UNIVERSITY OF CINCINNATI

Date:______

I, ______, hereby submit this work as part of the requirements for the degree of: in:

It is entitled:

This work and its defense approved by:

Chair: ______

Cultivation, overabundance, and establishment potential in the emerging invasive Pyrus

calleryana

A dissertation submitted to the

Graduate School

Of the University of Cincinnati

In partial fulfillment of the requirements for the degree of

Doctor of Philosophy

In the Department of Biological Sciences

Of the McMicken College of Arts and Sciences

By

Nicole A. Hardiman

B.A., Biological Sciences

University of Arkansas, Fayetteville, Arkansas, May 2000

Committee Chair: Dr. Theresa M. Culley

ABSTRACT

Pyrus calleryana is an emerging invasive species that appears to have had a recent and rapid increase in the rate of population spread. The species is a very popular ornamental tree, with as many as 29 different cultivated varieties. The species was originally thought to be of little invasive potential due to its genetically-controlled self-incompatibility mechanism and clonal propagation methods, so that cultivars were essentially clones of the same source tree.

Virtually unknown as an invasive ten years ago, naturalized populations have since been identified in 26 states. Genetic analyses show that cultivars are highly genetically structured and are polymorphic at the self-incompatibility locus. Invasive trees were also highly admixed hybrid progeny of these different cultivars. In cross-pollination experiments, all cultivars were capable of freely crossing, indicating all are functionally different at the self-incompatibility locus. Measures of reproductive and establishment ability were used to compare different cultivars and hybrid types in terms of an advantage in contribution to invasive populations. All groups were found to be highly fecund, have low mortality, and have high biomass accumulation. Invasive trees also produced greater numbers of seeds than cultivated individuals, indicating that invasive populations may have an increasing rate of spread due to high reproductive output. Cultivated populations, therefore, appear to be the source for invasive populations, and invasive populations are self-sustaining and composed of highly productive individuals. In the case of the Callery pear, availability of multiple cultivar types and widespread horticultural use seems to have allowed the species to not only naturalize, but also increase reproductive output.

ii

iii

ACKNOWLEDGMENTS

I would like to thank my advisor, Theresa Culley, for her assistance, availability, guidance, and support. When trying to explain my relationship with Theresa, I have described her as “somewhere between a boss and a friend”, to which I later realized perfectly describes a mentor. My Research Advisory Committee, Ken Petren, Steven Rogstad, Sarena Selbo, and Jodi

Shann, provided time, valuable discussion and feedback, and guidance. Their involvement not only improved my project, but also my personal development. Through many, many group discussions and one-on-one sessions, they have fundamentally altered who I am as a biologist and as a professional. Ed Romero also provided many, many hours of field assistance, helpful discussion, moral support, and professional support.

Thanks to several present and past graduate students for helpful feedback, discussions, and recreational pursuits. Thanks to Margie Becus, Tom Fulcher, Brian Baumgartner, and Jan

Haldeman for population identification. Funding sources include the U.S. Department of

Agriculture, the University of Cincinnati Research Council, the Department of Biological

Sciences, and the Botanical Society of America. Laboratory and field assistance was provided by Jessica Brzyski, Matt Klooster, Sarah McCann, Tracy Reeb, Brian Robin, Tegan Smedley, and Richard Stokes. I would also like to thank Google, for being the best information search engine on the planet. Much of the background and supporting information was generated using

Google. It is an invaluable tool that I use approximately 20 times a day.

iv

TABLE OF CONTENTS

Abstract……………………………………………………………………………………….……….…ii

Acknowledgements………………………………………………………………………...………..…..iv

List of Table and Figures……………………………………………………………………………...…vi

Preface……………………………………………………………………………………………….....xiii

Chapter 1: General Introduction…………………………………………………………………...……..1

Chapter 2: Cultivation and invasive potential: genetic evidence for intraspecific hybridization in Pyrus calleryana…………………………………………………………………………………….…24 Abstract……………………………………………………………………………..…………..25 Introduction………………………………………………………………………..…………....26 Materials and Methods……………………………………………………………..…………. .29 Results……………………………………………………………………………..…………....34 Discussion……………………………………………………………………………..………..38 References Cited……………………………………………………………………….………..43 Figure Legends………………………………………………………………………………….48

Chapter 3: Reproductive success of cultivated Pyrus calleryana and establishment ability of invasive, hybrid progeny……………………………………………………………...... 58 Abstract………………………………………………………………………………………....59 Introduction……………………………………………………………………………...... 60 Materials and Methods………………………………………………………………………….63 Results…………………………………………………………………………………...... 68 Discussion……………………………………………………………………………………....70 References Cited………………………………………………………………………………...76 Figure Legends………………………………………………………………………………….80

Chapter 4: The role of self-incompatibility in invasive potential of Pyrus calleryana………………....91 Abstract…………………...……………………………………………………………………92 Introduction…………………………………………………………………………………….93 Materials and Methods………………………………………………………………………....96 Results……………………………………………………………………………….. ……..100 Discussion……………………………………………………………………………...... 102 References Cited………………………………………………………………………. …….106 Figure Legends………………………………………………………………………………..112

Chapter 5: General Discussion…………………………….…………………………………………..121

Appendix 1…………………………………………………………………………………………….133

LIST OF TABLES AND FIGURES

Table 1.1: List of cultivars of Pyrus calleryana, including the year each became commercially available, the site of development, United States patent or trademark number, and the parental source, if known…...………………………………………………………………………………………………17

Table 2.1: Disease and pest susceptibilities, as well as environmental tolerances, of seven Pyrus calleryana cultivars……………………………………………………………………………………..20

Figure 1.1: Pictures of Pyrus calleryana (a) in cultivation and (b) in the wild. …………...…………...21

Figure 1.2: Locations of Pyrus calleryana seed collections by Francis Meyer and Frank Reimer across Asia………………………………………………………………….…………………………………..22

Table 2.1: Polymorphic microsatellite primers amplified in Pyrus calleryana…………………………49

Table 2.2: Descriptive population statistics for Pyrus calleryana cultivars and sampled populations…50

Table 2.3: Descriptive population statistics by locus across Pyrus calleryana cultivars of known type.51

Table 2.4. Coefficients for θ (below diagonal) and Nei's (1978; above diagonal) genetic identity for nine Pyrus calleryana cultivars……………………………………………………………..…………..52

Table 2.5: Frequency of diagnostic alleles for each cultivar in each invasive and putative parent population…...…………………………………………………………………………………………..53

Figure 2.1: Principle coordinates analysis comparing cultivars to putative parent and invasive populations of Pyrus calleryana...………………………………………………………………………55

Figure 2.3: (a) The number of cultivars found to contribute to each invasive individual‟s multi-locus genotype, based on diagnostic alleles for each cultivar found in the putative parent populations, and (b) the proportion of putative parent individuals who were identified as having more than one cultivar‟s diagnostic alleles………………………………………………………………..………………………56

Figure 2.4: The relationship between the average number of diagnostic alleles in invasive individuals and the LOD score………………………………………………………………………………………57

Table 3.1: Statistical analyses for cultivar reproductive measures and hybrid progeny establishment ability measures for Pyrus calleryana……………………………………………………………….…..……82

Table 3.2: Statistical analyses for reproductive ability for cultivated and invasive parents, and establishment ability measures between early-generation and late-generation hybrid progeny..………83

Table 3.3: Statistical analyses for ecophysiology measures between early-generation and late- generation hybrid progeny………………………………………………………………………………84

vi

Figure 3.1: Comparisons of maternal reproductive success characters, measured as fruit mass, seed mass, and seed viability, among Pyrus calleryana cultivar types………………………………………85

Figure 3.2: Comparisons of establishment ability, measured as percent germination, percent mortality and above and below-ground biomass, in early-generation hybrid progeny of Pyrus calleryana...……86

Figure 3.3: Photosynthetic and conductance rates, as well as water use efficiency (WUE) measured across early-generation hybrid types...………………………………………………………………….87

Figure 3.4: Comparisons of maternal reproductive success characters, measured as fruit mass, seed mass and seed viability, between cultivated parents of early generation hybrids and invasive parents of late generation hybrids………………………………………………………………………………….88

Figure 3.5: Comparisons of establishment ability, measured as percent germination, percent mortality and above and below-ground biomass, between early generation hybrids and late generation hybrids..89

Figure 3.6: Photosynthetic and conductance rates, as well as water use efficiency (WUE), comparing early-generation hybrid types versus later generation hybrid types…….………………………………90

Table 4.1: Genetic characterization for cultivars using the published C1/ C3 primer set and the designed nested C2/C3 primer set, including N (number of individuals), the fragment size in base pairs, and the assigned SI genotype…………..………………………………………………………………………113

Table 4.2: Descriptive statistics for Pyrus calleryana cultivars and invasive populations using the published C1/C3 primer set, including N (number of individuals), A (number of alleles), P (percent locus polymorphism), He (expected heterozygosity according to equilibrium assumptions, and Ho (observed heterozygosity)…..…………………………………………………………………………114

Figure 4.1: Gametophytic self-incompatibility system………………………………………………..115

Figure 4.2: Structure of pistil S-RNase locus as determined in almond (Ushijima 1998)…...………..116

Figure 4.3: Sequences for Pyrus calleryana „Bradford‟, „Cleveland‟, and „Redspire‟ cultivars aligned with Pyrus communis……………………………………………………………….…………………117

Figure 4.4: Results for the cross pollination experiment, indicating significantly greater fruit set in crosses between cultivars than other cross types………………………………………………………118

Figure 4.5: Percent fruit set for crosses between cultivars indicating no significant differences among cultivars as maternal sources or paternal sources…….…………………………..……………………119

vii

PREFACE

Bradford Pear

By Chris Chamberlain

You are the first to show off your gaudy spring plumage and then quickly fade to a formless dull blob.

Your sickly sweet cloying odor overwhelms and offends me

-masking the other more subtle aromas of the season that I treasure.

At the first sign of stress

Or w-i-n-d

You crack the middle

d

o

w

n

Leaving your previously sculptured symmetry hideously disfigured.

Yet, you are everywhere I look. Everywhere I look. Everywhere I look.

Apparently for some unknown reason everyone wants you around.

You are the Paris Hilton of trees.

viii

Chapter 1

General Introduction

Nicole A. Hardiman

Department of Biological Sciences

University of Cincinnati

614 Rieveschl Hall

Cincinnati, OH USA 45221-0006

Corresponding author - Email: [email protected], Tel:513-556-9705, Fax: 513-556-5299

1

Invasive Species Introduction

Invasive species have major economic and ecological impacts in North America, and are second only to habitat degradation in terms of endangerment to native species (Wilcove et al.1998). Invasive species, defined as non-indigenous species that have spread into the native flora and become dominant in that system (Reichard and While 2001), are estimated to cost $34 billion annually in damage to agricultural and natural areas (Pimentel et al. 2000). An estimated 5,000 introduced plant species have escaped and now exist in natural areas within the United States (Morse et al. 1995), with these species invading approximately 700,000 hectares of US wildlife habitat per year (Babbitt 1998). Numerous attempts have been made to predict invasive species based on certain traits (Kolar and Lodge 2001,

Rejmanek and Richardson 1996) and to identify habitats that are most likely to be invaded (Elton 1958,

Davis et al. 2001). Unfortunately, some introduced species only possess a subset of these traits and habitats appear to vary in susceptibility to invasion (Davis et al. 2005). Additionally, there is increasing evidence that species exhibit an increase in invasive tendencies following a prolonged lag period when the species was not previously invasive (Ewel et al. 1999). To effectively prevent and manage invasive species, it is important to identify the aggregate of factors, both pre and post-introduction, that contribute to the invasive potential of an introduced species.

Before a non-indigenous species becomes invasive, it experiences a lag period where self- sustaining populations establish but do not spread outside of small founder populations (Sakai et al.

2001). For introduced species that do not become invasive, spread is limited genetically, demographically (such as low population size), and/or ecologically. For species that do become invasive, it is during the lag phase that some aspect of population demography is altered, the time frame of which appears to be species-specific (Ewel et al. 1999). The transition to invasiveness may either be due to demographic factors (such as increasing propagule pressure following multiple introductions)

2

and/or evolutionary change in introduced population, both of which can result in an increased rate of spread. The necessary stimuli allowing these species to escape the limitations of the population bottleneck associated with founder populations and to subsequently spread outside of lag period populations is still being elucidated.

Multiple introductions of a species may serve to bring together different genotypes from native source populations, and there is a recognized connection between multiple introductions and genetic diversity (Kelly 2006). Genetically-differentiated, native populations can admix in new habitats, resulting in progeny with high genetic diversity relative to the initially introduced populations (Roman and Darling 2007, Bossdorf et al. 2005). Novel genetic combinations in the admixed progeny may result in the evolution of traits favoring invasion following introduction (Reznick and Ghalambor 2001,

Cox 2004). For example, many introduced plant species have been found to contain larger individuals with higher fecundity than conspecifics in their native range (Bossdorf et al. 2005).

One well-studied mechanism for the evolution of invasiveness associated with multiple introductions is hybridization (Ellstrand and Schierenbeck 2000). Hybridization could increase invasive potential by altering genetic variation and producing novel genotypes (Lee 2002) on which natural selection can act in the introduced environment. By acquiring beneficial genetic combinations, hybridization in introduced species may promote establishment success or increased fitness via improved adaptations to certain environments (Stebbins 1969). Intraspecific hybridization, or crossing between genetically differentiated populations, may act in a similar way to hybridization between species (Culley and Hardiman, in press). How novel genetic combinations promote invasiveness may provide insight into how species respond to rapid change in novel habitat conditions.

From a demographic perspective, multiple introductions may increase the standing propagule pressure in the introduced environment, such that the increased occurrence of a species positively

3

correlates to the likelihood of naturalization and establishment (Barrett and Husband 1990, Van Holle and Simberloff 2005). Various types of introduction events may also serve to alter the overall inoculation size of exotic species. These include numerous primary introductions from across the native range (Kolbe et al. 2004) and through secondary introductions that occur via commercial distribution channels (Kowarick 2003). The lack of population expansion during the lag phase could be explained by Allee effects, which limit the growth rate of populations because of restricted population size or density (Stephens et al. 1999). After a sufficient number of introduction events have occurred, the

Allee effect is weakened, resulting in an increased rate of spread (Cohen and Carlton 1998).

Cultivation is one of many mechanisms by which human-mediated activity influences propagule pressure in a non-indigenous species, and the practice of cultivation has been found to influence the invasive potential of introduced species (Kitajima et al. 2006). Although many horticultural species do not become invasive, commercial availability of cultivated species serves to increase the number and geographic distribution of introduction events (Mack 2000, Kowarik 2003). Increases in population growth in these species could be the result of overcoming demographic limitations on reproduction via widespread commercial distribution. Another possibility is that cultivation could be a special case of hybridization, where invasive potential evolves in hybridized progeny via genetic variation present across many types of cultivars. Thus, the development of multiple cultivars may serve to increase the amount of available genetic diversity within invasive progeny. Genetic diversity among cultivars may either reflect the genetic diversity found among structured populations in the native region, or may be the result of artificial selection for traits such as abundant flower production, environmental tolerance, and disease or pest resistance after introduction. These selection regimes may ultimately serve to increase the invasive potential of cultivated species (Barrett 1983) via either altered invasive potential in the cultivar or hybridized progeny which are genetically diverse relative to their cultivated parents.

4

The ornamental tree Pyrus calleryana (Figure 1.1) is a model species to study how cultivation influences invasiveness. This Asian species has been introduced to the United States for over 100 years, but invasive populations have been only recently been identified. The species appears to be in the early stages of invasion, with rapidly spreading populations and the number of new populations currently on the rise.

Pyrus calleryana Introduction and Cultivation History

The species was first introduced to combat fire blight in the cultivated, edible pear, Pyrus communis. Fire blight is a pollinator-mediated sexually-transmitted disease caused by the bacterium

Erwinia amylovoria that is potentially fatal. In the early 1900‟s, fire blight had caused an estimated

86% annual crop loss in P. communis (Meyer 1918). Frank Reimer, a plant breeder at the Southern

Oregon Experiment Station, consequently began searching for fire blight-resistant Pyrus species to use in breeding programs and as rootstock for P. communis. Pyrus calleryana was discovered to be highly resistant to the disease and, at Reimer‟s request, the plant explorer Frank Meyer agreed to collect P. calleryana seed in China for further study (Cunningham 1984).

Meyer collected seed of P. calleryana from 1916 to 1918, primarily in and near Jīngmén and also Yichang (Cunningham 1984; Figure 1.2). George D. Schlosser, an American missionary in Henan province, also assisted Meyer in locating wild P. calleryana seed. In 1917, Reimer traveled to Asia, first locating P. calleryana in southern Japan and then in southern and central Korea. Later, Reimer joined Meyer in Jīngmén, where they collected P. calleryana fruits together and then proceeded to travel to the Yíchāng area. Additional accessions of cultivated seeds were purchased in Nánjīng, China in 1919. Reimer also made a second collection of P. calleryana in Shāndōng province in 1919

(Westwood 1980), and exploration and fruit collection of the species continued throughout the following decades.

5

Following import to the United States Plant Introduction Stations in Corvallis, Oregon and Glen

Dale, Maryland, Pyrus calleryana seeds were screened for fire blight resistance. This involved large outplantings of seed and inoculating the resulting seedlings to determine their susceptibility to fire blight. In 1952, John Creech, a breeder at the Maryland Introduction Station, first recognized the ornamental potential of the species after finding a single tree with compact growth form, many flowers, and attractive leaves (Creech 1973). He propagated the tree by grafting cuttings of it onto P. calleryana seedlings and eventually named it the „Bradford‟ cultivar (Whitehouse et al. 1963). Consequently, all individuals of this cultivar are expected to be genetically identical, barring any somatic mutations that may occur. The tree was introduced to commercial markets as a flowering ornamental in 1962 and was recognized for its abundant flowers, rapid growth, and compact growth form. The „Bradford‟ cultivar became one of the most widely-planted street trees in the eastern United States.

Several additional Pyrus calleryana cultivars originated at the Glenn Dale, MD station (Table

1.1; Culley and Hardiman 2007). In 1969, the „Whitehouse‟ cultivar was developed by William

Ackerman, a research horticulturalist at the United States National Arboretum. The original tree was an open-pollinated, thornless seedling resulting from a cross between „Bradford‟ and one of the many P. calleryana seedlings growing at the station. The National Arboretum also introduced the „Capital‟ cultivar in 1981, which is of unknown parentage. Cultivars were developed at the Oregon Introduction

Station near Reimer‟s original plantings. Melvin Westwood, developed the „Autumn Blaze‟ cultivar after he discovered a seedling with bright red fall leaf coloration (Westwood 1980), which originated from one of Reimer‟s original outplantings from his Chinese seed collecting expeditions (Westwood

1980). The tree was also clonally propagated by grafting onto seedling P. calleryana rootstock, and the practice continues to be the primary form of cultivar propagation today.

6

As Callery Pear cultivars were being developed and released, the original „Bradford‟ cultivar was found to be prone to splitting after 15-20 years of growth due to the presence of narrow crotch angles at the base of the central, leading branches. Upon commercial availability of Pyrus calleryana seeds, many private nurseries began developing and releasing their own cultivars that exhibited improved branching patterns (Kuser et al. 2001). The „Aristocrat‟ was developed and made commercially available by William T. Straw in 1969 from a large number of P. calleryana seedlings growing at his nursery near Independence, KY. The „Chanticleer‟ was cloned from a street tree in

Cleveland, OH, which originated from commercial seed purchased in 1946 (Santamour and McArdle

1983). One of the most popular Callery Pear cultivars today, „Chanticleer‟ was named the 2005 Urban

Tree of the Year by the Society of Municipal Arborists (Phillips 2004). Cultivar development continues today. For example, Lake County Nursery in Perry, Ohio continues to breed and release cultivars such as „Valzam‟, „Jaczam‟, „Jilzam‟, and „Princess‟. Ornamental pear trees planted in commercial and residential areas now contain multiple types of cultivars, many of which contain a variety of genotypes that may represent different parts of the native Asian range.

Reproduction and Floral Biology

Pyrus calleryana is a perennial tree that flowers in the early spring, prior to leaf formation. The species is one of the first trees to leaf out in the spring and retains its leaves until late autumn. Flowers appear as an inflorescence with approximately 6-12 flowers per inflorescence (Cuizhi and Spongberg

2003). Individual flowers are epigynous, about 2-2.5 cm in diameter, and consist of five sepals and five petals. The protandrous flowers also possess two sets of 10 anthers that sequentially dehisce and 2-5 carpels with two ovules per locule, giving a maximum seed number of ten (Cuizhi and Spongberg

2003). Flowers are attractive to a variety of pollinators, including honeybees (Apis mellifera L.), bumble bees (Bombus terrestris L.), and hover flies (Syrphidae; Farkas et al. 2002). Fruits mature in

7

early to late autumn (August to October), and are dispersed in late fall by a variety of animals, including birds such as starlings and American Robins (Gilman & Watson 1994; Swearingen et al.

2002).

Self-Incompatibility

As is common in the Rosaceae, P. calleryana is self-incompatible (Zielinski 1965), so it cannot produce fruits through self-pollination. Self incompatibility (SI) in Pyrus species is due to the genetically controlled system, called gametophytic SI, which is controlled by two linked genes controlling pollen identity and pistil RNase structure (deNattencourt 2001). In this system, if the haploid pollen tissue shares the same S-allele as the maternal plant, pollen tube growth is arrested by glycoproteins with ribonuclease activity (S-RNases) that degrade pollen RNA. Compatible crosses can only occur between haploid pollen and diploid maternal tissue that do not share an S allele, resulting in either semi-compatible or fully compatible crosses between parental individuals.

The invasive potential of Callery Pear cultivars was originally thought to be limited because they rarely produced viable fruit (Zielinksi 1965; Swearingen et al. 2002). More recently however, abundant fruit set has been detected in many cultivars growing in urban areas (Swearington et al. 2002), and an increase in fruit set has been documented after planting different cultivars together (Gilman and

Watson 1999). The increase in fruit formation likely reflects the diversity of different cultivars planted today that contain different SI genotypes (see Chapter 2).

Susceptibility to Herbivory and Environmental Tolerances

Traits contributing to the popularity of the Callery Pear as an ornamental include its resistance to disease and herbivory, and tolerance to a wide range of environmental conditions (Table 1.2). The species is highly resistant to two problematic insects: the Japanese beetle (Popillia japonica; Keathley et al. 1999), and gypsy moth larvae (Lymantria dispar; Peterson and Smitley 1991). Secondary

8

compounds present in the Pyrus calleryana leaves are thought to be the primary mechanism of resistance to herbivory (Morewood et al. 2004). The species is also resistant to wood-boring beetles

(Anoplophora glabripennis) by producing chemical compounds that interfere with normal beetle development (Morewood et al. 2004). Although herbivory of cultivated individuals by white-tailed deer and caterpillars has been observed (Kays et al. 2003), the species is capable of rapidly recovering from herbivory damage (N. Hardiman, personal observation). Pyrus calleryana can also successfully grow in many habitat conditions. The species thrives in moist or dry conditions, alkaline to neutral soil pH, and many soil types (Table 1.2; Gerhold 2000; Kuser et al. 2001). As Meyer (1918) noted, such tolerance reflects the wide habitat variation of the species in its native range, where it occurs in montane regions, riparian areas, pine savannah, and old fields. Despite potentially harsh environments,

Callery pear cultivars exhibit rapid growth and establishment, and can eventually become established shade trees.

