2 mRNA normalized to actin ± S.E.M. from three independent experiments.

Figure 38. CD86 stimulation increases the phosphorylation of Lyn. Protein samples from resting, CD40L/IL-4-activated, and CD40L/IL-4/CD28/Ig-activated B cells were immunoprecipitated (IP) with an anti-Lyn antibody and the precipitates were analyzed for the presence of phospho-Lyn and total Lyn by Western blot analysis. One representative gel from three independent experiments is shown.

CHAPTER 4

DISCUSSION

4.1 Summary of results

Initially, CD86 was thought to be a costimulatory molecule that was unable to signal itself. However, a number of studies to date in both B cells and dendritic cells have suggested that CD86 is able to signal directly. For example, recent data in B cells shows that stimulation of CD86 on an activated B cell increases the rate of IgG1 production (89, 96, 97), as well as the level of anti-apoptotic factors (98), CD80 expression (99), NF-κB activation (100), and Oct-2 expression and binding to the 3’-IgH enhancer (100). In addition, recent data in dendritic cells show that stimulation of CD86 on a dendritic cell increases the activation of NF-κB, p38 MAPK, IDO, and IL-6 (133).

Therefore, since CD86 signaling has been shown in two different cell types, it is becoming more likely that CD86 is able to signal directly and can no longer be considered simply a costimulatory molecule for CD28 on a T cell.

The goal of the present study was to test the hypothesis that stimulation of CD86 on a CD40L/IL-4-activated B cell activates a distinct signaling pathway within the B cell to increase the activation of NF-κB and the gene transcription mediated by the 3’-IgH enhancer. Previous data show that CD86 stimulation on a CD40L/IL-4-activated B cell increases the level of NF-κB activation, Oct-2 expression and binding to the 3’-IgH 80 enhancer, and mature IgG1 mRNA and protein (100). The present data extend these findings and show that CD86 stimulation on a CD40L/IL-4-activated B cell activates the

PI3K/PDK1/Akt and PLCγ2/PKCα/β signaling pathways, increases the level of gene activity mediated by NF-κB and the 3’-IgH enhancer, and increases p50 and p65 binding to the hs4 region of the 3’-IgH enhancer (see Figure 39). In addition, we show for the first time that CD86 stimulation on a CD40L/IL-4-activated Wt, but not CD86- or CD19- deficient, B cell in vitro increases the phosphorylation of Lyn and CD19, as well as the amount of Lyn, Vav, and p85α PI3K that immunoprecipitated with CD19 (see Figure

39). Using an adoptive transfer model, the present data show for the first time that the loss of CD86 expression on a B cell alone prevents the generation of an optimal IgG1 response in vivo, even in the presence of a normal IL-4 and germline IgG1 response.

Thus, our findings suggest that CD86 on a B cell plays a key role in regulating the level of IgG1 produced in vitro and in vivo, independently of class switch recombination, and that Lyn and CD19 may serve as the signaling intermediates activated by CD86 proximal to PI3K.

4.2 Possible mechanisms by which CD86 regulates IgG1 production

4.2.1 Class switch recombination versus rate of mature IgG1 mRNA

production

Previous findings in CD40L/IL-4-activated B cells indicated that CD86 stimulation increased specifically the level of Oct-2 expression and binding to the 3’-IgH enhancer, which was associated with an increase in the rate of IgG1 produced per B cell, without affecting class switch recombination (CSR) (96, 100). However, whether a

Figure 39. Proposed CD86 signaling pathway in an activated B cell. (1) CD86 stimulation increases the phosphorylation of Lyn and CD19, as well as the amount of

Lyn, Vav, and PI3K that binds to CD19. (2) Stimulation of CD86 increases the activity of PI3K and the phosphorylation of PDK-1, Akt (thr308), and IKKα/β. The activation of

IKKα/β leads to the phosphorylation of IκBα. (3) Phosphorylated IκBα is rapidly degraded, allowing for the nuclear localization of NF-κB, specifically p50 and p65. (4)

Additionally, stimulation of CD86 increases the phosphorylation of PLCγ2 and PKCα/β,

(5) leading to the phosphorylation of p65. (6) NF-κB-dependent Oct-2 gene activity is increased, leading to an increase in the level of Oct-2 mRNA and protein. (7) Finally,

NF-κB- and 3’-IgH enhancer-mediated gene activity is increased via increased NF-κB and Oct-2 binding to their consensus sequences, leading to an increase in the rate of mature IgG1 transcription and protein production. 82 direct link existed between CD86 and 3'-IgH enhancer activity was unknown. The present results establish that a direct link exists, and may explain why a CD86-induced effect on CSR does not occur. First, CD40 preferentially activates the p50/RelB and p50/p65 dimers (74, 76), while CD86 specifically activates p50/p65 dimers alone (100).

And second, RelB appears to play a role in regulating germline IgG1 production (74, 76), while p50 and p65 appear to play a role in regulating the level of IgG1 protein produced

(134). These findings lend support to the proposal that the CD86-induced effect on the rate of IgG1 production is dissociated from the CD40-induced effect on CSR, but not from the CD40-induced effect on 3’-IgH enhancer activity.

4.2.2 Cell survival

A previous finding showed that CD86 induced an increase in the level of expression of the anti-apoptotic proteins Bcl-x(L) and Bcl-w, and a decrease in the level of expression of the pro-apoptotic factor caspase 8 (98), in LPS-activated B cells.

Therefore, one possibility is that CD86 stimulation increases the level of IgG1 by increasing the level of B cell survival signals. The PI3K/Akt pathway is known to phosphorylate the Bcl-2 family protein Bad to prevent it from inactivating prosurvival factors, such as Bcl-x(L) (135), as well as to phosphorylate and inactivate the pro- apoptotic factors caspase 9 (136) and members of the Forkhead family (137). Our finding that CD86 activates Akt provides a mechanism by which the anti-apoptotic effects may occur in LPS-activated B cells. However, it is not yet clear whether the effect on cell survival is associated with the rate of IgG1 produced in CD40L/IL-4-

83 activated B cells, since cell survival was unaffected by CD86 stimulation in our model system (96, 100).

4.3 CD86 Signaling in a B cell

4.3.1 Requirement for prior activation

Prior B cell activation appears to be necessary for CD86 to function as a B cell regulatory molecule, suggesting two possibilities. First, CD86 is an inactive signaling molecule that requires induction of the expression and/or binding of an adapter protein, as has been shown for the TCR and BCR complexes (138). The presence of 3 putative PKC phosphorylation sites on the short cytoplasmic tail of CD86 (95) suggests that a clustering of CD86 on the B cell surface may activate PKC to phosphorylate these sites to provide signaling capacity to the otherwise inert molecule. In support of this hypothesis, one study reported that the murine CD86 cytoplasmic domain was phosphorylated only after cell activation, suggesting that phosphorylation may play a role in the ability of

CD86 to signal in a murine B cell (139). Our results support this possibility since PKC activation is clearly increased when CD86 is stimulated on a CD40L/IL-4-activated B cell. Alternatively, CD86 may possess innate signaling potential, but because the level of

CD86 is low on a resting B cell, any signaling intermediates generated may be below the level of detection. In previous studies designed to determine if CD86 stimulation affects

B cell functional activity, it was found that prior activation of the B cell with LPS (98), the BCR (89, 99), or CD40L/IL-4 (96, 97, 100) was needed for CD86 stimulation to exert an effect on the level of antibody produced. Importantly, these activating stimuli increased the level of CD86 expressed on a B cell, suggesting that B cell activation may

84 induce a critical level of CD86 that is needed for a signal to be detectable. Alternatively, when two ligands were used that induce an increase in the level of CD86 expression without activating the B cell, namely IL-4 (86) and a β2-adrenergic receptor agonist (90), stimulation of CD86 alone was unable to generate a detectable level of signaling intermediates, suggesting that CD86 may not possess innate signaling potential, regardless of the level of CD86 expressed on the B cell surface. Thus, the apparent inability of CD86 alone to signal on a resting B cell is not simply due to the low level of

CD86 expression, but may be associated with the lack of a competency signal or factor afforded by B cell activation.

4.3.2 CD28/Ig stimulation of CD86

Previous studies used an anti-CD86 Ab to stimulate CD86 on the B cell surface.

However, we recently switched to using CD28/Ig to more closely mimic the endogenous ligand found on T cells, i.e., CD28. Because studies in dendritic cells using CD28/Ig suggested a role for both CD80 and CD86 signaling in some of the functional responses measured (133), and since CD28/Ig can bind to both CD80 and CD86 (140), the possibility existed that the loss of CD86 in a CD86-deficient B cell prevented

CD80/CD86 heterodimerization and, therefore, might explain the loss of CD28/Ig- induced signaling when CD86-deficient B cells were used. We think that this possibility is unlikely since fluorescence resonance electron transfer (FRET) technology showed that

CD80 exists primarily as a homodimer on the B cell surface, while CD86 exists primarily as a monomer (141). Likewise, the chemical properties of the potential dimer interfaces of CD80 and CD86 were shown to be very different. CD80 expresses a hydrophobic

85 interface that would promote dimerization, while CD86 expresses a hydrophilic interface that would make it less prone to dimerization (142). Therefore, it is unlikely that CD80 and CD86 interact on the cell surface to mediate the CD28/Ig-induced effects and, therefore, make it unlikely that the loss of an effect when using CD86-deficient B cells was due to loss of dimerization with CD80. Nonetheless, CD80-deficient B cells will be used in future experiments to further rule out this possibility. Another reason why we think CD80 is not involved in the signaling induced by CD28/Ig in a B cell is the fact that to induce the signaling intermediates measured in the present study within the first 24 h of B cell activation, both CD80 and CD86 would need to be concomitantly expressed during this time period. However, the kinetics of CD80 and CD86 expression are very different following B cell activation. CD86 surface expression is detectable at 6 h and maximal at 24 - 48 h after activation [(88) and (data not shown)], while CD80 surface expression is detectable by 24 h and maximal at 48 - 72 h [(143) and (data not shown)].

