DOCSLIB.ORG

Mitochondrial Biogenesis Through Activation of Nuclear Signaling Proteins

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mitochondrial Biogenesis Through Activation of Nuclear Signaling Proteins Downloaded from http://cshperspectives.cshlp.org/ on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Mitochondrial Biogenesis through Activation of Nuclear Signaling Proteins John E. Dominy and Pere Puigserver Department of Cancer Biology, Dana-Farber Cancer Institute and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts 02215 Correspondence: [email protected] The dynamics of mitochondrial biogenesis and function is a complex interplayof cellular and molecular processes that ultimately shape bioenergetics capacity. Mitochondrial mass, by itself, represents the net balance between rates of biogenesis and degradation. Mitochondrial biogenesis is dependent on different signaling cascades and transcriptional complexes that promote the formation and assembly of mitochondria—a process that is heavily dependent on timely and coordinated transcriptional control of genes encoding for mitochondrial pro- teins. In this article, we discuss the major signals and transcriptional complexes, program- ming mitochondrial biogenesis, and bioenergetic activity.This regulatory network represents a new therapeutic window into the treatment of the wide spectrum of mitochondrial and neurodegenerative diseases characterized by dysregulation of mitochondrial dynamics and bioenergetic deficiencies. itochondria are dense, double membrane- organelle. Mitochondria, for instance, are essen- Menclosed organelles that are present in all tial for the synthesis of pyrimidines and purines, mammalian cells except mature red blood cor- contribute to the synthesis of heme, regulate ni- puscles. They uniquely possess their own ge- trogen balance through the urea cycle, produce nome in a circular DNA molecule. Although ketone bodies, are necessary for sex hormone this genome encodes for only a small fraction production, are involved in the processing of of the total genes needed for mitochondrial or- xenobiotics, play a critical role in redox balance, ganelle assembly and function, it is thus neces- and are key regulators of the apoptotic program sarily complemented by nuclear-encoded genes. in mammals. Given the centrality of mitochon- Mitochondria provide a wide variety of bio- dria to the maintenance of so many pathways in chemical services to the cell. Although it is con- mammalian cells, it is not surprising that there ventionally accepted that energy production exist multiple layers of control that enable a through the aerobic oxidation of carbon sub- cell to coordinate its net mitochondrial activity strates and the generation of ATPis the principal with fuel sources, biosynthetic demands, prolif- function of mitochondria, this narrow view eration rates, and external stimuli. One impor- overlooks the many other impressive biosyn- tant layer in this signaling control is the expres- thetic and regulatory capacities of this versatile sion of mitochondrial nuclear-derived genes Editors: Douglas C. Wallace and Richard J. Youle Additional Perspectives on Mitochondria available at www.cshperspectives.org Copyright # 2013 Cold Spring Harbor Laboratory Press; all rights reserved; doi: 10.1101/cshperspect.a015008 Cite this article as Cold Spring Harb Perspect Biol 2013;5:a015008 1 Downloaded from http://cshperspectives.cshlp.org/ on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press J.E. Dominy and P. Puigserver that initiate the cellular program of mitochon- mitochondrial genome through the direct mod- drial biogenesis. Defects and failure in the in- ulation of transcription factor A mitochondrial tegrity of this signaling system can cause serious (TFAM) and transcription factor B proteins perturbations to cellular metabolism and give (TFBs) gene expression; TFAM and TFBs are rise to a broad range of tissue specific as well major regulators of mitochondrial DNA tran- as systemic pathologies in humans. The same scription and replication (Gleyzer et al. 2005). signaling system, on the other hand, also opens NRF-1 may play an integral role in coupling many therapeutic opportunities for the correc- mitochondrial replication with nuclear replica- tion of mitochondrial defects. In this article, we tion over the course of the cell cycle through discuss some of the major signaling factors that regulation of E2F transcription factor targets serve to regulate mitochondrial biogenesis and and mitochondrial genes, indicating a link be- their implications for the mitigation of mito- tween cell division and mitochondrial biogen- chondrial disorders. esis (Cam et al. 2004). Studies involving the promoter region of cytochrome c oxidase complex subunit IV REGULATION OF MITOCHONDRIAL (COXIV) revealed the presence of another nu- BIOGENESIS AND FUNCTION THROUGH clear respiratory factor, NRF-2, which was able NUCLEAR-BASED GENE EXPRESSION to regulate the expression of proteins in the Although mitochondria contain in excess of electron transport chain (Carter et al. 1992). 