Current Spread and Invasion

The first naturalized populations of the Callery pear were identified in Arkansas in 1964

(Vincent 2005). Since then, naturalized populations have been identified in 26 states. Approximately

50% of the identifications have occurred since 2000, and documentation of invasive populations in natural areas has been increasingly common (Stewart 1999; Swearington et al. 2002; Haldeman 2003;

Vincent 2005). Pyrus calleryana is currently listed as a plant invader of Mid-Atlantic natural areas by the US Fish and Wildlife (Swearingen et al. 2002), and is listed as invasive in six states: Alabama

(Alabama Invasive Plant Council 2006), Georgia (Georgia Exotic Pest Council 2006), North Carolina

(North Carolina Native Plant Society), Maryland (Anonymous 2006a), New Jersey (Campbell 2004), and Pennsylvania (Anonymous 2006b). It is on the watch list in Tennessee (Southwest Exotic Pest

9

Plant Council 2001), New York (Brooklyn Botanical Garden 2003), South Carolina (Haldeman et al.

2004) and Oklahoma (Anonymous 2006c).

Project Hypotheses

The goal for this research was to identify the factors contributing to the success of invasive species in introduced habitats. As these species alter ecosystem function and contribute to loss of biodiversity, it is important to identify and prevent introductions of new species that have the potential to become invasive. The objective for this research project was to understand the influence of intraspecific hybridization on genetic variation and population establishment ability using the newly invading species, Pyrus calleryana, as a model system. The central hypothesis was that hybridization between genetically-distinct cultivars of P. calleryana result in invasive populations, containing high genetic variability. The degree to which genetic variability has contributed to establishment success and reproductive capability, as well as the role of the SI system in affecting invasive potential, was also examined. The relative contribution of these factors was investigated via the following specific aims:

1. Determine the sources of locally invasive genotypes. The hypothesis was that sources of parental genotypes of invasive individuals are the „Bradford‟ and other cultivars that have been planted in the surrounding area. Genetic similarity within and among cultivars was determined, as well as the degree of hybridization in invasive progeny of cultivated individuals.

2. Examine the variation in establishment ability of cultivars and hybrid progeny. The hypothesis was that different cultivars would vary in degree of reproductive capability and establishment potential. Morphological characters associated with increased productivity were expected to be higher in specific parental cultivars, which would translate to an establishment advantage for that cultivar. In addition, invasive hybrid progeny were expected to have an establishment advantage over cultivar hybrid progeny.

10

3. Identify the role of the SI system in increased fruit set. The hypothesis was that Callery pear

cultivars are fixed for specific genotypes at the SI locus, and crossing between the cultivars is the cause

for increased fruit set. Invasive individuals‟ genotypes were expected to be heterozygous, comprised of

SI alleles from two different cultivars. The relationship between genetic similarity and reproductive

output between cultivars was also examined.

REFERENCES CITED

Alabama Invasive Plant Council (2006) List of Alabama's Invasive Plants by Land-Use and Water-Use

Sectors. Available at: http://www.se-eppc.org/alabama/ALIPCplantlist.pdf

Anonymous (2006a) Invasive species of concern in Maryland. Available at:

http://www.mdinvasivesp.org/list_terrestrial_plants.html

Anonymous (2006b) Invasive Exotic Plants In Pennsylvania List. Available at:

http://www.dcnr.state.pa.us/forestry/invasivetutorial/List.htm

Anonymous (2006c) Oklahoma non-native invasive plant species. Available at:

http://www.usao.edu/~onps/Invasives.pdf#search=%22%22pyrus%20calleryana%22%20watch%

22.

Babbitt B (1998) Statement by Secretary of the Interior on invasive alien species. National Weed

Symposium, Bureau of Land Management, April 1998, Denver, CO, pp. 8–10.

Barrett SCH (1983) Crop mimicry in weeds. Annual Review of Ecology and Systematics, 5, 1-25.

Barrett SCH & Husband BC (1990) In: Plant Population Genetics, Breeding, and Genetic Resources,

eds. Brown AHD, Clegg MT, Kahler AL, Weir BS (Sinauer, Sunderland, MA), pp. 254-278.

11

Bossdorf O, Auge H, Lafuma L, et al. (2005) Phenotypic and genetic differentiation between native and

introduced plant populations. Oecologia, 144, 1-11.

Brooklyn Botanical Garden (2003) The worst invasives in the New York metropolitan area. Available

online at: http://www.bbg.org/gar2/pestalerts/invasives/worst_nym.html

Campbell JM, Lawrence MJ (1981) The population genetics of the self-incompatibility polymorphism in

Papaver rhoeas. 1. The number and distribution of S-alleles in families from three localities.

Heredity, 46, 69-79.

Cohen AN and Carlton JT (1998) Accelerating invasion rate in a highly invaded estuary. Science, 279,

555-558.

Cox GW (2004) Alien Species and Evolution: The Evolutionary Ecology of Exotic Plants, Animals,

Microbes, and Interacting Native Species. Island Press, Washington.

Creech JL (1973) Ornamental plant introduction – Building on the past. Arnoldia, 33, 13-25.

Cuizhi G, Spongberg SA (2003) Pyrus. Flora of China, 9, 173-179.

Culley TM, Hardiman NA (2007) The beginning of a new invasive plant: a history of the ornamental

Callery pear in the United States. BioScience, 57, 956-964.

Culley TM, Hardiman NA (in press) The role of intraspecific hybridization in the evolution of

invasiveness: a case study of the ornamental pear tree Pyrus calleryana. Biological Invasions.

Cunningham IS (1984) Frank N. Meyer: Plant hunter in Asia. The Iowa State University Press, Ames,

IA.

Davis MA, Grime JP, Thompson K (2001) Fluctuating resources in plant communities: a general theory

of invisibility. Journal of Ecology, 88, 528 - 534.

Davis MA, Thomson K, Grime JP (2005) Invasibility: the local mechanisms driving community

assembly and species diversity. Ecography, 28, 696 – 704.

12

de Nettancourt D (2001) Incompatibility and incongruity in wild and cultivated plants. Springer, Berlin.

Ellstrand NC, Schierenbeck KA (2000) Hybridization as a stimulus for the evolution of invasiveness in

plants? Proceedings of the National Academy of Sciences, 97, 7043-7050.

Elton CS (1958) The Ecology of Invasion by Animals and Plants. University of Chicago Press, Chicago.

Ewel JJ, O‟Dowd DJ, Bergelson J et al. (1999) Deliberate introductions of species: research needs.

BioScience, 49, 619-630.

- (2002) Insect attraction of flowers in pear cultivars. In: (J Janick,

S Sansavini, M Tagliavini, D Sugar, AD Webster, eds.) Proceedings of the VIIIth International

Symposium on Pear, Acta Horticulturae n.596, ISHS. pp. 773-776.

Franklin M (2006) Invasive exotic species list. North Carolina Native Plant Society. Available at:

www.ncwildflower.org/invasive/list.htm

Georgia Exotic Pest Council (2006) List of non-native invasive plants in Georgia. Available at:

http://www.gaeppc.org/list.cfm

Gerhold HD (2000) Callery Pear cultivars tested as street trees: second report. Journal of Arboriculture,

26, 55-59.

Gilman EF, Watson DG (1994) Pyrus calleryana „Bradford‟: „Bradford‟ Callery pear. Fact Sheet ST-

537, Environmental Horticulture Department, Florida Cooperative Extensive Service, Institute of

Food and Agricultural Sciences, University of Florida.

Haldeman J (2003) Who let the pears out? Available at: http://www.scnps.org/articles/pears.html

Haldeman J, Nelson J, Glenn Km Roecker R (2004) SC Exotic Pest Plant Council Non-Native Invasive

Plant Species List. Available at: http://www.scswcs.org/invasiveplants.htm

Kays JS, Curtis L, Bartlett MV (2003) Resistance of ornamentals of deer damage. Maryland

Cooperative Extension Fact Sheet 655, University of Maryland, College Park.

13

Keathley CP, Potter DA, Houtz RL (1999) Freezing-altered palatability of the Bradford pear to Japanese

beetle: evidence for decompartmentalization and enzymatic degradation of feeding deterrents.

Entomological Experimentalis et Applicata, 90, 49-59.

Kelly DW et al. (2006) Contrasting patterns in genetic diversity following multiple invasions of fresh

and brackish waters. Molecular Ecology, 15, 3641-3652.

Kitajima K, Fox AM, Sato T, Nagamatsu D (2006) Cultivar selection prior to introduction may increase

invasiveness: Biological Invasions, 8, 1471-1482.

Kowarik I (2003) Human agency in biological invasions: secondary releases foster naturalization and

population expansion of alien plant species. Biological Invasions, 5, 293-312.

Kolbe JJ, Flor RE, Schettino LR et al. (2004) Genetic variation increases during biological invasion by a

Cuban lizard. Nature, 431, 177-181.

Kolar CS and Lodge DM (2001) Progress in invasion biology: predicting invaders. Trends in Ecology

and Evolution, 16, 199-204.

Kuser JE, Robinson G, Polanin N (2001) Four-year evaluation of five cultivars of Pyrus calleryana.

Journal of Arboriculture, 27, 88-91.

Lee CE (2002) Evolutionary genetics of invasive species. Trends in Ecology and Evolution, 17, 386-391.

Mack RN (2000) Cultivation fosters plant naturalization by reducing environmental stochasticity.

Biological Invasions, 2, 111-122.

Meyer FN (1918) Typescript of South China Explorations. Available from the Special Collections of the

National Agricultural Library online at

http://www.nal.usda.gov/speccoll/exhibits/meyer/meyer_typescript.html.

14

Morewood WD, Hoover K, Neiner PR, McNeil JR, Sellmer JC (2004) Host tree resistance against the

polyphagous wood-boring beetle Anoplophora glabripennis. Entomologia Experimentalis et

Applicata, 110, 79-86.

Morse LE, Kartesz JT, Kutner LS (1995) Native vascular plants. In: Our Living Resources: A Report to

the Nation of the Distribution, Abundance and Health of US Plants, Animals and Ecosystems.

Eds. LaRoe ET, Farris GS, Puckett CE, Doran PD, Mac MJ. Washington (DC), US Department

of the Interior, National Biological Service, pp. 205-209

Peterson NC, Smitley DR (1991) Susceptibility of selected shade and flowering tree to gypsy moth

(Lepidoptera: Lymantriidae). Journal of Economic Entomology, 84, 587-592.

Phillips L (2004) The 2005 urban tree of the year. City Trees, 40, 34-38.

Pimentel D, Lach L, Zuniga R, Morrison D (2000) Environmental and economic costs of non-

indigenous species iwwwn the United States. BioScience, 50, 53–65.

Reichard SH, White P (2001) Horticulture as a pathway of invasive plant introductions in the United

States. BioScience, 51, 103-113.

Rejmanek M, Richardson DM (1996) What attributes make some plant species more invasive? Ecology,

77, 1655–1661.

Reznick DN, Ghalambor CK (2001) The population ecology of contemporary adaptations: what

empirical studies reveal about the conditions that promote adaptive evolution. Genetica, 112,

183-189.

Roman J, Darling JA (2007) Paradox lost: genetic diversity and the success of aquatic invasions. Trends

in Ecology and Evolution, 22, 9, 454-464.

Sakai AK, Allendorf FW, Holt JS, et al. (2001) The population biology of invasive species. Annual

Review of Ecology & Systematics, 32, 305-332.

15

Santamour FS, McArdle AJ (1983) Checklist of cultivars of Callery Pear (Pyrus calleryana). Journal of

Arboriculture, 9, 114-116.

Southwest Exotic Pest Plant Council (2001) Invasive exotic pest plants in Tennessee. Available online at

http://www.se-eppc.org/states/TN/TNIList.html.

Stebbins GL (1969) The significance of hybridization on plant taxonomy and evolution. Taxon 18, 26-

35.

Stephens PA, Sutherland WJ, Freckleton RP (1999) What is the Allee effect? Oikos, 87, 185-190.

Stewart B (1999) The coming plague of pears. University of Maryland Cooperative Extension.

Available at: www.montgomerycountymd.gov/mc/services/dep/Landscape/pears.htm.

Swearingen j, Resheriloff K, Slattery B, Zwicker S (2002) Plant invaders of Mid-Atlantic natural areas.

National Park Service and US Fish and Wildlife Service.

Van Holle B, Simberloff D (2005) Ecological resistance to biological invasion overwhelmed by

propagule pressure. Ecology, 86, 33212-3218.

Vincent, MA (2005) On the spread and current distribution of Pyrus calleryana in the United States.

Castanea, 70, 20-31.

Westwood MN (1980) “Autumn Blaze‟ ornamental pear. HortScience, 15, 830-831.

Whitehouse WE, Creech JL, Seaton GA. 1963. Bradford ornamental pear – a promising shade tree.

American Nurseryman, 117, 56-60.

Wilcove DS, Rothstein D, Dubow J, Phillips A, Losos E (1998) Quantifying threats to imperiled species

in the United States. BioScience, 48, 607-615.

Zielinski QB (1965) Self-incompatibility of Pyrus species. Bulletin of the Torrey Botanical Club, 92,

219-220.

16

FIGURE LEGENDS

FIGURE 1.1

Pictures of Pyrus calleryana (a) in cultivation and (b) in the wild. Photos courtesy of Theresa Culley and Brian Baumgartner.

FIGURE 1.2

Locations of Pyrus calleryana seed collections by Francis Meyer and Frank Reimer across Asia.

Japanese and Korean collections were obtained by Reimer in 1918, and Chinese collections were obtained by either Meyer and Reimer between 1916 and 1919.

17

TABLES

Table 1.1: List of cultivars of Pyrus calleryana, including the year each became commercially

available, the site of development, United States patent or trademark number, and the parental source, if

known. “SPI” refers to the accession number from the United States Department of Agriculture.

Approx. U.S. patent Cultivar year of Site of origin (PP) or Source availability trademark (R) Bradford 1960 Glenn Dale, MD none Chinese seed purchased in Nanking, China in 1919 (SPI 47261); original tree planted at the USDA station (Santamour and McArdle 1983).

Chanticleer® 1965 Olmsted Falls, PP2489 Original tree planted in Cleveland, (Cleveland OH & Corvallis, R1616952 OH was derived from commercial Select, Stone OR seed purchased in 1946; synonymous Hill, Select, cultivars likely propagated from same Glenn's Form) street tree (Santamour and McArdle 1983).

Rancho 1965 Olmsted Falls, PP2092 Unknown OH Avery Park 1970's Corvallis OR none Originated from a population of P. calleryana seedlings planted in Avery Park, Corvallis, OR

Aristocrat® 1972 Independence KY PP3193 Chinese seed collected by Meyer; R1280081 selected from P. calleryana seedlings in 1969 Redspire 1975 South Brunswick PP3815 „Bradford‟b X unknown pollen township, NJ parent Valzam 1975 Perry, OH PP8050 „Cleveland Select‟ X unknown pollen (Valiant®) R1696359 parent

Princess 1976 Olmsted Falls, none Unknown OH

18

Whitehouse 1977 Glenn Dale, MD none 'Bradford' X unknown P. calleryana parent at USDA Station; original tree destroyed during clearing a field for cultivation.

Autumn Blaze 1978 Corvallis, OR PP4591 Parent originated from Chinese seed from Reimer‟s 1917 or 1919 collection (possibly from SPI 45592, part of which was given to Reimer; Westwood 1980)

Trinity®(XP- 1978 Portland, OR PP4530 Purchased seed 005) R2761003 Grant St. Yellow 1980 OR none Unknown

Capital 1981 Washington D.C. none 'Bradford' X unknown P. calleryana parent Edgewood® 1997 DuPage County, PP10151 P. calleryana X P. betulifolia (found (Edgedell) IL R2033633 growing in a cultivated area)

Veyna 2004 Visalia, CA PP15299 'Aristocrat' X P. kawakammii unknown cultivar Cambridge 2003 Cambridge City, applied Unknown IN

Earlyred unknown Vincennes, IN none „Bradford‟ X unknown pollen parent

Jaczam (Jack®) 1999 Perry, OH R2708807 Unknown

Jilzam (Jill™) 1990's Perry, OH none Unknown

Cleprizam 1990 Perry, OH R1683475 Unknown (Cleveland Pride®)

Bursnozam 1990's Perry, OH none Unknown (Burgandy Snow™)

Fronzam 1990's Perry, OH none Unknown (Frontier™)

Gladzam 1993 Perry, OH R2708808 Unknown

19

(Galdiator®)

Mepozam 1990's Perry, OH none Unknown (Metropolitan™)

New Bradford® 1996 Boring, OR R2034326 Unknown (Holmford)

20

Table 1.2: Disease and pest susceptibilities, as well as environmental tolerances, of seven Pyrus calleryana cultivars. Information is compiled from Pyrus calleryana fact sheets, obtained from the U.S.

Department of Agriculture and the U.S. Forest Service.

Cleveland Autumn Character Redspire Aristocrat Bradford Capital Select Blaze

Fireblight varies susceptible varies resistant susceptible resistant Resistance aphids, aphids, aphids, aphids, aphids, aphids, Pests scale scale scale scale scale scale insects insects insects insects insects insects Ozone tolerant tolerant tolerant tolerant tolerant tolerant Sensitivity Soil clay, sandy clay, sandy clay, sandy clay, sandy clay, sandy clay, sandy Tolerance loam loam loam loam loam loam pH 5.5 - 7.5 5.5 - 7.5 5.5 - 7.5 5.5 - 7.5 5.5 - 7.5 5.5 - 7.5 Tolerance

Drought high high high high high high Tolerance

Salt high high high high high high Tolerance

Light high high high high high high Requirement

Breakage no no yes no no no Sensitivity

Hardiness 5A-9A 5A-9A 5A-9A 4B-8 4A-8 5A-9B Zone Thorns no no yes no no no

21

Figure 1.1

(a)

(b)

22

Figure 1.2

23

Chapter 2

Cultivation and invasive potential: genetic evidence for intraspecific hybridization in Pyrus calleryana

(to be submitted to Molecular Ecology)

Nicole A. Hardiman & Theresa M. Culley

Department of Biological Sciences

University of Cincinnati

614 Rieveschl Hall

Cincinnati, OH USA 45221-0006

Corresponding author - Email: [email protected], Tel:513-556-9705, Fax: 513-556-5299

Keywords: cultivation, hybridization, introduced, invasive, microsatellite, Pyrus calleryana

24

ABSTRACT

The process of cultivation may be a special case of intraspecific hybridization as a mechanism for the evolution of invasiveness, where cultivation practices and commercial availability result in multiple introductions and enough standing genetic variation to generate novel admixture in cross- cultivar progeny. The Callery pear (Pyrus calleryana [Rosales: Rosaceae]) is a cultivated, ornamental tree that has begun invading old field and natural areas, sometimes creating dense, monospecific stands.

The species became commercially available in the 1960‟s as several cultivars, and despite widespread introduction over the last 40 years, has only recently become invasive. There is increasing evidence that certain species may evolve invasive potential after a lag period following introduction, and hybridization has previously been identified as a mechanism for evolution of invasiveness. The goal of this experiment was to identify the role of intraspecific hybridization, via crossing of genetically distinct cultivars, in the formation of invasive populations of Pyrus calleryana. Using microsatellite markers, commercially available cultivars were genotyped and found to be genetically distinct from one another. Parentage analyses of invasive individuals were performed to determine the most-likely parent pair of invasive individuals and the overall relative contribution of different cultivars found in nearby putative parent populations. In three populations located across the introduced range, all invasive individuals were F1 or advanced-generation progeny parented by hybridizing cultivated individuals.

Extensive admixture of cultivar genotypes via hybridization was found in all populations, consistent with the hypothesis that intraspecific hybridization plays a role in the evolution of invasiveness in P. calleryana.

25

INTRODUCTION

To effectively prevent establishment and spread of invasive species, it is important to identify the aggregate of factors, both pre and post-introduction, that contribute to their invasive potential, and in the study of invasive species, there has been increased focus on the evolution of traits favoring invasion following introduction (Reznick and Ghalambor 2001, Cox 2004). The first step in the invasion process begins with its introduction into a novel environment through either intentional or accidental human-mediated events (Sakai et al. 2001). Following establishment, a species may experience a lag period where self-sustaining populations exist but do not expand outside of small founder populations. The time frame of this lag period may be species-specific with spread limited genetically, demographically, and/or ecologically (Ewel et al. 1999). Many introduced species never advance past this stage. For most species that do become invasive, some aspect of the demography of introduced populations changes during the lag phase, allowing the rate of population growth to rapidly increase. Factors such as multiple introductions and high propagule pressure may facilitate escape from genetic and demographic limitations of founding populations, subsequently spreading beyond the original site of introduction (Taylor et al. 2004, Taylor and Hastings 2005).

Introduced species may also experience rapid evolutionary change, if it is promoted by novel genetic variation in traits related to establishment ability and performance. In a recent review, Bossdorf et al. (2005) found that introduced populations generally contained similar or higher genetic diversity than conspecifics found in their native range. Combined with the finding that some invasive species had larger plants with higher fecundity in the introduced range, these results indicate that evolution is occurring in these species following introduction. One well-studied mechanism for the evolution of invasiveness is hybridization. Many invasive species have been recognized as the result of hybridization events, either through crossing between two introduced species or crossing between an

26

introduced and native species (Ellstrand and Schierenbeck 2000). Hybridization can increase genetic diversity (Lee 2002) and may produce novel phenotypes on which natural selection can act.

Intraspecific hybridization may function in a similar way as hybridization between species, where crossing occurs between genetically differentiated populations produce novel variation in traits relating to invasion success (Culley and Hardiman, in press). Genetic differentiation could originate from either multiple introductions of geographically isolated, native populations or can be created by practices such as cultivation.

Cultivation affects the invasive potential of introduced plants (Kitajima et al. 2006), and intraspecific hybridization between cultivars may represent a mechanism for the evolution of invasiveness. Although many horticultural species do not become invasive, increases in population growth in these species could be the result of overcoming demographic limitations on reproduction.

Different types of introduction pathways can influence the overall propagule pressure of a species. For example, primary introduction events occur during initial import of the species from the native range, and secondary introduction events include widespread commercial distribution and planting for horticultural purposes (Kowarik 2003). Alternatively, artificial selection for traits such as abundant flower production, environmental tolerance, and disease or pest resistance may also create genetic differentiation among the resulting cultivars, which may serve to increase the invasive potential of cultivated species via hybridized progeny. Invasive potential may be evolving in these species because genetic variation present across cultivars may result in hybridized progeny with a greater probability of establishment potential.

An ideal system in which to study cultivation and intraspecific hybridization is Pyrus calleryana, an ornamental tree species which has recently become common in residential and commercial areas across the United States due to commercial-based plantings (Culley and Hardiman

27

2007). The species is native to China, Korea, and Japan, and was introduced to the United States in the early 20th century (Cunningham 1984). The original purpose of introduction was to breed fireblight resistance into Pyrus communis, the common edible pear. As Pyrus calleryana was increasingly recognized for its showy spring flowers, environmental tolerance, and rapid growth, breeding programs were enacted to develop the species as an ornamental (Creech 1973). In 1960, „Bradford‟ was the first cultivar to be commercially available. Since then, there have been as many as 29 additional cultivars developed for the commercial market (Whitehouse et al. 1963). Differences among cultivars are generally defined by plant breeders responsible for developing, propagating and patenting the species.