This difference in expression kinetics makes it unlikely that CD80 would be expressed to any detectable level on the B cell to interact with CD86 when CD28/Ig was added to our culture system 16 h following CD40L/IL-4 activation. Taken together, these two arguments make it unlikely that CD80 and CD86 interact with each other on a B cell at the time of addition of CD28/Ig to induce an intracellular signal and, therefore, we conclude that the effects measured following addition of CD28/Ig are likely due to CD86 stimulation alone.

86 4.3.3 Targets of NF-κB

The specific target genes activated by NF-κB in a B cell after CD86 stimulation remain unknown. Our finding of increased p50 and p65 binding to the hs4 region of the

3’-IgH enhancer suggests that the hs4 region is one target of the CD86-induced NF-κB activation. The hs4 region, which is known to be regulated directly by NF-κB and octamer binding proteins (114, 115), may be the specific target of the CD86 signaling pathway required for an increase in IgG1 on a per cell basis. A second potential target of the CD86-induced increase in NF-κB activity is the Oct-2 gene, which published data show, indirectly, is regulated by NF-κB (113). Furthermore, the present findings that an

IKK inhibitor blocked the CD86-induced activation of NF-κB and the increase in Oct-2 expression, further suggests, indirectly, that NF-κB regulates Oct-2 expression. What remains to be determined is whether or not NF-κB binds to putative κB-binding sites within the Oct-2 promoter, but such an experiment requires a characterization of the Oct-

2 promoter sequence, which has not been reported to date. Thus, these findings suggest that the Oct-2 promoter and the hs4 region of the 3'-IgH enhancer are likely targets for the NF-κB activated by CD86 stimulation.

A third potential target of the CD86 activated NF-κB is the CD80 gene. CD80 expression is regulated by κB-binding sites located within its promoter region (144), and

CD86 stimulation on a B cell is known to increase the level of CD80 mRNA and surface expression (99). Until now, the signaling pathway activated by CD86 to increase CD80, as well as the functional relevance of such regulation, is unknown. We propose that

CD86 may have a dual function during an IgG1 response in that it may enhance the level of IgG1 by increasing NF-κB activity, as well as Oct-2 expression and binding to the 3’- 87 IgH enhancer, but suppress the level of IgG1 indirectly by increasing CD80 expression to dampen the response. Although the ability of CD80 to signal is unknown, support for this proposal includes the early and late kinetics for CD28/CD86 (88, 145) and CTLA-

4/CD80 (143, 146) expression, respectively, on T and B cells, making CD86 and CD80 ideal candidates to strengthen and dampen the B cell response, as has been documented for CD28 and CTLA-4 [reviewed in (147)]. In dendritic cells, CD28-Ig enhanced activation of NF-κB, p38 MAPK, and IL-6, while CTLA-4-Ig activated the immunosuppressive pathway of tryptophan catabolism (133). The ability of CD28-Ig to induce a positive signal and CTLA-4-Ig to induce a negative signal has not been tested directly in B cells. Suvas et al. (98) showed in B cells that an anti-CD86 antibody induced anti-apoptotic genes, while an anti-CD80 antibody induced pro-apoptotic genes, suggesting CD28-Ig and CTLA-4-Ig could potentially activate both positive and/or negative signals within the B cell. Although the present data in B cells are the first to show that stimulation with CD28-Ig enhances IgG1 production in a CD86-dependent manner, the ability of CTLA-4-Ig to affect B cell function remains unknown.

Collectively, these findings suggest that B cells and T cells express costimulatory molecules during different phases of an immune response that possibly mediate opposing effector functions, with CD28/CD86 involved in immune enhancement and CTLA-

4/CD80 involved in immune suppression.

4.3.4 Two signaling pathways activated

The reason for the activation of two signaling pathways to mediate the CD86- induced effects on gene activity is becoming clearer. Previous data from our laboratory

88 suggested that one pathway activated a PKC-independent phosphorylation of IκBα, while the other activated a PKC-dependent phosphorylation of p65, with both pathways converging to increase Oct-2 and mature IgG1 mRNA expression (100). Alternatively, it is possible that the PKCα/β pathway is needed to phosphorylate Oct-2. A lack of Oct-2 phosphorylation, using cells transfected with a mutated form of the Oct-2 protein, was reported to result in decreased gene activity, suggesting that the phosphorylated form of

Oct-2 may be necessary for binding to DNA (114). Therefore, PKCα/β might also phosphorylate Oct-2 following CD86 stimulation to increase binding to the 3’-IgH enhancer. However, to make this determination, an antibody that recognizes the phosphorylated form of Oct-2 is needed, but is unavailable at present. The present findings suggest that the PI3K/Akt pathway is needed to activate the IKK complex to phosphorylate IκBα allowing for NF-κB activation, while the PLCγ2/PKCα/β pathway is needed to enhance p65 activity by mediating its phosphorylation. Thus, PKC- independent and PKC-dependent pathways are activated by CD86 stimulation on a

CD40L/IL-4-activated B cell, and both pathways appear to play an important role in mediating the CD86-induced increase in B cell activity.

4.3.5 Akt activation

The finding that CD86 appears to selectively induce the phosphorylation of Akt at thr308 as opposed to ser473 is interesting and novel. Akt activation and phosphorylation at thr308 is thought to be dependent on PI(3,4,5)P3 (148), which our data would support based on the observed increase in total PI3K activity. The increase in PI3K activity measured in vitro would suggest an increased amount of PI(3,4,5)P3 generation within the 89 cell, allowing for more PDK-1 and Akt to associate with PI(3,4,5)P3 and become activated. SHIP, a serine/threonine phosphatase, converts PI(3,4,5)P3 to PI(3,4)P2 and negatively regulates the activation of Akt [reviewed in (121)]. Therefore, our finding that

Akt phosphorylation at thr308 is increased following CD86 stimulation would suggest that SHIP is not playing a role in the enhancement of Akt activation, although a CD86- induced suppression of SHIP activity has not been eliminated.

4.3.6 CD19-deficient B cell phenotype

Because CD19-deficient B cells have been reported to respond differently to activation stimuli, it was possible that the inability of CD19-deficient B cells to respond to CD28/Ig may have been due to an inherent defect of CD40 signaling in these cells, as opposed to a defect in CD19-dependent CD86 signaling. This possibility was particularly relevant since CD40 stimulation is reported to be associated with CD19 activation (149). For example, the ability of CD19-deficient B cells to proliferate upon

CD40 stimulation was reported to be less than that in Wt B cells (150), while another report showed that proliferation remained unchanged (151). One possible explanation for these contrasting results is that the ligands used to stimulate CD40 differed, i.e., anti-

CD40 Ab decreased proliferation in CD19-deficient B cells when compared to Wt B cells

(150), while recombinant CD40L induced no change (151). If these two CD40- stimulating reagents activate different signaling intermediates, as has been reported previously (152), then it is possible that each signaling intermediate affected proliferation differently. Our findings using recombinant CD40L expressed on the surface of Sf9 cells would support the finding of (151) and expand it to the IgG1 response since Wt and

90 CD19-deficient B cells activated with CD40L/IL-4 produced comparable levels of IgG1.

This latter finding was also true for CD40/IL-4-activated B cells that made IgE (153).

Another possible explanation is that proliferation results may be misleading when interpreting Ab results. For example, proliferation in the B cell was measured at 72 h, while regulation of the role of mature IgG1 transcription was measured on day 5, at a time when any change in proliferation that may have occurred at 72 h may not be relevant to the IgG1 response that occurs days later. Taken together, the loss of CD86 signaling in a

CD19-deficient B cell appears to be due to a lack of CD19, and not to an inherent defect in the CD19-deficient B cell to make Ab after CD40 stimulation.

4.3.7 Ability of CD86 to activate CD19

The present data showed that CD86 stimulation increases PI3K activity, although the mechanism by which this occurs remained unknown since CD86 lacks expression of a tyrosine residue in the cytoplasmic domain that is required for PI3K activation. If previous reports are correct that CD19 stimulation activates PI3K (154, 155), and if our present finding is correct that CD86 stimulation activates CD19, then CD19 may be the link between CD86 stimulation and PI3K activation. However, what remains unclear is how CD86 mediates the activation of CD19. One possibility may be that CD86 activates

CD19 through a direct physical interaction. For example, CD21/CD81 are reported to activate CD19 via a direct physical interaction using their extracellular and transmembrane domains (156, 157). In contrast, MHCII (158) and CD180 (RP105) (159) are reported to activate CD19 without a detectable physical interaction. Our unpublished findings using co-immunoprecipitation suggest that CD86 and CD19 may not physically

91 interact with each other. While this finding does not preclude the possibility that CD86 and CD19 formed a weak interaction that was undetectable using our immunoprecipitation protocol, it does suggest that some mechanism would need to exist other than direct physical interaction. We propose, based on the present data, that this mechanism involves the phosphorylation of Lyn, phospho-Lyn binding to CD19, and subsequent phosphorylation of the CD19 cytoplasmic domain. However, the mechanism by which CD86 might activate Lyn directly remains unknown, but may be similar to the mechanism used by other B cell-associated receptors that also activate CD19. For example, crosslinking of the BCR (160) or CD21/CD19/CD81 (161) is known to recruit these receptor complexes into lipid raft domains where Lyn is selectively enriched (162).

If CD86 uses a similar mechanism, then it also would need to be recruited into a lipid raft domain following either CD40L/IL-4 and/or CD86 stimulation, providing a localized region in which CD86 would cluster with Lyn and/or CD19. In support of this hypothesis are the findings that crosslinking of either CD86 or CD40 on mature dendritic cells recruited CD86 to lipid raft domains (163). If the mechanism by which CD86 signals in a dendritic cell is similar to a B cell, which may involve recruitment of CD86 into lipid raft domains and clustering with signaling intermediates to allow for CD19 activation, then this clustering may be the mechanism by which CD86 activates Lyn,

CD19, and PI3K in a B cell.

