DOCSLIB.ORG

MTERF Factors: a Multifunction Protein Family

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MTERF Factors: a Multifunction Protein Family Article in press - uncorrected proof BioMol Concepts, Vol. 1 (2010), pp. 215–224 • Copyright ᮊ by Walter de Gruyter • Berlin • New York. DOI 10.1515/BMC.2010.015 Review MTERF factors: a multifunction protein family Marina Roberti1, Paola Loguercio Polosa1, Francesco During evolution, most of the bacterial genes moved from Bruni1, Stefania Deceglie1, Maria Nicola Gadaleta1,2 the organelle genome to the nuclear genome. In animal cells, and Palmiro Cantatore1,2,* mitochondrial DNA (mtDNA) is an example of extreme genetic economy. It consists of a circular molecule of 1 Dipartimento di Biochimica e Biologia Molecolare approximately 16 kbp, lacks introns, and contains only one ‘Ernesto Quagliariello’, Universita` degli Studi di Bari major non-coding sequence, which is the most variable part ‘Aldo Moro’, Via Orabona 4, 70125 Bari, Italy of the genome in size and sequence, and which includes the 2 Istituto di Biomembrane e Bioenergetica, CNR, Via regulatory signals for transcription and replication. Animal Amendola 165/A, 70126 Bari, Italy mtDNA (Figure 1) encodes only 13 subunits of the respira- * Corresponding author tory complexes and RNAs (two ribosomal RNAs and 22 e-mail: [email protected] tRNAs) required for their translation. Therefore, the produc- tion and assembly of the respiratory complex subunits require the coordinated expression of the two genomes, Abstract which is based on signalling pathways between nucleus and cytoplasm (4, 5). The MTERF family is a large protein family, identified in A considerable amount of knowledge has been produced metazoans and plants, which consists of four subfamilies, on the mechanism of mtDNA transcription, particularly in MTERF1, 2, 3 and 4. Mitochondrial localisation was pre- mammals (6). In humans, transcription of the heavy (H) dicted for the vast majority of MTERF family members and strand requires the HSP promoter, located in the 1000-bp- demonstrated for the characterised MTERF proteins. The long D-loop non-coding region (NCR), and proceeds through main structural feature of MTERF proteins is the presence two partially overlapping units (Figure 2). The ribosomal of a modular architecture, based on repetitions of a 30-resi- unit, starting at the initiation site IH1 (placed in HSP) and due module, the mTERF motif, containing leucine zipper- ending at the 39 end of the 16S rRNA gene, is responsible like heptads. The MTERF family includes transcription for the synthesis of the two rRNAs, tRNAPhe and tRNAVal. termination factors: human mTERF, sea urchin mtDBP and The messenger unit, starting at the initiation site IH2, located Drosophila DmTTF. In addition to terminating transcription, two nucleotides upstream of the 59 end of the 12S rRNA they are involved in transcription initiation and in the control gene, covers almost the entire H-strand and produces a poly- of mtDNA replication. This multiplicity of functions seems cistronic molecule, the processing of which originates all the to flank differences in the gene organisation of mitochondrial H-strand encoded mRNAs and the remaining 12 tRNAs. IH1 genomes. MTERF2 and MTERF3 play antithetical roles in is more frequently used than IH2, thus resulting in a higher controlling mitochondrial transcription: that is, mammalian rate of rRNA transcription (7). Transcription of the light (L) and Drosophila MTERF3 act as negative regulators, whereas strand starts from the LSP promoter (Figure 2), also located mammalian MTERF2 functions as a positive regulator. Both in the D-loop region, 150 bp from HSP, and produces only proteins contact mtDNA in the promoter region, perhaps eight tRNAs, ND6 mRNA and the H-strand replication establishing interactions, either mutual or with other factors. primer. Regulation of MTERF gene expression in human and Dro- Although their gene content remained similar, during evo- sophila depends on nuclear transcription factors NRF-2 and lution mitochondrial genomes of animals from various phyla DREF, respectively, and proceeds through pathways which and orders underwent profound variations in gene organisa- appear to discriminate between factors positively or nega- tion, that are likely to be reflected in differences in transcrip- tively