Cultivar designations are based on morphological differences such as branching structure, growth habit, and/or leaf shape. The average Callery pear has a height growth rate approximately four to five meters within an eight to ten year time frame (Handy 1980). The species is tolerant of a wide variety of environmental conditions and habitat types (Gillman and Watson 1994), and cultivated varieties are promoted and sold within most regions of the United States. The species has been identified in natural areas in 26 states (Vincent 2005), and is currently recognized as an invasive in ten states (Culley and

Hardiman 2007). Volunteer populations are usually found in highly-disturbed, open areas within an urban matrix such as along roadsides or railroad tracks, but populations have also been identified in nature preserves and wetland areas. Dense, monospecific stands that sometimes form may impede establishment of native mid- to late-successional plant species (Fierke and Kauffman 2005; Mandryk and Wein 2006). By combining native Asian genotypes through multiple introductions and subsequent cultivation, there may be increased potential for the evolution of invasiveness in this species through intraspecific hybridization (Culley and Hardiman, in press)

The hypothesis of this study is that crossing between various commercially available cultivars of P. calleryana has resulted in the establishment of invasive populations found in natural areas. The

28

objectives of this investigation were: 1) to compare genetic variation between cultivated and wild populations of P. calleryana using microsatellite loci, 2) to genetically characterize cultivars and identify individuals of unknown cultivar type, and 3) to determine the relative contribution of different cultivars to invasive populations of different ages. This study is the first in-depth investigation to identify the population genetics behind invasion of Pyrus calleryana. Along with traits favoring reproduction and survival, intraspecific hybridization may also be a key mechanism promoting invasive potential in this species. By identifying the role of intraspecific hybridization and possible post- introduction evolution in non-native species, it may be possible to predict scenarios in which invasion of this and other newly-introduced species can be prevented.

MATERIALS AND METHODS

Study Species

Pyrus calleryana is a deciduous tree that produces abundant white flowers in early spring. The flowers occur on an umbel with 6 to 12 flowers per inflorescence (Cuizhi and Spongberg 2003).

Pollinators include hive bees (Apis mellifera L.), bumble bees (Bombus terrestris L.), and hover flies

(Syrphidae spp.; Smith 1970), which travel freely between cultivar types (N. Hardiman, personal observation). Seed dispersal is promoted by the production of a small pome fruit, which are attractive to birds, especially European Starlings and American Robins, and possibly small mammals. The species also exhibits gametophytic self-incompatibility, which causes obligate outcrossing between genetically distinct individuals (de Nattencourt, 2001). This single locus system causes RNase enzymes in the maternal pistil to degrade the pollen tubes of incompatible haploid pollen; consequently crosses between genetically different cultivars are more likely to produce viable seed than crosses between genetically similar cultivars.

29

Cultivars are vegetatively propagated by grafting of the cultivar scion onto Pyrus calleryana rootstock. The scions are generated as cuttings from the original specimen tree from which the cultivar was developed and as such, all individuals of a given cultivar are expected to be genetically identical.

Asian accessions of P. calleryana are thought to be the major source of rootstock for the scions.

Propagation can also occur by budding with Pyrus communis or P. fauriei seedlings. Due to the presence of the self-incompatibility system and vegetative propagation, the species was originally thought to be of little invasive potential, because the tree could not self-pollinate or produce fruit in crosses between individuals of the same cultivar. Development of many different cultivars may have generated variation at the self-incompatibility locus, allowing individuals of different cultivars to successfully cross and produce viable seed.

Sample Collection

Leaf tissue was collected from multiple individuals (n=2-22) of each of nine P. calleryana cultivars (i.e. „Bradford‟, „Chanticleer‟, „Aristocrat‟, „Redspire‟, „Capital‟, „New Bradford‟, „Cleveland

Select‟, „Stonehill‟ and „Autumn Blaze‟). Single samples representing an additional seven cultivars were obtained from the National Clonal Germplasm Repository in Corvallis, Oregon („Valzam‟,

„Princess‟, „Grant St. Yellow‟, „Early Red‟, „Whitehouse‟, „Avery Park‟, and „Faurie‟). In addition, established invasive populations with a nearby putative parent source (i.e. cultivars in the neighboring residential and/or commercial area) were sampled in the following three sites: in and around the USDA

Introduction Station in Glen Dale, MD, around Warner Park in Nashville, TN, and at the Harris M.

Benedict Nature Preserve in Cincinnati, OH. Maryland is one of the original introduction sites, where invasive populations are now extensive and individuals may be the progeny of original P. calleryana rootstock (Culley and Hardiman 2007). At this site, putative parent populations consist of individuals located within the USDA Introduction Station itself and also individuals located in the surrounding

30

residential area. The Tennessee site has well-established invasive individuals, with older trees (mean d.b.h. = 8.9 cm) compared to invasive populations in Ohio that have only recently begun to appear

(mean d.b.h. = 3.3 cm). At each site, invasive individuals were sampled only if at least two meters apart and randomly sampled across the range of the population. In Maryland, Tennessee, and Ohio, leaves were collected from 100, 61, and 100 individuals in the invasive populations, respectively. Sixty putative parent individuals were collected in Maryland, 60 in Tennessee, and 75 in Ohio. Leaf tissue was frozen at -20ºC after collection.

Microsatellite Analysis

Sample DNA was extracted from leaf tissue using a modified CTAB method (Doyle and Doyle

1987). Microsatellite markers have been developed for genera across the Rosaceae family, including

Malus domestica, Pyrus communis, P. pyrifolia, and P. ussuriensis (Guilford et al. 1997,

Gianfranceschi et al. 1998, Yamamoto et al. 2002, Mnejja et al. 2004). While no microsatellite primers have been specifically designed for P. calleryana, we successfully amplified and detected high levels of polymorphism in P. calleryana using primers from closely-related species and genera (Table 2.1). For analysis of nine polymorphic loci, samples were multiplexed using the Qiagen Multiplex kit (Qiagen

Inc., Valencia, CA). PCR was performed using 10μl reaction volumes as follows: 1X Multiplex PCR

Master Mix, 1X primer mix (containing 0.2 μM each of the forward and reverse primers in TE), 12-16 ng DNA and ddH2O. Reverse primers were left unlabelled while forward primers were fluorescently tagged with 6-FAM, NED, or VIC (Table 2.1). Two separate primer mixes were used for multiplexing: one consisted of primers KU10, CH01F02, CH02D12, CH02B10 and CH02D11, and the other consisted of primers KA16, CH02B03b, CH01H10 and CH01H01. The temperature profile for the multiplexed samples was as follows: 95ºC for 15 min, followed by 27 cycles each of 94ºC for 30 s,

57ºC for 90 s, and 72ºC for 60 s, and then with a final extension of 72ºC for 30 min. PCR products

31

were analyzed using a 3730xl sequencer (Applied Biosystems, Fortune City, CA) with the LIZ 500 internal size standard. Fragment analysis was conducted using Genemapper v.3.7 (Applied

Biosystems).

Statistical Analysis

For all cultivars and invasive populations, the number of alleles per locus (A), percent polymorphism (P) at the 99% level, average expected heterozygosity (He), and average observed heterozygosity (Ho) were calculated using GDA software (Lewis and Zaykin 2001). Conformity to

Hardy-Weinberg expectations and the degree of linkage disequilibrium (LD) was also determined for all populations using exact tests, with P-values corrected using the standard Bonferroni method.

Genetic differentiation among cultivars and populations was calculated using θ (Wier & Cockerham

1984), and upper and lower 95% confidence intervals were generated by bootstrapping over all loci.

Nei‟s (1978) coefficient of genetic identity, which is a measure of genetic differentiation based on allele frequencies, was also determined for pair-wise cultivar comparisons. Principle coordinates analysis (PCoA) based on pair-wise genetic distances was conducted separately for the Ohio,

Tennessee, and Maryland sites. Genetic distances were calculated using the GenAlEx software program (Peakall and Smouse 2006), using the standard distance coefficient for codominant genotype data (Peakall and Smouse 1995; Smouse and Peakall 1999). The goal for PCoA analysis was to assess the degree of genetic distance among cultivars, to identify the cultivar-type of putative parents, and to assess genetic similarity between the putative parent and invasive individuals at each site.

Putative parent individuals at each of the three sites were assigned a cultivar type using the frequency-based analysis in the GeneClass2 software package (Piry et al. 2004). This method follows the Paetkau et al. (1995) formula, where the likelihood value is based on the frequency of multi-locus alleles in the reference population. Parentage analysis of invasive individuals within each of the three

32

populations was conducted using the Cervus v.3.0 software package (Marshall et al. 1998; Kalinowski et al. 2007). The two most likely parents for each invasive individual were determined using the reference cultivars as potential parents, in order to conform to Hardy-Weinberg genotype frequency assumptions in parental populations. Parent pair analysis with both sexes unknown was used because maternal or paternal contribution of specific cultivars was unable to be determined. Using Cervus, allele frequencies were first calculated across all loci for the cultivars and invasive populations using default parameters. Statistical confidence in the parentage assignment was then made by creating a distribution of LOD scores for 10,000 simulated offspring with mistyping error adjusted for each population. Cervus is beneficial for assigning parentage if there are multiple, genetically divergent parental types (i.e. cultivars) while taking into account alleles that occur in low frequencies that may be the result of genotyping error or mutation at highly-variable microsatellite loci. For this analysis, locus

CH01H01 significantly differed from Hardy-Weinberg expectations, so it was removed from the analysis. Invasive individuals were assigned a parent only if it was assigned with a positive LOD score and at least 80% confidence, as determined by the program.

Additionally, the number of diagnostic alleles for each cultivar was identified, as was the frequency of those alleles in each invasive and putative parent populations. An allele was defined as diagnostic if it was a private allele found in all individuals of the same cultivar type, but absent in all other cultivars. A count of diagnostic alleles for each individual in the invasive population was performed to determine the direct genetic contribution of each cultivar, as well as to verify parentage analysis results. This method may underestimate the actual number of contributing cultivars, since a cultivar could contribute a non-diagnostic allele, but it is beneficial for assessing the minimum level of admixture within each individual and therefore, across populations.

33

RESULTS

High levels of genetic diversity were detected among cultivars of known type, the putative parent populations, and within invasive populations of P. calleryana (Table 2.2). Across cultivars, an average of 1.8 alleles was found at each locus and the average proportion of polymorphic loci was 0.8.

The expected and observed heterozygosity averaged across cultivars was substantial (averaging 0.5 and

0.7). In the putative parent and invasive populations, the average number of alleles was 7.7 and 10.0, respectively, and all loci were polymorphic for these groups. The average expected heterozygosity was slightly higher in the invasive populations (0.8) than in the putative parent populations (0.7), but average observed heterozygosity was identical at 0.7. Across the nine polymorphic loci, several diagnostic, private alleles were detected for each cultivar (Table 2.3). For example, loci CH01F02 and

CH02B03b each contained one diagnostic allele for each of six cultivars, and locus KA16 contained diagnostic alleles for four cultivars.

Significant deviations from Hardy-Weinberg equilibrium were dependant on population and locus. Across all cultivars, three loci (CH02D11, CH02D12 and KU10) deviated from Hardy-

Weinberg expectations (Bonferroni-corrected P < 0.001). For the Tennessee and Ohio putative parent populations, eight and nine loci were out of Hardy-Weinberg equilibrium, respectively. The Maryland putative parent population significantly deviated from equilibrium at only two loci. The invasive populations in Ohio, Tennessee and Maryland deviated at four, three and three loci, respectively.

Linkage disequilibrium was found for two pairs of loci in the cultivars: CH02B10/CH02D11, and

CH01F02/KU10 (Bonferroni-corrected P < 0.0002). Linkage was also detected between all 36 loci pairings for the Tennessee and Ohio putative parent populations, but only for nine loci pairs in the

Maryland putative parent population. Linkage disequilibrium and deviations from Hardy-Weinberg were expected in these populations, because many individuals should be of the same cultivar type and,

34

therefore, genetically identical. In the invasive populations, only three loci pairs out of 36 were linked in Tennessee and Maryland, but 25 of the 36 pairings were in linkage disequilibrium in the Ohio invasive populations. In the latter, linkage disequilibrium may reflect the presence of mostly F1 intraspecific hybrids in this young population.

Genetic differentiation among all pooled cultivars (θ) was substantial at 0.509 (Upper CI =

0.577, Lower CI = 0.439). All pair-wise values of θ for cultivar comparisons were significantly different from zero based on 95% confidence intervals and thus genetically differentiated from one another (Table 2.4), except among the Cleveland Select, Chanticleer, and Stonehill cultivars. Results for Nei‟s (1978) genetic identity were similar to θ, with low identity found for all cultivar comparisons, other than the three mentioned above. When comparing invasive and putative parent populations at the three sites, the average θ across all sites was 0.039 with all values significantly different from zero.

The Principle Coordinates Analysis (PCoA) supported the above results of genetic structure within each location sampled (Figure 2.1). Most cultivar types appeared to be completely differentiated from one another, and as expected, most individuals of the same cultivar were genetically identical. Several cultivars had individuals that where genetically variable from the most commonly-found allele across all individuals of a given cultivar. There was an average of 3.25 anomalous alleles out of a total of 18 possible alleles (ranging from 2 to 5 alleles) for individuals belonging to the Capital, Cleveland,

Autumn Blaze and New Bradford cultivars. These alleles may be due to somatic mutation at those loci, where specific individuals were variable at a few alleles and identical for all others. Additionally, 12% of cultivated individuals acquired from retail sources appeared to be mislabeled, because these individuals overlapped with PCoA cultivar clusters differing from their designated type. The Ohio and

Tennessee putative parent individuals overlapped with a cultivar 80% and 79% of the time, respectively. On the other hand, only one out of a total of 56 putative parents overlapped with a

35

cultivar in Maryland. In the invasive populations, individuals were distributed among the cultivar and putative parent clusters.

The frequency-based analysis in GeneClass2 identified the cultivar type of most putative parent individuals (Figure 2.2). For the Ohio and Tennessee sites, 99% and 91% respectively of the individuals were assigned a cultivar type with at least 95% confidence. For the Maryland site, 68% of the putative parent individuals were assigned a cultivar-type. The proportion of cultivars found in the putative parent population varied by location, which is to be expected because each population has a different planting history and may reflect region-specific cultivar sales. The Cervus software program designated the two most-likely parent cultivars for each invasive individual for 79% of invasive individuals in Ohio, 33% in Tennessee, and 47% in Maryland. Across all three sites, 21% of invasive individuals were not assigned a parent with any confidence, and 22% of individuals were assigned a negative LOD score with high confidence.

By examining the frequency of cultivar diagnostic alleles for each invasive individual, the cultivar contribution can be quantified and the degree of admixture within individuals can be assessed

(Figure 2.3a). Across all three sites, 54% of the invasive individuals were found to have two cultivars contributing to their multi-locus genotype, and 31% had three to five contributing cultivars. The

Maryland invasive individuals had as many as five contributing cultivars, which is expected since it is one of the sites of original introduction and presumably has had more opportunity for admixture (i.e. production of F2, F3 and backcrossed progeny). Across all three populations, 14% of invasive individuals had only one cultivar implicated, which may be due to a lack of diagnostic alleles at those individuals‟ genotypes so that a second cultivar could not be specified. Alternatively, there may be cultivars present which have not yet been genetically characterized. In addition, this could potentially indicate a breakdown of the self-incompatibility system, resulting in self-fertilization. When

36

comparing the proportion of cultivar diagnostic alleles in the putative parent populations to those in invasive individuals, there was no significant difference (Table 2.5; paired t-test, df = 17, t = 0.02, P =

0.98). This indicates that no specific cultivar was over-represented in the invasive populations relative to the proportion found in the putative parent populations.

The putative parent individuals at each of the three sites not overlapping a cultivar in the PCoA analysis contained more than one cultivar diagnostic allele across all loci (Figure 2.3b). In Ohio and

Tennessee, 78% and 50% respectively of the individuals were found to have at least two contributing cultivars. In the oldest Maryland site, 85% of putative parents were found to have at least two contributing cultivars with as many as four contributing cultivars detected in some individuals. These individuals may represent additional offspring resulting from cultivar crosses, despite appearing to be a cultivated individual based on location. Alternatively, these individuals may represent uncharacterized cultivars or original Asian genotypes that were planted as street trees in the 1900‟s (Culley and

Hardiman 2007).

Invasive trees that had more than one or two contributing cultivars based on diagnostic alleles also had on average negative LOD scores, as detected in the parentage analysis (Figure 2.4). The negative relationship indicates the scores are the result of inaccurate parentage assignment due to a high number of detected cultivars across those invasive individuals‟ multi-locus genotypes. It is possible that the cultivars implicated as parents were present in the putative parent populations but were not sampled (see Figure 2.2). However, this is unlikely given that negative LOD scores indicate an unlikely and inaccurate parentage assignment. Within the Tennessee site, a positive LOD score was found for one individual that had four contributing cultivars, and was presumed to be anomalous. Our analysis indicates that Cervus can be accurate for detecting parentage in progeny that have one or two genetically distinct parents; however, parentage assignment is unreliable in hybridized progeny with

37

extensive parental genotype admixture from multiple genetically distinct sources. In Kalinowski et al.

(2007), a decrease in paternity assignment was found in parent-offspring pairs having two or more allelic mismatches, and admixture beyond the F1 generation. In the analysis of P. calleryana, high admixture may have resulted in the high number of allelic mismatches and a decrease in the resolution across loci. When comparing the number of mismatches between invasive individuals and the assigned putative parent in the current study, there was an average of 0.8 mismatches out of a total of 18 alleles in the Ohio population, 2.19 in Tennessee and 2.65 in Maryland.

DISCUSSION

This study indicated that the Pyrus calleryana cultivars examined in this study are genetically differentiated from one another and that invasive populations in three sites possess extensive admixture of cultivar genotypes. This clearly supports the hypothesis that invasive populations, at least in these areas, are progeny of hybridizing cultivars. Despite being originally imported from Asia over 100 years ago, the Callery pear began appearing as naturalized populations approximately 40 years after it was introduced as a commercially-available ornamental. Cultivation may be the primary mechanism by which the Callery pear overcame the limitations of self-incompatibility and other factors to produce invasive populations. Of woody invasive plant species, 82% have a horticultural introduction history

(Reichard and White 2001). Cultivated, horticultural species are likely to become invasive due to multiple primary and secondary introductions, which increase propagule pressure within introduced areas. Primary introductions include initial import of species from their native habitat, and secondary introductions include localized distribution (in the case of horticultural species, usually via commercial pathways) across a wide geographic area (Kowarik 2003). Additionally, the process of cultivation via artificial selection (e.g. selection for increased flower production) can increase reproductive allocation

38

and fecundity (Harlan 1975). Cultivation and subsequent propagation could thus serve as a source for invasive populations by effectively increasing introduction effort and inoculation size on a large scale

(Lockwood et al. 2005, Drake et al. 2005).

Selection of cultivars with specific traits through artificial breeding programs could also serve as a source for genetic differentiation among cultivars, creating new variation at non-neutral loci upon which natural selection can act. For cultivation to promote invasive potential, genetic differentiation as indicated by microsatellite markers has to be expressed as heritable trait differences. Cultivars of P. calleryana are highly genetically structured at presumably selectively-neutral microsatellite loci. Of the sixteen cultivars included in the study, only the „Stonehill‟, „Chanticleer‟, and „Cleveland Select‟ cultivars were identical, which is supported by anecdotal accounts that these cultivars were derived from the same parental source (Culley & Hardiman 2007). The genetic differentiation among cultivars may be due to multiple collections of seed from geographically-separated source populations across the native range of Callery pear (Culley and Hardiman, in press). Cultivars could be further genetically differentiated during their selection regimes. Additionally, the combination of demographic and genetic changes brought about by cultivation practices may also reduce the lag time between a species introduction and its appearance as an invasive. The mean lag time has previously been calculated to be

170 years for invasive trees and 131 years for invasive shrubs (Kowarik 1995). The lag time of invasive species of horticultural origin may be abbreviated if adequate additive genetic variance accumulates across cultivars. Indeed, changes in introduction vector activity attributable to the horticultural trade have been found to influence the probability of establishment of invasive populations

(Dehnen-Schmutz et al. 2007).

On a local scale at the three sites examined in this study, populations composed of different cultivars provide the source for nearby invasive populations. Widespread plantings (in this case,

39

cultivated plantings in residential or commercial areas) have previously been implicated as promoting the naturalization and spread of exotic, horticultural species (Mack et al. 2000). Invasive populations of Brazilian peppertree (Schinus terebinthifolius) and pampas grass (Cortaderia selloana) have been found to contain admixed genotypes originating from several ornamental cultivars or varieties (Okada et al. 2007, Williams et al. 2005). Additionally, hybridization between cultivars was implicated as the cause for formation of invasive olive (Olea europaea) populations in Australia (Besnard et al. 2007).

Invasive populations of Pyrus calleryana also appear to be of cultivated origin, with a combination of cultivar genotypes represented within each population. Results indicate all cultivars are equally capable of contributing to invasive populations because the frequency of cultivar alleles in invasive populations was similar to the frequency of cultivated individuals in the putative parent population.

Over half of invasive individuals in all sampled locations had at least two cultivar sources, indicating admixed genotypes from multiple cultivars. These results show not only that horticultural plantings are the source populations in these areas, but also that invasive individuals are capable of reproducing either among themselves or via backcrossing with cultivars. Invasive populations at these sites thus appear to be stabilized populations that have high individual survival and reproductive capability within populations (N. Hardiman, unpublished data). Additional studies of other location and different aged populations would be highly informative in elucidating how applicable these results are on a larger scale.

There was substantial variation across the three studied populations in the level of admixture and parentage resolution ability. Maryland is one of the original sites of introduction, which included plantings of imported Asian seeds, and subsequent development of several types of cultivars. Most

Callery pear rootstock may also originate from this location representing Asian populations (Culley and

Hardiman 2007). The Maryland site, therefore, contains parental sources beyond the known cultivars

40

and has a much longer invasion timeline than the other populations. The Maryland population also had less genetic variation explained by the PCoA analysis relative to Tennessee and Ohio. This appears to be due to the presence of many rare alleles originating from Asian genotypes combined with high admixture, which reduced the resolution power of the PCoA. This is substantiated by the high number of unassigned putative parent individuals and low parentage assignment of invasive individuals. Based on tree size in the putative parent and invasive populations, Tennessee is thought to be the next oldest population. Relative to the results found in the Ohio population, Tennessee invasive individuals are more admixed, despite having a large proportion of putative parent individuals composed of the

Bradford cultivar.