92 4.4 In vivo relevance

4.4.1 CD86 stimulation in vivo

The ability of CD40 and IL-4R stimulation to regulate the amount of IgG1 produced per B cell in the absence or presence of CD86 stimulation raises the possibility that B cells might be activated in vivo to produce a T cell-dependent antibody in an antigen non-specific manner. The current study uses a model system where naive B cells are stimulated with CD40L and IL-4 16 hours prior to addition of CD28-Ig to stimulate

CD86. This model system was developed to allow for characterization of the CD86 signaling pathway, and was not meant to suggest that antigen-independent B cell activation occurs in vivo. The original model system used by Kasprowicz et al. (89) stimulated the BCR, waited 24 hours, and then stimulated concurrently CD40, IL-4R, and

CD86. The latter sequence of stimuli was designed to mimic the in vivo situation where the BCR would endocytose the antigen, process it, and present the peptide in association with MHCII to a previously activated T cell that now expresses CD28 and CD40L, as well as secretes IL-4. In that model system, if CD40 and IL-4R were stimulated at the same time as CD86, CD86 was unable to signal unless activated earlier via the BCR, potentially because the BCR upregulates CD86 expression (82). With BCR stimulation, it would have been extremely difficult to dissect the CD86 signaling pathway when stimulated at the same time as CD40 and the IL-4R. Consequently, a new model system was developed in which CD40 and IL-4R were stimulated in the absence of BCR stimulation and anti-CD86 was added 16 hours later. With the time difference between

CD40 and IL-4R stimulation and CD86 stimulation, CD86 appeared competent to signal and able to increase IgG1 production in this new model system of B cell activation (96).

93 Therefore, this model system was chosen to dissect the CD86 signaling pathway.

However, now that the CD86 signaling pathway has been characterized, it will be important to bring back the BCR signal into the model system.

Determining the role of CD86 signaling in a B cell during a T cell-dependent Ab response in vivo has been a challenge due to the requirement of T cell costimulation. The present in vivo results addressed this issue and suggest that expression of CD86 on the B cell alone is required for an optimal IgG1 response to occur. Another study also attempted to determine the role of CD86 signaling in vivo using a mixed chimeras model system and found that CD40 expression on a B cell was essential for class switch recombination to IgG1, but that CD80/86 expression on the B cell was not (126). The present data agree with this finding since no change was detected in germline IgG1 mRNA between Wt and CD86-deficient B cells. However, in contrast to the mixed chimeras model system, our adoptive transfer model system showed that B cells lacking

CD86 expression produced approximately 2-fold less mature IgG1 mRNA and protein.

The reason for the discrepancy about the role of CD86 in mature IgG1 production in the two model systems is not yet evident, but our finding suggests that the expression of

CD86 on a B cell may play a crucial role in establishing the level of IgG1 produced in vivo.

4.4.2 Human versus murine CD86

Human and murine CD86 share approximately 70% gene homology, with a number of differences located in the cytoplasmic domain. Both human and murine cytoplasmic domains contain putative PKC phosphorylation sites, i.e., serine and

94 threonine residues, but the human CD86 cytoplasmic domain contains a greater number of potential phosphorylation sites. This suggests that similar mechanisms may be used for CD86 signal transduction in both species, but that humans may use additional phosphorylation sites to regulate signal intensity. However, the question remains as to whether the findings in mice about CD86 signaling reflect the mechanism by which human CD86 might function. First, CD86 stimulation on human tonsillar B cells in vitro was reported to increase the production of IgG4 (97), suggesting that human CD86 might also signal directly within a human B cell to regulate the level of IgG4 produced. The ability of both human and murine CD86 to regulate the level of IgG4/IgG1 produced by a

B cell suggests that similar signaling mechanisms might be used intracellularly.

However, whether or not the phosphorylation status of the CD86 cytoplasmic domain is involved in the signaling process has not been established in either species since the human and murine CD86 cytoplasmic domains have yet to be fully characterized.

Interestingly, one report in humans showed that a polymorphism in the human CD86 cytoplasmic domain of an alanine to threonine change at +1057 position (164), which introduced an additional potential phosphorylation site, was associated with a lower incidence of acute liver transplant rejection (165). This finding suggested that the introduction of an additional phosphorylation site in the cytoplasmic domain of human

CD86 might have altered the signaling capabilities of CD86 and/or the ability to costimulate a T cell. More interestingly, a number of studies in mice (127, 166) and humans (97) have suggested that prior activation of the B cell is required for CD86 signaling to activate an intracellular signaling pathway. If true, potentially the CD86 cytoplasmic domain requires phosphorylation to become competent to signal, an idea that

95 was extensively discussed in an earlier section. Taken together, both human and mouse data suggest that CD86 stimulation on a B cell regulates the level of a T cell-dependent

Ab response similarly, but the role played by the potential phosphoryaltion sites in the cytoplasmic domain of human and murine CD86 remain unknown.

4.4.3 Clinical relevance of CD86 signaling

CD86 stimulation on a B cell, both in vitro and in vivo, increases the amount of

IgG1 produced 2- to 3-fold above the level induced by CD40L/IL-4. Yet, it remains unknown as to whether the CD86-induced increase in IgG1 is relevant clinically. The level of antibody produced by a B cell in response to a T cell-dependent antigen in vivo is critical for providing protection against pathogens and assuring host survival. One report showed that the level of antibody produced by individuals immunized with Streptococcus pneumoniae was positively correlated with the level of protection afforded against the microorganism, e.g., a 2- to 3-fold increase in total serum IgG levels after vaccination afforded a 3- to 9-fold increase in protection against infection (167). This finding in humans supports the premise that relatively small changes in the level of IgG produced by a B cell can be relevant clinically. However, this is not to say that these relatively small changes in IgG levels are due to CD86 signaling in the activated B cells, but this possibility could be tested by comparing the level of CD86 expression on the B cells of those individuals that responded and produced more IgG, to those who did not respond as well. If an increase in CD86 expression on the B cell functions as part of a normal IgG response to promote an increase in the level of IgG produced, then individuals that fail to upregulate expression of CD86 on their B cells would be at risk. If true, the ability of a B

96 cell to increase expression of CD86 upon activation might be a predictor of the potential effectiveness of vaccination. Conversely, over expression of CD86 may lead to an exacerbated IgG response, increasing the potential to develop an autoimmune reaction.

In support of this hypothesis, a recent study discovered a polymorphism in the promoter region of human CD86 that was associated with systemic sclerosis (168), an autoimmune disease that is characterized by the presence of increased autoantibodies. If this polymorphism results in an increase in the level of CD86 expression on B cells from systemic sclerosis patients, then it would be interesting to test whether increased expression of CD86 on these cells translated into increased signaling capability. Thus, the ability of CD86 to directly regulate the level of an IgG1 response 2- to 3-fold may be relevant clinically and, therefore, understanding the mechanism by which CD86 signals within a B cell to regulate the level of an IgG1 response may provide us with potential molecular targets for therapeutic interventions to selectively regulate the IgG1 response positively or negatively.

4.5 Future directions

4.5.1 Phosphorylation of CD86

The present findings in this dissertation suggest that CD86 stimulation on an activated B cell generates an intracellular signaling pathway. However, the exact mechanism by which this occurs remains unknown. CD86 contains three putative PKC phosphorylaion sites in the cytoplasmic domain (95). Lenchow et al. reported that CD86 was phosphorylated only after cell activation (139), suggesting that the phosphorylation of CD86 plays a role in the signaling capability. Therefore, the possibility exists that the

97 three putative PKC phosphorylation sites in the CD86 cytoplasmic domain play a role in the activation of Lyn and/or CD19. One approach to test this hypothesis would be through the generation of CD86 receptors bearing mutated phosphorylation sites.

Because the present results identified the signaling intermediates involved in the CD86 signaling pathway upstream of NF-κB activation, Lyn and CD19 activation could be used as readouts to determine if the mutated CD86 receptor was functional. In addition, since

CD19 is reported to interact with CD21 and CD81 through the extracellular and transmembrane domains (156, 157), it would also be important to determine whether the

CD86 extracellular and/or transmembrane domains play a role in the ability to generate an intracellular signaling pathway and activate CD19. Finally, the use of confocal microscopy would begin to determine whether CD86 and CD19 were colocalizing on the

B cell before, during, or after cell activation and CD86 stimulation. Although the exact mechanism by which CD86 activates Lyn and CD19 remains unknown, the present study identified a number of signaling intermediates activated following stimulation of CD86, laying the groundwork for additional studies to be performed.

4.5.2 Role of Lyn and other protein tyrosine kinases

The identification that a protein tyrosine kinase (PTK) was activated following stimulation of CD86 was determined through use of various PTK inhibitors as well as through Western blot analysis for the level of phosphorylated PTKs. Lyn is reported to be the primary PTK responsible for phosphorylating CD19, in part because Lyn and

CD19 are immunoprecipitated together (169). The present data show that CD86 stimulation activates the PTK Lyn, supporting our data showing that CD86 stimulation

98 increases the phosphorylation of CD19. Tedder et al. reported that CD19 and Lyn form a positive feedback loop in which Lyn activation increases in the presence of CD19 (131).

Consequently, it is important to determine whether CD86 stimulation activates Lyn directly, or indirectly through CD19 activation. Stimulation of CD86 on CD40L/IL-4- activated CD19-deficient B cells and analysis of the level of Lyn phosphorylation would begin to address this question. In addition, it is important to determine whether CD86 and Lyn immunoprecipitate together, which would suggest that CD86 may activate Lyn directly. Furthermore, it is also important to determine whether the CD86-induced increase in CD19 phosphorylation is dependent on Lyn activtion alone. Stimulation of

CD86 on CD40L/IL-4-activated Lyn-deficient B cells and analysis for CD19 phosphorylation would begin to address this question. CD19 phosphorylation following

BCR crosslinking on Lyn-deficient B cells was relatively normal (170), suggesting that some redundancy exists between the Src-family PTKs, i.e. Lyn, Syk, and Btk.