acting in mitochondrial transcription. In this emerging tion mechanisms. scenario, it appears that MTERF proteins act to coordinate In the mitochondrial genome of the sea urchin Paracen- mitochondrial transcription. trotus lividus (Echinoid) (Figure 1), the ribosomal genes are separated by a region of 3.3 kbp containing a cluster of 15 Keywords: MTERF protein family; mtDNA replication; tRNA genes and the genes for ND1 and ND2; the main NCR mtDNA transcription; transcription termination factor. is very short (132 bp) and is located in the tRNA gene cluster downstream of the 12S rRNA gene (8). In this organism, mitochondrial transcription is presumed to proceed via mul- Introduction tiple and partially overlapping transcription units, the initia- tion sites of which are probably located near six small Mitochondria are cytoplasmic organelles of endosymbiotic AT-rich sequences scattered along the genome (see Figure 1) origin, which developed from an a-proteobacterium (1). (8, 9). 2010/012 Article in press - uncorrected proof 216 M. Roberti et al. Figure 1 Map of mitochondrial genome in three metazoans, showing the cognate transcription termination factor. Blue, green and yellow: genes encoding the 13 polypeptides of the respiratory complexes, the two rRNAs and the 22 tRNAs, respectively. Human mtDNA: OH and OL mark the replication origin of H- and L-strand, respectively, according to the conventional strand-asymmetric model of mtDNA replication (2). Transcription termination factor mTERF is shown to contact its binding sites. Sea urchin mtDNA: OR marks the replication origin of the leading strand (3). Black dots: position of the six small AT-rich sequences, perhaps acting as transcription promoters. Position of the two sites contacted by mtDBP is shown. Drosophila melanogaster mtDNA: OJ and ON mark the replication origin of major and minor coding strands, respectively. Transcription termination factor DmTTF is shown to contact its binding sites. The large non-coding AT-rich region (approx. 4.6 kbp) is not to scale. Article in press - uncorrected proof The MTERF protein family 217 Figure 2 Schematic representation of transcription regulatory regions and factors in human mtDNA. Light grey: D-loop region containing promoters HSP and LSP. Transcription initiation is assisted by factors TFAM and TFB2M. Transcription of rDNA region initiates at IH1 and ends at the 39 end of 16S rRNA gene. Transcription termination is mediated by mTERF which binds inside tRNALeu(UUR) gene. Simultaneous binding of mTERF to promoter and termination sites causes rDNA looping and allows recycling of POLRMT between both regions. IH2 directs transcription of entire H-strand, giving rise to a polycistronic RNA precursor molecule. IL promotes transcription of L- strand DNA, generating a polycistronic transcript and RNA primers for H-strand replication. Transcription repressor MTERF3 and tran- scription activator MTERF2 are shown to contact sequences in the promoter region. Symbols ∞ and ]: activation and repression, respectively. The mtDNA of Drosophila melanogaster (Figure 1) is transcription initiation site and establishes interactions with approximately 19.5 kbp long, and the AT-rich main NCR, TFAM, POLRMT and the first nucleotide of the RNA tran- approximately 4.6 kbp, accounts for the large size of the script (17). genome. Unlike human and sea urchin mitochondrial genes, Although the number of transcription units and the number Drosophila genes are almost equally distributed between the and position of promoters and termination sites of inverte- two strands of mtDNA, forming four clusters located alter- brate mtDNAs are probably different from those of mam- natively on the two strands (10). According to early mapping mals, mammalian POLRMT, TFAM and TFB2M show data of mature and precursor mitochondrial RNAs, Drosoph- evident orthologues in sea urchin and in Drosophila (18–20). ila mtDNA would be transcribed by multiple transcription This suggests that a common transcription initiation core units starting at the 59 ends of the gene blocks and termi- machinery operates in animal mitochondria. However, pre- nating at their 39 ends (11). vious and very recent studies indicate that mitochondrial The basal mitochondrial transcription machinery has been transcription in animals requires several additional protein well characterised in mammals (2, 12); it consists of a phage- factors, such as termination factors and positive and negative like mitochondrial RNA polymerase (POLRMT) and factors modulators. Intriguingly, all these factors show a common TFAM and TFB2M (Figure 2). TFAM belongs to the family evolutionary origin, because they are all members of a large, of the high mobility group (HMG) proteins, which are complex protein family, the MTERF family, whose name known to bind DNA with low or no sequence specificity. In derives from human mTERF, the first mitochondrial tran- addition to behaving as an architectural element, the factor scription termination factor to be characterised. specifically binds two mtDNA sequences located upstream of HSP and LSP and stimulates transcription (13, 14). Although TFB2M, a protein homologous to bacterial rRNA The MTERF protein family in metazoans methyltransferases, does not show specific DNA binding activity, it is able to activate transcription initiation (15). By
Load more

Recommended publications
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • Cytotoxic Effects and Changes in Gene Expression Profile
    Toxicology in Vitro 34 (2016) 309–320 Contents lists available at ScienceDirect Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit Fusarium mycotoxin enniatin B: Cytotoxic effects and changes in gene expression profile Martina Jonsson a,⁎,MarikaJestoib, Minna Anthoni a, Annikki Welling a, Iida Loivamaa a, Ville Hallikainen c, Matti Kankainen d, Erik Lysøe e, Pertti Koivisto a, Kimmo Peltonen a,f a Chemistry and Toxicology Research Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, Finland b Product Safety Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, c The Finnish Forest Research Institute, Rovaniemi Unit, P.O. Box 16, FI-96301 Rovaniemi, Finland d Institute for Molecular Medicine Finland (FIMM), University of Helsinki, P.O. Box 20, FI-00014, Finland e Plant Health and Biotechnology, Norwegian Institute of Bioeconomy, Høyskoleveien 7, NO -1430 Ås, Norway f Finnish Safety and Chemicals Agency (Tukes), Opastinsilta 12 B, FI-00521 Helsinki, Finland article info abstract Article history: The mycotoxin enniatin B, a cyclic hexadepsipeptide produced by the plant pathogen Fusarium,isprevalentin Received 3 December 2015 grains and grain-based products in different geographical areas. Although enniatins have not been associated Received in revised form 5 April 2016 with toxic outbreaks, they have caused toxicity in vitro in several cell lines. In this study, the cytotoxic effects Accepted 28 April 2016 of enniatin B were assessed in relation to cellular energy metabolism, cell proliferation, and the induction of ap- Available online 6 May 2016 optosis in Balb 3T3 and HepG2 cells. The mechanism of toxicity was examined by means of whole genome ex- fi Keywords: pression pro ling of exposed rat primary hepatocytes.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Blood-Derived Mitochondrial DNA Copy Number Is Associated with Gene Expression Across Multiple
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.17.209023; this version posted July 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Blood-derived mitochondrial DNA copy number is associated with gene expression across multiple 2 tissues and is predictive for incident neurodegenerative disease 3 4 Stephanie Y. Yang1, Christina A. Castellani1, Ryan J. Longchamps1, Vamsee K. Pillalamarri1, Brian 5 O’Rourke2, Eliseo Guallar3, Dan E. Arking1,2 6 7 8 1McKusick-Nathans Department of Genetic Medicine, Johns Hopkins University School of Medicine, 9 Baltimore, MD 10 2Division of Cardiology, Department of Medicine, Johns Hopkins University School of Medicine, 11 Baltimore, MD 12 3Departments of Epidemiology and Medicine, and Welch Center for Prevention, Epidemiology, and 13 Clinical Research, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 14 15 Email addresses: 16 [email protected] 17 [email protected] 18 [email protected] 19 [email protected] 20 [email protected] 21 [email protected] 22 [email protected] 23 24 25 26 27 28 29 30 31 32 33 34 35 *Correspondence and address for reprints to: 36 Dan E. Arking, Ph.D. 37 Johns Hopkins University School of Medicine 38 733 N Broadway Ave 39 Miller Research Building Room 459 40 Baltimore, MD 21205 41 (410) 502-4867 (ph) 42 [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.17.209023; this version posted July 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Human Mitochondrial Transcription Factors TFAM and TFB2M Work Synergistically in Promoter Melting During Transcription Initiatio