While invading horticultural species are often thought to be successful due to multiple introductions, the important distinction is that the process of cultivation itself may lead to the development and geographic distribution of many genetically differentiated populations, resulting in accumulation of evolutionarily important genetic and morphological traits and subsequent transmission of heritable traits to invasive progeny. The principles of hybridization can be applied to Pyrus calleryana because crossing between genetically divergent cultivars appear to result in highly admixed populations that now appear to be not only self-sustaining, but also rapidly spreading to new areas

(Vincent 2005). Intraspecific hybridization, defined as crossing between genetically distinct populations to produce hybrid progeny that possess invasive characters that allow them to exploit the introduced environment, is probably much more common than is currently recognized (Culley &

Hardiman, in press), but explicit investigation of the phenotypic effects of such processes in cultivated invaders is untested. By recognizing the importance of cultivation in evolutionary processes after introduction, attention must now shift to understanding the introduction history and the potential for invasiveness in new or currently introduced species that are not yet invasive.

41

Management of Pyrus calleryana in existing invasive populations will unfortunately be difficult given that cultivars are widely available through nurseries and retailers, and new cultivars are continually being developed. As with most invasive ornamentals, a key factor to preventing spread of the species is to decrease its commercial availability, but many retailers are reluctant to stop selling these economically-important species. One potential solution for cultivated, horticultural species is to limit the number of available cultivars, since production of a new cultivar is the functional equivalent of a new primary introduction. Ultimately, we believe prevention of spread of this and other invasive ornamental species begins with the consumer and public education to reduce consumer preferences for these species, as well as increasing the availability of native alternative species. As the public becomes more knowledgeable about what species are invasive or potentially invasive in their area, they will be less apt to purchase and plant those species, instead choosing suitable alternatives.

ACKNOWLEDGEMENTS

The authors would like to acknowledge Ken Petren, Steven Rogstad, Sarena Selbo, and Jodi

Shann for valuable input, data analysis advice, and helpful discussion. Ed Romero, Brian Robin, and

Sarah McCann provided field and laboratory assistance. We would like to thank all landowners, including the University of Cincinnati, the USDA Introduction Station, the city of Nashville, and many, many private home-owners. Funding for this research was provided by the USDA CSREES Grant

(#2006-35320-16565) to Theresa Culley; and grants from the University of Cincinnati Research

Council, and the Botanical Society of America to Nicole Hardiman.

42

REFERENCES CITED

Besnard G, Henry P, Wille L, Cooke D, Chapuis E (2007) On the origin of the invasive olives (Olea

europaea L., Oleaceae). Heredity, 99, 608-619.

Bossdorf O, Auge H, Lafuma L, et al. (2005) Phenotypic and genetic differentiation between native and

introduced plant populations. Oecologia, 144, 1-11.

Cox GW (2004) Alien Species and Evolution: The Evolutionary Ecology of Exotic Plants, Animals,

Microbes, and Interacting Native Species. Island Press, Washington.

Creech JL (1973) Ornamental plant introduction-building on the past. Arnoldia, 33, 13-25.

Cuizhi G, Spongberg SA (2003) Pyrus. In: Flora of china (eds. Wu ZY, Raven PH, Hong DY), vol. 9,

pp. 173-179.

Culley TM, Hardiman NA (in press) The role of intraspecific hybridization in the evolution of

invasiveness: A case study of the ornamental pear tree Pyrus calleryana. Biological Invasions.

Culley TM, Hardiman NA (2007) The beginning of a new invasive plant: a history of the ornamental

Callery pear in the United States. BioScience, 57, 11, 956-964.

Cunningham IS (1984) Frank N. Meyer: Plant Hunter in Asia, The Iowa State University Press, Ames,

Iowa. de Nettancourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. Springer,

Berlin.

Dehnen-Schmutz K, Touza J, Perrings C, Williamson M (2007) A century of the ornamental plant trade

and its impact on invasion success. Diversity and Distributions, 13, 527-534.

Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue.

Phytochemical Bulletin, 19, 11–15.

43

Drake JM Baggenstos P, Lodge DM (2005) Propagule pressure and persistence in experimental

populations. Biology Letters. 1, 480–483.

Ellstrand NC, Schierenbeck KA (2000) Hybridization as a stimulus for the evolution of invasiveness in

plants? Proceedings of the National Academy of Sciences, 97, 7043-7050.

Ewel JJ, O‟Dowd DJ, Bergelson J et al. (1999) Deliberate introductions of species: research needs.

BioScience, 49, 619-630.

Fierke MK, Kauffman JB (2005) Structural dynamics of riparian forests along a black cottonwood

successional gradient. Forest Ecology and Management, 215, 149–162.

Gianfranceschi L, Seglias N, Tarchini R, Komjanc M, Gessler C (1998) Simple sequence repeats for

the genetic analysis of apple. Theoretical and Applied Genetics, 96, 1069-1076.

Gilman EF, Watson DG (1994) Pyrus calleryana „Bradford‟: „Bradford‟ Callery pear. Fact sheet ST-

537, Gainsville (FL): Environmental Horitculture Department, Florida Cooperative Extension

Service, Institute of Food and Agricultural Sciences, University of Florida.

Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R (1997) Microsatellites in

Malus x domestica (apple): abundance, polymorphism and cultivar identification. Theoretical

and Applied Genetics, 94, 249–254.

Handy GE (1980) U.S. Patent 4,530. Washington, DC: U.S. Patent and Trademark Office. May 6,

1980.

Harlan JR (1975) Crops and Man. American Society of Agronomy and Crop Sciences Society of

America. Madison, WI, pp. 295.

Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program CERVUS

accommodates genotyping error increases success in paternity assignment. Molecular Ecology,

16, 1099-1106.

44

Kitajima K, Fox AM, Sato T, Nagamatsu D (2006) Cultivar selection prior to introduction may increase

invasiveness: Biological Invasions, 8, 1471-1482.

Kowarik I (1995) In: Plant Invasions: General Aspects and Special Problems (eds.: Pysek P, Prach K,

Rejmanek M and Wade PM), pp. 15-38. SPB Academic, The Hague.

Kowarik I (2003) Human agency in biological invasions: secondary releases foster naturalization and

population expansion of alien plant species. Biological Invasions, 5, 293-312.

Lee CE (2002) Evolutionary genetics of invasive species. Trends in Ecology and Evolution, 17, 386-

391.

Lewis PO, Zaykin D (2001) Genetic Data Analysis: computer program for the analysis of allelic data.

Version 1.0, http://lewis.eeb.ucon.edu/lewishome/software.html

Lockwood JL, Cassey P, Blackburn T (2005) The role of propagule pressure in explaining species

invasions. Trends in Ecology and Evolution, 20, 223-228.

Mack RN, Simberloff D, Lonsdale WM (2000) Biotic invasions: causes, epidemiology, global

consequence, and control. Ecological Applications, 10, 689-710.

Mandryk AM, Wein RW (2006) Exotic vascular plant invasiveness and forest invisibility in urban

boreal forest types. Biological Invasions, 8, 1651-1662.

Marshall TC, Slate J, Kruuk L, Pemberton JM (1998) Statistical confidence for likelihood-based

paternity inference in natural populations. Molecular Ecology, 7,5, 639-655.

Mnejja M, Garcia-Mas J, Howad W, et al. (2004) Simple-sequence repeat (SSR) markers of Japanese

plum (Prunus salicina Lindl.) are highly polymorphic and transferable to peach and almond.

Molecular Ecology Notes, 4, 163-166.

Nei M (1978) Estimation of average heterozygosity and genetic distance from a small number of

individuals. Genetics, 89, 583-590.

45

Okada M, Ahmad R, Jasieniuk M (2007) Microsatellite variation points to local landscape plantings as

sources of invasive pampas grass (Cortaderia selloana) in California. Molecular Ecology, 16,

4956-4971.

Paetkau D, Calvert W, Stirling I, Strobeck C (1995) Microsatellite analysis of population structure in

Canadian polar bears. Molecular Ecology, 4, 347-354.

Peakall R, Smouse PE. (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for

teaching and research. Molecular Ecology Notes, 6, 288-295.

Piry S, Alapetite A, Cornuet J-M, Paetkau D, Baudouin L, Estoup A (2004) GENECLASS2: A

software for genetic assignment and first-generation migrant detection. Heredity, 95, 536-539.

Reichard SH, White P (2001) Horticulture as a pathway of invasive plant introductions in the United

States. BioScience. 51, 2, 103-113.

Reznick DN, Ghalambor CK (2001) The population ecology of contemporary adaptations: what

empirical studies reveal about the conditions that promote adaptive evolution. Genetica, 112,

183-189.

Sakai AK, Allendorf FW, Holt JS et al. (2001) The population biology of invasive species. Annual

Review of Ecology & Systematics, 32, 305-332.

Smith BD (1970) Natural pollen transfer. In Towards Regulated Cropping (Eds. Williams RR and

Wilson D), pp. 29-40, Grower Books.

Smouse PE, Peakall R (1999) Spatial autocorrelation analysis of individual multiallele and multilocus

genetic structure. Heredity, 82, 561-573.

Taylor CM, David HG, Cicille JC et al. (2004) Consequence of an Allee effect in the invasion of a

Pacific estuary by Spartina alterniflora. Ecology, 85, 3254-3266.

Taylor CM, Hastings A (2005) Allee effects in biological invasions. Ecology Letters, 8, 895-908.

46

Vincent, MA (2005) On the spread and current distribution of Pyrus calleryana in the United States.

Castanea, 70, 20-31.

Weir BS, Cockerham CC (1984) Estimating F-statistics for the analysis of population structure.

Evolution, 43, 860-869.

Whitehouse WE, Creech JL, Seaton GA (1963) Bradford ornamental pear – a promising shade tree.

American Nurseryman, 117, 7-8, 56-60.

Williams DE, Overholt WA, Cuda JP Hughes CR (2005) Chloroplast and microsatellite DNA

diversities reveal the introduction history of Brazilian peppertree (Schinus terebinthifolius) in

Florida. Molecular Ecology, 14, 3643-3656.

Yamamoto T, Kimura T, Sawamura Y et al. (2002) Simple sequence repeats for genetic analysis in

pear. Euphytica, 124, 129-137.

47

FIGURE LEGENDS

FIGURE 2.1

Principle coordinates analysis comparing cultivars to putative parent and invasive populations of Pyrus calleryana. Each letter represents one type of cultivar: (A) Bradford, (B) Aristocrat, (C) Avery Park,

(D) Whitehouse, (E) Capital, (F) Grant St. Yellow, (G) Valzam, (H) Autumn Blaze, (I) Cleveland (also represents Chanticleer and Stonehill), (J) Early Red, (K) Princess, (L) Redspire, (M) New Bradford, (N)

Faurie. Panel (a) represents the Ohio site with the putative parent (N = 84) and the invasive populations

(N = 102), (b) represents the Tennessee site with the putative parent (N = 59) and the invasive (N = 60) populations, (c) represents the Maryland site with the trees found in the USDA Plant Introduction

Station, which are also putative parents (N = 20), a second putative parent population originating from the USDA Introduction Station (N = 36), and the invasive population (N = 95). Multiple putative parent individuals may stack on top of a cultivar.

FIGURE 2.2

Proportion of cultivar genotypes found in putative parent and invasive populations for the Maryland,

Tennessee and Ohio sites. The cultivar type of each putative parent individual was determined using the frequency-based analysis in GeneClass2. Putative parent percentages represent the proportion of data simulations that identified the presence of a given cultivar, with an assignment criterion of 99%.

Putative parent sample sizes were 78 for Ohio, 60 for Tennessee, and 56 for Maryland. For the invasive populations, the parental cultivar type was identified with a positive LOD score and at least 80% confidence. Unknown parental assignments were cultivars that did not meet those criteria. Invasive population sample sizes were 99 for Ohio, 60 for Tennessee, and 95 for Maryland.

48

FIGURE 2.3

(a) The number of cultivars found to contribute to each invasive individual‟s multi-locus genotype, based on diagnostic alleles for each cultivar found in the putative parent populations. Individuals with greater than or equal to two contributing cultivars represent genetic admixture between cultivars.

Individuals with greater than or equal to three contributing cultivars are indicative of hybrids beyond the F1 generation. (B) The proportion of putative parent individuals that were identified as having more than one cultivar‟s diagnostic alleles. These individuals were not characterized by PCoA or assignment analyses and appear to be offspring of crosses between cultivars.

FIGURE 2.4

The relationship between the average number of diagnostic alleles in invasive individuals and the LOD score. A high number of diagnostic alleles indicates extensive admixture, while a negative LOD score indicates that a parent cultivar was unable to be assigned to a particular invasive individual.

49

1 Table 2.1. Polymorphic microsatellite primers amplified in Pyrus calleryana. Given are forward (F) and reverse (R) primer

2 sequences, range of loci length, repeat motif, fluorescent label used in multiplexing, and the original reference and species for

3 which primers were developed (denoted by asterisks) or tested for amplification.

Species Primer Name Primer Sequence (5' - 3') Length (bp) Repeat Label Reference Developed In KA16 F: gcc agc gaa ctc aaa tct 129-160 (ct)4t(tc)17 NED Yamamoto et al. 2002 Pyrus pyrifolia*, R: aac gag aac gac gag cg P. bretschneideri,

KU10 F: agt atg tga cca ccc cga tgt t 265-292 (ct)20 6FAM " " P. ussuriensis, R: aga gtc ggt tgg gaa atg att g P. communis* Gianfranceschi et al. CH01F02+ F: acc aca tta gag cag ttg agg 172-199 (ag) VIC 22 1998 Malus x R: ctg gtt tgt ttt cct cca gc domestica*, + M. floribunda CH01H01 F: gaa aga ctt gca gtg gga gc 97-118 (ag)25.5 VIC " " R: gga gtg ggt ttg aga agg tt + CH01H10 F: tgc aaa gat agg tag ata tat gcc a 116-123 (ag)21 NED " " " " R: agg agg gat tgt ttg tgc ac

CH02B03b F: ata agg ata caa aaa ccc tac aca g 82-108 (ga)22 6FAM " " " " R: gac atg ttt ggt tga aaa ctt g

CH02B10 F: caa gga aat cat caa aga ttc aag 116-156 (ga)19.5 NED " " " " R: caa gtg gct tcg gat agt tg

CH02D11 F: agc gtc cag agc aac agc 105-140 (ag)21 VIC " " " " R: aac aaa agc aga tcc gtt gc

CH02D12 F: aac cag att tgc ttg cca tc 210-227 (ga)19 6FAM " " " " R: gct ggt ggt aaa cgt ggt g +previously tested in three cultivars of P. calleryana (Yamamoto et al. 2001)

50

Table 2.2: Descriptive population statistics for Pyrus calleryana cultivars and sampled populations. N, number of individuals; P, proportion polymorphic loci (99% level); A, average number of alleles at a locus; He, expected heterozygosity based on Hardy-Weinberg expectations; Ho, observed heterozygosity. Calculations for expected heterozygosity, He, based on one sample are not valid and, therefore, not included.

Cultivars n P A H e H o Aristocrat 19 1.0 2.1 0.52 1.00 Bradford 11 0.8 1.8 0.41 0.78 Cleveland 22 0.9 1.9 0.40 0.78 Chanticleer 4 0.8 1.8 0.44 0.78 Stonehill 2 0.8 1.8 0.52 0.78 Redspire 11 0.8 1.8 0.21 0.36 Capital 12 0.9 2.4 0.46 0.79 New Bradford 7 0.8 1.8 0.37 0.65 Faurie 1 0.9 1.9 - 0.89 Autumn Blaze 3 0.9 1.9 0.50 0.70 Early Red 1 0.7 1.7 - 0.67 Valzam 1 0.8 1.8 - 0.78 Princess 1 0.4 1.4 - 0.44 Grant St. Yellow 1 0.7 1.7 - 0.67 Whitehouse 1 0.7 1.6 - 0.67 Avery Park 1 0.6 1.6 - 0.56 Mean 0.8 1.8 0.4 0.7 Putative Parent Populations Tennessee 58 1.0 7.8 0.57 0.76 Maryland - USDA 20 1.0 8.7 0.81 0.69 Maryland 36 1.0 8.1 0.77 0.71 Ohio 77 1.0 6.2 0.67 0.74 Mean 48 1.0 7.7 0.7 0.7 Invasive Populations Tennessee 59 1.0 9.6 0.77 0.71 Maryland 95 1.0 11.4 0.82 0.73 Ohio 99 1.0 9.1 0.71 0.72 Mean 84 1.0 10.0 0.8 0.7

51

Table 2.3. Descriptive population statistics by locus across Pyrus calleryana cultivars of known type.

P, proportion polymorphism across cultivars (99% level); A, average number of alleles; He, expected frequency of heterozygotes; Ho, observed frequency of heterozygotes; and the number of cultivar diagnostic alleles for each locus.

Diagnostic Locus P A H H e o Alleles CH01F02 1.0 15.0 0.83 0.84 6 CH02B10 1.0 10.0 0.71 0.73 1 CH02D11 1.0 21.0 0.86 0.83 3 CH2D2 1.0 12.0 0.78 0.65 2 KU10 1.0 12.0 0.73 0.65 2 CH01H01 1.0 13.0 0.77 0.49 2 CH01H10 1.0 11.0 0.61 0.64 1 CH02B03b 1.0 21.0 0.87 0.91 6 KA16 1.0 17.0 0.87 0.85 5

52

Table 2.4. Coefficients for θ (below diagonal) and Nei's (1978; above diagonal) genetic identity for nine Pyrus calleryana cultivars. * represents significant deviation from zero (P < 0.05).

Aristocrat Bradford Cleveland Capital Redspire New Bradford Autumn Blaze Chanticleer Stonehill Aristocrat - 0.415 0.155 0.320 0.098 0.201 0.206 0.161 0.172 Bradford 0.419* - 0.234 0.298 0.159 0.143 0.220 0.242 0.260 Cleveland 0.512* 0.545* - 0.290 0.597 0.516 0.371 1.057 1.135 Capital 0.432* 0.500* 0.503* - 0.284 0.328 0.177 0.299 0.321 Redspire 0.596* 0.666* 0.468* 0.593* - 0.897 0.393 0.616 0.661 New Bradford 0.501* 0.593* 0.450* 0.501* 0.260* - 0.263 0.530 0.570 Autumn Blaze 0.470* 0.545* 0.496* 0.517* 0.631* 0.552* - 0.385 0.413 Chanticleer 0.493* 0.548* -0.001 0.491* 0.534* 0.465* 0.484* - 1.182 Stonehill 0.488* 0.548* -0.001 0.483* 0.551* 0.465* 0.463* 0.00 -

53

Table 2.5: Frequency of diagnostic alleles for each cultivar in each invasive and putative parent population. An allele was considered diagnostic for parental types if it occurred in all individuals of a known cultivar, and was identified in the test populations regardless of genotype at each locus. Statistical comparisons between invasive and putative parent populations for each site were not significant (Paired t-test, t[17] = 0.03, P = 0.98).

Ohio Tennessee Maryland Invasive Parent Invasive Parent Invasive Parent Aristocrat 0.41 0.17 0.27 0.00 0.09 0.08 Bradford 0.43 0.53 0.38 0.90 0.26 0.21 Chanticleer 0.10 0.12 0.07 0.04 0.22 0.18 Capital 0.03 0.01 0.21 0.00 0.26 0.39 Redspire 0.03 0.13 0.05 0.02 0.13 0.05 Faurie 0.01 0.04 0.02 0.04 0.04 0.08

53

Figure 2.1

54

Figure 2.2

55

Figure 2.3

56

Figure 2.4

57

Chapter 3

Reproductive success of cultivated Pyrus calleryana and establishment ability of invasive,

hybrid progeny

(to be submitted to the American Journal of Botany)

Nicole A. Hardiman & Theresa M. Culley

Department of Biological Sciences

University of Cincinnati

614 Rieveschl Hall

Cincinnati, OH USA 45221-0006

Corresponding author – Email: [email protected], Tel: 513-556-9705

Keywords: cultivation, intraspecific hybridization, invasive, propagule pressure, Pyrus calleryana

58

ABSTRACT

The function of intraspecific hybridization in the evolution of invasiveness is still relatively understudied, especially with respect to the initial establishment and persistence of invasive populations. Species subject to multiple introductions of divergent populations may benefit from new genetic combinations created during hybridization events and/or demographic releases from founder populations. In this study, we quantify the outcome of hybridization between genetically different cultivars of Pyrus calleryana in a common garden experiment.

Previously, Pyrus calleryana cultivars have been shown to be highly genetically divergent and invasive populations of the species were composed of hybrid individuals containing highly admixed cultivar genotypes. Measures of reproduction (e.g. percent seed viability and seed mass) and establishment ability (including measures of ecophysiology, mortality, and survival) were collected to assess if particular cultivars were more likely to establish invasive populations and if genetic admixture through hybridization translated to increased reproduction and establishment of hybrid offspring. Significant differences were only detected in measures of reproduction ability, but no specific cultivar or hybrid type emerged as consistently more fecund.

Late generation hybrids, which are more genetically admixed, also had significantly less biomass accumulation, indicating a reduction in hybrid performance relative to the cultivated progeny.

Ultimately, this study indicates that the sudden increase in spread and establishment of Pyrus calleryana may have been initiated by introduction of multiple types of ornamental cultivars and subsequent widespread planting.

59

INTRODUCTION

In the process of invasion, a lag period is defined as the time between the introduction and naturalization of a non-indigenous species (Roman and Darling 2007). Many non- indigenous species never proceed past the lag period, and only species exhibiting invasive tendencies spread outside of initially introduced populations. The time frame of lag periods is variable and species-specific (Sakai et al. 2001) but the average delay in invasion for plants has been calculated to range from 130 to 170 years, depending on the growth form of the species

(Kowarick 1995). Exactly how these species progress from small founding populations during the lag period to become widespread and invasive is still unknown. Invasion success may be determined by greater propagule pressure, such that the increased occurrence of a species positively correlates to the likelihood of naturalization and establishment (Van Holle and

Simberloff 2005). Another possibility is if release from a lag period is caused by mechanisms that promote change on either demographic and/or genetic levels. On such mechanism of change may be hybridization, resulting in novel genetic combinations in introduced populations that have synergistic effects on invasion potential and rate of spread (Roman and Darling 2007).

Multiple introductions through human-mediated activity are an additional factor increasing the probability of naturalized establishment (Barrett and Husband 1990); the function of which is to release founder populations from Allee effects that may be limiting population growth due to low initial population size or density (Stephens et al. 1999). Allee effects can weaken as the number of introduction events accumulates through time, resulting in a rapid increase in the rate of spread (Cohen and Carlton 1998). Such multiple introduction events may reflect numerous primary introductions from across the native range (Kolbe 2004) or in some cases, through secondary introductions that occur via commercial and agricultural distribution

60

channels (Kowarick 2003). The overall effect is to increase the propagule pressure of the species within the introduced range, by expanding the number and size of introduction events. Genetic change can also occur in non-indigenous species with a history of numerous introductions.

Different genotypes from distinct source populations in the native range can admix in new habitats, resulting in progeny with high genetic diversity relative to the initially introduced populations. Approximately 69% of invasive plant species have genetic diversity greater than or equal to their native counterparts (Bossdorf et al. 2005), and there is an increasingly recognized connection between multiple introductions and genetic diversity (Kelly 2006).

