DETECTION AND CHARACTERIZATION OF A UNIQUE AMMONIA OXIDIZING ARCHAEA; CULTURED FROM LAKE SUPERIOR
Michael J. Schlais
A Dissertation
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
December 2014
Committee:
George S. Bullerjahn, Advisor
John Snyder Graduate Faculty Representative
Robert M. McKay
Scott O. Rogers
Paul Morris
© 2014
Michael J. Schlais
All Rights Reserved iii ABSTRACT
George Bullerjahn, Advisor
In the past century Lake Superior has seen a 5-fold increase in nitrate levels. Previous research has shown this increase to be due to as of yet undescribed in-lake oxidation processes.
It has recently been shown that ammonia oxidizing archaea (AOA) in marine and freshwater environments belonging to the phylum Thaumarchaeota have the ability to oxidize ammonium, and are specifically suited to the low NH /oligotrophic environment of Lake Superior. In this study isolation and enrichment of these unique₄⁺ freshwater ammonia oxidizing archaea from
Lake Superior has enabled the direct measurement of NO ¯ and N O production and NH metabolism. In the search for in-lake nitrifying organisms₂ we have₂ identified and described₄⁺ a novel group of freshwater ammonia oxidizing archaea using the ammonia monooxygenase alpha (amoA) subunit gene as a diagnostic tool for microbes capable of ammonia oxidation.
Flow cytometry was used to determine cell abundances and ideal incubation times and temperatures for these AOA taken from these Lake Superior. These data along with nitrification measurements enabled us to determine per cell nitrification rates for our AOA enrichment cultures, which have shown that they do indeed account for a major component of in-lake nitrification processes. With the exception of the marine archaeon Nitrosopumilus maritimus, most research has been focused on culture-independent methods for the characterization of nitrifying microbes. This study is among the first of these culture dependent studies to describe methods for culturing a freshwater ammonia oxidizing archaea.
iv
Dedicated to my father who has been an effortless teacher and philosopher and who always
encouraged my curiosity for life; to my uncle Ed who has been my lifelong mentor and who
taught me one of the key components of being a scientist, whether he knew it or not, how to
“improvise”; to my wife and to my mother who were both limitless sources of love and encouragement along this journey; and to my two children who were a constant reminder that
nothing good is accomplished without hard work and determination. v ACKNOWLEDGMENTS
I would like to thank my advisor Dr. George Bullerjahn for his patience and guidance throughout my research. He has been an amazing source of knowledge that not all graduate students are fortunate enough to get in an advisor. He provided the kind of freedom in his research lab that enabled all of his graduate students to follow their own curiosity. I would also like to thank him for his understanding and support with some of the personal life challenges that came my way during my work at Bowling Green.
I would also like to thank Dr. Michael McKay who was always a great sounding board for ideas and who often guided me through problems when my advisor was not available. Dr.
McKay has been an invaluable co-advisor on my research journey. It is rare to have one great advisor during ones graduate experience, but in my case I believe I had not one but two.
I would also like to thank my committee members Dr. Paul Morris and Dr. Scott Rogers who both brought their unique ways of seeing the world to my studies and to my research at Bowling
Green State University. I must also thank my fellow lab members for their help and support and
most of all their friendship throughout my PhD journey.
Finally I cannot thank my parents enough for the sacrifices they both made for me during
this journey. Without their support I could never have achieved this great accomplishment.
Thanks to my wife who supported me through thick and thin and who believed in me even when
I did not.
.