    Published online 28 November 2016 Nucleic Acids Research, 2017, Vol. 45, No. 2 861–874 doi: 10.1093/nar/gkw1157 Human mitochondrial transcription factors TFAM and TFB2M work synergistically in promoter melting during transcription initiation Aparna Ramachandran1, Urmimala Basu1,2, Shemaila Sultana1, Divya Nandakumar1 and Smita S. Patel1,* 1Department of Biochemistry and Molecular Biology, Rutgers, Robert Wood Johnson Medical school, Piscataway, NJ 08854, USA and 2Graduate School of Biomedical Sciences, Rutgers University, Piscataway, NJ 08854, USA Received August 10, 2016; Revised November 02, 2016; Editorial Decision November 04, 2016; Accepted November 04, 2016 ABSTRACT is transcribed by POLRMT, which is homologous to single subunit RNA polymerases from phage T7 and yeast mito- Human mitochondrial DNA is transcribed by POL- chondria (3). T7 RNA polymerase can initiate transcription RMT with the help of two initiation factors, TFAM on its own without any transcription factors (4), the Sac- and TFB2M. The current model postulates that the charomyces cerevisiae Rpo41 requires Mtf1 to initiate tran- role of TFAM is to recruit POLRMT and TFB2M to scription (5–7), and the human POLRMT requires two ini- melt the promoter. However, we show that TFAM tiation factors, TFAM (Transcription Factor A of the Mi- has ‘post-recruitment’ roles in promoter melting and tochondria) and TFB2M (Transcription Factor B2 of the RNA synthesis, which were revealed by studying Mitochondria) for transcript synthesis (8,9). the pre-initiation steps of promoter binding, bend- The initiation factor TFB2M is structurally homologous ing and melting, and abortive RNA synthesis. Our to bacterial RNA methyltransferase ErmC’ (8,10); how- 2-aminopurine mapping studies show that the LSP ever, it has lost most of its RNA methyltransferase activity (11) and serves mainly as the transcription initiation fac- (Light Strand Promoter) is melted from −4to+1in − tor.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Mitochondrial Biogenesis Through Activation of Nuclear Signaling Proteins
    Downloaded from http://cshperspectives.cshlp.org/ on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Mitochondrial Biogenesis through Activation of Nuclear Signaling Proteins John E. Dominy and Pere Puigserver Department of Cancer Biology, Dana-Farber Cancer Institute and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts 02215 Correspondence: [email protected] The dynamics of mitochondrial biogenesis and function is a complex interplayof cellular and molecular processes that ultimately shape bioenergetics capacity. Mitochondrial mass, by itself, represents the net balance between rates of biogenesis and degradation. Mitochondrial biogenesis is dependent on different signaling cascades and transcriptional complexes that promote the formation and assembly of mitochondria—a process that is heavily dependent on timely and coordinated transcriptional control of genes encoding for mitochondrial pro- teins. In this article, we discuss the major signals and transcriptional complexes, program- ming mitochondrial biogenesis, and bioenergetic activity.This regulatory network represents a new therapeutic window into the treatment of the wide spectrum of mitochondrial and neurodegenerative diseases characterized by dysregulation of mitochondrial dynamics and bioenergetic deficiencies. itochondria are dense, double membrane- organelle. Mitochondria, for instance, are essen- Menclosed organelles that are present in all tial for the synthesis of pyrimidines and purines, mammalian cells except
    [Show full text]
  • TFB2M (NM 022366) Human Untagged Clone – SC112537