Hybridization may allow species to not only overcome limitations of small population size, but to also have an increased rate of spread through evolutionary processes (Ellstrand and

Schierenbeck 2000). Species whose introductions originate from several source populations and are brought together in the introduced range may produce intraspecific hybrids that exhibit new genetic variability (Rieseberg 1995). Thus, hybrids may have increased variation in their ability to respond to new habitats through novel, invasion-related phenotypes. Although a majority of recombined genotypes may not exhibit any advantage, a subset “may represent better adaptations to certain environments” (Stebbins 1969). Vigorous hybrid types may exhibit greater reproductive capacity or establishment ability, which enables expansion of populations. Late generation intraspecific hybrids can also exhibit increased fitness relative to early generation hybrids, which is attributed to epistasis among linked loci and can result in beneficial genetic synergism within populations (Erickson and Fenster 2006, Fenster and Galloway 2000).

A model species for testing the effects of intraspecific hybridization on invasive potential is Pyrus calleryana, a popular ornamental tree that has as many as 29 commercially available cultivars. Native to Asia, the species is in the beginning stages of widespread invasion (Culley

61

and Hardiman 2007). Naturalized and/or invasive populations have been identified in at least 26 states across the United States. Although the species has been introduced since the 1900‟s, the first documented naturalized populations were not identified until 1964, with 50% of invasive populations occurring since 2000 (Vincent 2005). The species exhibits gametophytic self incompatibility, such that an individual cannot produce seed through self-fertilization (de

Nettancourt 2001). Cultivars appear to have extensive genotype variation at the self- incompatibility locus, because cultivars are able to freely cross with one another in cross- pollination experiments (Hardiman and Culley, in prep). Invasive populations have previously been found to be composed of novel genetic combinations of distinct cultivar genotypes

(Hardiman and Culley, in prep). If cultivars are variable for traits related to fitness and establishment ability, these new genetic combinations in invasive hybrid individuals may result in the “best of both worlds”, where the invasive progeny possess beneficial traits from both cultivars.

The purpose of this study was to identify the potential for intraspecific hybridization between cultivars to increase the rate of spread of Pyrus calleryana. The hypothesis is that invasive individuals exhibit greater hybrid performance in terms of reproductive capability and establishment potential due to advantageous combinations of specific cultivar genotypes or due to increased genetic admixture. This study consisted of two different experiments. The first evaluated early generation hybrids obtained from known maternal cultivars. This comparison served to identify cultivars that have a higher-than-expected reproductive contribution and to also detect hybrid vigor among cultivar progeny. The second test examined hybrid performance in early (F1) versus late generation progeny, where increasing genetic admixture in late generation progeny is hypothesized to result in greater performance. Maternal reproductive

62

success was compared between cultivated and invasive parents, and establishment ability was compared between the resultant progeny seedlings. If hybrid combinations do not significantly differ, then there is no evidence for specific genetic combinations contributing to quantifiable increases in traits related to invasive potential. An alternative explanation for the lag period release of the Callery pear is that all individuals, regardless of cultivar parentage or level of genetic admixture are equally capable of contributing to the spread of invasive populations. By identifying the role of intraspecific hybridization in Pyrus calleryana, it may be possible to elucidate the factors contributing to invasive potential in this species.

MATERIALS AND METHODS

Sampling protocol: cultivar comparisons

Mature fruits were collected in 2006 from individuals of known cultivar type located in a common garden at Long Branch Farm in Goshen, Ohio and in a city park at Heritage Park in

Westerville, Ohio. Sampled cultivars included „Bradford‟, „Chanticleer‟, „Aristocrat‟,

„Redspire‟, „Cleveland Select‟, „Stonehill‟, „Faurie‟, „Capital‟ and „Autumn Blaze‟. Sample sizes for maternal trees varied because collection was performed based on availability of individuals and fruits. An average of 3.4 individuals was sampled for each cultivar, with a range of one to five individuals. For each tree, five fruits were collected and stored at room temperature.

Sampling protocol: early versus late generation hybrids

Six sites, each including both an invasive population and a nearby cultivated population, were located across Hamilton County, Ohio and Boone County, Kentucky. In Hamilton County, invasive populations were identified at the Harris M. Benedict Nature Preserve and at Armleder

63

Park (Hamilton County Park District) in Cincinnati, Ohio. In Kentucky, populations were located along roadsides and in old field areas along Highway KY18, State Routes 536 and 338, and

Mary Grubbs Highway. At each location, five fruits were collected from each of five invasive and five cultivated individuals. Two sites (Armleder Park and Mary Grubs Highway) had small invasive Callery pear populations, so fruits were collected from only two trees each in the invasive and cultivated populations. Seeds obtained from the fruits produced by nearby cultivated individuals were designated early generation hybrids, and seeds obtained from fruits produced from invasive individuals were designated late generation hybrids. To verify that late generation hybrids were more genetically admixed than early generation hybrids, genetic analysis of cultivar contribution was conducted according to the method of Hardiman and Culley

(Chapter 2), using cultivar-specific diagnostic alleles. Fifteen individuals representing the early generation hybrids and fifteen representing the late generation hybrids were randomly selected for genetic analysis. After determining the number of cultivar diagnostic alleles for each tree‟s multi-locus genotype, a Wilcoxon non-parametric test was used to compare significant differences in the number of contributing cultivars between the two groups.

Maternal reproductive success

Fruit mass was determined for a total of 155 fruits for the cultivar comparison and 245 fruits for the hybrid comparison. Seeds were extracted from all fruits within seven days following collection and the number of viable and inviable seeds, as determined by visual conformation of seed abortion, was recorded. Viable seeds for all individuals were weighed seperately using a Mettler-Toledo AG204 analytical balance (Columbus, OH), for a total of 728 seeds for the cultivar comparison and 793 seeds for the hybrid comparison.

64

Establishment ability

Seven to ten days following extraction and weighing, seeds were germinated according to

Hummer and Postman (2003). Seeds were soaked in water for 24 hours, then surface sterilized in 10% bleach solution for 5 minutes. They were then stratified between filter paper in petri dishes and stored at 5ºC. Seeds began germinating after 14 days, and percent germination was recorded as the number of seeds that had produced root radicals following 45 days of cold stratification. As they germinated, seeds were planted, equally spaced, in 10.2 x 10.2 cm pots

(nine seeds per pot), containing Pro-Mix planting media. The pots were placed in a M12

Environmental Growth Chamber (Chagrin Falls, Ohio), where temperature and light were alternated between 15ºC for 14 hours of darkness and 25ºC for 10 hours of light (Hummer and

Postman 2003). Pots were randomly arranged initially within the growth chamber, and then rotated in flats and watered every two days. Osmocote fertilizer was applied after two weeks within the growth chamber. Mortality was recorded as the number of seeds that did not emerge following initial planting or as the number of seedlings that perished during the growing season.

After the first two true leaves emerged, each seedling was transplanted to a 5 x 5 cm pot and transferred to an outdoor common garden in Boone County, Kentucky. The common garden consisted of a covered, fenced deer exclosure where pots were randomized. Throughout the season, plants were watered every two days and fertilized once per month. Half-way through the growth season (mid-July), seedlings were transplanted to 10 x 25 cm Treepots™ (Stuewe and

Sons, Corvallis, OR).

To quantify the photosynthetic ability and water use efficiency of progeny, instantaneous ecophysiology measures were obtained with a LiCor-6400 infrared gas analyzer (IRGA; Li-Cor,

Lincoln, NE) beginning October 1, 2007, when the saplings were approximately six months old.

65

These measures included photosynthetic rate (A), stomatal conductance (g), and water use efficiency (WUE, calculated as A/g). Individual plants were measured from 1000 to 1400 EST on six consecutive days in a greenhouse. Five saplings per maternal tree were randomly selected, for a total of 125 saplings for the cultivar comparison and 245 saplings for the hybrid comparison. Measurements were taken on the distal-most, fully-expanded leaf at the top of each individual. Conditions for the IRGA chamber were set as follows: air flow at 500 µmol/sec, reference and sample CO2 concentration set at 370 µmol, leaf temperature at 26ºC, leaf area at 3 cm2, and stomatal ratio at 0.5. Target relative humidity was approximately 40% and pressure was approximately 98 kPa. On each day of use, the CO2 concentration for the IRGA was standardized and calibrated. In order to determine the maximum photosynthetic rate (A) for the experiment, light response curves were determined for five randomly selected individuals. The photosynthetic rate was recorded at each light level of 0, 300, 600, 900, and 1200 PAR. For the five replicates, the curve approached the asymptote at 1200 PAR, and this value was used throughout the experiment. Following each photosynthetic measurement, the leaf section within the chamber was digitized and then its area was calculated using Image J software (Rasband

1997). Photosynthetic and conductance rates were then adjusted based on these area measures.

Finally, three saplings from each maternal source tree were randomly selected for above and below ground biomass measures, for a total of 75 saplings for the cultivar comparison and

147 saplings for the hybrid comparison. Each sapling was carefully removed from the pot and excavated from the soil. Roots were washed with water over a 1 mm mesh sieve. Above and below ground sapling components were separated and dried at 60ºC for 48 hours prior to weighing.

66

Statistical analysis

Statistical analyses were conducted using JMP v.7.0 (SAS Institute, Cary, NC). All variables for maternal reproductive success and establishment ability for both comparisons were first tested for normality using the Shapiro-Wilks test and homoscedasity using Bartlett‟s test.

The majority of untransformed variables were parametric with homogeneous variances, with a few exceptions. For the cultivar reproductive success comparison, fruit mass was log transformed to meet parametric criteria, but seed mass could not be appropriately transformed and was analyzed using a non-parametric test (see below). For the comparison between establishment of early and late generation hybrid types, percent germination could not be adequately transformed and was also analyzed with a non-parametric test.

For the cultivar comparison, effects of cultivar types and maternal source tree (nested within cultivar type) on most measures of reproduction and establishment were examined with mixed-model ANOVAs; the nested maternal source factor was used to determine the degree to which variation among maternal trees contributed to variation within cultivar types. For the hybrid comparison, the ANOVA model included fixed factors of hybrid type (early generation versus late generation) and site nested within hybrid type. For ecophysiology traits, a two-way

ANOVA included the fixed factors of hybrid type, date of measurement, and the interaction of type and date. For measures in which a significant effect was detected, a Tukey multiple comparisons test was performed to determine which specific groups differed significantly from the others. In the case of non-parametric variables, Kruskall-Wallis tests were used to test for significant variation between groups using ranked data. For measures in which the main effect was rejected, a non-parametric post-hoc test was used to test for significant differences among groups.

67

RESULTS

Among cultivar comparison

For maternal reproductive measures, highly significant differences (P < 0.0001) were detected among cultivar types for fruit mass and percent seed viability, as well as for the nested

ANOVA accounting for variation within cultivar sources (Table 3.1; Figure 3.1). The

„Chanticleer‟, „Cleveland‟ and „Faurie‟ cultivars had fruits with significantly greater mass (1.81 g, 1.50 g and 1.35 g, respectively) than other cultivar types (mean = 1.17 g). Averaged across all cultivars, 56% of seeds were viable. The „Autumn Blaze‟, „Capital‟, and „Redspire‟ cultivars had a significantly higher percentage of viable seeds (71%, 78% and 69% respectively) than other cultivars. Seed mass was also significantly different among cultivars (Table 3.1, Figure

3.1; Kruskall-Wallis: X2 = 72.61, P<0.0001), with significantly larger seeds produced in the

„Bradford‟, „Capital‟, and „Redspire‟ cultivars. From these data, all cultivars appear to be highly productive, but both the „Capital‟ and „Redspire‟ cultivars possessed significantly larger and more seeds than all others.

For the measures of establishment ability in the resultant hybrid progeny, there were no significant differences in percent seed germination (Table 3.1; Figure 3.2; Kruskall-Wallis X2 =

8.58, P = 0.38) and mortality (Kruskall-Wallis: X2 = 2.32, P = 0.97) among the progeny from different cultivars. Germination was high across all groups, with an overall average of 81% for all cultivars and ranging from 68% in the „Bradford‟ progeny to 95% in the „Cleveland‟ progeny.

Additionally, mortality was low across all groups, with an overall average of 9% of seedlings dying throughout the entire growing season. Photosynthetic, conductance and WUE rates were not significantly different among progeny types (Table 3.1; Figure 3.3). The average

68

photosynthetic rate among cultivar progeny was 11.8 µmol/m-2/s-1, ranging from 9.7 to 13.4

µmol/m-2/s-1. Stomatal conductance averaged 0.20 mmol/m-2/s-1, ranging from 0.14 to 0.21 mmol/m-2/s-1. WUE averaged 75.4 mmol m-1, and ranged from 59.8 mmol mol-1 in the „Faurie‟ cultivar to 87.2 mmol mol-1 in the „Bradford‟ cultivar. All of the above values are within the expected ranges, based on previous ecophysiology studies of woody species (Feng et al. 2007).

Significant differences in biomass accumulation across cultivar progeny (Table 3.1; Figure 3.2) was primarily driven by the „Faurie‟ cultivar having significantly less biomass. All hybrid progeny of the different cultivar types examined in this study appear to be readily able to establish, with high survival and rapid biomass accumulation in the first year.

Early Generation versus Late Generation Hybrids

Genetic analysis to examine the level of genetic admixture between the two hybrid groups revealed that the late generation hybrids had significantly more cultivars contributing to them (3.0) than early generation hybrids (2.1; Wilcoxon X2 = 9.25, df = 1, P = 0.0023), as determined by cultivar diagnostic alleles. For all maternal reproductive measures, there were significant differences between groups, with variation within sites also significant (Table 3.2;

Figure 3.4). In post-hoc analyses, the cultivated parents of early generation hybrids had significantly larger fruits and heavier seeds than invasive parents of late generation hybrids, but the latter produced significantly more viable seeds per fruit. Across both groups, an average of

54% of seeds was viable.

In terms of establishment ability of hybrid progeny, there were no significant differences among the two hybrid groups for percent germination (Table 3.2; Kruskall-Wallis: X2=1.44, P =

0.23), which was high but moderately variable for both groups, with germination rates of 89% for early generation hybrids and 69% of late generation hybrids. Mortality was also low and did

69

not significantly differ between the hybrid groups (Table 3.2; Figure 3.3), with both groups having 7% average mortality. Total biomass was significantly greater in early generation progeny (mean total biomass = 3.35 g) than late generation progeny (mean = 2.66 g), and this was due to significantly greater below ground biomass within the early generation hybrids (Table

3.2; Figure 3.5).

Photosynthetic rates, stomatal conductance rates, and WUE were not significantly different between early and late generation hybrids (Table 3.3; Figure 3.6). On the other hand, there was a highly significant effect of date (P <0.0001) but the interaction was not significant.

The average photosynthetic rate for early generation and late generation hybrid types was 11.9

µmol/m-2/s-1 and 11.1 µmol/m-2/s-1, respectively. Although stomatal conductance was three-fold higher in the early generation progeny, there were no significant differences due to high variation around the mean. WUE was also higher, but not significantly so, in the early generation progeny, with an average of 72.3 mmol mol-1 to 65.1 mmol mol-1 in the late generation progeny.

With the exception of the stomatal conductance in the late generation progeny, all ecophysiology values fell within the range of the cultivar progeny groups previously examined (see above).

Overall, these data indicate that invasive parents examined here are capable of producing more seeds than cultivated parents, but the early generation hybrids resulting from cultivated parents have significantly more biomass than late generation hybrids, with all other traits being similar.

DISCUSSION

Because cultivars of P. calleryana are genetically divergent and wild populations are known to consist of admixed individuals, intraspecific hybridization between cultivars and subsequent increased performance in hybrid progeny was hypothesized to have provided in part

70

the evolutionary jump-start needed to facilitate the invasive potential of the species and release from its lag period. However, hybridized progeny of the Pyrus calleryana cultivars examined here do not appear to exhibit significant greater hybrid performance, and progeny of invasive individuals do not have greater reproduction and establishment ability than early generation progeny. Regardless of the lack of vigor in any particular hybrid subset, progeny of cultivars still exhibited substantial seed set, germination rates and low levels of mortality, which may explain why invasive populations continue to persist. Additionally, the fact that early and late generation hybrids were equally able to establish suggests that invasive populations will continue to spread despite the lack of hybrid advantage relative to cultivated parents. Hybridization does not appear to result in specific beneficial genetic combination, at least in the early stages.

Rather, the availability of many types of cultivars has provided the propagule pressure necessary to facilitate hybridization and subsequently alter rates of reproduction in cultivated populations.

For invasiveness to evolve through hybridization, hybrid progeny of parental cultivars would have to possess novel genetic combinations that generate new vigorous invasion-related phenotypes (e.g. abundant flowering, rapid growth). Previous studies have shown that traits in invasive hybrid progeny are intermediate or vigorous relative to the same traits in their parents

(Suehs et al. 2004, Bossdorf et al. 2005, Ayers et al. 2008). Unfortunately, comparisons to parental cultivars were not possible in this study, because cultivars are not available as seed or seedlings as they are vegetatively propagated through grafting. If hybridization were to generate a significant genetic alteration in the Callery pear, invasive cultivar progeny should exhibit variation across hybrid types in traits relating to invasive potential (Rhode and Cruzan 2005).

Within this variable response to hybridization, a subset of hybrid types might exhibit greater fitness relative to other hybrid types. Vigor in a specific hybrid type would depend upon the

71

genetic contributions of the two admixing cultivars and the response of the hybrid to its environment. Studies in Avena barbata have shown that subsets of hybrid types exhibited hybrid vigor in fitness-related traits, while other hybrid types within the same generation exhibited hybrid breakdown (Johansen-Morris and Latta 2006). In the case of the Callery pear, no specific cultivar‟s progeny consistently emerged as more likely to contribute to invasive populations, indicating that no specific genetic combination resulted in increased establishment ability.

When comparing across cultivar types in Pyrus calleryana, maternal reproductive investment was more influential in invasive potential than progeny establishment ability. Three maternal cultivars had significantly larger fruits than all other groups. Larger fruits may be more desirable to frugivores (Wheelwright 1993); consequently, these cultivars may have more seeds dispersed into natural areas. Five cultivars also had higher numbers of seeds per fruit. The only cultivar that was common between these two measures was „Capital‟, which may indicate an advantage in overall reproductive capacity. However, in a related genetic analysis of invasive populations, the „Capital‟ cultivar did not contribute a disproportionately higher portion of progeny to invasive populations (N. Hardiman, unpubl. data). Additionally, all cultivars appear equally likely to establish in natural areas because all cultivar progeny had high germination and survival. Biomass accumulation among cultivar progeny was essentially the same with only the

„Faurie‟ progeny being significantly smaller than all other groups.

Cultivated parents of early generation hybrids produced fruits and seeds that were significantly larger than invasive parents of late generation hybrids. These results may be explained as a maternal effect of cultivated parents, which are located in a horticultural setting that usually includes abundant resources and little to no competition. This may confer an establishment advantage, since larger seeds are more likely to survive and persist in a seed bank

72

(Harrison et al. 2007). Invasive parents did have higher numbers of seeds, which could be evidence of increased performance in traits related to invasiveness. However, in the case of

Pyrus calleryana, higher numbers of seeds may actually reflect a larger number of compatible mates in invasive populations. Invasive populations of P. calleryana may have a higher diversity of self-incompatibility genotypes, which would increase the likelihood of encountering genetically different pollen and, therefore, result in an increase in the number of compatible crosses among invasive individuals (Lafuma and Maurice 2007).

Late generation progeny, which are more genetically admixed than early generation progeny, were also hypothesized to have increased hybrid performance relative to early generation progeny, but it was not detected in P. calleryana. Increases in fitness in late generation versus early generation progeny has been found in Chamaecrista fasciculate

(Erickson and Fenster 2006). In that study, genetic recombination in later generations via hybridization among progeny was responsible for increases in fitness relative to early generation progeny and parental ecotypes. For progeny establishment ability measures in P. calleryana, early generation progeny had significantly greater belowground biomass accumulation through the season, which was contrary to expectation. High biomass in early generations may be the result of hybrid vigor, but this is unknown since comparisons to cultivars could not be made.

Late generation progeny in this study are presumed to be composed of F2, F3 and back-crossed individuals, so any evolutionary responses may have yet to occur in invasive populations. In order to detect quantifiable evolutionary-based traits, future studies could focus on establishment ability in populations of varying age or examine the variation in responses to different types of environmental stressors, such as drought tolerance or light requirements.

73

Hybrids also did not differ significantly for ecophysiology measures. In a multi- population study of invasive Buddleja davidii, no differences across populations were also detected for the same ecophysiology measures (Feng et al. 2007). Given that the populations were found in a variety of habitat-types, this result was attributed to phenotypic plasticity and a

“general-purpose genotype” for the species. In Pyrus calleryana, significantly lower biomass in later generation progeny may actually provide evidence for decreased hybrid performance, at least in this life history stage. Because Pyrus calleryana cultivars have undergone artificial selection regimes that may have created a “cultivation-adapted” genetic architecture, extensive genetic admixture in invasive scenarios may actually serve to break-up the artificially-selected genome. Artificial selection regimes focus on a narrow suite of traits, which can include reproductive allocation and fecundity (Harlan 1975). Admixture in early generations may actually reduce the ability of Pyrus calleryana to perform in environmental conditions differing from horticultural settings. Given the relatively recent invasion timeline of the sampled populations, evolutionary responses increasing invasiveness may have not yet occurred and sampling in the oldest and most established populations may have yielded contrasting results.

In the case of Pyrus calleryana, cultivar hybridization does not necessarily translate to significantly increasing invasive potential via novel genetic combinations, at least in early generations of hybridization in newly invasive populations. Rather than one hybrid type contributing disproportionately to invasive progeny populations, all hybrid types appear to be equally and highly capable of reproducing and creating progeny that can successfully establish.

In cases where hybridization between cultivars is occurring, increase performance in specific subsets of cultivar progeny does not appear to be the primary mechanism for invasion success in this species, at least in the sites examined here. Another explanation is that cultivation and

74

widespread availability through commercial outlets has increased the overall propagule pressure of the species, which has facilitated naturalization. Many invasive species have horticultural origins (Reichard and White 2001), and horticulturally-important species have a history of numerous introductions (Mack 2000, Kowarik 2003). Pyrus calleryana has experienced multiple types of introductions in its history: 1) primary introductions from China and across

Asia at the turn of the century, 2) subsequent introduction over the last few decades of various cultivars, which are genetically differentiated (Hardiman and Culley, in prep), and 3) numerous and ongoing secondary introductions into cultivated settings within residential and commercial areas across the United States. These different introductions serve to increase the overall inoculum size of the species, which is positively correlated with an increased rate of invasion

(Roman and Darling 2007, Cohen and Carlton 1998). Therefore, the relatively recent emergence from the lag period in Pyrus calleryana seems more likely to be explained the introduction of various cultivar types, which provided enough genetic variation to overcome the reproductive limitation of self incompatibility and its associated Allee effect. Additionally, widespread ornamental plantings comprised of multiple cultivar types functioned to increase the inoculum size to the point at which not only naturalization occurred, but also so that the rate of invasion could rapidly increase. Subsequent introductions, via either increasing the number of cultivars or continuing to plant the species in large numbers, may continue to facilitate an accelerated rate of spread within invasive populations.

