DOCSLIB.ORG

Blueprint Genetics Cystic Kidney Disease Panel

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Blueprint Genetics Cystic Kidney Disease Panel Cystic Kidney Disease Panel Test code: KI0901 Is a 41 gene panel that includes assessment of non-coding variants. Is ideal for patients with multicystic dysplastic kidneys with or without additional congenital anomalies. About Cystic Kidney Disease In addition to polycystic kidney disease (PKD), the Cystic Kidney Disease Panel offers diagnostics for other multicystic dysplastic kidney disorders (MCDK), such as congenital anomalies with unilateral or bilateral kidney enlargement, distended by multiple cysts, and non-functional and medullary cystic kidney disease. MCDK frequently presents antenatally at routine ultrasound scans, with the majority detected around the 20th week of gestation. Most patients with unilateral MCDK are asymptomatic if the other kidney is fully functional but may occasionally present with abdominal obstructive signs when the cysts become too large. They may also develop hypertension, proteinuria, and renal failure in the long run. Hypertrophy of the contralateral kidney may occur in 24-46% cases before birth, and in up to 80% of cases in the years after birth. Bilateral MCDK is considered a lethal entity. At birth, affected infants have features of the Potter sequence (constellation of signs resulting from prolonged in utero oligohydramnios) with severe pulmonary hypoplasia and severe renal failure, and they often die shortly after birth. The global prevalence of MCDK is not known, but the birth prevalence of the unilateral MCDK is estimated at 1:4,300 live births. Availability 4 weeks Gene Set Description Genes in the Cystic Kidney Disease Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD ANKS6 Nephronophthisis AR 9 12 CEP164 Nephronophthisis AR 11 9 CEP290* Bardet-Biedl syndrome, Leber congenital amaurosis, Joubert AR 130 289 syndrome, Senior-Loken syndrome, Meckel syndrome CEP83 Nephronophthisis AR 10 10 COL4A1 Schizencephaly, Anterior segment dysgenesis with cerebral AD 58 107 involvement, Retinal artery tortuosity, Porencephaly, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Brain small vessel disease CRB2 Focal segmental glomerulosclerosis, Ventriculomegaly with cystic AR 12 22 kidney disease DCDC2 Deafness, Nephronophthisis, Sclerosing cholangitis, neonatal AR 13 9 DNAJB11 Autosomal dominant polycystic kidney disease AD 6 1 DZIP1L Polycystic kidney disease 5 AR 4 5 https://blueprintgenetics.com/ EYA1 Otofaciocervical syndrome, Branchiootic syndrome, Branchiootorenal AD 56 218 syndrome GANAB Polycystic kidney and/or polycystic liver disease 3 AD 7 12 GLIS2 Nephronophthisis AR 3 3 HNF1B Renal cell carcinoma, nonpapillary chromophobe, Renal cysts and AD 35 234 diabetes syndrome IFT172 Retinitis pigmentosa, Short -rib thoracic dysplasia with or without AR 22 25 polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) INVS Nephronophthisis AR 16 34 IQCB1 Senior-Loken syndrome AR 24 41 JAG1 Alagille syndrome AD 131 610 LRP5* Van Buchem disease, Osteoporosis-pseudoglioma syndrome, AD/AR/Digenic 57 196 Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis MAPKBP1 Nephronophthisis 20 AR 6 7 NEK8 Nephronophthisis AR 16 18 NOTCH2* Alagille syndrome, Hajdu-Cheney syndrome AD 37 70 NPHP1 Nephronophthisis, Joubert syndrome, Senior-Loken syndrome AR 19 76 NPHP3 Nephronophthisis, Renal-hepatic-pancreatic dysplasia, Meckel AR 38 75 syndrome NPHP4 Nephronophthisis, Senior-Loken syndrome AR 20 113 OFD1 Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, XL 153 160 Orofaciodigital syndrome, Joubert syndrome PAX2 Isolated renal hypoplasia, Papillorenal syndrome, Focal segmental AD 30 96 glomerulosclerosis 7 PKD1* Polycystic kidney disease AD 237 1923 PKD2 Polycystic kidney disease AD 55 333 PKHD1 Polycystic kidney disease AR 249 557 RPGRIP1L COACH syndrome, Joubert syndrome, Meckel syndrome, Retinal AR 39 49 degeneration in ciliopathy, modifier SDCCAG8 Bardet-Biedl syndrome, Senior-Loken syndrome AR 14 18 SEC61A1 Hyperuricemic nephropathy, familial juvenile 4 AD 4 4 SIX5 Branchiootorenal syndrome AD 3 10 TMEM67 Nephronophthisis, COACH syndrome, Joubert syndrome, Meckel AR 87 170 syndrome TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 