1000 proteins, its tiny circular genome encodes NRF-2 promotes the expression of genes that for only 13 proteins, 22 tRNAs, and two rRNAs; encode for mitochondrial complex IV cyto- the balance of this genetic shortage is made chrome c oxidase (Gugneja et al. 1995). Like up by the nuclear genome (Calvo and Mootha NRF1, NRF2 also controls the expression of 2010). Because the vast majority of mitochon- TFAM and TFBs. The differential regulation drial genes are situated in the nucleus, trans- of NRF1 and NRF2 is not completely under- cription complexes at promoters of these genes stood but phosphorylation of these factors can control their expression. This affords the cell alter their transcriptional activities (Scarpulla the opportunity to coordinately regulate the 2008). In addition, specific coactivators of the expression of both mitochondrial and non- PGC-1 family sculpt NRFs-dependent control mitochondrialgenesetstoaffectaunifiedspecif- of mitochondrial gene expression in response ic cellular response. Below we highlight some to different signaling pathways (Wu et al. 1999). of the major nuclear transcriptional complexes regulating mitochondrial gene expression and Nuclear Hormone Receptors the diverse signaling pathways to which they respond (Fig. 1). Within the superfamily of nuclear hormone receptors, there are several subclasses that con- trol mitochondrial function and biogenesis. Nuclear Respiratory Factors The PPAR group of receptors is one such set. Sequence analysis of the electron transport gene PPARa, which can be activated by long-chain cytochrome c promoter initially identified nu- fatty acids and eicosanoids, can potently pro- clear respiratory factor 1 (NRF-1) as an impor- mote the expression of genes involved in mi- tant regulator of gene expression (Evans and tochondrial b-oxidation (Gulick et al. 1994). Scarpulla 1989). NRF-1 controls the expression The activation of PPARg activation, on the of a significant number of the proteins that other hand, triggers mitochondrial biogenesis make up the five respiratory complexes, as well in white adipose tissue (Wilson-Fritch et al. as proteins integral to mitochondrial import 2004); PPARg activation is also necessary to and heme biosynthesis (Scarpulla 2008). NRF- induce the expression of mitochondrial genes 1 is also able to integrate nuclear control of the involved in the brown fat-mediated thermogen- transcriptional and replicative activity of the ic program (Puigserver et al. 1998). PPARd,in 2 Cite this article as Cold Spring Harb Perspect Biol 2013;5:a015008 Downloaded from http://cshperspectives.cshlp.org/ on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Programming Mitochondrial Biogenesis Nuclear-encoded genes Fusion/ Mitochondrial TCA cycle enzymes Fatty acid β oxidation OXPHOS genes fission factors protein import Tfam/TFBs PPARs ERRs CREB YY1 THRs NRF1 NRF2 RIP140 PGC-1α/β JNK mTORC1 Nutrients/ anabolic stimuli PKA SIRT1 ROS + CAMK/MAPK AMPK NAD Adrenergic stimuli Muscle contractions/ 2+ Ca other stimuli ? Mitochondrial gene transcription/ Low adenylate charge DNA replication SIRT3/ SIRT4/ SIRT5 Deacylation of mitochondrial proteins Figure 1. An overview of the transcriptional complexes regulating mitochdondrial gene expression and the signaling pathways converging upon them. Illustrated are the major transcriptional complexes/chromatin remodeling factors directly associated with changes in mitochondrial gene expression (see text for additional information). skeletal muscle, is able to up-regulate mitochon- truncated form of thyroid hormone receptor a drial genes associated with fatty acid oxidation has been reported to be localized to the mito- and specify slow twitch fiber type (Narkar et al. chondrion and may serve to directly activate the 2008; Kleiner et al. 2009). transcription of genes in the mitochondrial ge- Thyroid hormone receptors (THRs) can nome (Casas et al. 1999). also promote mitochondrial biogenesis and tis- Estrogen-related receptors ERR-a, ERR-b, sue-specific function. This includes mitochon- and ERR-g are yet another set of nuclear hor- drial-driven thermogenesisthat occurs in brown mone receptors capable of promoting mito- fat during the adaptation to lower temperatures chondrial biogenesis. These receptors have no (Silva 1995). In some instances, THRs directly known endogenous ligands and are primary drive the transcription of nuclear-encoded genes, expressed in tissues with high oxidative meta- whereas, in others, the effects can occur indi- bolism capacities (Eichner and Giguere 2011). rectly through the thyroid hormone-mediated