ACKNOWLEDGEMENTS

The authors would like to acknowledge Ken Petren, Steven Rogstad, Sarena Selbo, and

Jodi Shann for valuable input, data analysis advice, and helpful discussion. Jessica Brzyski, Matt

75

Klooster, Tracy Reeb, Tegan Smedley and Richard Stokes provided field and laboratory assistance. We would like to thank all landowners, including University of Cincinnati,

Cincinnati Nature Center, Hamilton County Parks, and many business and home owners.

Funding for this research was provided by the USDA CSREES Grant (#2006-35320-16565) to

Theresa Culley, and awards from the University of Cincinnati Research Council and the

Botanical Society of America to Nicole Hardiman.

REFERENCES CITED

Ayers DR, Zaremba K, Sloop CM, Strong DR (2008) Sexual reproduction of cordgrass hybrids

(Spartina foliosa x alterniflora) invading tidal marshes in San Francisco Bay. Diversity

and Distributions, 14, 187-195.

Barrett SC & Husband BC (1990) In: Plant Population Genetics, Breeding, and Genetic

Resources, eds. Brown AHD, Clegg MT, Kahler AL, Weir BS (Sinauer, Sunderland,

MA), pp. 254-278.

Bossdorf O, Auge H, Lafuma L, et al. (2005) Phenotypic and genetic differentiation between

native and introduced plant populations. Oecologia, 144, 1-11.

Campbell TS, Echternacht AC (2003) Introduced species as moving targets: changes in body

sizes of introduced lizards following experimental introductions and historical invasions.

Biological Invasions, 5, 193-212.

Cohen AN and Carlton JT (1998) Accelerating invasion rate in a highly invaded estuary.

Science, 279, 555-558.

Culley TM, Hardiman NA (2007) The beginning of a new invasive plant: a history of the

ornamental Callery pear in the United States. BioScience, 57, 956-964.

76

de Nettancourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. Springer,

Berlin.

Ellstrand NC, Schierenbeck KA (2000) Hybridization as a stimulus for the evolution of

invasiveness in plants? Proceedings of the National Academy of Sciences, 97, 7043-

7050.

Erickson DL and Fenster CB (2006) Intraspecific hybridization and the recovery of fitness in the

native legume Chamaecrista fasciculate. Evolution, 60, 225-233.

Feng YL, Auge H, Ebeling SK (2007) Invasive Buddleja davidii allocates more nitrogen to its

photosynthetic machinery than five native woody species. Oecologia, 153, 501-510.

Fester CB and Galloway LF (2000) Population differentiation in an annual legume: genetic

architecture. Evolution, 54, 1157-1172.

Harlan JR (1975) Crops and Man. American Society of Agronomy and Crop Science Society of

America. Madison, p. 295.

Hardiman NA, Culley TM (in prep) Cultivation and invasive potential: genetic evidence for

intraspecific hybridization in Pyrus calleryana.

Harrison SK, Reginer EE, Schmoll JT, Harrison JM (2007) Seed size and burial effects on giant

ragweed (Ambrosia trifida) emergence and seed demise. Weed Science, 55, 16-22.

Hummer KE, Postman JD (2003) Pyrus L. Pear. Available from: www.nsl.fs.fed.

us/wpsm/pyrus. pdf

Johansen-Morris AD, Latta RG (2006) Fitness consequences of hybridization between ecotypes

of Avena barbata: hybrid breakdown, hybrid vigor, and transgressive segregation.

Evolution, 60, 1585-1595.

77

Kelly DW et al. (2006) Contrasting patterns in genetic diversity following multiple invasions of

fresh and brackish waters. Molecular Ecology, 15, 3641-3652.

Kowarick I (1995) In: Plant Invasions: General Aspects and Special Problems, eds. Pysek P,

Prach K, Rejmanek M, and Wade PM (spb Academic, The Hague), pp.15-38.

Kowarik I (2003) Human agency in biological invasions: secondary releases foster naturalization

and population expansion of alien plant species. Biological Invasions, 5, 293-312.

Lafuma L, Maurice S (2007) Increase in mate availability without loss of self-incompatibility in

the invasive species Senecio inaequidens (Asteraceae). Oikos, 116, 201-208.

Mack RN (2000) Cultivation fosters plant naturalizations by reducing environmental

stochasticity. Biological Invasions, 2, 111-122.

Rasband WS, Image J, U.S. National Institutes of Health, Bethesda, Maryland, USA, http://rsb.

Info.nih.gov/ij, 1997-2007.

Reichard SH, White P (2001) Horticulture as a pathway of invasive plant introductions in the

United States. BioScience. 51, 103-113.

Rieseberg LH (1995) The role of hybridization in evolution: old wine in new skins. American

Journal of Botany, 82, 944-953.

Rhode JM and Cruzan MB (2005) Contribution of heterosis and epistasis to hybrid fitness.

American Naturalist. 166, E124-E139.

Roman J, Darling JA (2007) Paradox lost: genetic diversity and the success of aquatic invasions.

Trends in Ecology and Evolution, 22, 454-464.

Sakai AK, Allendorf FW, Holt JS, et al. (2001) The population biology of invasive species.

Annual Review of Ecology & Systematics, 32, 305-332.

78

Stebbins GL (1969) The significance of hybridization on plant taxonomy and evolution. Taxon

18, 26-35.

Stephens PA, Sutherland WJ, Freckleton RP (1999) What is the Allee effect? Oikos, 87, 185-

190.

Suehs CM, Affre L, Medail F (2004) Invasion dynamics of two alien Carpobrotus (Aizoaceae)

taxa on a Mediterranean island: I. genetic diversity and introgression. Heredity, 92, 31-

40.

Van Holle B, Simberloff D (2005) Ecological resistance to biological invasion overwhelmed by

propagule pressure. Ecology, 86, 33212-3218.

Vincent, MA (2005) On the spread and current distribution of Pyrus calleryana in the United

States. Castanea, 70, 20-31.

Wheelwright NT (1993) Fruit size in a tropical tree species: variation, preference by birds, and

heritability. Vegetatio, 107, 163-174.

79

FIGURE LEGENDS

FIGURE 3.1

Comparisons of maternal reproductive success characters, measured as fruit mass, seed mass, and seed viability, among Pyrus calleryana cultivar types. Different letters indicate significant differences (P < 0.05) in post-hoc multiple comparisons tests.

FIGURE 3.2

Comparisons of establishment ability, measured as percent germination, percent mortality and above and below-ground biomass, in early-generation hybrid progeny of Pyrus calleryana.

Letters indicate significantly different groups (P < 0.05) in post-hoc multiple comparisons test.

Significant groupings are the same for above and below ground measures.

FIGURE 3.3

Photosynthetic and conductance rates, as well as water use efficiency (WUE) measured across early-generation hybrid types. No significant differences were detected across groups for all measures.

FIGURE 3.4

Comparisons of maternal reproductive success characters, measured as fruit mass, seed mass and seed viability, between cultivated parents of early generation hybrids and invasive parents of late generation hybrids. Greater than statements indicate significant differences (P < 0.05) in post- hoc multiple comparisons.

FIGURE 3.5

Comparisons of establishment ability, measured as percent germination, percent mortality and above and below-ground biomass, between early generation hybrids and late generation hybrids.

80

Letters indicate significant differences (P < 0.05) in post-hoc multiple comparisons. The significant difference in biomass was due to below ground biomass only.

FIGURE 3.6

Photosynthetic and conductance rates, as well as water use efficiency (WUE), comparing early- generation hybrid types versus later generation hybrid types. No significant differences were detected across groups for all measures.

81

Table 3.1: Statistical analyses for Pyrus calleryana cultivar reproductive measures, including fruit mass, seed mass and percent seed viability, as well as hybrid progeny establishment ability measures, including percent germination, percent mortality, ecophysiology measures and above and below-ground biomass. Each trait was analyzed separately and presented is the ANOVA mixed model F-statistic or Kruskall-Wallis X2 value for each trait. Absent values indicate that specific test was not performed. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Source of Variation Maternal Among Source within Cultivars Cultivars Trait Statistic df = 8 df = 22 Cultivar Reproduction Fruit Mass F 4.68**** 3.52**** Seed Mass X2 72.61***** - Seed Viability F 18.50**** 4.13**** Hybrid Establishment Germination X2 8.58 - Mortality X2 2.32 - Biomass Above F 2.97** 1.40 Below F 2.46* 1.41 Photosynthetic Rate F 1.21 0.66 Conductance Rate F 1.06 0.80 WUE F 1.34 0.95

82

Table 3.2: Statistical analyses for cultivated and invasive parent reproductive ability, measured as fruit mass, seed mass, and percent seed viability; as well as establishment ability measures between early-generation and late-generation hybrid progeny, including percent germination, percent mortality, and above and below-ground biomass. Each trait was analyzed separately and presented is the ANOVA F-statistic or Kruskall-Wallis X2 value for each trait. Absent values indicate the specific test was not performed. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Source of Variation Between Sites within Types Type Trait Statistic df = 1 df = 11 Reproduction Fruit Mass F 180.23**** 10.16**** Seed Mass F 209.21**** 16.85**** Seed Viability F 17.79**** 4.82**** Establishment Mortality F 0.43 0.80 Germination X2 1.44 - Biomass Above F 2.39 4.09** Below F 8.25** 2.62*

83

Table 3.3: Statistical analyses for ecophysiology measures between early-generation and late- generation hybrid progeny. Presented are the ANOVA F-statistic for each variable. *P<0.05,

**P<0.01, ***P<0.001, ****P<0.0001.

Source of Variation Between Among Dates x Types Dates Types Trait Statistic df = 1 df = 6 df = 6 Photosynthetic F 0.45 25.29**** 0.62 Rate Conductance F 0.04 11.20**** 1.87 Rate WUE F 4.54 23.79**** 1.58

84

Figure 3.1

85

Figure 3.2

120% 100% 80% 60%

Germination 40% 20% 0%

20%

15%

10% Mortality 5%

0%

6 5 4 3

2 Biomass (g)Biomass 1 Above 0 Below

Capital Faurie Aristocrat Bradford Cleveland Redspire Stonehill Chanticleer Autumn Blaze Maternal Source

86

Figure 3.3

20.0

) -1

s 15.0 -2 10.0

(µ mol(µ m 5.0 A A 0.0

0.30

) 0.25

-1 s

-2 0.20 0.15

0.10 (mmol m

g 0.05 0.00

140.0

) 120.0 -1 100.0 80.0 60.0 40.0 WUE(mmol m 20.0 0.0

Capital Faurie Bradford Cleveland Redspire Stonehill Aristocrat Chanticleer Autumn Blaze Maternal Source

87

Figure 3.4

3.00 Early>Late Early 2.50 Late 2.00 1.50

1.00 FruitMass(g) 0.50 0.00

30.00 Early>Late 25.00 Early>Late 20.00 15.00 10.00

SeedMass(mg) 5.00 0.00

120% Late>Early 100% 80% 60%

SeedViability 40% 20% 0% 338 536 AP HZ KY18 MG Site

88

Figure 3.5

120%

100%

80% Early 60% Late

Germination 40%

20%

0%

30% 25% 20% 15%

Mortality 10% 5% 0%

3.0

2.0

1.0 AboveGround Biomass (g) 0.0

4.0

3.0

2.0

1.0 BelowGround Biomass (g) 0.0 338 536 AP HZ KY18 MG Site

89

Figure 3.6

30.0 Early

) 25.0 Late

-1 s

-2 20.0 15.0

10.0 (µmol m

A 5.0 0.0

0.4

)

-1 s

-2 0.3

0.2 (mmol m (mmol

g g 0.1

0.0

100.0

) -1 80.0 60.0 40.0

WUE (mmol mol(mmol WUE 20.0 0.0 338 536 AP HZ KY18 MG Site

90

Chapter 4

The role of self-incompatibility in invasive potential of Pyrus calleryana

(to be submitted to Biological Invasions)

Nicole A. Hardiman & Theresa M. Culley

Department of Biological Sciences

University of Cincinnati

614 Rieveschl Hall

Cincinnati, OH USA 45221-0006

Corresponding author – Email: [email protected], Tel: 513-556-9705

Keywords: cultivation, gametophytic self-incompatibility, invasive, Pyrus calleryana

91

ABSTRACT

Introduced species that exhibit self-incompatibility (SI) are thought to be less likely to become invasive because reproduction is not assured in small founder populations.

Alternatively, SI may become an advantage in an introduced species after a sufficient number of individuals and/or different SI alleles accumulate, because it promotes outbreeding and gene flow among populations. Subsequently, the rate of reproduction in introduced populations may escalate as population sizes increase and relatedness among individuals decreases. Pyrus calleryana is an ornamental tree that exhibits gametophytic SI and is an emerging invasive in at least 26 states. Crossing between cultivars has been shown to be the primary source for invasive individuals, but reasons behind the substantial reproductive capacity in the species have yet to be determined. The goals of this experiment were to genetically characterize Pyrus calleryana cultivars at the SI locus and verify its functionality with a cross-pollination experiment. In addition, the relationship between genetic polymorphism and reproductive capacity was examined. The hypothesis was that various commercially-available cultivars are genetically variable at the SI locus, which is expected to translate into high fruit set in cross pollinations between cultivars. While amplification of the SI locus was not consistent across all cultivars, results indicate each cultivar has a unique set of SI alleles. Outcrossing appears to be freely occurring between cultivars, with few limitations to fruit set in the cross-pollination experiment.

Introduction of other self-incompatible, non-indigenous species can potentially be managed by limiting the amount of introduced genetic diversity and, therefore, reducing the potential for naturalization and increased invasion potential.

92

INTRODUCTION

Self-incompatibility (SI), defined as the inability of fertile, hermaphroditic flowers to set seed after self-pollination (deNattencourt 2001), is not a trait usually associated with invasive plant species. Of the many studies that have attempted to generalize the characters of invasive plant species, the ability to propagate through self-fertilization, including autogamy or geitonogamy, is the most commonly listed breeding system (Baker 1974, Rejamanek and

Richardson 1996, Kolar and Lodge 2001). Introduced taxa that exhibit SI are thought to be less likely to become invasive than self-compatible species because reproduction is not assured through selfing and/or due to a stronger Allee effect preventing population growth (Stebbins

1957; Lloyd 1992). SI systems require multiple SI alleles to maintain cross-compatibility

(Lafuma and Maurice 2007), which has been empirically verified in natural populations

(Emerson 1938, Campbell and Lawrence 1981, Richman et al. 1996) and is explained by negative frequency-dependant selection for rare alleles (Wright 1939). Consequently, a larger population size is required to maintain sufficient genetic diversity for successful reproduction

(Elam et al. 2007).

Alternatively, SI may become an advantage for introduced species after a sufficient number of individuals with different SI alleles have been introduced into founder populations, because it promotes outbreeding and gene flow among populations (Castric and Vekemans

2004). In the context of invasiveness, such outcrossing can promote novel genetic combinations; therefore the rate of reproduction in introduced populations may increase as populations grow larger and relatedness among individuals decreases (Elam et al. 2007). Obligate outcrossing can also alter the available genetic diversity and genetic structuring across metapopulations, which is important for evolutionary success (Hiscock and Tabah 2003). How SI influences invasive

93

potential of introduced species has only recently been empirically studied and population genetic analyses of self-incompatible invasive species have rarely been performed (but see: Brennan et al. 2002, Mena-Ali and Stephenson 2007).

SI can be achieved through either physical or genetic mechanisms (Ganders 1979, Barrett

1998). Physical SI flowers are characterized by herkogamy or dichogamy, in which selfing is prevented by either spatial or temporal segregation of floral sexual structures. In genetically- based systems of pollen and stigma recognition and rejection (i.e. sporophytic and gametophytic

SI), compatible crosses can only occur between individuals that do not share the same SI genotype or allele. Sporophytic SI is a multi-locus mechanism that prevents self-crossing by rejecting diploid pollen tissue possessing the same SI genotype as the stigma genotype, producing either compatible or incompatible crosses. In the gametophytic SI system, the interaction between the haploid pollen tissue and diploid genotype of the stigma determine if fertilization between two individuals will be fully compatible, semi-compatible, or incompatible.

If a SI allele is shared between the pollen and stigma, pollen tube growth down the style will be prevented by ribonuclease glycoproteins (S-RNases) that degrade pollen RNA (Figure 4.1; deNattencourt 2001).

Pyrus calleryana, commonly called the Callery pear, is an emerging invasive species that exhibits gametophytic SI. The species was originally introduced into the United States from

China to provide rootstock for and breed fungal resistance in Pyrus communis, the common edible pear, at the turn of the 20th century. The „Bradford‟ cultivar was introduced as an ornamental in the 1960‟s and was noted for its quick establishment, rapid growth, and showy spring flowers (Dirr 1977). Due to the presence of narrow crotch angles at the base of the central, leading branches, the trees were prone to splitting if not regularly pruned (Culley and

94

Hardiman 2007). Subsequently, several alternative cultivars of P. calleryana were developed that did not exhibit this trait. These cultivars were planted widely across the United States, primarily in the eastern region and along the western coast states. In 1982, the species was named the second most popular landscape tree by the National Landscaping Association (Stewart

1999). Recently, Pyrus calleryana has been observed growing in natural areas in 26 states

(Vincent 2005; Culley and Hardiman 2007). The species is listed by the U.S. Fish and Wildlife as a plant invader of Mid-Atlantic Natural Areas (Swearingen et al. 2002), and is considered an invasive or watch-listed in ten states (Culley and Hardiman 2007). Pyrus calleryana cultivars are primarily propagated by grafting; therefore, individuals of the same cultivar are essentially clones of the same genetic individual. Due to the presence of the SI system, the species was originally thought to be of little invasive potential because it was initially unable to set fruit, but now does so abundantly in many areas.

Because its history of cultivation may be a key mechanism generating genetic diversity at the SI locus and its emerging status as an invasive, Pyrus calleryana is an ideal system in which to examine the effects of SI, especially in new invasive populations that are genetically admixed relative to cultivated populations (Hardiman and Culley, in prep). Cultivated populations are composed of many individuals of several types of cultivars, which may have provided enough genetic variation at the SI locus across the cultivated population to allow for more compatible crosses to occur. The goals of this study were to characterize Pyrus calleryana cultivars at the SI locus, to assess genetic diversity in cultivars and invasive populations, and to relate genetic composition at the SI locus to reproductive measures. Callery pear cultivars are hypothesized to be polymorphic in genotype at the SI locus, with individuals of the same cultivar type being genetically identical. Variation at the SI locus among Callery pear cultivars is also hypothesized

95

to positively correspond to variation in reproductive output among cultivars. Genotypes of invasive individuals are expected to be heterozygous at the SI locus and composed of alleles from two different cultivars.

MATERIALS AND METHODS

Genetic analysis

Leaf tissue was collected from multiple individuals (average N = 3.4) of nine locally available P. calleryana cultivars („Bradford‟, „Chanticleer‟, „Aristocrat‟, „Redspire‟, „Capital‟,

„New Bradford‟, „Cleveland Select‟, „Stonehill‟ and „Autumn Blaze‟), and single samples representing an additional seven cultivars („Valzam‟, „Princess‟, „Grant St. Yellow‟, „Early

Red‟, „Whitehouse‟, „Avery Park‟, and „Faurie‟) were obtained from the National Clonal

Germplasm Repository in Corvallis, Oregon. In addition, leaf tissue was collected at sites of established invasive populations located in the Harris M. Benedict Nature Preserve in Cincinnati,

OH (N = 65), around Warner Park in Nashville, TN (N = 60), and within and around the USDA

Introduction Station at Glen Dale, MD (N = 68). Maryland is one of the original introduction sites, where invasive individuals may be the progeny of original P. calleryana rootstock from different introduced individuals and, therefore, may include SI alleles not found in cultivars. In

Ohio and Tennessee, invasive individuals have previously been shown to be the progeny of crosses between different cultivars (Hardiman and Culley, in prep). Following collection, all samples were frozen at -20ºC.

Sample DNA was extracted from leaf tissue using a modified CTAB method (Doyle and

Doyle 1987) before being genotyped at the SI locus. Using PCR-based methods, SI alleles have been characterized in several genera of the Rosaceae, including Malus, Prunus, and Pyrus

96

(Broothaerts et al. 1995, Wiersma et al. 2001, Zuccherelli et al. 2002). The gene contains five conserved regions (C1, C2, C3, RC4, C5; Figure 4.2) and one intron-containing hypervariable regions (RHV), where compatibility discrimination is determined (Ushijima et al 1998). The SI locus was first characterized in the Solanaceae (de Nattencourt 2001), and locus-specific primers have been developed that anneal to the C1 and C3 regions (hereafter referred to as the C1/C3 primer set) that subsequently isolate the RHV region (Zuccherelli et al. 2002, forward sequence:

5‟-ATGAATTCGATTATTTTCARTTTACGCAGC-3‟; reverse sequence: 5‟-

CGGAATTCGGTGCCATGTTTACGCCACT-3‟). These primer regions are typically highly conserved such that these primers have been used successfully in a variety of different species

(Broothaerts et al. 1995, Zuccherelli et al. 2002, Sanzol et al. 2006,). Allele polymorphism can then be identified based on size differences. SI alleles detected in this manner have also been verified to correspond with seed production in parental plants with different SI genotypes

(Zuccherelli et al. 2002, Takasaki et al. 2006). PCR was performed using 25μl reaction volumes as follows: 1X Buffer, 0.4 mM MgCl2, 0.15mM dNTP‟s, 0.5 μM each forward and reverse primer in TE, 12-16 ng DNA, 1 unit Promega Taq Polymerase and ddH2O to volume. The PCR temperature profile included: 94ºC for 1 min, followed by 35 cycles each of 94ºC for 30 s, 46ºC for 30 s, and 72ºC for 1 min, and then with a final extension of 72ºC for 7 min. Selected PCR products were genotyped and sequenced using a 3730xl sequencer (Applied Biosystems, Fortune

City, CA) with the LIZ 500 internal size standard. PCR amplicon fragment analysis was then conducted for all PCR products using Genemapper vers. 3.7 (Applied Biosystems). Pairwise genetic distances between cultivars were calculated according to Peakall and Smouse (2006) using GenAlEx software.

97

Successful amplification of the target region was verified through BLAST of the sequenced product. Sequences from three Pyrus calleryana cultivars (Bradford, Redspire, and

Cleveland) were aligned using Geneious (Drummond 2007). Cultivar sequences were also aligned with Pyrus communis sequences (Sanzol et al. 2006) to identify conserved sequences across species. Percent sequence identity at the C2 and C3 regions, at the HVR, and at the intron region within the HVR was calculated on a pair-wise basis between each Pyrus calleryana cultivar.

PCR amplification and sequencing of all Pyrus calleryana cultivars and invasive populations was inconsistent. Furthermore, most invasive individuals possessed only one fragment band, rather than the expected two fragments of different sizes representing two different cultivar alleles. To further address this issue, nested primers were designed at the C2 and C3 regions using the cultivar sequences. The forward primer SIc.f (5‟-

GTTCATGGTTTGTGGCCTTCA-3‟) was designed to anneal at C2 and the reverse primer SIc.r

(5‟-CAGGAGCCATGTTTATCCCA–3‟) was designed at C3 (referred to as the C2/C3 primer set; Figures 4.2 and 4.3). PCR was performed using the concurrent primer labeling method as described by Culley et al. (2008). Fragment analysis was also analyzed as given above.