177 372 https://blueprintgenetics.com/ TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 396 1195 TTC21B Short-rib thoracic dysplasia, Nephronophthisis, Asphyxiating thoracic AR 23 63 dysplasia (ATD; Jeune) UMOD Familial juvenile hyperuricemic nephropathy, Glomerulocystic kidney AD 33 108 disease with hyperuricemia and isosthenuria, Medullary cystic kidney disease 2 VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 206 614 WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia AR 33 43 with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) ZNF423 Nephronophthisis, Joubert syndrome AD/AR 10 7 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic location HGVS RefSeq RS-number HG19 CEP290 Chr12:88462434 c.6012-12T>A NM_025114.3 rs752197734 CEP290 Chr12:88494960 c.2991+1655A>G NM_025114.3 rs281865192 CEP290 Chr12:88508350 c.1910-11T>G NM_025114.3 CEP290 Chr12:88534822 c.103-18_103-13delGCTTTT NM_025114.3 COL4A1 Chr13:110802675 c.*35C>A NM_001845.4 COL4A1 Chr13:110802678 c.*32G>A/T NM_001845.4 COL4A1 Chr13:110802679 c.*31G>T NM_001845.4 EYA1 Chr8:72156939 c.1051-12T>G NM_000503.4 EYA1 Chr8:72211483 c.640-15G>A NM_000503.4 JAG1 Chr20:10629767 c.1349-12T>G NM_000214.2 https://blueprintgenetics.com/ OFD1 ChrX:13768358 c.935+706A>G NM_003611.2 rs730880283 OFD1 ChrX:13773245 c.1130-22_1130-19delAATT NM_003611.2 rs312262865 OFD1 ChrX:13773249 c.1130-20_1130-16delTTGGT NM_003611.2 PKD1 Chr16:2140209 c.12445-14T>C NM_001009944.2 PKD1 Chr16:2147825 c.10167+25_10167+43delGGCTGGGCTGGGGGTCCTG NM_001009944.2 rs1197421698 PKD1 Chr16:2152273 c.9202-16G>A NM_001009944.2 PKD2 Chr4:88940551 c.596-59A>G NM_000297.3 rs750504141 PKHD1 Chr6:51618610 c.8798-459C>A NM_138694.3 PKHD1 Chr6:51747238 c.7350+653A>G NM_138694.3 TSC1 Chr9:135800306 c.363+668G>A NM_000368.4 TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004 TSC2 Chr16:2106052 c.600-145C>T NM_000548.3 TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132 TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150 TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3 TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794 VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744 VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3 VHL Chr3:10191719 c.*70C>A NM_000551.3 VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225 Test Strengths Exons 1-33 of the PKD1 have multiple segmentally duplicated pseudogenes that reduce sensitivity of NGS diagnostics in general. However, Blueprint Genetics custom assay has good coverage (>20x) with high mapping rates (mapping quality >40) for 99.5% of the target regions in PKD1 gene. Our validation showed high mean coverage of 199X for the PKD1 gene. Thus, our NGS Panel is not expected to have major limitations in detecting variants in PKD1 gene although clinical validation has not been performed at large scale. The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level https://blueprintgenetics.com/ Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations The following
Load more

Recommended publications
  • Educational Paper Ciliopathies
    Eur J Pediatr (2012) 171:1285–1300 DOI 10.1007/s00431-011-1553-z REVIEW Educational paper Ciliopathies Carsten Bergmann Received: 11 June 2011 /Accepted: 3 August 2011 /Published online: 7 September 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com Abstract Cilia are antenna-like organelles found on the (NPHP) . Ivemark syndrome . Meckel syndrome (MKS) . surface of most cells. They transduce molecular signals Joubert syndrome (JBTS) . Bardet–Biedl syndrome (BBS) . and facilitate interactions between cells and their Alstrom syndrome . Short-rib polydactyly syndromes . environment. Ciliary dysfunction has been shown to Jeune syndrome (ATD) . Ellis-van Crefeld syndrome (EVC) . underlie a broad range of overlapping, clinically and Sensenbrenner syndrome . Primary ciliary dyskinesia genetically heterogeneous phenotypes, collectively (Kartagener syndrome) . von Hippel-Lindau (VHL) . termed ciliopathies. Literally, all organs can be affected. Tuberous sclerosis (TSC) . Oligogenic inheritance . Modifier. Frequent cilia-related manifestations are (poly)cystic Mutational load kidney disease, retinal degeneration, situs inversus, cardiac defects, polydactyly, other skeletal abnormalities, and defects of the central and peripheral nervous Introduction system, occurring either isolated or as part of syn- dromes. Characterization of ciliopathies and the decisive Defective cellular organelles such as mitochondria, perox- role of primary cilia in signal transduction and cell isomes, and lysosomes are well-known