Load more

Recommended publications
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • AMPK, Mitochondrial Function, and Cardiovascular Disease
    International Journal of Molecular Sciences Review AMPK, Mitochondrial Function, and Cardiovascular Disease Shengnan Wu * and Ming-Hui Zou Center for Molecular and Translational Medicine, Georgia State University, Atlanta, GA 30303, USA; [email protected] * Correspondence: [email protected] Received: 11 June 2020; Accepted: 6 July 2020; Published: 15 July 2020 Abstract: Adenosine monophosphate-activated protein kinase (AMPK) is in charge of numerous catabolic and anabolic signaling pathways to sustain appropriate intracellular adenosine triphosphate levels in response to energetic and/or cellular stress. In addition to its conventional roles as an intracellular energy switch or fuel gauge, emerging research has shown that AMPK is also a redox sensor and modulator, playing pivotal roles in maintaining cardiovascular processes and inhibiting disease progression. Pharmacological reagents, including statins, metformin, berberine, polyphenol, and resveratrol, all of which are widely used therapeutics for cardiovascular disorders, appear to deliver their protective/therapeutic effects partially via AMPK signaling modulation. The functions of AMPK during health and disease are far from clear. Accumulating studies have demonstrated crosstalk between AMPK and mitochondria, such as AMPK regulation of mitochondrial homeostasis and mitochondrial dysfunction causing abnormal AMPK activity. In this review, we begin with the description of AMPK structure and regulation, and then focus on the recent advances toward understanding how mitochondrial dysfunction controls AMPK and how AMPK, as a central mediator of the cellular response to energetic stress, maintains mitochondrial homeostasis. Finally, we systemically review how dysfunctional AMPK contributes to the initiation and progression of cardiovascular diseases via the impact on mitochondrial function. Keywords: mitochondrial function; AMPK; cardiovascular disease 1. Introduction Cells constantly coordinate their metabolism to satisfy their energy needs and respond to the use of nutrients.
    [Show full text]
  • Cytotoxic Effects and Changes in Gene Expression Profile
    Toxicology in Vitro 34 (2016) 309–320 Contents lists available at ScienceDirect Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit Fusarium mycotoxin enniatin B: Cytotoxic effects and changes in gene expression profile Martina Jonsson a,⁎,MarikaJestoib, Minna Anthoni a, Annikki Welling a, Iida Loivamaa a, Ville Hallikainen c, Matti Kankainen d, Erik Lysøe e, Pertti Koivisto a, Kimmo Peltonen a,f a Chemistry and Toxicology Research Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, Finland b Product Safety Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, c The Finnish Forest Research Institute, Rovaniemi Unit, P.O. Box 16, FI-96301 Rovaniemi, Finland d Institute for Molecular Medicine Finland (FIMM), University of Helsinki, P.O. Box 20, FI-00014, Finland e Plant Health and Biotechnology, Norwegian Institute of Bioeconomy, Høyskoleveien 7, NO -1430 Ås, Norway f Finnish Safety and Chemicals Agency (Tukes), Opastinsilta 12 B, FI-00521 Helsinki, Finland article info abstract Article history: The mycotoxin enniatin B, a cyclic hexadepsipeptide produced by the plant pathogen Fusarium,isprevalentin Received 3 December 2015 grains and grain-based products in different geographical areas. Although enniatins have not been associated Received in revised form 5 April 2016 with toxic outbreaks, they have caused toxicity in vitro in several cell lines. In this study, the cytotoxic effects Accepted 28 April 2016 of enniatin B were assessed in relation to cellular energy metabolism, cell proliferation, and the induction of ap- Available online 6 May 2016 optosis in Balb 3T3 and HepG2 cells. The mechanism of toxicity was examined by means of whole genome ex- fi Keywords: pression pro ling of exposed rat primary hepatocytes.