CD19 might not be the only target of Lyn activation. Lyn is reported to phosphorylate a number of adaptor and scaffolding proteins that may play a role in the

CD86 signaling pathway. For example, B cell adaptor for PI3K (BCAP) is an adaptor protein involved in BCR and CD19 signaling. A number of Src-family kinases have been reported to phosphorylate BCAP (171), including Lyn (172). BCAP is reported to interact with PI3K and increase its activity (171-174). Therefore, if our results are true that CD86 stimulation increases the activation of Lyn and Lyn phosphorylates BCAP, then it is possible that the CD86-induced increase in PI3K activity is mediated in part by the activation of BCAP. Future studies will address this hypothesis. Another possibility is that CD86 stimulation increases the phosphorylation of the scaffolding proteins Grb2

99 associated binder (Gab)1 and/or Gab2. The Gab-family of scaffolding proteins is reported to play a role in BCR-mediated activation of PI3K/Akt (175-177). The tyrosine phosphorylation of Gab1/2 was observed in Wt, but not Lyn-deficient B cells (178), suggesting that Lyn is required for the tyrosine phosphorylation of Gab1/2. Therefore, if our results are true that CD86 stimulation increases the activation of Lyn and Lyn phosphorylates Gab1/2, then it is possible that the CD86-induced increase in PI3K activity is mediated in part by the activation of Gab1/2. Thus, while the possibility still exists that other signaling adaptor and scaffolding proteins play a role in the CD86- induced signaling pathway, the present data show that CD86 stimulation activates Lyn and CD19.

4.5.3 Role of BCR

One important B cell activation receptor is the BCR. Crosslinking of the BCR on the surface of the B cell leads to activation of numerous signaling intermediates

[reviewed in (179)], including PLCγ2 and PI3K. Because CD86 and BCR stimulation both generate common signaling intermediates, future studies will determine if CD86 either stimulates the BCR indirectly or uses the same adapter proteins to activate the

PI3K/PDK1/Akt and PLCγ2/PKCα/β signaling pathways. It is also possible that CD86 will gain access to the latter adapter proteins only after B cell activation occurs. Since the present findings suggest that CD86 activates PLCγ2, future studies will determine if

CD86 also activates two downstream effectors of PLCγ2, namely intracellular Ca2+ and phospho-Erk. The present data would suggest that intracellular Ca2+ might be increased, as suggested by the activation of PLCγ2 and PKCα/β. Erk activation has not been shown 100 to regulate Oct-2 expression, 3’-IgH enhancer activity, or IgG1 production; therefore, we think it is unlikely to be involved as a CD86 signaling intermediate.

4.6 Concluding remarks

At the time these experiments were initiated, it was reported that stimulation of

CD86 on an activated B cell increased the rate of IgG1 production (89, 96, 97), as well as the level of anti-apoptotic factors (98), CD80 expression (99), NF-κB activation (100), and Oct-2 expression and binding to the 3’-IgH enhancer (100). However, the molecular mechanism by which CD86 stimulation generated the intracellular signaling pathway within the B cell remained unknown. The present data show that CD86 stimulation on a

CD40L/IL-4-activated B cell activates the PI3K/PDK1/Akt and PLCγ2/PKCα/β signaling pathways, increases the level of gene activity mediated by NF-κB and the 3’-

IgH enhancer, and increases p50 and p65 binding to the hs4 region of the 3’-IgH enhancer (see Figure 39). In addition, we show for the first time that CD86 stimulation on a CD40L/IL-4-activated Wt, but not CD86- or CD19-deficient, B cell in vitro increases the phosphorylation of Lyn and CD19, as well as the amount of Lyn, Vav, and p85α PI3K that immunoprecipitated with CD19. Using an adoptive transfer model, the present data show that the loss of CD86 expression on a B cell alone prevents the generation of an optimal IgG1 response in vivo, even in the presence of a normal IL-4 and germline IgG1 response. Thus, our findings suggest that CD86 on a B cell plays a key role in regulating the level of IgG1 produced in vitro and in vivo, independently of class switch recombination, and that Lyn and CD19 may serve as the signaling intermediates activated by CD86 proximal to PI3K.

101 The contribution of the present findings to the understanding of a T cell- dependent IgG1 response in vivo is that these findings are the first to show that CD86 expression on a B cell plays a role in mediating the generation of a normal IgG1 response.

The adoptive transfer in vivo model used in these experiments was carefully designed to test whether CD86 expression on a B cell was required for a normal IgG1 response in vivo without disrupting the normal T cell activation and costimulation, which presumably would have occurred via CD86 expression on dendritic cells. The findings from these experiments were critical in that they suggested that the signaling pathway identified in vitro for CD86 appears to be the same in vivo, i.e. a signaling pathway that regulates IgG1 and Oct-2.

Finally, the major contribution to the field of immunology made by this dissertation research is that the present findings are the first to identify the mechanism by which CD86 generates an intracellular signaling pathway within the B cell to activate

NF-κB and increase production of IgG1. By using the present in vitro model system, a known starting point, i.e., NF-κB regulation, allowed for the logical progression of experiments to work backwards from the CD86-induced increase in NF-κB activation, to an identification of the signaling molecules involved in the signaling pathway upstream of NF-κB. The use of the present in vivo model system was critical in showing that

CD86 stimulation on a B cell during a T cell-dependent IgG1 response was required for a normal IgG1 response. Collectively, the current data show on the molecular level that

CD86 stimulation on an activated B cell regulates the level of an IgG1 response, both in vitro and in vivo, through generation of unique intracellular signaling pathways. The knowledge gained from this work on the regulation of an IgG1 response may provide us 102 with potential molecular targets for therapeutic interventions to selectively regulate the

IgG1 response positively or negatively.

103

LITERATURE CITED

1. Sansonetti, P. J. 2006. The innate signaling of dangers and the dangers of innate signaling. Nat Immunol 7:1237-1242.

2. Hornef, M. W., M. J. Wick, M. Rhen, and S. Noremark. 2002. Bacterial strategies for overcoming host innate and adaptive immune responses. Nature Immunology 3:1033-1040.

3. Essellier, A. F., P. Jeanneret, L. Carmen, and N. Winkelstein. 1955. The phagocytic activity of the eosinophile granulocytes; influence of cortisone acetate and hydrocortisone acetate on eosinophil and neutrophil phagocytosis. Int Arch Allergy Appl Immunol 6:129-142.

4. Crabbe, J. 1956. Enhancing action of small doses of cortisone on macrophage phagocytosis of staphylococci in rabbits. Acta Endocrinol (Copenh) 21:41-46.

5. Bilbey, D. L., and H. Salem. 1959. Influence of sulphur dioxide inhalation on the phagocytic activity of the macrophage system. Nature 184(Suppl 10):722-723.

6. Kunin, S., G. M. Shearer, A. Globerson, and M. Feldman. 1972. Immunogenic function of macrophages: in vitro production of antibodies to a hapten-carrier conjugate. Cell Immunol 5:288-295.

7. Calich, V. L., L. M. Singer-Vermes, A. M. Siqueira, and E. Burger. 1985. Susceptibility and resistance of inbred mice to Paracoccidioides brasiliensis. Br J Exp Pathol 66:585-594.

8. Pinkston, P., A. Smeglin, N. J. Roberts, Jr., F. R. Gibb, P. E. Morrow, and M. J. Utell. 1988. Effects of in vitro exposure to nitrogen dioxide on human alveolar macrophage release of neutrophil chemotactic factor and interleukin-1. Environ Res 47:48-58.

9. Wolpe, S. D., B. Sherry, D. Juers, G. Davatelis, R. W. Yurt, and A. Cerami. 1989. Identification and characterization of macrophage inflammatory protein 2. Proc Natl Acad Sci U S A 86:612-616. 104

10. Fahey, T. J., 3rd, B. Sherry, K. J. Tracey, S. van Deventer, W. G. Jones, 2nd, J. P. Minei, S. Morgello, G. T. Shires, and A. Cerami. 1990. Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF and IL- 1. Cytokine 2:92-99.

11. Robertson, M. 1998. Antigen Presentation. Current Biology 8:R829-831.

12. Bevilacqua, M. P., J. S. Pober, D. L. Mendrick, R. S. Cotran, and M. A. Gimbrone, Jr. 1987. Identification of an inducible endothelial-leukocyte adhesion molecule. Proc Natl Acad Sci U S A 84:9238-9242.

13. Carlos, T. M., B. R. Schwartz, N. L. Kovach, E. Yee, M. Rosa, L. Osborn, G. Chi-Rosso, B. Newman, R. Lobb, M. Rosso, and et al. 1990. Vascular cell adhesion molecule-1 mediates lymphocyte adherence to cytokine-activated cultured human endothelial cells. Blood 76:965-970.

14. Dvorak, H. F., S. J. Galli, and A. M. Dvorak. 1986. Cellular and vascular manifestations of cell-mediated immunity. Hum Pathol 17:122-137.

15. Cook, M. C., A. Basten, and B. Fazekas de St.Groth. 1998. Influence of B cell receptor ligation and TCR affinity on T-B collaboration in vitro. Eur.J.Immunol. 28:4037-4049.

16. Awdeh, Z. L., A. R. Williamson, and B. A. Askonas. 1970. One cell-one immunoglobulin. Origin of limited heterogeneity of myeloma proteins. Biochem J 116:241-248.

17. Benacerraf, B. 1978. A hypothesis to relate the specificity of T lymphocytes and the activity of I region-specific Ir genes in macrophages and B lymphocytes. J.Immunol. 120:1809-1812.