vi TABLE OF CONTENTS
Page
CHAPTER I INTRODUCTION ……………………………………………………. 1
1.1A Description of Laurentian Great Lakes as
Freshwater ecosystems ……………………………………………. 1
1.1B Lake Superior ………………………………………………………… 2
1.1C The Nitrogen Cycle …………………………………………………… 3
1.1D Nitrate Buildup ………………………………………………………… 4
1.2A Characterization and Diversity of AOB ………………………………. 5
1.2B Culture Characteristics of Nitrosomonas europaea …………………... 6
1.3A Characterization of ammonia oxidizing microbes: Archaea ………….. 7
1.3B Archaeal Cell Membrane Structure …………………………………… 9
1.3C Archaeal Ammonia Oxidation Pathways ……………………………... 10
1.3D Anthropogenic Influences on Lake Superior …………………………. 15
1.4A Identification of AOA and AOB Communities in Lake Superior …….. 15
1.4B Community Diversity of Lake Superior AOAs ………………………. 16
1.4C Characterization of the AOA Culture ………………………………… 17
1.4D Nitrifier Denitrification Processes ……………………………………. 17
CHAPTER 2 MATERIALS AND METHODS …………………………………… 19
2.1A Sample Collection; Water Column …………………………………… 19
2.1B Sample Collection; Sediment …………………………………………. 19
2.2A DNA Extraction from Environmental Samples; Water Column ……...... 22
2.2B DNA Extraction from Environmental Samples; Sediment …………… 22
2.2C DNA Extraction from Plate Cultures …………………………………. 22 vii 2.2D DNA Extraction from Flask Cultures ………………………………… 22
2.3A Amplification of Bacterial and Archaeal amoA Gene Sequences ……… 23
2.3B Amplification of Archaeal 16SrDNA and amoA Gene Sequences
from Cultures …………………………………………………………. 24
2.3C Amplification of Archaeal nirK Sequences ……………………………. 24
2.4 Construction of Clone Libraries ……………………………………….. 24
2.5 DNA Sequencing ………………………………………………………. 25
2.6A Culture Establishment …………………………………………………. 25
2.6B Media Development for AOA Culture ………………………………… 26
2.6C Methods for Maintenance of Culture Purity; 15N- NH Assimilaion
Assay ………………………………………………………………….₄⁺ 27
2.7A Colorimetric Nitrite Detection Assay ………………………………….. 28
2.7B Colorimetric Ammonium Detection Assay …………………………….. 28
2.7C. Nitrous Oxide Detection using Gas Chromatography …………………. 29
2.7D AOA Culture Negative Control for all N Measurement Assays ………. 30
2.7E Copper Utilization and Dependence using Cyclam ……………………. 30
2.8. Flow Cytometric Analysis ……………………………………………… 31
CHAPTER 3 RESULTS …………………………………………………………….. 32
3.1A Bacterial and Archaeal amoA Detection ……………………………….. 32
3.1B Alternative Archaeal amoA Primers ……………………………………. 33
3.1C Bacterial and Archaeal amoA Detection from Sediment ………………. 34
3.2 Bacterial amoA Community Analysis ………………………………….. 35
3.3 Archaeal amoA Detection in the Water Column ……………………..... 37
3.4A Archaeal nirK-like Sequence Detection from Environment viii and Cultures ……………………………………………………….. 39
3.4B Archaeal nirK-like Phylogenetic Analysis …………………………..... 40
3.5A Culture Establishment ………………………………………………… 42
3.5B Culture Morphology …………………………………………………. . 44
3.5C Culture Growth Conditions ………………………………………….. 44
3.5D Viability of AOA and AOB Cultures ………………………………... 45
3.5E Establishment of Cultures Containing a Sole Ammonium
Oxidizing Microbe ………………………………………………….. 46
3.5F AOA Culture Characterization ………………………………………. 47
3.6 nirK-like Sequences from Lake Superior ……………………………. 49
3.7 Description of 3 Experimental Groups ………………………………. 51
3.7A Preliminary Growth Assay: Experiment Group 1 …………………… 51
3.7B Nitrification Based on Culture Morphology: Experiment
Group 1 …………………………………………………………….. 52
3.7C Preliminary Growth Assay Flow Cytometry ………………………… 54
3.8A Flow Cytometry to Determine Culture Purity: Experiment
Group 2 …………………………………………………………….. 55
3.8B Nitrification and Ammonium Depletion: Experiment Group 2 ……..... 58
3.9A Experiment Group 3: Detection of Nitrite, Nitrous Oxide
and Ammonium Depletion …………………………………………. 59
3.9B Experiment Group 3: AOA Culture Nitrogen Stoichiometry
values ……………………………………………………………….. 60
3.9C Experiment Group 3: Extended ……………………………………… 62
3.10 Natural Ammonium Conversion Measurement ……………………… 63 ix 3.11 Analysis of Copper Availability/Recruitment on Nitrification ……….. 64
CHAPTER 4 DISCUSSION ……………………………………………………….. 66
4.1 Identification of a Novel Freshwater AOA and AOB from
Lake Superior ………………………………………………………... 66
4.2 Lake Superior AOA Detection and Phylogeny: amoA sequences ……... 67
4.3 Lake Superior AOA Enrichment Culture ……………………………… 67
4.4A Nitrogen Stoichiometry in AOA Cultures …………………………….. 68
4.4B nirK Activity …………………………………………………………… 69
4.4C Comparing AOA Culture Growth and Nitrification Rates …………….. 69
4.5 Copper Recruitment and Requirements for Oxidative Pathways ………. 70
4.6 The Role of AOA Activity with Regard to the Existing Nitrogen
Budget for Lake Superior ……………………………………………… 71