    [Show full text]
  • Potter Syndrome: a Case Study
    Case Report Clinical Case Reports International Published: 22 Sep, 2017 Potter Syndrome: A Case Study Konstantinidou P1,2, Chatzifotiou E1,2, Nikolaou A1,2, Moumou G1,2, Karakasi MV2, Pavlidis P2 and Anestakis D1* 1Laboratory of Forensic and Toxicology, Department of Histopathology, Aristotle University of Thessaloniki, Greece 2Laboratory of Forensic Sciences, Department of Histopathology, Democritus University of Thrace School, Greece Abstract Potter syndrome (PS) is a term used to describe a typical physical appearance, which is the result of dramatically decreased amniotic fluid volume secondary to renal diseases such as bilateral renal agenesis (BRA). Other causes are abstraction of the urinary tract, autosomal recessive polycystic kidney disease (ARPKD), autosomal dominant polycystic kidney disease (ADPKD) and renal hypoplasia. In 1946, Edith Potter characterized this prenatal renal failure/renal agenesis and the resulting physical characteristics of the fetus/infant that result from oligohydramnios as well as the complete absence of amniotic fluid (anhydramnios). Oligohydramnios and anhydramnios can also be due to the result of leakage of amniotic fluid from rupturing of the amniotic membranes. The case reported concerns of stillborn boy with Potter syndrome. Keywords: Potter syndrome; Polycystic kidney disease; Oligohydramnios sequence Introduction Potter syndrome is not technically a ‘syndrome’ as it does not collectively present with the same telltale characteristics and symptoms in every case. It is technically a ‘sequence’, or chain of events - that may have different beginnings, but ends with the same conclusion. Below are the different ways that Potter syndrome (A.K.A Potter sequence) can begin due to various causes of renal failure. They gave numbers to differentiate the different forms, but this system had not caught in the medical and scientific communities [1].
    [Show full text]
  • A 10-Year-Old Girl with Joubert Syndrome and Chronic Kidney Disease and Its Related Complications
    4226 Letter to the Editor A 10-year-old girl with Joubert syndrome and chronic kidney disease and its related complications Chong Tian1#, Jiaxiang Chen1,2#, Xing Ming1, Xianchun Zeng1, Rongpin Wang1 1Department of Medical Imaging, Guizhou Provincial People’s Hospital, Guiyang, China; 2Guizhou University School of Medicine, Guiyang, China #These authors contributed equally to this work. Correspondence to: Rongpin Wang. Department of Medical Imaging, Guizhou Provincial People’s Hospital, Zhongshan East Road 83, Guiyang 550002, China. Email: [email protected]. Submitted Aug 05, 2020. Accepted for publication Apr 01, 2021. doi: 10.21037/qims-20-943 View this article at: http://dx.doi.org/10.21037/qims-20-943 Introduction and ankles was tolerated without redness, swelling, fistula, or sinus tract surrounding the skin. She had been healthy in Joubert syndrome (JS) is a rare genetic disorder of recessive the past, and her academic performance was moderate. She neurodevelopmental disorder characterized by distinctive was a picky eater and had a mild short stature but showed cerebellar vermis and mid-hindbrain hypoplasia/dysplasia no other development dysplasia. Nystagmus, oculomotor called the “molar tooth sign” (MTS) (1). Patients present apraxia, hypotonia, and abnormal breathing patterns were with symptoms characteristic of hypotonia in infancy not observed. Concerning the patient’s family history, her and later develop ataxia, ocular motor apraxia, and may mother and father appeared normal, but their first child died also present with developmental delays or intellectual retardation. Defined by the central nervous system features, of renal failure at the age of 4, their second-born twin sons JS also affects many other organs, such as the kidneys, liver, died in the perinatal period (causes unknown), and a third and bones.