    [Show full text]
  • Estradiol Stimulates Mitochondrial Biogenesis and Adiponectin Expression in Skeletal Muscle
    G CAPLLONCH-AMER and others Mitochondrial biogenesis 221:3 391–403 Research stimulation in WGM Estradiol stimulates mitochondrial biogenesis and adiponectin expression in skeletal muscle Gabriela Capllonch-Amer1, Miquel Sbert-Roig1, Bel M Galme´s-Pascual1, Ana M Proenza1,2, Isabel Llado´1,2, Magdalena Gianotti1,2 and Francisco J Garcı´a-Palmer1,2 1Grup Metabolisme Energe` tic i Nutricio´ , Departament de Biologia Fonamental i Cie` ncies de la Salut, Institut Correspondence Universitari d’Investigacio´ en Cie` ncies de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, should be addressed km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain to M Gianotti 2Centro de Investigacio´ n Biome´ dica en Red Fisiopatologı´a de la Obesidad y la Nutricio´ n (CIBERobn, CB06/03/0043), Email Instituto de Salud Carlos III, Madrid, Spain [email protected] Abstract Sexual dimorphism has been found in mitochondrial features of skeletal muscle, with female Key Words rats showing greater mitochondrial mass and function compared with males. Adiponectin is an " 17b-estradiol insulin-sensitizing adipokine whose expression has been related to mitochondrial function and " testosterone that is also expressed in skeletal muscle, where it exerts local metabolic effects. The aim of this " ovariectomy research was to elucidate the role of sex hormones in modulation of mitochondrial function, as " mitochondrial biogenesis well as its relationship with adiponectin production in rat skeletal muscle. An in vivo study with " mitochondrial dynamics ovariectomized Wistar rats receiving or not receiving 17b-estradiol (E2)(10mg/kg per 48 h for " skeletal muscle Journal of Endocrinology 4 weeks) was carried out, in parallel with an assay of cultured myotubes (L6E9) treated with " adiponectin E2 (10 nM), progesterone (Pg; 1 mM), or testosterone (1 mM).
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Blood-Derived Mitochondrial DNA Copy Number Is Associated with Gene Expression Across Multiple
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.17.209023; this version posted July 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Blood-derived mitochondrial DNA copy number is associated with gene expression across multiple 2 tissues and is predictive for incident neurodegenerative disease 3 4 Stephanie Y. Yang1, Christina A. Castellani1, Ryan J. Longchamps1, Vamsee K. Pillalamarri1, Brian 5 O’Rourke2, Eliseo Guallar3, Dan E. Arking1,2 6 7 8 1McKusick-Nathans Department of Genetic Medicine, Johns Hopkins University School of Medicine, 9 Baltimore, MD 10 2Division of Cardiology, Department of Medicine, Johns Hopkins University School of Medicine, 11 Baltimore, MD 12 3Departments of Epidemiology and Medicine, and Welch Center for Prevention, Epidemiology, and 13 Clinical Research, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 14 15 Email addresses: 16 [email protected] 17 [email protected] 18 [email protected] 19 [email protected] 20 [email protected] 21 [email protected] 22 [email protected] 23 24 25 26 27 28 29 30 31 32 33 34 35 *Correspondence and address for reprints to: 36 Dan E. Arking, Ph.D. 37 Johns Hopkins University School of Medicine 38 733 N Broadway Ave 39 Miller Research Building Room 459 40 Baltimore, MD 21205 41 (410) 502-4867 (ph) 42 [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.17.209023; this version posted July 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Human Mitochondrial Transcription Factors TFAM and TFB2M Work Synergistically in Promoter Melting During Transcription Initiatio