4.7A Further Study …………………………………………………………….. 72
4.7B Examination of Lake Superior AOAs for Mixotrophic/Heterotrophic
Growth ………………………………………………………………… 72
4.7C Presence and Activity of nirK-like Sequences and nirK Activities …….. 73
4.7D Continued Culture Work ………………………………………………... 74
4.7E Metagenomic Analysis …………………………………………………... 75
REFERENCES ………………………………………………………………………… 76 - 90
APPENDIX A. …………………………………………………………………………. 91
x LIST OF FIGURES
Figure Page
1.0 Plastocyanin-like proteins in AOA ETC 12
2.0 Comparison of AOB/AOA nitrification pathways 14
2.1a Sampling sites throughout Lake Superior 20
3.1a Detection of AOB/AOA amoA sequences from stations WM and CD-1 32
3.1b Detection of AOA amoA sequences from station WM 33
3.1c Detections of archaeal amoA sequences from sediment 34
3.2 Neighbor-joining tree of bacterial amoA sequences 36
3.3 Neighbor-joining tree of archaeal amoA sequences 38
3.4a Detection of nirK-like sequences from AOA culture and open lake
samples 39
3.4b Neighbor-joining tree of archaeal nirk-like from Lake Superior and
AOA enrichment cultures 41
3.5a Gel image of amoA sequences from AOA enrichment cultures 43
3.5b Gel image of amoA sequences from AOB enrichment cultures 43
3.5c Plate culture images of two AOA enrichment culture morphologies 44
3.5e Gel images of AOA/AOB enrichments populations based on amoA
and bacterial 16S rDNA analysis 45
3.5f Gel images showing persistence of AOA/AOB in enrichment cultures 47
3.5g Flow cytometry images of AOA enrichment culture complexity 48
3.6a Gel images of AOA nirk-like sequences from water samples 49
3.6b Gel image of AOA nirk-like sequences from three culture extracts 50
3.7a AOA cell abundance of initial enrichment cultures as measured by xi flow cytometry 52
3.7b AOA nitrite production relative to culture morphology and
temperature 53
3.7c Flow cytometry image of oblate culture morphology 54
3.8a Flow cytometry images plotted with various populations within
two AOA enrichment culture morphologies 56
3.8b Total cell abundances of filtered and whole cell enrichment cultures 58
3.8c Conversion of ammonium to nitrite in experiment group two
enrichment cultures 59
3.9a Nitrogen conversion measurements including nitrous oxide in
experiment group three cultures 60
3.9b Ratios of nitrogen species during for experiment group three
during a two week incubation 61
3.9c Ammonium depletion versus nitrite production over extended
incubation with group three enrichment cultures 62
3.10 Natural ammonium conversion/loss as measured with sterile
AOA media 63
3.11 Copper availability/recruitment versus rate of nitrification in AOA
enrichment cultures 64
xii LIST OF TABLES
Table Page
2.1A Lake Superior sample collections sites, depths and collection dates 21
4.4 Nitrogen stoichiometry in AOA enrichment cultures 69
1
CHAPTER 1 INTRODUCTION
1.1A Description of Laurentian Great Lakes as Freshwater ecosystems
Supplying 20% of the world’s freshwater, the Laurentian Great Lakes are one of the world’s greatest natural resources. Although they share a common glacial origin, each lake represents a unique freshwater ecosystem. The ecosystems within each lake are defined by a variety of different conditions, both man-made and natural. Natural conditions such as water temperature and stratification, lake morphology, and trophic conditions help to define each lake’s unique ecosystem. Average water temperatures among the lakes can range from 10°C to 25°C
(Fuller et al, 1995) while morphological characteristics such as surface area and depth may play a vital role in the types of microbial communities that have developed from lake to lake. Lake
Superior for example, has an average depth of 147 meters causing a large portion of the water column to exist in the aphotic zone while Lake Erie has an average depth of only 19 meters leaving much of the lake in the photic zone. This one difference is enough to greatly influence the dominant types of microorganisms responsible for primary production at the base of the trophic system.
Eighteen percent of the nation’s coastal population can be found along the Laurentian
Great Lakes (Crossett et. al 2009). The most significant human influence on the lakes involves inputs from agricultural and industrial land usage from these highly populated areas. Nutrient loading occurs in several of the lakes due to watershed inputs from industrial and agricultural runoff. Lake Superior, Lake Huron and Lake Michigan are all oligotrophic while Lake Ontario is mesotrophic near shore and oligotrophic in the open lake. Lake Erie is oligotrophic in the eastern basin while the central and western basins are mesotrophic and eutrophic respectively.