    [Show full text]
  • Molar Tooth Sign of the Midbrain-Hindbrain Junction
    American Journal of Medical Genetics 125A:125–134 (2004) Molar Tooth Sign of the Midbrain–Hindbrain Junction: Occurrence in Multiple Distinct Syndromes Joseph G. Gleeson,1* Lesley C. Keeler,1 Melissa A. Parisi,2 Sarah E. Marsh,1 Phillip F. Chance,2 Ian A. Glass,2 John M. Graham Jr,3 Bernard L. Maria,4 A. James Barkovich,5 and William B. Dobyns6** 1Division of Pediatric Neurology, Department of Neurosciences, University of California, San Diego, California 2Division of Genetics and Development, Children’s Hospital and Regional Medical Center, University of Washington, Washington 3Medical Genetics Birth Defects Center, Ahmanson Department of Pediatrics, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, California 4Department of Child Health, University of Missouri, Missouri 5Departments of Radiology, Pediatrics, Neurology, Neurosurgery, University of California, San Francisco, California 6Department of Human Genetics, University of Chicago, Illinois The Molar Tooth Sign (MTS) is defined by patients with these variants of the MTS will an abnormally deep interpeduncular fossa; be essential for localization and identifica- elongated, thick, and mal-oriented superior tion of mutant genes. ß 2003 Wiley-Liss, Inc. cerebellar peduncles; and absent or hypo- plastic cerebellar vermis that together give KEY WORDS: Joubert; molar tooth; Va´ r- the appearance of a ‘‘molar tooth’’ on axial adi–Papp; OFD-VI; COACH; brain MRI through the junction of the mid- Senior–Lo¨ ken; Dekaban– brain and hindbrain (isthmus region). It was Arima; cerebellar vermis; first described in Joubert syndrome (JS) hypotonia; ataxia; oculomo- where it is present in the vast majority of tor apraxia; kidney cysts; patients with this diagnosis.
    [Show full text]
  • Potter Syndrome, a Rare Entity with High Recurrence Risk in Women with Renal Malformations – Case Report and a Review of the Literature
    CASE PRESENTATIONS Ref: Ro J Pediatr. 2017;66(2) DOI: 10.37897/RJP.2017.2.9 POTTER SYNDROME, A RARE ENTITY WITH HIGH RECURRENCE RISK IN WOMEN WITH RENAL MALFORMATIONS – CASE REPORT AND A REVIEW OF THE LITERATURE George Rolea1, Claudiu Marginean1, Vladut Stefan Sasaran2, Cristian Dan Marginean2, Lorena Elena Melit3 1Obstetrics and Gynecology Clinic 1, Tirgu Mures 2University of Medicine and Pharmacy, Tirgu Mures 3Pediatrics Clinic 1, Tirgu Mures ABSTRACT Potter syndrome represents an association between a specific phenotype and pulmonary hypoplasia as a result of oligohydramnios that can appear in different pathological conditions. Thus, Potter syndrome type 1 or auto- somal recessive polycystic renal disease is a relatively rare pathology and with poor prognosis when it is diag- nosed during the intrauterine life. We present the case of a 24-year-old female with an evolving pregnancy, 22/23 gestational weeks, in which the fetal ultrasound revealed oligohydramnios, polycystic renal dysplasia and pulmonary hypoplasia. The personal pathological history revealed the fact that 2 years before this pregnancy, the patient presented a therapeutic abortion at 16 gestational weeks for the same reasons. The maternal ultra- sound showed unilateral maternal renal agenesis. Due to the fact that the identified fetal malformation was in- compatible with life, we decided to induce the therapeutic abortion. The particularity of the case consists in di- agnosing Potter syndrome in two successive pregnancies in a 24-year-old female, without any significant
    [Show full text]
  • Genes in Eyecare Geneseyedoc 3 W.M