18. Hayglass, K. T., S. J. Naides, C. F. Scott, B. Benacerraf, and M.-S. Sy. 1986. T cell development in B cell-deficient mice. IV. The role of B cells as antigen- presenting cells in vivo. J.Immunol. 136:823-829.

19. Uhr, J. W., and M. S. Finkelstein. 1963. Antobody formation. IV. Formation of rapidly and slowly sedimenting antibodies and immunological memory to bacteriophage phi-X 174. J. Exp. Med. 117:457-477.

20. Celada, F. 1967. Quantitative studies of the adoptive immunological memory in mice. II. Linear transmission of cellular memory. J. Exp. Med. 125:199-211.

21. Greaves, M., and G. Janossy. 1972. Elicitation of selective T and B lymphocyte responses by cell surface binding ligands. Transplant Rev 11:87-130.

105

22. Howard, J. G., J. J. Miranda, H. Zola, and G. H. Christie. 1973. Characteristics of B cell tolerance induced with T-independent polysaccharides. Adv Exp Med Biol 29:369-375.

23. Raff, M. C., J. J. Owen, M. D. Cooper, A. R. Lawton, 3rd, M. Megson, and W. E. Gathings. 1975. Differences in susceptibility of mature and immature mouse B lymphocytes to anti-immunoglobulin-induced immunoglobulin suppression in vitro. Possible implications for B-cell tolerance to self. J Exp Med 142:1052- 1064.

24. Boitard, C. 1992. B-cell responses in autoimmune diseases. Curr.Opin.Immunol. 4:741-747.

25. Goodnow, C. C. 1997. Glimpses into the balance between immunity and self- tolerance. Ciba.Found.Symp. 204:190-202; discus.

26. Gu, H., D. Kitamura, and K. Rajewsky. 1991. B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound Dµ protein and selection of DH element reading frames. Cell 65:47-40.

27. Hardy, R. R. 2003. B-cell commitment:deciding on the players. Current Opinion in Immunology 15:158-165.

28. Kuppers, R., M. Zhao, M. L. Hansmann, and K. Rajewsky. 1993. Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections. Embo J 12:4955-4967.

29. Bretscher, P., and M. Cohn. 1970. A theory of self-nonself discrimination. Science 169:1042-1049.

30. Guzman-Rojas, L., J. C. Sims-Mourtada, R. Rangel, and H. Martinez-Valdes. 2002. Life and death within germinal centres: a double-edge sword. Immunology 107:167-175.

31. Lortan, J. E., S. Oldfield, C. A. Roobottom, and I. C. MacLennan. 1988. Migration of newly-produced virgin B cells from bone marrow to secondary lymphoid organs. Adv Exp Med Biol 237:87-92.

32. Ledbetter, J. A., and E. A. Clark. 1986. Surface phenotype and function of tonsillar germinal center and mantle zone B cell subsets. Hum Immunol 15:30-43.

33. Jacob, J., and G. Kelsoe. 1992. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers. J Exp Med 176:679-687.

106

34. McHeyzer-Williams, M. G., M. J. McLean, P. A. Lalor, and G. J. Nossal. 1993. Antigen-driven B cell differentiation in vivo. J Exp Med 178:295-307.

35. Apel, M., and C. Berek. 1990. Somatic mutations in antibodies expressed by germinal centre B cells early after primary immunization. Int Immunol 2:813-819.

36. Jacob, J., J. Przylepa, C. Miller, and G. Kelsoe. 1993. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. III. The kinetics of V region mutation and selection in germinal center B cells. J Exp Med 178:1293- 1307.

37. Qin, D., J. Wu, K. A. Vora, J. V. Ravetch, A. K. Szakal, T. Manser, and J. G. Tew. 2000. Fc gamma receptor IIB on follicular dendritic cells regulates the B cell recall response. J Immunol 164:6268-6275.

38. Petrasch, S. G., M. H. Kosco, C. J. Perez-Alvarez, J. Schmitz, and G. Brittinger. 1991. Proliferation of germinal center B lymphocytes in vitro by direct membrane contact with follicular dendritic cells. Immunobiology 183:451-462.

39. Ziegner, M., G. Steinhauser, and C. Berek. 1994. Development of antibody diversity in single germinal centers: selective expansion of high-affinity variants. Eur J Immunol 24:2393-2400.

40. Lagresle, C., C. Bella, P. T. Daniel, P. H. Krammer, and T. DeFrance. 1995. Regulation of germinal center B cell differentiation. Role of the human APO- 1/Fas (CD95) molecule. J.Immunol. 154:5746-5756.

41. Kosco, M. H., A. P. Monfalcone, A. K. Szakal, and J. G. Tew. 1988. Germinal center B cells present antigen obtained in vivo to T cells in vitro and stimulate mixed lymphocyte reactions. Adv Exp Med Biol 237:883-888.

42. Kosco, M. H., A. K. Szakal, and J. G. Tew. 1988. In vivo obtained antigen presented by germinal center B cells to T cells in vitro. J Immunol 140:354-360.

43. Seppala, I., M. Hurme, H. Sarvas, and O. Makela. 1976. The role of B-cell memory in secondary IgG and IgM responses. Scand J Immunol 5:213-219.

44. Dilosa, R. M., K. Maeda, A. Masuda, A. K. Szakal, and J. G. Tew. 1991. Germinal center B cells and antibody production in the bone marrow. J Immunol 146:4071-4077.

45. Foy, T. M., J. D. Laman, J. A. Ledbetter, A. Aruffo, E. Claasen, and R. J. Noelle. 1994. gp39-CD40 interactions are essential for germinal center formation and the development of B cell memory. J. Exp. Med. 180:157-163.

107

46. Gray, D., P. Dullforce, and S. Jainandunsing. 1994. Memory B cell development but not germinal center formation is impaired by in vivo blockade of CD40-CD40 ligand interaction. J. Exp. Med. 180:141-155.

47. Angelin-Duclos, C., G. Cattoretti, K. I. Lin, and K. Calame. 2000. Commitment of B lymphocytes to a plasma cell fate is associated with Blimp-1 expression in vivo. J Immunol 165:5462-5471.

48. Campbell, K. S. 1999. Signal transduction from the B cell antigen-receptor. Current Opinion in Immunology 11:256-264.

49. Davie, J. M., and W. E. Paul. 1974. Role of T lymphocytes in the humoral immune response. I. Proliferation of B lymphocytes in thymus-deprived mice. J Immunol 113:1438-1445.

50. Valle, A., C. E. Zuber, T. DeFrance, O. Djossou, M. De Rie, and J. Banchereau. 1989. Activation of human B lymphocytes through CD40 and interleukin-4. Eur.J.Immunol. 19:1463-1460.

51. Gascan, H., J.-F. Gauchat, G. Aversa, P. van Vlasslelear, and J. E. de Vries. 1991. Anti-CD40 monoclonal antibodies or CD4+ T cell clones and IL-4 induce IgG4 and IgE switching in purified human B cells via different signaling pathways. J.Immunol. 147:8-13.

52. Sprent, J. 1978. Restricted helper function of F1 hybrid T cells positively selected to heterologous erthyrocytes in irradiated parental strain mice. II. Evidence for restrictions affecting helper cell induction and B-cell collaboration, both mapping to the K end of the H-2 complex. J.Exp.Med. 147:1159-1174.

53. Kupfer, A., S. L. Swain, C. A. Janeway, and S. J. Singer. 1986. The specific direct interaction of helper T cells and antigen-presenting B cells. PNAS 83:6080-6083.

54. Noelle, R. J., J. McCann, L. Marshall, and W. C. Bartlett. 1989. Cognate interactions between helper T cells and B cells. III. Contact-dependent, lymphokine-independent induction of B cell cycle entry by activated helper T cells. J.Immunol. 143:1807-1814.

55. Croft, M., and S. L. Swain. 1992. Analysis of CD4+ T cells that provide contact- dependent bystander help to B cells. J.Immunol. 149:3157-3165.

56. Noelle, R. J., M. Roy, D. M. Shepherd, I. Stamenkovic, J. A. Ledbetter, and A. Aruffo. 1992. A 39-kDa protein on activated helper T cells binds CD40 and transduces the signal for cognate activation of B cells. Proc.Natl.Acad.Sci.USA 89:6550-6554.

108

57. Vitetta, E. S., J. Ohara, C. D. Myers, J. E. Layton, P. H. Krammer, and W. E. Paul. 1985. Serological, biochemical, and functional identity of B cell-stimulatory factor 1 and B cell differentiation factor for IgG1. J.Exp.Med. 162:1726-1731.

58. Coffman, R. L., J. Ohara, M. W. Bond, J. Carty, A. Zlotnik, and W. E. Paul. 1986. B cell stimulatory factor-1 enhances the IgE response of lipopolysaccharide- activated B cells. J.Immunol. 136:4538-4541.

59. Snapper, C. M., and W. E. Paul. 1987. Interferon-gamma and B cells stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236:944-947.

60. Lee, C. G., K. Kinoshita, A. Arudchandran, S. M. Cerritelli, R. J. Crouch, and T. Honjo. 2001. Quantitative regulation of class switch recombination by switch region transcription. J Exp Med 194:365-374.

61. Stavnezer, J. 1999. Molecular processes that regulate class switching. Current Topics in Microbiology and Immunology 245:127-168.

62. Warren, W. D., and M. T. Berton. 1995. Induction of germline gamma-1 and epsilon Ig gene expression in murine B cells: IL-4 and the CD40 ligand-CD40 interaction provide distinct but synergistic signals. J.Immunol. 155:5637-5646.

63. Jumper, M. D., J. B. Splawski, P. E. Lipsky, and K. Meek. 1994. Ligation of CD40 induces sterile transcripts of multiple H chain isotypes in human B cells. J.Immunol. 152:438-430.