The higher productivity in the central and western basins is due largely to nutrient loadings from 2
agricultural lands. Dissolved Oxygen availability among the lakes tends to be fairly stable with
the exception of Lake Erie. In summer months the hypolimnion of the central basin (Edwards et
al., 2005) and occasionally the western basin (Schlosser et al., 2005) can become hypoxic or
anoxic.
1.1B Lake Superior
Lake Superior represents an especially distinct ecosystem. It is cold, dark, rich in dissolved oxygen and highly oligotrophic and with regard to the other great lakes, there are few
anthropogenic nutrient loading sources. Nonetheless, there are stoichiometric imbalances in both
the carbon and nitrogen cycle that have yet to be completely resolved. This may not be the case
in such a deep, dark, oligotrophic lake as Lake Superior. Lake Superior has an increasing N:P
ratio with nitrate levels ~25µM while phosphate levels are in the picomolar range (Sterner et al.,
2007, 2011). So nitrogen cycling may more specifically be due to low phosphorus. This in turn
may also be at the root of the lake’s dentitrification problems. Current estimates of the carbon
cycle in Lake Superior indicate that organic carbon disappears at a faster rate than the rate of
inputs (Kumar et al., 2008). In addition, preliminary analysis of the nitrogen cycle has shown
that although the lake has a much higher concentration of nitrate than ammonium the rate of
ammonium utilization is actually much higher than nitrate assimilation (Kumar et al., 2008).
This indicates the necessity for evaluating the role of other, non-photoautotrophic types of
primary producers native to the lake. It has been shown by (Ivanikova et al., 2005) that despite
the abundance of available nitrate in the lake its lack of iron and phosphorous places a limit on
the ability of photoautotrophs to utilize the nitrate. Additionally, light limitation plays a role
especially during isothermal mixing (Ivanikova et al. 2007, Berges et al. 2014). This process
leads to a build-up of nitrate and slows the turnover of organic carbon production. 3
1.1C The Nitrogen Cycle
Nitrogen is often a limiting nutrient in primary production and exists in a wider variety of chemical forms than most other elements. Most of its chemical forms are considered
bioavailable “fixed” forms with the exception of N . Biologically there are two major directions
in which nitrogen can be sent;(1) the conversion of₂ N to a bioavailable form, called nitrogen
fixation and (2) the conversion of nitrates to molecular₂ nitrogen N called denitrification. The
balance of these two processes by microorganisms in a given ecosystem₂ is what determines the
amount and type of bioavailable nitrogen (MacDonald 1986). This concept along with carbon
fixation by photo and chemoautotrophs is what consequently determines the amount of
productivity in that ecosystem.
In an aquatic system, the nitrogen cycle can be started with the reduced, highly
bioavailable form of nitrogen; ammonium. Ammonium can be used for amino acid synthesis
directly by phytoplankton or used as a source of oxidative energy by chemoautotrophic bacteria
and archaea. Phytoplankton use ammonium before nitrate or nitrite as a N source since it
requires less energy to use than would be required in the reduction of nitrates (Prochazkova et
al., 1970) (Flores et al., 1983). In fact, while other nitrogenous species such as (NH ) can lead
to positive effects with regard to nitrate uptake (Krouk et al., 2010) the mere presence₄⁺ of
ammonium will actively inhibit cyanobacterial assimilation of nitrate (Ohashi et al., 2011).
The second ammonium utilization pathway is governed by chemoautotrophic bacteria
and archaea (AOA and AOB) which are capable of oxidizing ammonium to nitrite. Nitrite in
this pathway is further oxidized by nitrite oxidizing bacteria (NOB’s) to nitrate. The nitrate can
then be used in nitrogen assimilation by phytoplankton. The assimilatory reduction of nitrate by
is highly dependent on light to provide the necessary energy for the reduction of nitrates 4
(Gardner et al., 2004). There is also some evidence that nitrite produced by ammonia oxidizing
microbes may be reduced to nitric oxide and/or nitrous oxide (Remde and Conrad 1990).
Finally, the remineralization of organic material in deep waters and sediments of the lake
releases more bioavailable ammonium back in to the water column.