    Genes in Eyecare geneseyedoc 3 W.M. Lyle and T.D. Williams 15 Mar 04 This information has been gathered from several sources; however, the principal source is V. A. McKusick’s Mendelian Inheritance in Man on CD-ROM. Baltimore, Johns Hopkins University Press, 1998. Other sources include McKusick’s, Mendelian Inheritance in Man. Catalogs of Human Genes and Genetic Disorders. Baltimore. Johns Hopkins University Press 1998 (12th edition). http://www.ncbi.nlm.nih.gov/Omim See also S.P.Daiger, L.S. Sullivan, and B.J.F. Rossiter Ret Net http://www.sph.uth.tmc.edu/Retnet disease.htm/. Also E.I. Traboulsi’s, Genetic Diseases of the Eye, New York, Oxford University Press, 1998. And Genetics in Primary Eyecare and Clinical Medicine by M.R. Seashore and R.S.Wappner, Appleton and Lange 1996. M. Ridley’s book Genome published in 2000 by Perennial provides additional information. Ridley estimates that we have 60,000 to 80,000 genes. See also R.M. Henig’s book The Monk in the Garden: The Lost and Found Genius of Gregor Mendel, published by Houghton Mifflin in 2001 which tells about the Father of Genetics. The 3rd edition of F. H. Roy’s book Ocular Syndromes and Systemic Diseases published by Lippincott Williams & Wilkins in 2002 facilitates differential diagnosis. Additional information is provided in D. Pavan-Langston’s Manual of Ocular Diagnosis and Therapy (5th edition) published by Lippincott Williams & Wilkins in 2002. M.A. Foote wrote Basic Human Genetics for Medical Writers in the AMWA Journal 2002;17:7-17. A compilation such as this might suggest that one gene = one disease.
    [Show full text]
  • Genetic and Developmental Basis of Renal Coloboma (Papillorenal) Syndrome
    Perspective Genetic and developmental basis of renal coloboma (papillorenal) syndrome Expert Rev. Ophthalmol. 4(2), 135–xxx (2009) Lisa A Schimmenti Renal coloboma syndrome, also known as papillorenal syndrome, is characterized by optic Department of Pediatrics and nerve anomalies and kidney hypodysplasia. Autosomal dominant mutations in the gene Ophthalmology, University of encoding the paired box transcription factor PAX2 can be identified in nearly half of all Minnesota Medical School, 420 patients with this phenotype. The primary ophthalmologic findings include congenital central Delaware Street Southeast, retinal vasculature absence associated with abnormalities in retinal blood vessel patterning MMC 730, Minnesota, and deeply excavated optic discs. Other published findings include optic nerve hypoplasia, MN 55455, USA optic nerve cyst, optic nerve pits, retinal coloboma, microphthalmia and scleral staphyloma. Tel.: +1 612 624 5613 Visual acuity ranges from normal to severe impairment. Up to one third of affected patients Fax: +1 612 626 2993 will develop end-stage renal disease. Mouse and zebrafish withPax2/pax2a mutations provide [email protected] developmentally based explanations for the observed phenotypic observations in affected patients. KEYWORDS: optic nerve coloboma • optic nerve dysplasia • papillorenal syndrome • PAX2 • renal coloboma syndrome The clinical presentation of optic nerve anomalies total of 10 years later, Weaver et al. reported a case associated with renal hypodysplasia should alert the of two brothers, both with optic nerve colobomas, clinician to the possibility that a patient may have interstitial nephritis and renal failure [3]. Weaver renal coloboma syndrome, a condition also known noted the similarity of the optic nerve colobomas as papillorenal syndrome (OMIM#120330). The in his patients with the ‘morning glory anomaly’, optic nerve findings could be described as a ‘dys- previously reported by Karcher et al.