64. Stavnezer-Nordgren, J., and S. Sirlin. 1986. Specificity of immunoglobulin heavy chain switch correlates with activity of germline heavy chain genes prior to switching. EMBO J. 5:95-102.

65. Zhang, K. 2003. Accessibility control and machinery of immunoglobulin class switch recombination. J Leukoc Biol 73:323-332.

66. Linehan, L. A., W. D. Warren, A. P. Thompson, M. J. Grusby, and M. T. Berton. 1998. STAT6 is required for IL-4-Induced germline Ig gene transcription and switch recombination. J.Immunol. 161:302-310.

67. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S. Kashiwamura, K. Nakanishi, N. Yoshida, T. Kishimoto, and S. Akira. 1996. Essential role of STAT6 in IL-4 signalling. Nature 380:627-630.

68. Calderhead, D. M., Y. Kosaka, E. M. Manning, and R. J. Noelle. 1999. CD40- CD154 interactions in B cell signaling. Current Topics in Microbiology and Immunology 245:73-99.

109

69. Valle, A., C. E. Zuber, T. Defrance, O. Djossou, M. De Rie, and J. Banchereau. 1989. Activation of human B lymphocytes through CD40 and interleukin 4. European Journal of Immunology 19:1463-1467.

70. Foy, T. M., A. Aruffo, J. Bajorath, J. E. Buhlman, and R. J. Noelle. 1996. Immune regulation by CD40 and its ligand gp39. Ann.Rev.Immunol. 14:591-617.

71. Hostager, B. S., I. M. Catlett, and G. A. Bishop. 2000. Recruitment of CD40 and Tumor Necrosis Factor Receptor-associated Factors 2 and 3 to Membrane Microdomains during CD40 Signaling. J Biol Chem 275:15392-15398.

72. Inui, S., T. Kaisho, H. Kikutani, I. Stamenkovic, S. B., C. E. A., and K. T. 1990. Identification of the Intracytoplasmic Region Essantial for Signal Transduction Through a B Cell Activation Molecule, CD40. European Journal of Immunology 20:1747-1753.

73. Hostager, B. S., and G. A. Bishop. 2002. Role of TNF receptor-associated factor 2 in the activation of IgM secretion by CD40 and CD120b. J Immunol 168:3318- 3322.

74. Warren, W. D., K. L. Roberts, L. A. Linehan, and M. T. Berton. 1999. Regulation of the germline immunoglobulin Cgamma1 promoter by CD40 ligand and IL-4: dual roel for tandem NF-kappaB binding sites. Molecular Immunology 36:31-44.

75. Iciek, L. A., S. A. Delphin, and J. Stavnezer. 1997. CD40 cross-linking induces Ig epsilon germline transcripts in B cells via activation of NF-kB: synergy with IL-4 induction. J.Immunol. 158:4769-4779.

76. Lin, S. C., H. H. Wortis, and J. Stavnezer. 1998. The ability of CD40L, but not lipopolysaccharide, to initate immunoglobulun switching to immunoglobulin G1 is explanied by differential induction of NF-kappaB/Rel proteins. Mol.Cell.Biol. 18:5523-5532.

77. Berberich, I., G. Shu, F. Siebelt, J. R. Woodgett, J. M. Kyriakis, and E. A. Clark. 1996. Cross-linking CD40 on B cells preferentially induces stress-activated protein kinase rather then mitogen-activated protein kinases. EMBO J. 15:92-101.

78. Sakata, N., H. Patel, N. Terada, A. Aruffo, G. L. Johnson, and E. W. Gelfand. 1995. Selective activation of c-jun kinase mitogen-activated protein kinase by CD40 in human B cells. J Biol Chem 270:30823-30828.

79. Sutherland, C. L., A. W. Heath, S. L. Pelech, P. R. Young, and M. R. Gold. 1996. Differential activation of the ERK, JNK, and p38 mitogen-activated protein kinases by CD40 and the B cell antigen receptor. J. Immunol. 157:3381-3390.

110

80. Dadgostar, H., B. Zarnegar, A. Hoffmann, X. F. Qin, U. Truong, G. Rao, D. Baltimore, and G. Cheng. 2002. Cooperation of multiple signaling pathways in CD40-regulated gene expression in B lymphocytes. Proc Natl Acad Sci U S A 99:1497-1502.

81. Freeman, G. J., A. S. Freedman, J. M. Segil, G. Lee, J. F. Whitman, and L. M. Nadler. 1989. B7, a new member of the Ig superfamily with unique expression on activated and neoplastic B cells. J Immunol 143:2714-2722.

82. Freeman, G. J., J. G. Gribben, V. A. Boussiotis, J. W. Ng, V. A. Restivo, Jr., L. A. Lombard, G. S. Gray, and L. M. Nadler. 1993. Cloning of B7-2: a CTLA-4 counter-receptor that costimulates human T cell proliferation. Science 262:909- 911.

83. Azuma, M., D. Ito, K. Okumara, J. H. Phillips, L. L. Lanier, and C. Somoza. 1993. B70 antigen is a second ligand for CTLA-4 and CD28. Nature 366:76-79.

84. Koulova, L., E. A. Clark, G. Shu, and B. Dupont. 1991. The CD28 ligand B7/BB1 provides costimulatory signal for alloactivation of CD4+ T cells. J.Exp.Med. 173:759-762.

85. Roy, M., A. Aruffo, J. Ledbetter, P. Linsley, M. Kehry, and R. Noelle. 1995. Studies on the interdependence of gp39 and B7 expression and function during antigen-specific immune responses. Eur.J.Immunol. 25:596-603.

86. Stack, R. M., D. J. Lenschow, G. S. Gray, J. A. Bluestone, and F. W. Fitch. 1994. IL-4 treatment of small splenic B cells induces costimulatory molecules B7-1 and B7-2. J.Immunol. 152:5723-5733.

87. Hathcock, K. S., G. Laszlo, H. B. Dickler, J. Bradshaw, P. Linsley, and R. J. Hodes. 1993. Identification of an alternative CTLA-4 ligand costimulatory for T cell activation. Science 262:905-907.

88. Lenschow, D. J., G. H. T. Su, L. A. Zuckerman, N. Nabavi, C. L. Jellis, G. S. Gray, J. Miller, and J. A. Bluestone. 1993. Expression and functional significance of an additional ligand for CTLA-4. Proc.Natl.Acad.Sci.USA 90:11054-11058.

89. Kasprowicz, D. J., A. P. Kohm, M. T. Berton, A. J. Chruscinski, A. H. Sharpe, and V. M. Sanders. 2000. Stimulation of the B cell receptor, CD86 (B7-2), and the beta-2-adrenergic receptor intrinsically modulates the level of IgG1 produced per B cell. J.Immunol. 165:680-690.

111 90. Kohm, A. P., A. Mozaffarian, and V. M. Sanders. 2002. B cell receptor- and beta- 2-adrenergic receptor-induced regulation of B7-2 (CD86) expression in B cells. J.Immunol. 168:6314-6322.

91. Li, J., Z. Liu, S. Jiang, R. Cortesini, S. Lederman, and N. Suciu-Foca. 1999. T suppressor lymphocytes inhibit NF-kappa B-mediated transcription of CD86 gene in APC. J.Immunol. 163:6386-6692.

92. Linsley, P. S., and J. A. Ledbetter. 1993. The role of the CD28 receptor during T cell responses to antigen. Ann.Rev.Immunol. 11:191-212.

93. Shahinian, A., K. Pfeffer, K. P. Lee, T. M. Kundig, K. Kishihara, A. Wakeham, K. Kawai, P. S. Ohashi, C. B. Thompson, and T. W. Mak. 1993. Differential T cell costimulatory requirements in CD28-deficient mice. Science 261:609-612.

94. Borriello, F., M. P. Sethna, S. D. Boyd, A. N. Schweitzer, E. A. Tivol, D. Jacoby, T. B. Strom, E. M. Simpson, G. J. Freeman, and A. H. Sharpe. 1997. B7-1 and B7-2 have overlapping, critical roles in immunoglobulin class switching and germinal center formation. Immunity 6:303-313.

95. Hathcock, K. S., and R. J. Hodes. 1996. Role of the CD28-B7 costimulatory pathways in T cell-dependent B cell responses. Adv.Immunol. 62:131-166.

96. Podojil, J. R., and V. M. Sanders. 2003. Selective regulation of mature IgG1 transcription by CD86 and beta2-adrenergic receptor stimulation. J.Immunol. 170:5143-5151.

97. Jeannin, P., Y. Delneste, S. Lecoanet-Henchoz, J.-F. Gauchat, J. Ellis, and J.-Y. Bonnefoy. 1997. CD86 (B7-2) on Human B cells: A functional role in proliferation and selective differentiation into IgE- and IgG4-producing cells. J.Biol.Chem. 272:15613-15619.

98. Suvas, S., V. Singh, S. Sahdev, H. Vohra, and J. A. Agrewala. 2002. Distinct role of CD80 and CD86 in the regulation of the activation of B cell and B cell lymphoma. J.Biol.Chem. 277:7766-7775.

99. Sahoo, N. C., K. V. Rao, and K. Natarajan. 2002. CD80 expression is induced on activated B cells following stimulation by CD86. Scand J Immunol 55:577-584.

100. Podojil, J. R., N. W. Kin, and V. M. Sanders. 2004. CD86 and beta2-adrenergic receptor signaling pathways, respectively, increase Oct-2 and OCA-B Expression and binding to the 3'-IgH enhancer in B cells. J.Biol.Chem 279:23394-23404.

101. Yamamoto, Y., and R. B. Gaynor. 2004. IkappaB kinases: key regulators of the NF-kappaB pathway. Trends Biochem. Sci. 29:72-79.

112

102. Alt, F. W., E. M. Oltz, F. Young, J. Gorman, G. Taccioli, and Chen.J. 1992. VDJ recombination. Immunol. Today 13:306-314.