1.1D Nitrate Buildup
In the past century nitrate levels in Lake Superior have increased nearly 5-fold (with
nitrate concentrations at 6 mM in (1906) to ~30 mM today). In the determination of NO3 and
fixed N budgets for Lake Superior, 15N and 18O stable isotope data indicate that the continuing
rate of nitrification is occurring as a result of in-lake oxidation processes (Sterner et al, 2007)
(Finlay et al. 2007). Part of the reason for the continuing nitrification of the lake is due to the
oligotrophic conditions of the lake. Phytoplankton which could normally contribute to the
assimilation of nitrates in the euphotic zone, are limited by the availability of other co- metabolites. In order for assimilative nitrate reduction to occur there must be a sufficient amount of iron (Fe) and phosphorus (P) available. However in oligotrophic Lake Superior there is a low availability of both (Ivanikova et al., 2005, 2007). Furthermore, due to the extreme depth of the
lake, during the period of annual mixing preceding and following thermal stratification,
phytoplankton will have a diminished ability to access light energy available in the euphotic zone
(Ivanikova et al., 2007). This may negatively affect nitrate assimilation rates in phytoplankton
since the energy captured during photosynthesis is required for the reduction and assimilation of
nitrates to ammonium. This also limits assimilation of ammonium directly because of its low
concentrations in the euphotic zone (Kumar et al., 2007). The inability of microorganisms to remove or reduce nitrate is not limited to photoautotrophs. Bacteria capable of denitrification require hypoxic environments where they can use nitrate or nitrite as a final electron acceptor 5
instead of oxygen. However, Lake Superior being cold, deep and oligotrophic is highly
oxygenated even during summer stratification (Thomas and Dell, 1978), limiting the activity of
these microbes to deep anoxic sediments (Small et al., 2013).
These data have indicated that nitrification caused by ammonia oxidizing microbes may be exclusively responsible for the gradual nitrate buildup in the lake. It is known that ammonia
oxidizing microbes can be both beneficial and detrimental to freshwater ecosystems. However,
they can also cause nitrate to build up contributing to the stoichiometric imbalance of N and P
seen in the lake. Indeed, the current N/P ratio in the open lake exceeds 8,000, considerably
higher than the idealized Redfield ratio of 16 (Sterner et al. 2007).
1.2A Characterization and Diversity of AOB
Ammonia oxidizing bacteria are of great importance to many ecosystems throughout the
world. In many habitats they are the driving force in nitrification (Hall, 1986). Initial
characterization of AOB based on phenotypic characteristics proved problematic due to the fact
that they are difficult to isolate in pure culture and grow to low cell densities (Koops and Moeller
1992). In fact, studies done to further elucidate their electron transport pathways show that most
AOB share virtually identical systems (Giannakis et al., 1985; Koops et al., 1991). Even
analysis of cellular lipids provides little value taxonomically as all genera share the same
complement of membrane lipids (Blumer et al, 1969). Identification of two distinct lineages of
AOB was first observed by (Woese et al., 1985) through development and comparison of 16S
rRNA gene libraries.
The oxidation of ammonia to nitrate is a two step process carried out by separate
nitrifying chemoautotrophic bacteria and archaea. Ammonia oxidizing bacteria utilize
ammonium as a sole substrate for the production of energy and subsequent CO assimilation via
₂ 6
the Calvin cycle. The first step in nitrification is the oxidation of ammonium to hydroxyl amine
using the ammonia monooxygenase (AMO) enzyme followed by a second oxidation reaction
carried out by the enzyme hydroxylamine oxidoreductase (HAO):
NH3 + 2H+ + 2e- + O2 NH2OH + H2O
(ammonia monooxygenase)
NH2OH + H2O HNO2 + 4H+ + 4e-
(hydroxylamine oxidoredcutase)
These reactions are carried out by one genus of Gammaproteobacteria (Nitrosococcus) and four
Betaproteobacteria (Nitrosomonas, Nitrosospira, Nitrosolobus and Nitrosovibrio). In recent
years a variety of ammonia oxidizing microbes have been isolated and cultured, including the
model bacterium Nitrosomonas europaea and the archaeon Nitrosopumilus maritimus. Despite
the fact that AOB have been studied for decades, the more recently discovered AOA may be
more important ecologically. Indeed, it has been shown in both marine sediments and soil
environments that ammonia oxidizing archaea (AOA) are numerically dominant over ammonia
oxidizing bacteria (AOB) (Leininger et al., 2006, Park et al., 2008).
1.2B Culture Characteristics of Nitrosomonas europaea
Nitrosomonas europaea is an obligate chemolithotroph in the β-subdivision of
Proteobacteria (Head et al., 1993; Woese et al., 1984). It gets all of its energy through the
reduction of ammonium to nitrite. It uses carbon dioxide as its sole carbon source. Most of the
current knowledge about AOB has come in some form from the study of this model organism.