Cross pollination experiment

In order to validate that genetic variability among cultivars at the SI locus results in functional differences in reproduction, a hand-pollination experiment was performed. Three trees of each of several cultivars („Bradford‟, „Redspire‟, „Aristocrat‟, and „Cleveland‟) were planted within a deer exclosure in an old field setting, located at Long Branch Farm (Cincinnati

Nature Center) in Cincinnati, Ohio. The cross-pollination experiment was performed in early spring (late March to early April) for three consecutive years: 2004, 2005, and 2006. Flowering

98

of specific cultivars was variable across years and was analyzed separately. In 2004, preliminary experimentation was performed on only three „Bradford‟ trees. In 2005, only two „Cleveland‟ and two „Aristocrat‟ trees flowered; and in 2006, three „Redspire‟, three „Bradford‟, three

„Aristocrat‟, and two „Cleveland‟ trees had sufficient flowering for experimentation. Prior to flower emergence, inflorescences were isolated from pollinators using netted bags made of

Delnet (DelStar Technologies, Inc., Middletwon, DE). Prior to anthesis and hand-pollinations, several flowers (up to four per inflorescence) were emasculated to prevent self-pollination.

Cross types included self crosses (“self”), crosses between different individuals of the same cultivar (“within cultivar”), and between individuals of different cultivars (“between cultivar”).

For self crosses, pollen-donating flowers and maternal flowers were located on different inflorescences of the same plant. For within cultivar and between cultivars crosses, all individuals were reciprocally crossed as maternal and paternal sources. All crosses were replicated at least three times. Pollination was performed by application of pollen to the receptive stigma using pollination forceps to brush dehisced anthers across the stigmatic area.

All crosses were performed within three to five days of flower emergence, which is the time frame of stigma receptivity (Sanzol et al. 2003). Fruit set was monitored on a monthly basis until fruit maturation, which occurred in early fall of each year.

All statistical analyses were conducted using JMP v.7.0 (SAS Institute, Cary, NC).

Because crossing data were highly non-normally distributed, significance tests consisted of non- parametric tests on ranked data. Significant differences in fruit set between cross types, including self crosses, within cultivar crosses and between cultivar crosses as types, were first tested using Kruskall-Wallis tests (P < 0.05). For crosses between cultivars, two separate significance tests were performed for all cultivars as either maternal sources or paternal sources.

99

Significance tests were also performed across years by grouping all cultivars together for each year. Relationships between genetic SI data and fruit set from the crossing experiment were tested using the non-parametric correlation test, Spearman‟s ρ, using mean fruit set for each individual. Two separate correlations were conducted comparing fruit set to either the pair-wise genetic distance based on SI data or to the pairwise sequence identity at the HVR.

RESULTS

Genetic analysis

Using the C1/C3 primer set, only 81% (13 out of 16) of examined cultivars were able to be genotyped. Consistently non-amplifying cultivars included the „Autumn Blaze‟, „Capital‟, and

„New Bradford‟ cultivars. Of cultivars that were genotyped, high polymorphism was detected among cultivars, with a total of nine alleles detected across these cultivars and most cultivars having a diagnostic genotype at the SI locus. Individuals of the same cultivar also possessed the same SI genotype. The cultivars „Chanticleer‟, „Cleveland‟, „Faurie‟, and „Stonehill‟ had identical genotypes suggesting these are clones of the same maternal source, which is expected given previous genetic and anecdotal evidence (Table 4.1; Hardiman and Culley, in press).

„Early Red‟ and „Princess‟ cultivars were also identical to each other. An average of 49% of invasive trees were genotyped with the C1/C3 primer set (Table 4.2; range = 83% - 18%).

Observed heterozygosity based on fragment size in invasive populations was also much lower than expected (80% across all three populations), even given the variable amplification rate.

Using the C2/C3 nested primers, all sixteen cultivars were successfully genotyped, but only four fragment sizes were detected (Table 4.1). Eleven cultivars possessed fragments of the same size (NPc2, NPc2). „Chanticleer‟ and „New Bradford‟ also possessed the same fragment

100

sizes (NPc3, NPc3), as well as „Faurie‟ and „Grant St. Yellow‟ (NPc2, NPc4). „Aristocrat‟ was the only cultivar exhibiting a diagnostic genotype (NPc1, NPc2). As expected, individuals of the same cultivar possessed the same SI genotype.

Only the „Bradford‟, „Chanticleer‟, and „Redspire‟ cultivars were successfully sequenced using the C1/C3 primer set. When comparing sequences between Pyrus communis and across

Pyrus calleryana cultivars, there was an average of 89% sequence identity (Figure 4.3). Across the three cultivars, there was an average of 87% sequence identity. At the specific gene location for the three cultivars, sequence similarity was 98% at the C2 region, 81% at the HVR region,

91% at the intron located within the HVR, and 83% at the C3 region. BLAST results for the

C1/C3 primer set and the C2/C3 primer set verified that the targeted S-RNase gene was successfully amplified.

Cross-pollination experiment

As expected, cross pollination resulted in significantly more fruit set in between cultivar crosses than either self crosses or within cultivar crosses (Figure 4.4; X2 = 54.29, df = 2, P <

0.0001). There was an average of 82% fruit set in the between cultivar treatment, compared with an average of 27% in self crosses and 10% in within cultivar crosses. Crosses involving all cultivar combinations resulted in high fruit set, with the specific exception of the cross with

„Bradford‟ as the pollen donor and „Cleveland‟ as the maternal source (Figure 4.5). In crosses between cultivars, no significant differences in fruit set were detected across maternal cultivars

(X2 = 2.03, df = 3, P = 0.56), or across paternal cultivars (X2= 4.39, df = 3, P = 0.22). There

2 were significant differences in fruit set between years (X = 7.07, df = 2, P = 0.03), which is most likely due to variation in sample sizes between years. The correlation between SI genetic

101

distance and fruit set was positive, but not significant (ρ = 0.03, P = 0.84). HVR sequence identity and fruit set were also positively correlated, but non-significant (ρ = 0.26, P = 0.11).

DISCUSSION

Although Pyrus calleryana was introduced over 100 years ago, it has only recently become invasive, and the contributing factors of invasion in this species have previously been unknown. The planting of different Pyrus calleryana cultivars, which are variable at the SI locus, in a given area appears to be a key factor releasing the species from demographic limitations to reproduction and spread. Despite technical difficulties of genotyping Pyrus calleryana cultivars at the SI locus, several conclusions can be made about the relationship between the genetic composition and reproductive differences between the cultivars. Most cultivars are genetically distinct at the SI locus, and appear to be functionally different as well.

Cultivars that were genetically polymorphic using the C1/C3 primer set appeared monomorphic with the nested C2/C3 primer set. Based on this observation, functional polymorphism at the SI locus seems to be determined by sequence compositional differences (not necessarily length) within the HVR of the SI locus. Additionally, allele size differences detected using the C1/C3 primer set may be caused by sequence-length variation between the C1 and C2 regions.

Given the moderate PCR amplification success in cultivars, the lower frequency of SI locus amplification in invasive populations with the C1/C3 primer set was far less than expected.

Amplification failure in some individuals and apparent homozygosity in other individuals indicate one or more mutations have occurred in Pyrus calleryana at either the C1 forward (SIF) or C3 reverse (SIR) primer region, causing one or several alleles to appear in the null allele state.

The C3 reverse primer contained a high GC content, which increases the likelihood of mutation

102

(DeRose-Wilson and Gaut 2007). How a mutation might be so widespread across the invasive populations is unknown, but the SI system in invasive individuals appears to be equally as functional as in cultivated individuals when self-crosses are performed (N. Hardiman, unpublished data). With the C2/C3 nested primer set, significant size similarity was detected among cultivars, indicating that functional differences between alleles are due to sequence variation within the HVR and not to size variation. This finding is contrary to the expectation that compatibility is determined by size differences, as was found in almond (Ushijima 1998).

Similar results to P. calleryana were found in Prunus lannesiana, where allele delineations were made using RFLP analysis (Kato and Mukai 2004).

Fruit set detected in self crosses and within cultivar crosses was also unexpected, and there are several possible reasons for this occurrence. Gametophytic SI systems have been identified as leaky in Solanum carolinense (Solanaceae; Mena-Ali 2007), where specific SI alleles were found to have a weakened incompatibility reaction. Additional reasons for fruit set in self and within cultivar crosses include a compromised SI reaction in aging flowers (Levin

1996) or parthenocarpy (Moriya et al. 2005). In P. calleryana, all cultivars had a small percentage of selfed fruits over the three-year experiment, indicating that a specific SI allele does not have a weakened SI reaction. Despite these results, seeds resulting from self-pollinations are not expected to be a significant contributing factor to invasive populations, especially if seed set is reduced due to inbreeding depression, which has been found in other species with gametophytic SI (Mena-Ali et al. 2008).

Introduced species that are self-incompatible do not possess the benefit of reproductive assurance in small populations; therefore, these species are thought to be less likely to become invasive (Davis et al. 2004). As is the case with Pyrus calleryana, there appears to be a positive

103

relationship between the number of introduction events and the accumulated genetic variability across genetically-divergent populations (i.e. different types of cultivars). Callery pear appears to have overcome Allee effects through introduction of cultivars that are variable at the SI locus.

Both factors serve to increase the likelihood of encountering a compatible mate and may explain the abundant fruit set in cultivars. Pyrus calleryana invasive populations consist of highly admixed progeny of cultivated parents, and seed set is higher in invasive parents relative to cultivar parents (Hardiman and Culley, in prep). Therefore, seed set may be maximized relative to cultivars, potentially leading to an increase in population size and density. Reproductive success has previously been found to escalate with increasing population size and decreasing relatedness among individuals (Elam et al. 2007). As P. calleryana invasive populations become more admixed, the rate of spread may continue to increase as new compatible combinations are formed and mutation produces new SI alleles.

Although the number of invasive, self-incompatible species has not been empirically quantified, SI does not appear to be as rare in invasive species as previously thought (Elam et al.

2007). Several factors can reduce an establishment disadvantage in introduced species that exhibit SI. First, introduced species that become invasive are usually introduced through human- mediated activities, which are correlated with numerous introduction events (Roman and Darling

2007). Recent literature reviews have shown that introduced populations of many invasive species have the same or increased genetic diversity relative to their native conspecifics (e.g.

Bossdorf et al. 2005), presumably due to a history of numerous introductions. If this genetic diversity applies to the SI locus, then these species can rapidly accrue the necessary number of SI alleles to stimulate population growth. Second, modeling studies have shown that the colonizing disadvantage in self-incompatible species is decreased in perennial species that produce large

104

numbers of seeds and possess a seed bank (Pannell and Barrett 1998). Third, self-incompatible species that have many species of common pollinators may have a decreased disadvantage because they are not pollinator limited (Liu et al. 2006). These factors taken together may create a cycle of rapidly increasing invasive potential: new SI alleles are introduced either from the native region or via processes such as cultivation, which serves to increase the likelihood of encountering a compatible mate. Abundant pollinators may promote gene flow and migration among populations, which results in increased fitness within populations due to frequency- dependent, balancing selection. The overall result of which is not only an increase in the rate of reproduction within populations and demographic release of founding populations from Allee effects, but also a potential increase in the evolutionary success of these species.

Limiting invasive potential in this species, as well as other species with similar introduction and horticultural histories, may be a matter of reducing the number of available cultivars or the amount of introduced genetic diversity. In doing so, the amount of variability at the SI locus could be reduced across populations. For human-mediated introductions of self- incompatible species, the amount of genetic variability present across populations may be due to introduction of variable SI genotypes from across the native range of the species. If species that are introduced for horticultural purposes can be limited to one source region in the native range or limited to one cultivar or SI genotype, the invasive potential of the species could potentially be curtailed. This may even be true for currently introduced species, if the limitation is put in place prior to any indication of naturalization. Unfortunately, there are no centralized regulatory or management mechanisms controlling the number of introductions of new species or development of cultivars, which is essentially carte blanche in the United States relative to other countries.

105

ACKNOWLEDGEMENTS

The authors would like to acknowledge Ken Petren, Steven Rogstad, Sarena Selbo, and

Jodi Shann for valuable input, data analysis advice, and helpful discussion. We would like to thank all landowners, including University of Cincinnati, Hamilton County Parks, the Cincinnati

Nature Center, and many business and home owners. Funding for this research was provided by the USDA CSREES Grant (#2006-35320-16565) to Theresa Culley, and both the University of

Cincinnati Research Council and the Botanical Society of America with grants to Nicole

Hardiman.

REFERENCES CITED

Baker HG (1974) The evolution of weeds. Annual Review of Ecology and Systematics, 5, 1–24.

Barrett SCH (1998) The evolution, maintenance, and loss of self-incompatibility systems. In:

Plant Reproductive Ecology: Patterns and Strategies. Eds. Doust JL and Lovett L, Oxford

University Press, pp. 98-124.

Bossdorf O, Auge H, Lafuma L, et al. (2005) Phenotypic and genetic differentiation between

native and introduced plant populations. Oecologia, 144, 1-11.

Brennan AC, Harris SA, Tabah DA, Hiscock SJ (2002) The population genetics of sporophytic

self-incompatibility in Senecio squalidus L. (Asteraceae) I: S allele diversity in a natural

population. 89, 430-438.

Broothaerts W, Janssens GA, Proost P, Broekaert WF (1995) cDNA cloning and molecular

analysis of two self-incompatibility alleles from apple. Plant Molecular Biology, 27, 499–

511.

106

Campbell JM, Lawrence MJ (1981) The population genetics of the self-incompatibility

polymorphism in Papaver rhoeas. 1. The number and distribution of S-alleles in

families from three localities. Heredity, 46, 69-79.

Castric V & Vekemans X (2004) Plant self-incompatibility in natural populations: a critical

assessment of recent theoretical and empirical advances. Molecular Ecology, 13, 2873-

2889.

Culley TM, Hardiman NA (2007) The beginning of a new invasive plant: a history of the

ornamental callery pear in the United States. BioScience, 57, 956 – 964.

Culley TM Weller SG, Sakai AK, Putnam KA (2008) Characterization of microsatellite loci in

the Hawaiian endemic shrub, Schiedea adamantis (Caryophyyaceae), and amplification in

related genera. Molecular Ecology Resources. doi: 10.1111/j.1755-0998.2008.02161.x deNattencourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. Springer,

Berlin.

DeRose LJ, Gaut BS (2007) Transcription-related mutations and GC content drive variation in

nucleotide substitution rates across the genomes of Arabidopsis thaliana and Arabidopsis

lyrata. BMC Evolutionary Biology, 7, 66-78.

Davis HG, Taylor CM, Lambrinos JG, Strong DR (2004) Pollen limitation causes an Allee effect

in a wind pollinated invasive grass (Spartina alterniflora). Proceedings of the National

Academy of Sciences, 101, 13804-13807.

Dirr MA (1998) Manual of Woody Landscape Plants: their identification, ornamental

characteristics, culture, propagation and uses. Stipes, Champaign, Illinois.

Drummond AJ, Ashton B, Cheung M, Heled J, Kearse M, Moir R, Stones-Havas S, Thierer T,

Wilson A (2007) Geneious v. 3.7, Available from http://www.geneious.com

107

Elam DR, Ridley CE, Goodell K, Ellstrand NC (2007) Population size and relatedness affect

fitness in a self-incompatible invasive plant. Proceedings of the National Academy of

Sciences, 104, 549-552.

Emerson S (1938) The genetics of self-incompatibility in Oenothera organensis. Genetics, 23,

190-202.

Ganders FR (1979) The biology of heterostyly. New Zealand Journal of Botany, 17, 607-635.

Hardiman NA, Culley TM (in prep) Evidence of intraspecific hybridization in Pyrus calleryana.

Hardiman NA, Culley TM (in prep) Reproductive success of cultivated Pyrus calleryana and

establishment ability of hybrid progeny.

Hiscock SJ & Tabah DA (2003) The different mechanisms of sporophytic self-incompatibility.

Philo. Trans. R. Soc. London B, 358, 1037-1045.

Kato S, Mukai Y (2004) Allelic diversity of S-RNase at the self-incompatibility locus in natural

flowering cherry populations (Prunus lannesiana var. speciosa). Heredity, 92, 249 – 256.

Kolar CS and Lodge DM (2001) Progress in invasion biology: predicting invaders. Trends in

Ecology and Evolution, 16, 199-204.

Lafuma L and Maurice S (2007) Increase in mate availability without loss of self-incompatibility

in the invasive species Senecio inaequidens (Asteraceae). Oikos. 116, 201-208.

Levin DA (1996) The evolutionary significance of pseudo self-fertility. American Naturalist,

148, 321-332.

Liu H, Pemberton RW, Stiling P (2006) Native and introduced pollinators promote a self-

incompatible invasive woody vine (Paederia foetida L.) in Florida. The Journal of the

Torrey botanical Society, 133, 304-311.

108

Lloyd DG (1992) Self- and cross-fertilization in plants, II. The selection of self-fertilization.

International Journal of Plant Sciences, 153, 358-369.

Mena-Ali JI & Stephenson AG (2007) Segregation analyses of partial self-incompatibility in self

and cross progeny of Solanum carolinense reveal a leaky allele. Genetics 177: 501-510.

Mena-Ali JI, Keser LH, Stephenson AG (2008) Inbreeding depression in Solanum carolinense

(Solanaceae), a species with a plastic self-incompatibility response. BMC Evolutionary

Biology, 8, 10.

Moriya Y, Yochihiro T, Kazuma O, Daiyu I, Yunosuke S, Tetsu N, Takeshi T (2005)

Parthenocarpy and self- and cross-compatibility in ten European pear cultivars. Journal of

the Japanese Society for Horticultural Science, 74, 424–430.

Pannell JR, Barrett SCH (1998) Baker‟s Law revisited: reproductive assurance in a

metapopulation. Evolution, 52, 657-668.

Peakall R, Smouse PE. (2006) GENALEX 6: genetic analysis in Excel. Population genetic

software for teaching and research. Molecular Ecology Notes, 6, 288-295.

Rejmanek M, Richardson DM (1996) What attributes make some plant species more invasive?

Ecology, 77, 1655–1661.

Richman AD, Uyenoyama MK, Kohn JR (1996) Allelic diversity and gene genealogy at the self-

incompatibility locus in the Solanaceae. Science, 273, 1212-1216.

Roman J, Darling JA (2007) Paradox lost: genetic diversity and the success of aquatic invasions.

Trends in Ecology and Evolution, 22, 9, 454-464.

Sanzol J, Rallo P, Herrero M (2003) Asynchronous development of stigmatic receptivity in the

pear (Pyrus communis; Rosaceae) flower. American Journal of Botany, 90, 78–84.

109

Sanzol J, Sutherland BG, Robbins TP (2006) Identification and characterization of genomic

DNA sequences of the S-ribonuclease gene associated with self-incompatibility alleles S1

to S5 in European pear. Plant Breeding, 125, 513–518.

Stebbins GL (1957) Self-fertilization and population viability in the higher plants. American

Naturalist, 91, 337–354.

Stewart B (1999) The coming plague of pears. University of Maryland Cooperative Extension.

Available at: www.montgomerycountymd.gov/mc/services/dep/Landscape/pears.htm.

Swearingen J, Resheriloff K, Slattery B, Zwicker S (2002) Plant invaders of Mid-Atlantic natural

areas. National Park Service and US Fish and Wildlife Service.

Stephenson AG, Good SV, Vogler DW (2000) Interrelationships among inbreeding depression,

plasticity in the self-incompatibility system, and the breeding system of Campanula

repunculoides L. (Campanulaceae). Annals of Botany, 85, 211-219.

Takasaki T, Moriya Y, Okada K, Yamamoto K et al. (2006) cDNA cloning of nine S alleles and

establishment of a PCR-RFLP system for genotyping European pear cultivars.

Theoretical and Applied Genetics, 112, 1543-1552.

Ushijima K, Sassa H, Tao R, Yamane H, Dandekar AM, Gradzial TM, Hirano H (1998) Cloning

and characterization of cDNAs encoding S-RNAses in almond (Prunus dulcis): primary

structural features and sequence diversity of the RNases in the Rosacease. Molecular and

General Genetics, 260, 261–268.

Vincent, MA (2005) On the spread and current distribution of Pyrus calleryana in the United

States. Castanea, 70, 20-31.

Wiersma PA, Wu Z, Zhou L, Hampson C, Kappl F (2001) Identification of new self-

incompatibility alleles in sweet cherry (Prunus avium L.) and clarification of

110

incompatibility groups by PCR and sequencing analysis. Theoretical Applied Genetics,

102, 700–708.

Wright S (1939) The distribution of self-sterility alleles in populations. Genetics, 24, 538-552.

Zuccherelli S, Tassinari P, Broothaerts W, Tartarini S, Dondini L, Sansavini S (2002) S-allele

characterization in self-incompatible pear (Pyrus communis L.) Sexual Plant

Reproduction, 15, 153–158.

111

FIGURE LEGENDS

FIGURE 4.1

Gametophytic self-incompatibility system. Based on diploid gynoecium genotype and the haploid pollen tissue, crosses can be incompatible, semi-incompatible, or compatible. Pollen tube growth is arrested in the style by pistil RNases (deNattencourt 2001).

FIGURE 4.2

Structure of pistil S-RNase locus as determined in almond (Ushijima 1998). Shown are the five conserved regions (C1, C2, C3, RC4, C5) and the single hypervariable region (RHV), including the targeted regions for the published C1 (“SIF”) and C3 (“SIR”) primers in Pyrus communis.

Designed nested primers targeted the C2 (SIc.f) and C3 (SIc.r) regions in Pyrus calleryana cultivars.

FIGURE 4.3

Sequences for Pyrus calleryana „Bradford‟, „Cleveland‟, and „Redspire‟ cultivars aligned with

Pyrus communis sequence from Sanzol (2001). Underlined regions represent C2 and C3 regions as given in Zuccherelli et al. (2002). Underlined and bold sequences are the nested primer target areas. The italicized region represents the intron region within the hypervariable region (HVR).

The non-italicized region within the C2 & C3 regions are presumed to be the HVR.

FIGURE 4.4

Results for the cross pollination experiment, indicating significantly greater fruit set in crosses between cultivars than other cross types (Kruskall-Wallis X2 = 54.29, df = 2, P < 0.0001).

Crosses include self pollinations (different flower from the same plant), crosses between different individuals of the same cultivar (within cultivar), and crosses between individuals of different cultivars (between cultivars). Sample sizes are given below the columns.

112

FIGURE 4.5

Percent fruit set for crosses between cultivars indicating no significant differences among all culitvars as maternal sources (Kruskall-Wallis X2 = 2.03, P = 0.56) or paternal sources (Kruskall-

Wallis X2 = 4.39, P = 0.22). For each grey bar, the first cultivar listed on the X-axis label is the maternal source and the second cultivar is the paternal source. The black bars indicate the reciprocal cross of the same parents. Sample sizes are given below the columns.

113

Table 4.1: Genetic characterization for cultivars using the published C1/ C3 primer set and the designed nested C2/C3 primer set, including N (number of individuals), the fragment size in base pairs, and the assigned SI genotype.