103. Khamlichi, A. A., E. Pinaud, C. Decourt, C. Chauveau, and M. Cogne. 2000. The 3' IgH regulatory region: a complex structure in a search for a function. Adv. Immunol. 75:317-345.

104. Stevens, S., J. Ong, U. Kim, L. A. Eckhardt, and R. G. Roeder. 2000. Role of OCA-B in 3'-IgH enhancer function. J.Immunol. 164:5306-5312.

105. Pinaud, E., A. A. Khamlichi, C. Le Morvan, M. Drouet, V. Nelsso, M. Le Bert, and M. Cogne. 2001. Localization of the 3' IgH locus elements that effect long- distance regulation of class switching recombination. Immunity 15:187-199.

106. Sepulveda, M. A., A. V. Emelyanov, and B. K. Birshtein. 2004. NF-kappa B and Oct-2 synergize to activate the human 3' Igh hs4 enhancer in B cells. J Immunol 172:1054-1064.

107. Staudt, L. M., R. G. Clerc, H. Singh, J. H. LeBowitz, P. A. Sharp, and D. Baltimore. 1988. Cloning of a lymphoid-specific cDNA encoding a protein binding the regulatory octamer DNA motif. Science 241:577-580.

108. He, X., M. N. Treacy, D. M. Simmons, H. A. Ingraham, L. W. Swanson, and M. G. Rosenfeld. 1989. Expression of a large family of POU-domain regulatory genes in mammalian brain development. Nature 340:35-41.

109. Staudt, L. M., H. Singh, R. Sen, T. Wirth, P. A. Sharp, and D. Baltimore. 1986. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature 323:640-643.

110. Ninkina, N. N., V. L. Buchman, A. N. Akopian, S. N. Lawson, M. Yamamoto, E. Campbell, L. Corcoran, and J. N. Wood. 1995. Nerve growth factor-regulated properties of sensory neurones in Oct-2 null mutant mice. Brain Res Mol Brain Res 33:233-244.

111. Corcoran, L. M., and M. Karvelas. 1994. Oct-2 is required in T cell-independent B cell activation for G1 progression and for proliferation. Immunity 1:635-645.

112. Humbert, P. O., and L. M. Corcoran. 1997. Oct-2 gene disruption eliminates the peritoneal B-1 lymphocytes linage and attenuates B-2 cell maturation and function. J.Immunol. 159:5273-5285.

113 113. Bendall, H. H., D. C. Scherer, C. R. Edson, D. W. Ballard, and E. M. Oltz. 1997. Transcription factor NF-kappaB regulates inducible Oct-2 gene expression in precursor B lymphocytes. J. Biol. Chem. 272:28826-28828.

114. Tang, H., and P. A. Sharp. 1999. Transcriptional regulation of the murine 3' IgH enhancer by OCT-2. Immunity 11:517-526.

115. Michaelson, J. S., M. Singh, C. M. Snapper, W. C. Sha, D. Baltimore, and B. K. Birshtein. 1996. Regulation of 3' IgH enhancers by a common set of factors, including kappa B-binding proteins. J Immunol 156:2828-2839.

116. Haughton, G., L. W. Arnold, G. A. Bishop, and T. J. Mercolino. 1986. The CH series of murine B cell lymphomas: Neoplastic analogues of Ly-1+ normal B cells. Immunol.Rev. 93:35-51.

117. Shi, X., and L. A. Eckhardt. 2001. Deletional analyses reveal an essential role for the hs3b/hs4 IgH 3' enhancer pair in an Ig-secreting but not an earlier-stage B cell line. Int Immunol 13:1003-1012.

118. Kane, L. P., V. S. Shapiro, D. Stokoe, and A. Weiss. 1999. Induction of NF- kappaB by the Akt/PKB kinase. Curr Biol 9:601-604.

119. Malinin, N. L., M. P. Boldin, A. V. Kovalenko, and D. Wallach. 1997. MAP3K- related kinase involved in NF-kappaB induction by TNF, CD95 and IL-1. Nature 385:540-544.

120. Alessi, D. R., M. Deak, A. Casamayor, F. B. Caudwell, N. Morrice, D. G. Norman, P. Gaffney, C. B. Reese, C. N. MacDougall, D. Harbison, A. Ashworth, and M. Bownes. 1997. 3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural and functional homology with the Drosophila DSTPK61 kinase. Curr Biol 7:776-789.

121. Marshall, A. J., H. Niiro, T. J. Yun, and E. A. Clark. 2000. Regulation of B-cell activation and differentiation by the phosphatidylinositol 3-kinase and phospholipase Cgamma pathway. Immunol Rev 176:30-46.

122. Berridge, M. J. 1993. Inositol triphosphate and calcium signaling. Nature 361:315-322.

123. Rhee, S. G., and Y. S. Bae. 1997. Regulation of phosphoinositide-specific phospholipase C isozymes. J Biol Chem 272:15045-15048.

124. Berberich, I., G. L. Shu, and E. A. Clark. 1994. Cross-linking CD40 on B cells rapidly activates nuclear factor-kappa B. J.Immunol. 153:4357-4466.

114 125. Chauveau, C., E. Pinaud, and M. Cogne. 1998. Synergies between regulatory elements of the immunoglobulin heavy chain locus and its palindromic 3' locus control region. Eur J Immunol 28:3048-3056.

126. Lumsden, J. M., J. A. Williams, and R. J. Hodes. 2003. Differential requirements for expression of CD80/86 and CD40 on B cells for T-dependent antibody responses in vivo. J Immunol 170:781-787.

127. Kin, N. W., and V. M. Sanders. 2006. CD86 Stimulation on a B Cell Activates the Phosphatidylinositol 3-Kinase/Akt and Phospholipase C{gamma}2/Protein Kinase C{alpha}beta Signaling Pathways. J Immunol 176:6727-6735.

128. Baban, B., A. M. Hansen, P. R. Chandler, A. Manlapat, A. Bingaman, D. J. Kahler, D. H. Munn, and A. L. Mellor. 2005. A minor population of splenic dendritic cells expressing CD19 mediates IDO-dependent T cell suppression via type I IFN signaling following B7 ligation. Int Immunol 17:909-919.

129. Del Nagro, C. J., D. C. Otero, A. N. Anzelon, S. A. Omori, R. V. Kolla, and R. C. Rickert. 2005. CD19 function in central and peripheral B-cell development. Immunol Res 31:119-131.

130. Wang, Y., S. R. Brooks, X. Li, A. N. Anzelon, R. C. Rickert, and R. H. Carter. 2002. The physiologic role of CD19 cytoplasmic tyrosines. Immunity 17:501-514.

131. Fujimoto, M., J. C. Poe, P. J. Jansen, S. Sato, and T. F. Tedder. 1999. CD19 Amplifies B Lymphocyte Signal Transduction by Regulating Src- Family Protein Tyrosine Kinase Activation. J.Immunol. 162:7088-7094.

132. Xu, Y., K. W. Harder, N. D. Huntington, M. L. Hibbs, and D. M. Tarlinton. 2005. Lyn tyrosine kinase: accentuating the positive and the negative. Immunity 22:9- 18.

133. Orabona, C., U. Grohmann, M. L. Belladonna, F. Fallarino, C. Vacca, R. Bianchi, S. Bozza, C. Volpi, B. L. Salomon, M. C. Fioretti, L. Romani, and P. Puccetti. 2004. CD28 induces immunostimulatory signals in dendritic cells via CD80 and CD86. Nat Immunol 5:1134-1142.

134. Horwitz, B. H., P. Zelazowski, Y. Shen, K. M. Wolcott, M. L. Scott, D. Baltimore, and C. M. Snapper. 1999. The p65 subunit of NF-kappa B is redundant with p50 during B cell proliferative responses, and is required for germline CH transcription and class switching to IgG3. J Immunol 162:1941-1946.

135. Datta, S. R., H. Dudek, X. Tao, S. Masters, H. Fu, Y. Gotoh, and M. E. Greenberg. 1997. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231-241.

115

136. Cardone, M. H., N. Roy, H. R. Stennicke, G. S. Salvesen, T. F. Franke, E. Stanbridge, S. Frisch, and J. C. Reed. 1998. Regulation of cell death protease caspase-9 by phosphorylation. Science 282:1318-1321.

137. Biggs, W. H., 3rd, J. Meisenhelder, T. Hunter, W. K. Cavenee, and K. C. Arden. 1999. Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc Natl Acad Sci U S A 96:7421-7426.

138. Weil, R., and A. Israel. 2004. T-cell-receptor- and B-cell-receptor-mediated activation of NF-kappaB in lymphocytes. Curr Opin Immunol 16:374-381.

139. Lenschow, D. J., T. L. Walunas, and J. A. Bluestone. 1996. CD28/B7 system of T cell costimulation. Ann.Rev.Immunol. 14:233-258.

140. Freeman, G. J., F. Borriello, R. J. Hodes, H. Reiser, J. G. Gribben, J. W. Ng, J. Kim, J. M. Goldberg, K. Hathcock, G. Laszlo, L. A. Lombard, S. Wang, G. S. Gray, L. M. Nadler, and A. H. Sharpe. 1993. Murine B7-2, an alternative CTLA4 counter-receptor that costimulates T cell proliferation abd interleukin 2 production. J. Exp. Med. 178:2185-2192.

141. Zhang, X., J. C. Schwartz, S. C. Almo, and S. G. Nathenson. 2003. Crystal structure of the receptor-binding domain of human B7-2: insights into organization and signaling. Proc Natl Acad Sci U S A 100:2586-2591.

142. Bhatia, S., M. Edidin, S. C. Almo, and S. G. Nathenson. 2005. Different cell surface oligomeric states of B7-1 and B7-2: implications for signaling. Proc Natl Acad Sci U S A 102:15569-15574.