This is due to two factors; first it is fairly amenable to culture, as compared to other AOBs and
second has been receptive to considerable gene manipulation studies (Arp et al., 2002). Many
of these gene system studies have helped to illuminate the enzymatic pathways for ammonium 7
oxidation and electron transfer including the discovery of the two key enzymes involved in
ammonia oxidation; AMO and HAO. Furthermore, N. europaea culture dependent studies
targeting key nutrient and reductant availabilities have helped to explain the role of AOBs in both terrestrial and marine environments. For example (Stein and Arp 1998) showed that ammonia oxidation by AOB in culture requires relatively high (50mM) concentrations of ammonium. As a result there is a subsequent loss of ammonium oxidation activity once nitrite builds to ~ 20-25mM due to nitrite toxicity and the lower pH occurring from the loss of ammonium. While AOA grow at much lower, ~1mM ammonium (Konneke et al., 2005) and
~500µM concentrations of ammonium (this study). These studies help to explain why recent
findings have shown AOA to be numerically dominant among nitrifying communities in a wide
variety of habitats.
1.3A Characterization of ammonia oxidizing microbes: Archaea
Not long ago it was believed that there were only two primary lineages of living
organisms; prokaryotes and eukaryotes. These two lineages contained every living organism
known to exist on the earth until a ground breaking discovery in the late 20th century. (Woese and Fox 1977) compared ribosomal gene sequences to identify a third primary lineage of organisms; the Archaea. For years to follow it was still believed that the Archaea were only found in extreme inhospitable environments such as hypersaline lakes, hot springs, and deep sea vents (Woese 1987). The discovery of this domain of organisms nonetheless has given us major clues to how cellular evolution occurs. It is now believed that Archaea are more closely related to eukaryotes than bacteria based on information obtained from the sequencing of the first archaeal genome; Methanococcus jannaschii (Bult et al., 1996). For example the transcription and translational machinery is more similar to eukaryotes than that of bacteria (Bell and Jackson 8
1998). Their phylogenetic and physiological diversity as well as their role in the global
biogeochemical cycles has been greatly underestimated. At first, only methanogenic archaea were believed to play a vital role in the global carbon cycle (Garcia et al., 2000). Over the past two decades it has been shown, with the help of 16S rRNA molecular techniques that Archaea actually have a ubiquitous distribution throughout the world, thriving and sometimes dominating the microbial community in moderate environments (DeLong, 1998; Schleper et al., 2005).
Today with metagenomic and cultivation based studies it has been determined that ammonia oxidizing archaea found in moderate terrestrial and marine environments may actual play a vital role in the global nitrogen and carbon cycles (Schleper and Nicol, 2010). Phylogenetic characterization of archaea found in moderate aerobic habitats was established by (Fuhrman et al., 1992) and (Delong 1992) based on 16S rRNA sequence analysis of marine environments.
The sequences from this gene survey were grouped into three new lineages. The first grouping called “Group 1” was found to group with cultured hyperthermophilic archaea in the kingdom
Crenarchaeota. The second two, “Group 2” and Group 3” were found to affiliate within the kingdom Euryarchaeota along with the methanogens and halophiles (Delong 1992). Further
Group 1 (Crenarchaeota) 16S rRNA analysis from a variety of moderate habitats revealed a number of distinct clades. The majority of soil sequences grouped together in a clade referred to as 1.1b while most marine sequences grouped together in a clade called 1.1a (Schleper and Nicol
2010). With stable isotope studies conducted by (Kuypers et al., 2001; Pearson et al., 2001;
Wuchter et al., 2003) these two groupings would later be shown to possess the physiological tools to utilize inorganic carbon as a nutrient source.
A better understanding of the physiology and metabolism of these organisms came in the form of a fosmid from a metagenomic library. Soil fosmid “54d9” provided the first genetic 9
evidence to explain how these organisms used carbon and nitrogen (Treusch et al., 2005). This
43kb insert not only contained 16S and 23S rRNA sequences which showed affiliation to the
“Group 1” Crenarcheaota but also contained 2 putative ammonia monoxygenase enzyme
subunits (amoA and amoB) and a possible copper dependent nitrite reductase gene (nirK)
(Treusch et al., 2005). Subunit C of the archaeal AMO enzyme was first identified in a whole genome shotgun sequencing project during the Global Ocean Survey (Venter et al., 2004).
Recently group 1.1 crenarchaeota have been reassigned to a new phylum;
Thaumarchaeota wich contains all AOA. Before this all mesothermic ammonia oxidizing archaea were grouped in the phylum Crenarchaeota along with many hyperthermophilic organisms. However, upon analysis of ribosomal proteins from the first available genome sequence of the marine sponge symbiont Cenarchaeum symbiosum (Brochier-Armanet et al.