    [Show full text]
  • Autosomal Dominant Medullary Cystic Kidney Disease (ADMCKD)
    Autosomal Dominant Medullary Cystic Kidney Disease (ADMCKD) Author: Doctor Antonio Amoroso1 Creation Date: June 2001 Scientific Editor: Professor Francesco Scolari 1Servizio Genetica e Cattedra di Genetica, Istituto per l'infanzia burlo garofolo, Via dell'Istria 65/1, 34137 Trieste, Italy. [email protected] Abstract Keywords Disease name Synonyms Diagnostic criteria Differential diagnosis Prevalence Clinical description Management Etiology Genetic counseling References Abstract Autosomal dominant medullary cystic kidney disease (ADMCKD) belongs, together with nephronophthisis (NPH), to a heterogeneous group of inherited tubulo-interstitial nephritis, termed NPH-MCKD complex. The disorder, usually first seen clinically at an average age of 28 years, is characterized by structural defects in the renal tubules, leading to a reduction of the urine–concentrating ability and decreased sodium conservation. Clinical onset and course of ADMCKD are insidious. The first sign is reduced urine– concentrating ability. Clinical symptoms appear when the urinary concentrating ability is markedly reduced, producing polyuria. Later in the course, the clinical findings reflect the progressive renal insufficiency (anemia, metabolic acidosis and uremic symptoms). End-stage renal disease typically occurs in the third-fifth decade of life or even later. The pathogenesis of ADMCKD is still obscure and how the underlying genetic abnormality leads to renal disease is unknown. ADMCKD is considered to be a rare disease. Until 2000, 55 affected families had been described. There is no specific therapy for ADMCKD other than correction of water and electrolyte imbalances that may occur. Dialysis followed by renal transplantation is the preferred approach for end-stage renal failure. Keywords Autosomal dominant medullary cystic disease, medullary cysts, nephronophthisis, tubulo-interstitial nephritis Disease name Diagnostic criteria Autosomal dominant medullary cystic kidney The renal presentation of MCKD is relatively disease (ADMCKD) non-specific.
    [Show full text]
  • Ophthalmology
    Ophthalmology Information for health professionals MEDICAL GENETIC TESTING FOR OPHTHALMOLOGY Recent technologies, in particularly Next Generation Sequencing (NGS), allows fast, accurate and valuable diagnostic tests. For Ophthalmology, CGC Genetics has an extensive list of medical genetic tests with clinical integration of results by our Medical Geneticists. 1. EXOME SEQUENCING: Exome Sequencing is a very efficient strategy to study most exons of a patient’s genome, unraveling mutations associated with specific disorders or phenotypes. With this diagnostic strategy, patients can be studied with a significantly reduced turnaround time and cost. CGC Genetics has available 2 options for Exome Sequencing: • Whole Exome Sequencing (WES), which analyzes the entire exome (about 20 000 genes); • Disease Exome by CGC Genetics, which analyzes about 6 000 clinically-relevant genes. Any of these can be performed in the index case or in a Trio. 2. NGS PANELS For NGS panels, several genes associated with the same phenotype are simultaneously sequenced. These panels provide increased diagnostic capability with a significantly reduced turnaround time and cost. CGC Genetics has several NGS panels for Ophthalmology that are constantly updated (www.cgcgenetics.com). Any gene studied in exome or NGS panel can also be individually sequenced and analyzed for deletion/duplication events. 3. EXPERTISE IN MEDICAL GENETICS CGC Genetics has Medical Geneticists specialized in genetic counseling for ophthalmological diseases who may advice in choosing the most appropriate
    [Show full text]
  • Joubert Syndrome and Related Disorders
    Brancati et al. Orphanet Journal of Rare Diseases 2010, 5:20 http://www.ojrd.com/content/5/1/20 REVIEW Open Access JoubertReview Syndrome and related disorders Francesco Brancati1,2, Bruno Dallapiccola3 and Enza Maria Valente*1,4 Abstract Joubert syndrome (JS) and related disorders (JSRD) are a group of developmental delay/multiple congenital anomalies syndromes in which the obligatory hallmark is the molar tooth sign (MTS), a complex midbrain-hindbrain malformation visible on brain imaging, first recognized in JS. Estimates of the incidence of JSRD range between 1/80,000 and 1/ 100,000 live births, although these figures may represent an underestimate. The neurological features of JSRD include hypotonia, ataxia, developmental delay, intellectual disability, abnormal eye movements, and neonatal breathing dysregulation. These may be associated with multiorgan involvement, mainly retinal dystrophy, nephronophthisis, hepatic fibrosis and polydactyly, with both inter- and intra-familial variability. JSRD are classified in six phenotypic subgroups: Pure JS; JS with ocular defect; JS with renal defect; JS with oculorenal defects; JS with hepatic defect; JS with orofaciodigital defects. With the exception of rare X-linked recessive cases, JSRD follow autosomal recessive inheritance and are genetically heterogeneous. Ten causative genes have been identified to date, all encoding for proteins of the primary cilium or the centrosome, making JSRD part of an expanding group of diseases called "ciliopathies". Mutational analysis of causative genes is available in few laboratories worldwide on a diagnostic or research basis. Differential diagnosis must consider in particular the other ciliopathies (such as nephronophthisis and Senior-Loken syndrome), distinct cerebellar and brainstem congenital defects and disorders with cerebro-oculo-renal manifestations.