    Published online 28 November 2016 Nucleic Acids Research, 2017, Vol. 45, No. 2 861–874 doi: 10.1093/nar/gkw1157 Human mitochondrial transcription factors TFAM and TFB2M work synergistically in promoter melting during transcription initiation Aparna Ramachandran1, Urmimala Basu1,2, Shemaila Sultana1, Divya Nandakumar1 and Smita S. Patel1,* 1Department of Biochemistry and Molecular Biology, Rutgers, Robert Wood Johnson Medical school, Piscataway, NJ 08854, USA and 2Graduate School of Biomedical Sciences, Rutgers University, Piscataway, NJ 08854, USA Received August 10, 2016; Revised November 02, 2016; Editorial Decision November 04, 2016; Accepted November 04, 2016 ABSTRACT is transcribed by POLRMT, which is homologous to single subunit RNA polymerases from phage T7 and yeast mito- Human mitochondrial DNA is transcribed by POL- chondria (3). T7 RNA polymerase can initiate transcription RMT with the help of two initiation factors, TFAM on its own without any transcription factors (4), the Sac- and TFB2M. The current model postulates that the charomyces cerevisiae Rpo41 requires Mtf1 to initiate tran- role of TFAM is to recruit POLRMT and TFB2M to scription (5–7), and the human POLRMT requires two ini- melt the promoter. However, we show that TFAM tiation factors, TFAM (Transcription Factor A of the Mi- has ‘post-recruitment’ roles in promoter melting and tochondria) and TFB2M (Transcription Factor B2 of the RNA synthesis, which were revealed by studying Mitochondria) for transcript synthesis (8,9). the pre-initiation steps of promoter binding, bend- The initiation factor TFB2M is structurally homologous ing and melting, and abortive RNA synthesis. Our to bacterial RNA methyltransferase ErmC’ (8,10); how- 2-aminopurine mapping studies show that the LSP ever, it has lost most of its RNA methyltransferase activity (11) and serves mainly as the transcription initiation fac- (Light Strand Promoter) is melted from −4to+1in − tor.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • TFB2M (NM 022366) Human Untagged Clone – SC112537
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC112537 TFB2M (NM_022366) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: TFB2M (NM_022366) Human Untagged Clone Tag: Tag Free Symbol: TFB2M Synonyms: Hkp1; mtTFB2 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC112537 sequence for NM_022366 edited (data generated by NextGen Sequencing) ATGTGGATCCCAGTGGTCGGGCTTCCTCGGCGGCTGAGGCTCTCCGCCTTGGCGGGCGCT GGTCGCTTTTGCATTTTAGGGTCTGAAGCGGCGACGCGAAAGCATTTGCCGGCGAGGAAC CACTGTGGGCTCTCTGACTCCTCTCCGCAGCTGTGGCCCGAACCGGATTTCAGGAATCCG CCAAGGAAGGCGTCTAAGGCCAGCTTAGACTTTAAGCGTTACGTAACCGATCGGAGATTG GCTGAGACCCTGGCGCAAATCTATTTGGGAAAACCAAGTAGACCTCCACACCTACTGCTG GAGTGCAATCCAGGTCCTGGAATCCTGACTCAGGCATTACTTGAAGCTGGTGCCAAAGTG GTTGCGCTCGAAAGTGACAAAACTTTTATTCCACATTTGGAGTCCTTAGGAAAAAATCTG GATGGAAAACTACGAGTGATTCACTGTGACTTCTTTAAACTAGATCCTAGAAGTGGTGGA GTAATAAAACCACCTGCTATGTCTTCTCGAGGGCTCTTTAAGAATTTGGGAATAGAAGCA GTTCCTTGGACAGCAGACATCCCTTTAAAAGTAGTTGGAATGTTCCCAAGTAGAGGTGAG AAAAGGGCACTTTGGAAACTCGCATATGACTTGTATTCCTGTACTTCTATATATAAATTT GGACGAATAGAAGTAAATATGTTTATTGGTGAAAAAGAATTCCAGAAACTAATGGCAGAT CCCGGAAATCCAGACTTGTATCATGTATTAAGTGTTATCTGGCAATTAGCTTGTGAGATT AAGGTTCTGCACATGGAGCCTTGGTCATCATTTGATATATACACCCGGAAAGGGCCGCTG GAAAACCCAAAGCGTAGGGAATTATTAGACCAATTACAACAAAAGCTGTATCTTATTCAA ATGATTCCTCGTCAAAATTTATTTACCAAGAACTTAACACCTATGAACTATAATATATTT
    [Show full text]
  • Transcriptional Regulatory Circuits Controlling Mitochondrial Biogenesis and Function
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Transcriptional regulatory circuits controlling mitochondrial biogenesis and function Daniel P. Kelly1,3 and Richard C. Scarpulla2 1Center for Cardiovascular Research, Departments of Medicine, Molecular Biology & Pharmacology, and Pediatrics, Washington University School of Medicine, St.Louis, Missouri 63119, USA ; 2Department of Cell and Molecular Biology, Northwestern Medical School, Chicago, Illinois 60611, USA We are witnessing a period of renewed interest in the The limited coding capacity of mtDNA necessitates biology of the mitochondrion.The mitochondrion serves that nuclear genes make a major contribution to mito- a critical function in the maintenance