2008) it became clear that these AOA from moderate environments were different. They did not
just represent a sister group among Crenarchaeaota but rather a separate phylum
(Thaumarchaeota) that branched off before the separation of Euryarchaeota and Crenarchaeota
(Spang et al, 2010).
1.3B Archaeal cell membrane structure
Archaea have a variety of structural differences with regard to cell structure, organization
and molecular function. One of the most notably different features of archaea is the molecular
structure of their cell membrane. The membrane phosphlipids in archaea are made of chains of
glycerol-ethers with isoprene side-chains while Bacteria and Eukarya have membrane lipids
made of fatty acid chains linked by ester bonds ((Kates et al., 1963, 1966; Woese et al.,
1985,1987,1990). In additition the archaeal isoprenoid side-chains, which are normally 20
carbons in length are often connected to each other (40 carbon glycerolipids) creating a lipid 10 monolayer instead of a bilayer. The components of the archaeal monolayer are called glycerol dialkyl glycerol tetraethers (GDGT’s) (Kates et al., 1963, 1966). These isoprenoid side-chains are also often branched and can even have cyclopentane moieties. The type and number of branched moieties can often be indicative of specific types of archaea and/or the type of habitat they are found in. The cyclopentane moiety, for example, may be important in conveying thermal tolerance as its prevalence in the monolayer has been shown to increase under increasing temperatures in some Sulfolobus species (Lai et al., 2008). Their distinctive GDGT’s may be useful in showing evolutionary relationships among the many groups of archaea. The GDGT called “crenarchaeaol” has been isolated from a variety of Crenarcheaota and shows similarity among both the 1.1a and 1.1b branches of AOA; including cultured samples from both the moderate thermophile N. gargensis (Pitcher et al., 2009) and the mesophilic N. maritimus culture (Schouten et al., 2008). It has not been isolated from cultured hyperthermophilic crenarcheaota suggesting that it may be a marker more specifically for ammonia oxidizers rather than all crenarcheaota. In one study the abundance of “crenarchaeol” in soils was shown to correlate with the abundance of amoA gene copies (Leninger et al., 2006).
1.3C Archaeal Ammonia Oxization Pathways
A fully reconciled pathway by which ammonia oxidation occurs in archaea has yet to be determined. However, based on the fully sequenced genomes of the marine sponge symbiont C. symbosium (Hallman et al. 2006) and the Seattle aquarium culture N. maritimus (Walker et al.,
2010) a proposed pathway by which ammonia is used has been constructed. It is however important to note that despite a considerable difference in GC content between the two genomes they still have an overlap of nearly 1200 genes (Walker et al., 2010). Many of these genes share highly similar sequence identity especially with regard to carbon fixation and metabolic genes. 11
This indicates that the genomes from both of these AOA may be valuable in establishing a proposed ammonia oxidation pathway (Schleper and Nicol 2010). Further comparison with model AOB genomes has shown that many of these metabolism genes, are with the exception of ammonia monooxygenase unique to AOAs, indicating that the pathway itself may be very different.
As previously mentioned the three orthologous archaeal AMO subunits (A,B, and C) comparable to the AOB enzyme have already been identified. In bacterial ammonia oxidation, hydroxylamine generated from the oxidation of ammonium is then oxidized to nitrite by the periplasmic enzyme hydroxylamine oxidoreductase (HAO). No archaeal homologues of this second enzyme have been discovered from AOA genomic sequences. This could be due to the fact that the bacterial enzyme requires a periplasmic space in which to function. In the AOB pathway oxidation of hydroxylamine sends electrons back to the AMO enzyme and also forward to cyctochrome C proteins along the electron transport chain in the cytoplasmic membrane (Fig.
1). In AOA what is known for certain is that the cyctochrome proteins found in the AOB ETC do not exist. Instead there are Type 1 copper proteins that take the place of the cytochromes
(Hallman et al. 2006).
12
Figure. 1.0: Plastocyanin-like proteins in AOA ETC: Comparison of 3 denitrification pathways (A,B and C). B and C show metal content differences between known AOB and proposed AOA nitrifying enzymes during the oxidation of ammonia (Glass and Orphan 2012).
At this point there are two possible pathways for how the AOAs oxidize ammonium.
First there may be an as yet unidentified complement of enzymes that more or less directly replace the action of the AOB HAO, oxidizing hydroxylamine directly to nitrite. The pathway could then follow a similar direction as the AOB model where electrons from this oxidation step are sent both to activate the AMO enzyme and also to the ETC. Next the reduction of toxic nitrite to nitric oxide would be carried out via an archaeal homologue of the AOB nitrite 13 reductase found to be present in N. maritimus and other soil archaea (Treusch et al., 2004;
Bartossek 2010). Finally, the reduction of reactive nitric oxide to nitrous oxide could happen via archaeal NOR enzyme homologues which have not yet been detected in AOA’s.