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC112537 TFB2M (NM_022366) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: TFB2M (NM_022366) Human Untagged Clone Tag: Tag Free Symbol: TFB2M Synonyms: Hkp1; mtTFB2 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC112537 sequence for NM_022366 edited (data generated by NextGen Sequencing) ATGTGGATCCCAGTGGTCGGGCTTCCTCGGCGGCTGAGGCTCTCCGCCTTGGCGGGCGCT GGTCGCTTTTGCATTTTAGGGTCTGAAGCGGCGACGCGAAAGCATTTGCCGGCGAGGAAC CACTGTGGGCTCTCTGACTCCTCTCCGCAGCTGTGGCCCGAACCGGATTTCAGGAATCCG CCAAGGAAGGCGTCTAAGGCCAGCTTAGACTTTAAGCGTTACGTAACCGATCGGAGATTG GCTGAGACCCTGGCGCAAATCTATTTGGGAAAACCAAGTAGACCTCCACACCTACTGCTG GAGTGCAATCCAGGTCCTGGAATCCTGACTCAGGCATTACTTGAAGCTGGTGCCAAAGTG GTTGCGCTCGAAAGTGACAAAACTTTTATTCCACATTTGGAGTCCTTAGGAAAAAATCTG GATGGAAAACTACGAGTGATTCACTGTGACTTCTTTAAACTAGATCCTAGAAGTGGTGGA GTAATAAAACCACCTGCTATGTCTTCTCGAGGGCTCTTTAAGAATTTGGGAATAGAAGCA GTTCCTTGGACAGCAGACATCCCTTTAAAAGTAGTTGGAATGTTCCCAAGTAGAGGTGAG AAAAGGGCACTTTGGAAACTCGCATATGACTTGTATTCCTGTACTTCTATATATAAATTT GGACGAATAGAAGTAAATATGTTTATTGGTGAAAAAGAATTCCAGAAACTAATGGCAGAT CCCGGAAATCCAGACTTGTATCATGTATTAAGTGTTATCTGGCAATTAGCTTGTGAGATT AAGGTTCTGCACATGGAGCCTTGGTCATCATTTGATATATACACCCGGAAAGGGCCGCTG GAAAACCCAAAGCGTAGGGAATTATTAGACCAATTACAACAAAAGCTGTATCTTATTCAA ATGATTCCTCGTCAAAATTTATTTACCAAGAACTTAACACCTATGAACTATAATATATTT
    [Show full text]
  • UC San Diego Electronic Theses and Dissertations
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Cardiac Stretch-Induced Transcriptomic Changes are Axis-Dependent Permalink https://escholarship.org/uc/item/7m04f0b0 Author Buchholz, Kyle Stephen Publication Date 2016 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Cardiac Stretch-Induced Transcriptomic Changes are Axis-Dependent A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioengineering by Kyle Stephen Buchholz Committee in Charge: Professor Jeffrey Omens, Chair Professor Andrew McCulloch, Co-Chair Professor Ju Chen Professor Karen Christman Professor Robert Ross Professor Alexander Zambon 2016 Copyright Kyle Stephen Buchholz, 2016 All rights reserved Signature Page The Dissertation of Kyle Stephen Buchholz is approved and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2016 iii Dedication To my beautiful wife, Rhia. iv Table of Contents Signature Page ................................................................................................................... iii Dedication .......................................................................................................................... iv Table of Contents ................................................................................................................ v List of Figures ...................................................................................................................
    [Show full text]
  • Mitochondrial Biogenesis Is Transcriptionally Repressed In
    RESEARCH COMMUNICATION Mitochondrial biogenesis is transcriptionally repressed in lysosomal lipid storage diseases King Faisal Yambire1,2,3, Lorena Fernandez-Mosquera1, Robert Steinfeld4, Christiane Mu¨ hle5, Elina Ikonen6, Ira Milosevic3, Nuno Raimundo1* 1Institute of Cellular Biochemistry, University Medical Center Goettingen, Goettingen, Germany; 2International Max-Planck Research School in Neuroscience, Goettingen, Germany; 3European Neuroscience Institute Goettingen, University Medical Center Goettingen, Goettingen, Germany; 4Klinik fu¨ r Kinder- und Jugendmedizin, University Medical Center Goettingen, Goettingen, Germany; 5Department of Psychiatry and Psychotherapy, Friedrich-Alexander University Erlangen-Nu¨ rnberg (FAU), Erlangen, Germany; 6Department of Anatomy, Faculty of Medicine, University of Helsinki, Biomedicum Helsinki, Helsinki, Finland Abstract Perturbations in mitochondrial function and homeostasis are pervasive in lysosomal storage diseases, but the underlying mechanisms remain unknown. Here, we report a transcriptional program that represses mitochondrial biogenesis and function in lysosomal storage diseases Niemann-Pick type C (NPC) and acid sphingomyelinase deficiency (ASM), in patient cells and mouse tissues. This mechanism is mediated by the transcription factors KLF2 and ETV1, which are both induced in NPC and ASM patient cells. Mitochondrial biogenesis and function defects in these cells are rescued by the silencing of KLF2 or ETV1. Increased ETV1 expression is regulated by KLF2, while the increase of KLF2 protein levels in NPC and ASM stems from impaired signaling downstream sphingosine-1-phosphate receptor 1 (S1PR1), which normally represses KLF2. In *For correspondence: patient cells, S1PR1 is barely detectable at the plasma membrane and thus unable to repress KLF2. [email protected] This manuscript provides a mechanistic pathway for the prevalent mitochondrial defects in goettingen.de lysosomal storage diseases.