C1/C3 Primer C2/C3 Primer

Cultivar N Fragment Size Genotype Fragment Size Genotype

Aristocrat 3 346 435 Pc1, Pc2 333 375 NPc1, NPc2

Autumn Blaze 2 - - - 375 375 NPc2, NPc2

Avery Park 1 459 459 Pc8, Pc8 375 375 NPc2, NPc2

Bradford 5 429 451 Pc3, Pc4 375 375 NPc2, NPc2

Capital 5 - - - 375 375 NPc2, NPc2

Chanticleer 3 454 454 Pc5, Pc5 421 421 NPc3, NPc3

Cleveland 5 454 454 Pc5, Pc5 375 375 NPc2, NPc2

Early Red 1 422 451 Pc6, Pc4 375 375 NPc2, NPc2

Faurie 1 454 454 Pc5, Pc5 375 427 NPc2, NPc4

Grant St. Yellow 1 457 459 Pc7, Pc8 375 427 NPc2, NPc4

New Bradford 4 - - - 421 421 NPc3, NPc3

Princess 1 422 451 Pc6, Pc4 375 375 NPc2, NPc2

Redspire 2 422 422 Pc6, Pc6 375 375 NPc2, NPc2

Stonehill 2 454 454 Pc5, Pc5 375 375 NPc2, NPc2

Valzam 1 454 454 Pc5, Pc5 375 375 NPc2, NPc2

Whitehouse 1 454 461 Pc5, Pc9 375 375 NPc2, NPc2

114

Table 4.2: Descriptive statistics for Pyrus calleryana cultivars and invasive populations using the published C1/C3 primer set, including N (number of individuals), A (number of alleles), P

(percent locus polymorphism), He (expected heterozygosity according to equilibrium assumptions, and Ho (observed heterozygosity).

% Genotyped N A P He Ho Cultivars 79 16 9.0 1.0 0.76 0.46 Ohio Invasive 83 65 7.0 1.0 0.71 0.22 Maryland Invasive 47 68 6.0 1.0 0.79 0.16 Tennessee Invasive 18 60 7.0 1.0 0.80 0.27

115

Figure 4.1

Pollen parent S1S2

Pollen S1 S2 S S Genotype 1 2 S1 S2

Pistil Genotype S1S2 S1S3 S3S4 : Fully Incompatible Semi- compatible compatible

116

Figure 4.2

C1 C2 RHV C3 RC4 C5 5‟ 3‟

SIF SIR SIc.f SIc.r

117

Figure 4.3

1 10 20 30 40 50 60 | | | | | | | P.communis CCGGCCGTATGCAACTCTAATCCTACTCATTGTAACGATCCTACTGACAAGTTGTTTACG Redspire CCTG------ACTGACAAGTTGTTTACG Bradford G------ACAAGTTGTTTACG Cleveland CCTGC------CTGACAAGTTGTTTACG Conserved

P.communis GTTCACGGTTTGTGGCCTTCAAACAGAAATGGACCTGACCCAGAAAAATGTAAGACTACA Redspire GTTCATGGTTTGTGGCCTTCAAACAAAAATGGACCTGACCCAGAAAAATGCAAGACTATA Bradford GTTCACGGTTTGTGGCCTTCAAACAGAAATGGACCTGACCCAGAAAAATGTAAGACTACG Cleveland GTTCATGGTTTGTGGCCTTCAAACAAAAATGGACCTGACCCAGAAAAATGCAAGAATATA Region 2

P.communis GCCCTGAATTCTCAGAAGGTAATATTATTAATAATGAGATGGTCAATATTGTTTATTTCA Redspire CCCCTGAATTCTCGGAAGGTAATATTATTAATAATGAGATGGTCAATATTGTTTATTTCA Bradford GCCCTGAATTCTCAAAAGGTAATATTATTAATAATGACATGGTCAATATTGTTTATTTCA Cleveland CAAATGAATTCTCGGAAGGTAATATTATTAATAATGAGATGGTCAATATTGTTTATTTCA

P.communis TTTATGCACTCGTGTATA-TATAGATTACA-ATACTTAACATAGATTTTCATGCACGCCT Redspire TTTATGCACCCGTGTATAAAATATATTACATATACTCCACATATATTTTCGCGCACCTGT Bradford TTTATGCACTCGTGTATA-TATAGATTACA-ATACTTAACATAGATTTTCATGCACGCCT Cleveland TTTATGCACCTGTGTATAAAATATATTACATATACTCCACATATATTTTCGTGCACCCCT

P.communis GTGCAAATATTACAATTAATTTAAAATTTAATCATGAATTGTTTCTATTACATAATTATA Redspire GTGGAAATATTACAATTATTTTAAAATTTACTCATGTTGTGTCTCTATTATATAATTATA Bradford GTGCAAATATTACAATTAATTTAAAATTTAATCATGAATTGTTTCTATTACATAATTCTA Cleveland GTGGAAATATTACAATTATTTTAAAATTTACTCATGTTTTGTTTCTATTATATAATTATA

P.communis TTGTCAGATAGGAAATATGACAGCCCAATTGGAAATTATTTGGCCGAACGTCCTCAATCG Redspire TTGCCATATAAAAAATATGACCCCCCTTGTGGAAATTATTTGCCAAAACGCGCTCTCTCT Bradford TTGTCAGATAGGAAATATGACAGCCCAATTGGAAATTATTTGGCCGAACGTACTCAATCG Cleveland TTGCCAGATAGGAAATATGACCCCCCTTGTGGAAATTTTTTGGCCAAACGTGCTCTCTCT

P.communis ATCCGATCATGTAGGCTTCTGGGAAAAAGAGTGGATCAAACATGGCACCTGCGGGTATCC Redspire ACCCTATCGTGTGCGCTTCGGGAAAAGAGAGTGGCATACACGTGGCCC------Bradford ATCCGATCATGTAGGCTTCTGGGAAAAAGAGTGGCGTAAACATGGCAC------Cleveland ACCCTATCGTGTGCGCTTCTGGAAAAGAGAGTGGCATACACGTGGCCC------Conserved Region 3

118

Figure 4.4

120% 2004 2005 100% 2006

80%

60% Percent Set Fruit 40%

20%

0% 6 28 36 11 14 28 42 28 73 Self Within Cultivar Between Cultivar Cross Type

119

Figure 4.5

120

Chapter 5

General Conclusions

Nicole A. Hardiman

Department of Biological Sciences

University of Cincinnati

614 Rieveschl Hall

Cincinnati, OH USA 45221-0006

Corresponding author – Email: [email protected], Tel: 513-556-9705

121

Invasive Callery pear populations appear to have a rapidly increasing rate of spread, but the primary cause of invasion in this species has previously been unknown. The primary mechanism of invasion in this species appears to be due primarily due to cross-pollination between genetically divergent cultivars and subsequently overcoming demographic restrictions on population growth. Genetic variability at the SI locus among cultivars allowed for the initial reproduction between individuals of differing cultivar types. Cultivar-specific genetic polymorphism at the SI locus enabled cultivars to freely interbreed and increase fruit production.

Increased fruit production in cultivated individuals resulted in altered localized propagule pressure, facilitating invasive population establishment and spread. There appears to be a relationship between the number of introduction events of genetically-divergent populations (i.e. different types of cultivars) and the accumulated genetic variability within invasive populations.

In this study, hybridization between cultivars was found to be the source for invasive populations, with all cultivars being highly productive and capable of contributing to invasive populations. Invasive populations are self-sustaining and composed of individuals that are also highly productive; actually producing more seeds per individual than their cultivar parents. The size and density of invasive Callery pear populations may continue to increase in the future due to this large reproductive capacity. Subsequent introductions, via either development of new cultivars or continuing to plant the species in large numbers, may continue to facilitate an accelerated rate of spread within naturalized populations.

Of the sixteen P. calleryana cultivars included in the study, most are highly genetically structured at selectively-neutral microsatellite loci. The initial genetic differentiation among cultivars may be due to multiple collections of seed from geographically-separated source populations across the native range of Callery pear (Culley and Hardiman, in press). Cultivars

122

could also be genetically differentiated because of different selection regimes during cultivation.

On a local scale, populations composed of different cultivars are the parents of nearby invasive populations, with a combination of cultivar genotypes represented within each invasive population and extensive admixture found within invasive individuals. Over half of invasive individuals in all sampled locations had two cultivar parents, with all other individuals appearing to be admixed beyond the F1 generation. Not only do P. calleryana cultivars comprise the source populations, but also invasive individuals are capable of reproducing either among themselves or via backcrossing with cultivars. Widespread plantings for horticultural purposes have previously been found to promote naturalization and spread of exotic, horticultural species

(Mack 2000). Hybridization between cultivars has also been implicated as the cause for formation of invasive olive (Olea europaea; Besnard et al. 2007), Brazilian peppertree (Schinus terebinthifolius; Williams et al. 2005) and pampas grass (Cortaderia selloana; Okada et al.

2007), with invasive populations containing admixed genotypes originating from several ornamental cultivars or varieties. Because the frequency of cultivar alleles in invasive populations and parent populations was roughly equal, all cultivars appear equally capable of contributing to invasive populations.

Hybridization has produced significant genetic variation in invasive populations, but a substantial alteration in traits related to fecundity and establishment ability was not detected.

Invasive cultivar progeny was hypothesized to result in new variation across hybrid types in traits relating to invasive potential (Rhode and Cruzan 2005), with one hybrid exhibiting vigorous invasion-related phenotypes. In the case of the Callery pear, two cultivars (i.e.

„Redspire‟ and „Capital‟) emerged as more fecund than the others, which could indicate these two are more likely to establish invasive populations; however analysis of the frequency of

123

cultivar contribution in invasive populations in the microsatellite experiment did not provide evidence of this. Based on measures of establishment ability, no specific cultivar‟s hybrid progeny possessed a better performing phenotype, also indicating that no single cultivar was more likely to contribute to invasive populations. Late generation progeny, which are more genetically admixed than early generation progeny, were also hypothesized to have increased hybrid performance relative to early generation progeny in terms of reproduction and establishment ability, but it was not detected in P. calleryana, at least in early life history stages.

For the comparisons among cultivars and between hybrids, maternal reproductive investment was more influential in invasive potential than progeny establishment ability, indicating biotic traits found in cultivars that are associated with reproduction, such as large numbers of flowers and seeds may be a primary source for invasive potential. Cultivated parents of early generation hybrids produced fruits and seeds that were significantly larger than invasive parents of late generation hybrids, which may reflect the horticultural setting of cultivated parents. Late generation hybrids did produce larger numbers of seeds than early generation hybrids. This result may be due to a higher diversity of SI genotypes across invasive populations, so that the likelihood of encountering a compatible mate is higher in invasive versus cultivated individuals.

In Pyrus calleryana, cultivar development may have served to increase overall fitness by focusing on traits such as avoidance of limb breakage, flower production, disease resistance, and rapid growth (Cunningham 1984), which may have also served to incorporate cultivar-specific SI genotypes.

Despite technical difficulties of characterizing and genotyping Pyrus calleryana cultivars at the SI locus, SI appears to be a key mechanism releasing this species from demographic limitations to reproduction and subsequent spread. Cultivars were found to be functionally

124

different at the SI locus, given that all crosses between cultivars resulted in fruit set. Contrary to expectation, functional polymorphism at the SI locus seems to be determined by sequence differences within the HVR of the SI locus, rather than based on size differences between alleles.

SI in introduced species may actually confer an advantage for developing invasive potential, if it is preceded by introduction of enough genetic variation to overcome the Allee effect and also be accompanied by biotic factors that promote overall fitness.

Hybridization can lead to invasiveness through either demographic means or through evolutionarily-important genetic factors resulting in vigorous invasion-related phenotypes (such as abundant flowering and rapid growth). Intraspecific hybridization between cultivars and subsequent increased performance in hybrid progeny was hypothesized to have provided the evolutionary jump-start needed to facilitate the invasive potential of the species. The principles of hybridization can be applied to Pyrus calleryana because crossing between genetically divergent cultivars result in highly admixed populations that now appear to be not only self- sustaining, but also rapidly spreading to new areas (Vincent 2005). Results indicate hybridization, at least in the early stages, is contributing to release from the lag period primarily through crossing of cultivars that are genetically distinct at the SI locus. Rather than one hybrid type benefiting from specific genetic combinations that produce novel invasion-related traits, all hybrid types appear to be equally and highly capable of reproducing and creating progeny that can successfully establish.

Cultivation in this species may be facilitating invasive potential via the widespread introduction of many cultivar types, resulting in high propagule pressure on local scales. 82% of woody invasive plant species have horticultural origins (Reichard and White 2001), and horticulturally-important species have a history of numerous introductions (Mack 2000, Kowarik

125

2003). Cultivated, horticultural species are likely to become invasive due to multiple primary and secondary introductions, which increase propagule pressure within introduced areas. Primary introductions include initial import of species from their native habitat, and secondary introductions include localized distribution (in the case of horticultural species, usually via commercial pathways) across a wide geographic area (Kowarik 2003). Cultivation and subsequent propagation could thus serve as a source for invasive populations by effectively increasing introduction effort and inoculation size on a large scale (Lockwood et al. 2005, Drake et al. 2005). Additionally, the process of cultivation via artificial selection for certain traits (e.g. selection for increased flower production) can increase reproductive allocation and fecundity

(Harlan 1975). Selection of cultivars through artificial breeding programs could serve as a source for genetic differentiation among cultivars, subsequently altering genetic composition of introduced populations and creating new variation at non-neutral loci upon which natural selection can act. Although evolutionary-based phenotypic change was not detected in P. calleryana, for other horticulturally-important species, the process of cultivation itself may also result in accumulation of evolutionarily important genetic and morphological traits and subsequent transmission of heritable traits to invasive progeny.

The combination of demographic and genetic changes brought about by cultivation practices may also reduce the lag time between a species introduction and its appearance as an invasive. The mean lag time has previously been calculated to be 170 years for invasive trees and

131 years for invasive shrubs (Kowarik 1995). The lag time of invasive species of horticultural origin may be abbreviated due to the rapid accumulation of adequate population numbers through numerous introduction events. Indeed, changes in vector activity attributable to the horticultural trade have been found to influence the probability of establishment of invasive

126

populations (Dehnen-Schmutz et al. 2007). By recognizing the role of cultivation in species currently considered invasive, attention must now shift to understanding the introduction history and the potential for invasiveness in either new species introductions or currently introduced, but not yet invasive species.

Implications for Management

Currently, there are few formal management strategies for the Callery pear, and the use of herbicides and control treatments for the species has not been quantified. To effectively remove invasive individuals, above and below-ground biomass must be completely excavated, as growth from remnant root tissue is very common (Swearingen et al. 2002). For large trees that have been cut down, systemic herbicide such as concentrated glyphosate or triclopyr must be applied to the trunk to prevent re-growth (Swearingen et al. 2002), and multi-year monitoring may be required. If tree removal is not possible, trees can also be girdled about six inches above the ground. Mowing of these trees is ineffective because the species readily sprouts from any existing trunk or roots. Sucker growth at the base of the tree trunk should also be removed to prevent possible growth, flowering, and cross-pollination with the scion.

Cultivar development continues in private nurseries and many types of cultivars are widely available through nurseries and retailers, making management and prevention of Pyrus calleryana invasion difficult. As with most invasive ornamentals, many retailers are reluctant to stop selling these economically-important ornamental species and are often resistant to any government regulation these species. By decreasing the commercial availability, either through voluntary or regulatory means, it may be possible to prevent naturalization and spread of these species. One potential solution is to limit the number of available cultivars in a given area, since the availability of many types of cultivars functions to reduce any Allee effects limiting

127

population growth. In doing so, the strength of the propagule pressure across introduced populations would be reduced, despite the numbers of individuals that are planted. The amount of genetic variability could also be reduced across cultivated populations, which may reduce the likelihood of the evolution of invasive potential. It is important to note, however, this would only prevent invasion in some species, because several clonal or agamospermous species are currently very successful invasives (Saltonstall 2002, Kissling 2006).

In Pyrus calleryana, SI was a limiting factor for invasive potential until a sufficient number of SI alleles were present in cultivated populations. SI now appears to be the primary reason for increased fruit set in cultivated individuals that genetically differ at the SI locus. SI may limit fecundity in very small populations, but the number of introduction events may increase with cultivation. Not only may there be a demographic advantage by introduction of genetically-variable cultivars which enables crossing between individuals, but also the potential for evolution in introduced habitats may increase. For intentionally introduced, self- incompatible species, including currently introduced species or new introductions in the future, the amount of genetic variability at the SI locus in founder populations may reflect multiple introductions from across the native range. To limit both the demographic effect of SI and the increase in evolutionary potential, it is essential that the amount of introduced variability at the

SI locus be kept to a minimum. If species that are introduced for horticultural purposes can be limited to one source region in the native range or limited to one cultivar or SI genotype, the invasive potential of the species could be curtailed.

Biological containment of Pyrus calleryana and other horticulturally introduced species may also be a viable prevention strategy and can be accomplished by development of cultivars that are pollen or seed sterile. Replacing existing cultivars with sterile ones in the commercial

128

market would seriously reduce, if not eliminate, invasive potential while still providing a revenue source for landscapers, plant breeders, and retailers. If new species that are introduced for economic reasons (i.e. ornamental or agricultural use) could be made sterile, the formation of new invasive species may be curtailed. While technologies for genetically-induced sterility are still being modified, the practice was originally developed for genetically-modified plant species to prevent reproduction outside of cultivated populations. Pollen sterility can be achieved through mitochondrial rearrangements which affect pollen viability (Sandhu 2007). Seed sterility can be achieved through gene silencing technology by either disrupting the seed development process or production of seeds that are unable to germinate (Mitsuda et al. 2006). Another common practice is induction of polyploidy by treatment of meristematic tissue with oryzalin

(Olsen et al. 2006). Sterile polyploid cultivars of Pyrus calleryana are currently being developed that are seedless or have very low fertility (Pooler 2007). While sterile cultivars would have to be extensively tested for sterility success, these new technologies may be a viable option for biological containment.

Because invasive Pyrus calleryana populations are currently forming across the U.S. and the rate of spread may continue to rise, it is important that land managers recognize the invasive potential of the species. Early eradication of invasive populations will only be successful if nearby source populations are identified and removed, which may entail working with property owners to replace existing trees with non-invasive species. Many urban arborists have already begun replacing Callery pears as the trees grow old or succumb to branch splitting (B. Gerard, personal communication). If invasive populations have not already formed, this strategy may be valuable in reducing the invasion potential of Callery pear on a local scale.

129

REFERENCES CITED

Besnard G, Henry P, Wille L, Cooke D, Chapuis E (2007) On the origin of the invasive olives

(Olea europaea L., Oleaceae). Heredity, 99, 608-619.

Culley TM, Hardiman NA (in press) The role of intraspecific hybridization in the evolution of

invasiveness: a case study of the ornamental pear tree Pyrus calleryana. Biological

Invasions.

Cunningham IS (1984) Frank N. Meyer: Plant Hunter in Asia, The Iowa State University Press,

Ames, Iowa.

Dehnen-Schmutz K, Touza J, Perrings C, Williamson M (2007) A century of the ornamental plant

trade and its impact on invasion success. Diversity and Distributions, 13, 527-534.

Drake JM Baggenstos P, Lodge DM (2005) Propagule pressure and persistence in experimental

populations. Biology Letters. 1, 480–483.

Harlan JR (1975) Crops and Man. American Society of Agronomy and Crop Sciences Society of

America. Madison, WI, pp. 295.

Kissling WD, Lod JM, Schnittler M (2006) Agamospermous seed production of the invasive

tussock grass Nardus stricta L. (Poaceae) in New Zealand – evidence from pollination

experiments. Flora, 201, 144-151.

Kowarik I (1995) In: Plant Invasions: General Aspects and Special Problems (eds.: Pysek P,

Prach K, Rejmanek M and Wade PM), pp. 15-38. SPB Academic, The Hague.

Kowarik I (2003) Human agency in biological invasions: secondary releases foster naturalization

and population expansion of alien plant species. Biological Invasions, 5, 293-312.

Lockwood JL, Cassey P, Blackburn T (2005) The role of propagule pressure in explaining species

invasions. Trends in Ecology and Evolution, 20, 223-228.

130

Mack RN (2000) Cultivation fosters plant naturalization by reducing environmental stochasticity.

Biological Invasions, 2, 111-122.

Mitsuda N, Hiratsu K, Todaka D, Nakashima K, Yamaguchi-Shinozaki K, Ohme-Takagi M

(2006) Efficient production of make and female sterile plants by expression of a chimeric

repressor in Arabidosis and rice. Plant Biotechnology Journal, 4, 325-332.

Okada M, Ahmad R, Jasieniuk M (2007) Microsatellite variation points to local landscape

plantings as sources of invasive pampas grass (Cortaderia selloana) in California.

Molecular Ecology, 16, 4956-4971.

Olsen RT, Ranney TG, Violoria Z (2006) Reproductive behavior of induced allotetraploid

Chitalpa and in vitro embryo culture of polyploidy progeny. Journal fo the American

Society for Horticultural Science, 131, 716-724.

Pooler M (2007) Developing non-invasive nursery crops. 2007 Annual Report, Floral and

Nursery Plant Research Unit, Agricultural Research Service, USDA. Available at:

www.ars.usda.gov/research/projects/projects.htm?ACCN_NO=407751

Reichard SH, White P (2001) Horticulture as a pathway of invasive plant introductions in the

United States. BioScience. 51, 2, 103-113.

Rhode JM and Cruzan MB (2005) Contribution of heterosis and epistasis to hybrid fitness.

American Naturalist. 166, E124-E139.

Saltonstall K (2002) Cryptic invasion by a non-native genotype of the common reed, Phragmites

australis, into North America. Proceedings of the National Academy of Sciences of the

United States, 99, 2445-2449.

131

Sandhu APS, Abdelnoor RV, Mackenzie SA (2007) Transgenic induction of mitochondrial

rearrangements for cytoplasmic male sterility in crop plants. Proceedings of the National

Academy of Sciences of the United States, 104, 1766-1770.

Swearingen J, Resheriloff K, Slattery B, Zwicker S (2002) Plant invaders of Mid-Atlantic natural

areas. National Park Service and US Fish and Wildlife Service.

Vincent, MA (2005) On the spread and current distribution of Pyrus calleryana in the United

States. Castanea, 70, 20-31.

Williams DE, Overholt WA, Cuda JP Hughes CR (2005) Chloroplast and microsatellite DNA

diversities reveal the introduction history of Brazilian peppertree (Schinus terebinthifolius)

in Florida. Molecular Ecology, 14, 3643-3656.

132

APPENDIX 1

Below is a citation list of previously published literature co-authored by Nicole Hardiman regarding invasive Pyrus calleryana.

Hardiman NA and Culley TM (2007) Genetic analysis of Callery pear cultivars to determine the

origin of invasive populations. Proceedings of the 2007 Ohio Invasive Plants Research

Conference. Nicole Cavender (Ed.). Ohio Biological Survey. Columbus, Ohio. pp. 59-66.

Culley TM, Hardiman NA (2007) The beginning of a new invasive plant: a history of the

ornamental Callery pear in the United States. BioScience, 57, 11, 956-964.

Culley TM, Hardiman NA (in press) The role of intraspecific hybridization in the evolution of

invasiveness: A case study of the ornamental pear tree Pyrus calleryana. Biological

Invasions.

133