of cellular energy chondrial metabolic systems and molecular architecture stores, thermogenesis, and apoptosis.Moreover, alter- (Garesse and Vallejo 2001).One major class of nuclear ations in mitochondrial function contribute to several genes contributes catalytic and auxiliary proteins to the inherited and acquired human diseases and the aging mitochondrial enzyme systems.For example, the major- process.This review summarizes our understanding of ity of the 100 or so subunits of the respiratory apparatus the transcriptional regulatory mechanisms involved in are nucleus-encoded.In addition, nucleus-encoded meta- the biogenesis and energy metabolic function of mito- bolic enzymes necessary for the oxidation of pyruvate, chondria in higher organisms. fatty acids (␤-oxidation
    [Show full text]
  • UC San Diego Electronic Theses and Dissertations
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Cardiac Stretch-Induced Transcriptomic Changes are Axis-Dependent Permalink https://escholarship.org/uc/item/7m04f0b0 Author Buchholz, Kyle Stephen Publication Date 2016 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Cardiac Stretch-Induced Transcriptomic Changes are Axis-Dependent A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioengineering by Kyle Stephen Buchholz Committee in Charge: Professor Jeffrey Omens, Chair Professor Andrew McCulloch, Co-Chair Professor Ju Chen Professor Karen Christman Professor Robert Ross Professor Alexander Zambon 2016 Copyright Kyle Stephen Buchholz, 2016 All rights reserved Signature Page The Dissertation of Kyle Stephen Buchholz is approved and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2016 iii Dedication To my beautiful wife, Rhia. iv Table of Contents Signature Page ................................................................................................................... iii Dedication .......................................................................................................................... iv Table of Contents ................................................................................................................ v List of Figures ...................................................................................................................
    [Show full text]
  • Mitochondria-Localized AMPK Responds to Local Energetics and Contributes to Exercise and Energetic Stress-Induced Mitophagy
    Mitochondria-localized AMPK responds to local energetics and contributes to exercise and energetic stress-induced mitophagy Joshua C. Drakea,b,1, Rebecca J. Wilsona,c, Rhianna C. Lakera, Yuntian Guana,d, Hannah R. Spauldinga, Anna S. Nichenkob, Wenqing Shena, Huayu Shanga, Maya V. Dorna, Kian Huanga, Mei Zhanga,e, Aloka B. Bandarab, Matthew H. Brisendineb, Jennifer A. Kashatusf, Poonam R. Sharmag, Alexander Younga, Jitendra Gautamh, Ruofan Caoi, Horst Wallrabei,j, Paul A. Changk, Michael Wongk, Eric M. Desjardinsl,m, Simon A. Hawleyn, George J. Christg,o, David F. Kashatusf, Clint L. Millerc,g,p,q, Matthew J. Wolfa,e, Ammasi Periasamyi,j, Gregory R. Steinbergl,r, D. Grahame Hardien, and Zhen Yana,d,e,s,1 aCenter for Skeletal Muscle Research at Robert M. Berne Cardiovascular Research Center, University of Virginia School of Medicine, Charlottesville,VA 22908; bDepartment of Human Nutrition, Foods, and Exercise, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061; cDepartment of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, VA 22908; dDepartment of Pharmacology, University of Virginia School of Medicine, Charlottesville, VA 22908; eDepartment of Medicine, University of Virginia School of Medicine, Charlottesville, VA 22908; fDepartment of Microbiology, Immunology and Cancer Biology, University of Virginia School of Medicine, Charlottesville, VA 22908; gDepartment of Biomedical Engineering, University of Virginia School of Medicine, Charlottesville, VA 22908; hDepartment
    [Show full text]