    [Show full text]
  • Epigenetic Regulation of Mitochondrial Quality Control Genes in Multiple Myeloma: a Sequenom Massarray Pilot Investigation on Hmcls
    Journal of Clinical Medicine Communication Epigenetic Regulation of Mitochondrial Quality Control Genes in Multiple Myeloma: A Sequenom MassARRAY Pilot Investigation on HMCLs Patrizia D’Aquila 1,†, Domenica Ronchetti 2,3,† , Maria Eugenia Gallo Cantafio 4, Katia Todoerti 2,3, Elisa Taiana 2,3 , Fernanda Fabiani 5, Alberto Montesanto 1, Antonino Neri 2,3, Giuseppe Passarino 1 , Giuseppe Viglietto 4, Dina Bellizzi 1,‡ and Nicola Amodio 4,*,‡ 1 Department of Cell Biology, Ecology and Earth Sciences, University of Calabria, 87036 Rende, Italy; [email protected] (P.D.); [email protected] (A.M.); [email protected] (G.P.); [email protected] (D.B.) 2 Department of Oncology and Hemato-Oncology, University of Milan, 20122 Milan, Italy; [email protected] (D.R.); [email protected] (K.T.); [email protected] (E.T.); [email protected] (A.N.) 3 Hematology, Fondazione Cà Granda IRCCS Policlinico, 20122 Milan, Italy 4 Department of Experimental and Clinical Medicine, Magna Graecia University of Catanzaro, 88100 Catanzaro, Italy; [email protected] (M.E.G.C.); [email protected] (G.V.) 5 Medical Genetics, University “Magna Graecia”, 88100 Catanzaro, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-0961-3694159 † P.D. and D.R. equally contributed to this work. ‡ D.B. and N.A. equally contributed to this work. Citation: D’Aquila, P.; Ronchetti, D.; Gallo Cantafio, M.E.; Todoerti, K.; Abstract: The mitochondrial quality control network includes several epigenetically-regulated genes Taiana, E.; Fabiani, F.; Montesanto, A.; involved in mitochondrial dynamics, mitophagy, and mitochondrial biogenesis under physiologic Neri, A.; Passarino, G.; Viglietto, G.; conditions.
    [Show full text]
  • A System-Wide Approach to Diabetic Nephropathy
    A System-Wide Approach to Diabetic Nephropathy By Luis Andrés de la Mora Palafox In Partial Fulfillment of the Requirements For the Degree of Master of Science in Biological Engineering King Abdullah University of Science and Technology Thuwal Kingdom of Saudi Arabia July 2011 2 The thesis A System-Wide Approach to Diabetic Nephropathy by Luis Andrés de la Mora Palafox is approved by: Committee Chairperson: Dr. Timothy Ravasi Committee Member: Dr. Jasmeen Merzaban Committee Member: Dr. Christoph Gehring 3 © July 2011 Luis Andrés de la Mora Palafox All Rights Reserved 4 This work is dedicated To my mother and my father Ustedes me enseñaron A caminar entre los espacios Que nos separan del conocimiento 5 ACKNOWLEDGEMENTS I want to thank Timothy Ravasi for giving me an opportunity to work with him. But especially I want to thank him for sharing his knowledge and philosophy of life with me. Also, I want to thank Dr. Satish Rao and Dr. Kumar Sharma for been a guide and a support during my time in San Diego and across the whole process. Finally, I want to thank the KAUST Graduate Skills Lab, in particular Dr. Ari Sherris for helping me finding the correct way to transfer my ideas into the paper. The process has been long and difficult. I am sure that without the support of the people I mention here and many others that were next to me all the time I wouldn’t have accomplished my goals. 6 ABSTRACT A System-Wide Approach to Diabetic Nephropathy Luis Andrés de la Mora Palafox Diabetes mellitus is a complex human disease that affects more than 280 million people worldwide.
    [Show full text]