143. Razi-Wolf, Z., G. J. Freeman, F. Galvin, B. Benacerraf, and L. M. Nadler. 1992. Expression and function of the murine B7 antigen, the major costimulatory molecule expressed by peritoneal exudate cells. Proc.Natl.Acad.Sci.USA 89:4214- 4210.

144. Zhao, J., G. J. Freeman, G. S. Gray, L. M. Nadler, and L. H. Glimcher. 1996. A cell type-specific enhancer in the human B7.1 gene regulated by NF-kappaB. J Exp Med 183:777-789.

145. Gross, J. A., E. Callas, and J. P. Allison. 1992. Identification and distribution of the costimulatory receptor CD28 in the mouse. J.Immunol. 149:380-388.

146. Linsley, P. S., W. Bardy, M. Urnes, L. S. Grosmaire, N. K. Damle, and J. A. Ledbetter. 1991. CTLA-4 is a second receptor for the B cell activation antigen B7. J.Exp.Med. 174:561-569.

116

147. Sharpe, A. H., and G. J. Freeman. 2002. The B7-CD28 superfamily. Nature Reviews Immunology 2:116-126.

148. Stokoe, D., L. R. Stephens, T. Copeland, P. R. Gaffney, C. B. Reese, G. F. Painter, A. B. Holmes, F. McCormick, and P. T. Hawkins. 1997. Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B. Science 277:567-570.

149. Gardby, E., X. J. Chen, and N. Y. Lycke. 2001. Impaired CD40-signalling in CD19-deficient mice selectively affects Th2-dependent isotype switching. Scand J Immunol 53:13-23.

150. Sato, S., A. S. Miller, M. C. Howard, and T. F. Tedder. 1997. Regulation of B lymphocyte development and activation by the CD19/CD21/CD81/Leu 13 complex requires the cytoplasmic domain of CD19. J Immunol 159:3278-3287.

151. Rickert, R. C., K. Rajewsky, and J. Roes. 1995. Impairment of T-cell-dependent B-cell responses and B-1 cell development in CD19-deficient mice. Nature 376:352-355.

152. Baccam, M., and G. A. Bishop. 1999. Membrane-bound CD154, but not CD40- specific antibody, mediates NF-kappaB-independent IL-6 production in B cells. Eur J Immunol 29:3855-3866.

153. Pongratz, G., J. W. McAlees, D. H. Conrad, R. S. Erbe, K. M. Haas, and V. M. Sanders. 2006. The Level of IgE Produced by a B Cell Is Regulated by Norepinephrine in a p38 MAPK- and CD23-Dependent Manner. J Immunol 177:2926-2938.

154. Buhl, A. M., C. M. Pleiman, R. C. Rickert, and J. C. Cambier. 1997. Qualitative regulation of B cell antigen receptor signaling by CD19: selective requirement for PI3-kinase activation, inositol-1,4,5-trisphosphate production and Ca2+ mobilization. J Exp Med 186:1897-1910.

155. Tuveson, D. A., R. H. Carter, S. P. Soltoff, and D. T. Fearon. 1993. CD19 of B cells as a surrogate kinase insert region to bind phosphatidylinositol 3-kinase. Science 260:986-989.

156. Matsumoto, A. K., J. Kopicky-Burd, R. H. Carter, D. A. Tuveson, T. F. Tedder, and D. T. Fearon. 1991. Intersection of the complement and immune systems: a signal transduction complex of the B lymphocyte-containing complement receptor type 2 and CD19. J Exp Med 173:55-64.

117 157. Matsumoto, A. K., D. R. Martin, R. H. Carter, L. B. Klickstein, J. M. Ahearn, and D. T. Fearon. 1993. Functional dissection of the CD21/CD19/TAPA-1/Leu-13 complex of B lymphocytes. J Exp Med 178:1407-1417.

158. Bobbitt, K. R., and L. B. Justement. 2000. Regulation of MHC class II signal transduction by the B cell coreceptors CD19 and CD22. J Immunol 165:5588- 5596.

159. Yazawa, N., M. Fujimoto, S. Sato, K. Miyake, N. Asano, Y. Nagai, O. Takeuchi, K. Takeda, H. Okochi, S. Akira, T. F. Tedder, and K. Tamaki. 2003. CD19 regulates innate immunity by the toll-like receptor RP105 signaling in B lymphocytes. Blood 102:1374-1380.

160. Petrie, R. J., P. P. Schnetkamp, K. D. Patel, M. Awasthi-Kalia, and J. P. Deans. 2000. Transient translocation of the B cell receptor and Src homology 2 domain- containing inositol phosphatase to lipid rafts: evidence toward a role in calcium regulation. J Immunol 165:1220-1227.

161. Cherukuri, A., P. C. Cheng, H. W. Sohn, and S. K. Pierce. 2001. The CD19/CD21 complex functions to prolong B cell antigen receptor signaling from lipid rafts. Immunity 14:169-179.

162. Pierce, S. K. 2002. Lipid rafts and B-cell activation. Nat Rev Immunol 2:96-105.

163. Meyer zum Bueschenfelde, C. O., J. Unternaehrer, I. Mellman, and K. Bottomly. 2004. Regulated recruitment of MHC class II and costimulatory molecules to lipid rafts in dendritic cells. J Immunol 173:6119-6124.

164. Delneste, Y., R. Bosotti, G. Magistrelli, J. Y. Bonnefoy, and J. F. Gauchat. 2000. Detection of a polymorphism in exon 8 of the human CD86 gene. Immunogenetics 51:762-763.

165. Marin, L. A., M. R. Moya-Quiles, M. Miras, M. Muro, A. Minguela, J. Bermejo, P. Ramirez, A. M. Garcia-Alonso, P. Parrilla, and M. R. Alvarez-Lopez. 2005. Evaluation of CD86 gene polymorphism at +1057 position in liver transplant recipients. Transpl. Immunol. 15:69-74.

166. Kasprowicz, D. J., A. P. Kohm, M. T. Berton, A. J. Chruscinski, A. Sharpe, and V. M. Sanders. 2000. Stimulation of the B cell receptor, CD86 (B7-2), and the beta 2-adrenergic receptor intrinsically modulates the level of IgG1 and IgE produced per B cell. J Immunol 165:680-690.

167. Fine, D. P., J. L. Kirk, G. Schiffman, J. E. Schweinle, and J. C. Guckian. 1988. Analysis of humoral and phagocytic defenses against Streptococcus pneumoniae serotypes 1 and 3. J. Lab. Clin. Med. 112:487-497.

118

168. Abdallah, A. M., E. A. Renzoni, S. Anevlavis, A. L. Lagan, F. M. Munkonge, C. Fonseca, C. M. Black, D. Briggs, A. U. Wells, S. E. Marshall, N. McHugh, R. M. du Bois, and K. I. Welsh. 2006. A polymorphism in the promoter region of the CD86 (B7.2) gene is associated with systemic sclerosis. Int J Immunogenet 33:155-161.

169. Brooks, S. R., P. M. Kirkham, L. Freeberg, and R. H. Carter. 2004. Binding of cytoplasmic proteins to the CD19 intracellular domain is high affinity, competitive, and multimeric. J Immunol 172:7556-7564.

170. Xu, Y., S. J. Beavitt, K. W. Harder, M. L. Hibbs, and D. M. Tarlinton. 2002. The activation and subsequent regulatory roles of Lyn and CD19 after B cell receptor ligation are independent. J Immunol 169:6910-6918.

171. Okada, T., A. Maeda, A. Iwamatsu, K. Gotoh, and T. Kurosaki. 2000. BCAP: the tyrosine kinase substrate that connects B cell receptor to phosphoinositide 3- kinase activation. Immunity 13:817-827.

172. Inabe, K., and T. Kurosaki. 2002. Tyrosine phosphorylation of B-cell adaptor for phosphoinositide 3-kinase is required for Akt activation in response to CD19 engagement. Blood 99:584-589.

173. Qin, S., and P. B. Chock. 2003. Implication of phosphatidylinositol 3-kinase membrane recruitment in hydrogen peroxide-induced activation of PI3K and Akt. Biochemistry 42:2995-3003.

174. Yamazaki, T., K. Takeda, K. Gotoh, H. Takeshima, S. Akira, and T. Kurosaki. 2002. Essential immunoregulatory role for BCAP in B cell development and function. J Exp Med 195:535-545.

175. Nishida, K., Y. Yoshida, M. Itoh, T. Fukada, T. Ohtani, T. Shirogane, T. Atsumi, M. Takahashi-Tezuka, K. Ishihara, M. Hibi, and T. Hirano. 1999. Gab-family adapter proteins act downstream of cytokine and growth factor receptors and T- and B-cell antigen receptors. Blood 93:1809-1816.

176. Ingham, R. J., L. Santos, M. Dang-Lawson, M. Holgado-Madruga, P. Dudek, C. R. Maroun, A. J. Wong, L. Matsuuchi, and M. R. Gold. 2001. The Gab1 docking protein links the b cell antigen receptor to the phosphatidylinositol 3-kinase/Akt signaling pathway and to the SHP2 tyrosine phosphatase. J Biol Chem 276:12257- 12265.

177. Ingham, R. J., M. Holgado-Madruga, C. Siu, A. J. Wong, and M. R. Gold. 1998. The Gab1 protein is a docking site for multiple proteins involved in signaling by the B cell antigen receptor. J Biol Chem 273:30630-30637.

119

178. Zhu, Q. S., L. J. Robinson, V. Roginskaya, and S. J. Corey. 2004. G-CSF-induced tyrosine phosphorylation of Gab2 is Lyn kinase dependent and associated with enhanced Akt and differentiative, not proliferative, responses. Blood 103:3305- 3312.

179. Dal Porto, J. M., S. B. Gauld, K. T. Merrell, D. Mills, A. E. Pugh-Bernard, and J. Cambier. 2004. B cell antigen receptor signaling 101. Mol Immunol 41:599-613.

120