    [Show full text]
  • WES Gene Package Multiple Congenital Anomalie.Xlsx
    Whole Exome Sequencing Gene package Multiple congenital anomalie, version 5, 1‐2‐2018 Technical information DNA was enriched using Agilent SureSelect Clinical Research Exome V2 capture and paired‐end sequenced on the Illumina platform (outsourced). The aim is to obtain 8.1 Giga base pairs per exome with a mapped fraction of 0.99. The average coverage of the exome is ~50x. Duplicate reads are excluded. Data are demultiplexed with bcl2fastq Conversion Software from Illumina. Reads are mapped to the genome using the BWA‐MEM algorithm (reference: http://bio‐bwa.sourceforge.net/). Variant detection is performed by the Genome Analysis Toolkit HaplotypeCaller (reference: http://www.broadinstitute.org/gatk/). The detected variants are filtered and annotated with Cartagenia software and classified with Alamut Visual. It is not excluded that pathogenic mutations are being missed using this technology. At this moment, there is not enough information about the sensitivity of this technique with respect to the detection of deletions and duplications of more than 5 nucleotides and of somatic mosaic mutations (all types of sequence changes). HGNC approved Phenotype description including OMIM phenotype ID(s) OMIM median depth % covered % covered % covered gene symbol gene ID >10x >20x >30x A4GALT [Blood group, P1Pk system, P(2) phenotype], 111400 607922 101 100 100 99 [Blood group, P1Pk system, p phenotype], 111400 NOR polyagglutination syndrome, 111400 AAAS Achalasia‐addisonianism‐alacrimia syndrome, 231550 605378 73 100 100 100 AAGAB Keratoderma, palmoplantar,
    [Show full text]
  • Renal Cystic Disorders Infosheet 6-14-19
    Next Generation Sequencing Panel for Renal Cystic Disorders Clinical Features: Renal cystic diseases are a genetically heterogeneous group of conditions characterized By isolated renal disease or renal cysts in conjunction with extrarenal features (1). Age of onset of renal cystic disease ranges from neonatal to adult onset. Common features of renal cystic diseases include renal insufficiency and progression to end stage renal disease (ESRD). Identification of the genetic etiology of renal cystic disease can aid in appropriate clinical management of the affected patient. Our Renal Cystic Disorders Panel includes sequence and deletion/duplicaton analysis of all 79 genes listed below. Renal Cystic Disorders Sequencing Panel AHI1 BMPER HNF1B NEK8 TCTN3 WDPCP ANKS6 C5orf42 IFT27 NOTCH2 TFAP2A WDR19 ARL13B CC2D2A IFT140 NPHP1 TMEM107 XPNPEP3 ARL6 CDC73 IFT172 NPHP3 TMEM138 ZNF423 B9D1 CEP104 INPP5E NPHP4 TMEM216 B9D2 CEP120 INVS OFD1 TMEM231 BBIP1 CEP164 IQCB1 PDE6D TMEM237 BBS1 CEP290 JAG1 PKD2 TMEM67 BBS10 CEP41 KIAA0556 PKHD1 TRIM32 BBS12 CEP83 KIAA0586 REN TSC1 BBS2 CRB2 KIF14 RPGRIP1L TSC2 BBS4 CSPP1 KIF7 SALL1 TTC21B BBS5 DCDC2 LZTFL1 SDCCAG8 TTC8 BBS7 GLIS2 MKKS TCTN1 UMOD BBS9 GLIS3 MKS1 TCTN2 VHL Disorder Genes Inheritance Clinical features/molecular genetics Bardet Biedl ARL6 AR Bardet-Biedl syndrome (BBS) is an autosomal syndrome BBS1 recessive multi-systemic ciliopathy characterized By BBS10 retinal dystrophy, oBesity, postaxial polydactyly, BBS12 leaning difficulties, renal involvement and BBS2 genitourinary abnormalities (2). Visual prognosis is BBS4 poor, and the mean age of legal Blindness is 15.5 BBS5 years. Birth weight is typically normal But significant BBS7 weight gain Begins within the first year. Renal BBS9 disease is a major cause of morBidity and mortality.
    [Show full text]