Cystic Kidney Disease Panel Test code: KI0901 Is a 41 gene panel that includes assessment of non-coding variants. Is ideal for patients with multicystic dysplastic kidneys with or without additional congenital anomalies. About Cystic Kidney Disease In addition to polycystic kidney disease (PKD), the Cystic Kidney Disease Panel offers diagnostics for other multicystic dysplastic kidney disorders (MCDK), such as congenital anomalies with unilateral or bilateral kidney enlargement, distended by multiple cysts, and non-functional and medullary cystic kidney disease. MCDK frequently presents antenatally at routine ultrasound scans, with the majority detected around the 20th week of gestation. Most patients with unilateral MCDK are asymptomatic if the other kidney is fully functional but may occasionally present with abdominal obstructive signs when the cysts become too large. They may also develop hypertension, proteinuria, and renal failure in the long run. Hypertrophy of the contralateral kidney may occur in 24-46% cases before birth, and in up to 80% of cases in the years after birth. Bilateral MCDK is considered a lethal entity. At birth, affected infants have features of the Potter sequence (constellation of signs resulting from prolonged in utero oligohydramnios) with severe pulmonary hypoplasia and severe renal failure, and they often die shortly after birth. The global prevalence of MCDK is not known, but the birth prevalence of the unilateral MCDK is estimated at 1:4,300 live births. Availability 4 weeks Gene Set Description Genes in the Cystic Kidney Disease Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD ANKS6 Nephronophthisis AR 9 12 CEP164 Nephronophthisis AR 11 9 CEP290* Bardet-Biedl syndrome, Leber congenital amaurosis, Joubert AR 130 289 syndrome, Senior-Loken syndrome, Meckel syndrome CEP83 Nephronophthisis AR 10 10 COL4A1 Schizencephaly, Anterior segment dysgenesis with cerebral AD 58 107 involvement, Retinal artery tortuosity, Porencephaly, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Brain small vessel disease CRB2 Focal segmental glomerulosclerosis, Ventriculomegaly with cystic AR 12 22 kidney disease DCDC2 Deafness, Nephronophthisis, Sclerosing cholangitis, neonatal AR 13 9 DNAJB11 Autosomal dominant polycystic kidney disease AD 6 1 DZIP1L Polycystic kidney disease 5 AR 4 5 https://blueprintgenetics.com/ EYA1 Otofaciocervical syndrome, Branchiootic syndrome, Branchiootorenal AD 56 218 syndrome GANAB Polycystic kidney and/or polycystic liver disease 3 AD 7 12 GLIS2 Nephronophthisis AR 3 3 HNF1B Renal cell carcinoma, nonpapillary chromophobe, Renal cysts and AD 35 234 diabetes syndrome IFT172 Retinitis pigmentosa, Short -rib thoracic dysplasia with or without AR 22 25 polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) INVS Nephronophthisis AR 16 34 IQCB1 Senior-Loken syndrome AR 24 41 JAG1 Alagille syndrome AD 131 610 LRP5* Van Buchem disease, Osteoporosis-pseudoglioma syndrome, AD/AR/Digenic 57 196 Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis MAPKBP1 Nephronophthisis 20 AR 6 7 NEK8 Nephronophthisis AR 16 18 NOTCH2* Alagille syndrome, Hajdu-Cheney syndrome AD 37 70 NPHP1 Nephronophthisis, Joubert syndrome, Senior-Loken syndrome AR 19 76 NPHP3 Nephronophthisis, Renal-hepatic-pancreatic dysplasia, Meckel AR 38 75 syndrome NPHP4 Nephronophthisis, Senior-Loken syndrome AR 20 113 OFD1 Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, XL 153 160 Orofaciodigital syndrome, Joubert syndrome PAX2 Isolated renal hypoplasia, Papillorenal syndrome, Focal segmental AD 30 96 glomerulosclerosis 7 PKD1* Polycystic kidney disease AD 237 1923 PKD2 Polycystic kidney disease AD 55 333 PKHD1 Polycystic kidney disease AR 249 557 RPGRIP1L COACH syndrome, Joubert syndrome, Meckel syndrome, Retinal AR 39 49 degeneration in ciliopathy, modifier SDCCAG8 Bardet-Biedl syndrome, Senior-Loken syndrome AR 14 18 SEC61A1 Hyperuricemic nephropathy, familial juvenile 4 AD 4 4 SIX5 Branchiootorenal syndrome AD 3 10 TMEM67 Nephronophthisis, COACH syndrome, Joubert syndrome, Meckel AR 87 170 syndrome TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 177 372 https://blueprintgenetics.com/ TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 396 1195 TTC21B Short-rib thoracic dysplasia, Nephronophthisis, Asphyxiating thoracic AR 23 63 dysplasia (ATD; Jeune) UMOD Familial juvenile hyperuricemic nephropathy, Glomerulocystic kidney AD 33 108 disease with hyperuricemia and isosthenuria, Medullary cystic kidney disease 2 VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 206 614 WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia AR 33 43 with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) ZNF423 Nephronophthisis, Joubert syndrome AD/AR 10 7 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic location HGVS RefSeq RS-number HG19 CEP290 Chr12:88462434 c.6012-12T>A NM_025114.3 rs752197734 CEP290 Chr12:88494960 c.2991+1655A>G NM_025114.3 rs281865192 CEP290 Chr12:88508350 c.1910-11T>G NM_025114.3 CEP290 Chr12:88534822 c.103-18_103-13delGCTTTT NM_025114.3 COL4A1 Chr13:110802675 c.*35C>A NM_001845.4 COL4A1 Chr13:110802678 c.*32G>A/T NM_001845.4 COL4A1 Chr13:110802679 c.*31G>T NM_001845.4 EYA1 Chr8:72156939 c.1051-12T>G NM_000503.4 EYA1 Chr8:72211483 c.640-15G>A NM_000503.4 JAG1 Chr20:10629767 c.1349-12T>G NM_000214.2 https://blueprintgenetics.com/ OFD1 ChrX:13768358 c.935+706A>G NM_003611.2 rs730880283 OFD1 ChrX:13773245 c.1130-22_1130-19delAATT NM_003611.2 rs312262865 OFD1 ChrX:13773249 c.1130-20_1130-16delTTGGT NM_003611.2 PKD1 Chr16:2140209 c.12445-14T>C NM_001009944.2 PKD1 Chr16:2147825 c.10167+25_10167+43delGGCTGGGCTGGGGGTCCTG NM_001009944.2 rs1197421698 PKD1 Chr16:2152273 c.9202-16G>A NM_001009944.2 PKD2 Chr4:88940551 c.596-59A>G NM_000297.3 rs750504141 PKHD1 Chr6:51618610 c.8798-459C>A NM_138694.3 PKHD1 Chr6:51747238 c.7350+653A>G NM_138694.3 TSC1 Chr9:135800306 c.363+668G>A NM_000368.4 TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004 TSC2 Chr16:2106052 c.600-145C>T NM_000548.3 TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132 TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150 TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3 TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794 VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744 VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3 VHL Chr3:10191719 c.*70C>A NM_000551.3 VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225 Test Strengths Exons 1-33 of the PKD1 have multiple segmentally duplicated pseudogenes that reduce sensitivity of NGS diagnostics in general. However, Blueprint Genetics custom assay has good coverage (>20x) with high mapping rates (mapping quality >40) for 99.5% of the target regions in PKD1 gene. Our validation showed high mean coverage of 199X for the PKD1 gene. Thus, our NGS Panel is not expected to have major limitations in detecting variants in PKD1 gene although clinical validation has not been performed at large scale. The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level https://blueprintgenetics.com/ Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations The following