The second proposed pathway was developed by Martin Klotz (Walker et al., 2010)
(Figure 2). This model takes into account the lack of archaeal HAO and NOR enzymes and the lack of sequence similarity in the AMO enzyme. If there is no direct representative of HAO and
NOR enzymes it is possible that the pathway itself may be fundamentally different. In this second model oxidation of ammonium by the unique AMO would produce nitroxyl instead of hydroxylamine. The enzyme nitroxyl oxidoreductase (NxOR) is then used to oxidize nitroxyl to nitrite yielding fewer electrons which would be sent only to a Type 1 copper protein in the ETC and not cyclically back to the AMO. Nitrite then gets reduced to nitric oxide by NirK. Finally without any NORs, the nitric oxide would be cycled back to activate the AMO producing nitroxyl and molecular nitrogen and completing the cycle. Evidence required for confirmation of this pathway would require further understanding of the structure and function of archaeal AMO enzymes, identification of NxOR and lack of nitrous oxide production as compared to bacterial ammonia oxidation pathways. A study done by Santoro and colleagues (2011) measured nitrous oxide production rates from an AOA dominant community along the California current and observed production rates that were nearly ten times higher than what cultivated AOB have been shown to be capable of. Showing at least in this ecosystem, a substantial fraction of nitrous oxide production may come from AOA nitrification. Furthermore, AOA enrichment cultures have also been shown to moderate nitrous oxide production rates (Jung et al., 2011; Santoro et al., 2011). Data from these studies indicates that the pathway proposed by Klotz is incorrect, and 14 instead the AOA pathway has novel enzymes that serve as functional equivalents to HAO and
NOR.
Figure. 2.0 Comparison of AOB/AOA nitrification pathways: Comparison of AOB nitrification pathway with AOA pathway proposed by Martin Klotz (Walker et al. 2010). The key difference in the AOA pathway proposed above is the absence of the bacterial enzyme hydroxylamine oxidoreductase (HAO), in exchange for the putative enzyme nitroxyl oxidoreductase (NxOR). 15
1.3D Anthropogenic Influences on Lake Superior
Although there has been little anthropogenic influence on Lake Superior over the past
few decades relative to the other Laurentian Great Lakes, long-term effects of copper mining native to the Keweenwa Peninsula area of the lake may be one of the few activities that have contributed to the stoichiometric imbalances we are currently observing. Mining in the region began in the late 1840’s and lasted until the late 1968 while peak mining activities occurred between 1890 and 1930 (Kerfoot et al., 1994). During this time period several hundred million tons of tailings were dumped into the lake (Babcock and Spiroff 1970). As a result dissolved Cu in the water column is elevated in the range of 9.9–13.1 nM (Nriagu et al. 1996). Furthermore, it has been shown that elevated Cu concentrations throughout the water column diminish productivity of Lake Superior phytoplankton (via the inhibition of Mn uptake)(Twiss et al.
2004). These data as well as the discovery that AOA possess only copper dependent oxidative
enzymes instead of the haem dependent cofactor often used in AOB nitrification led us to use a
use a variety of copper concentrations in the culture media. Therefore part of the
characterization of the cultures will focus on measuring the rate of nitrification under a variety of
copper availabilities.
1.4A Identification of AOA and AOB Communities in Lake Superior
We have discovered two groups of ammonia oxidizing prokaryotes capable of converting
ammonium to nitrite in the deeper aphotic waters of Lake Superior. It is currently known that
both bacteria and archaea play a role in ammonia oxidation in most marine and soil
environments. However much less is known about the role these microbes play in freshwater
environments. Using specific bacterial and archaeal amoA gene primers we have identified two
unique groups of ammonia oxidizing microbes in water samples taken throughout Lake Superior. 16
We discovered a group of AOB found to cluster within the beta sub-class of the proteobacterial
family and freshwater clusters of ammonia oxidizing archaea (AOA) which group within the
freshwater 1.1a and soil 1.1b crenarchaeota; now also proposed to be in a new phylum,
Thaumarcheota (Spang et al., 2010). The discovery and identification of these unique Lake
Superior ammonia oxidizing microbes led us to cultivation based characterization of these
organisms. Since the goal of this study was to gain a better understanding of the role of these
organisms in the nitrogen cycle of the lake we first chose to focus on the cultivation of the
archaeal ammonia oxidizers for a variety of reasons. First it has been shown in both marine
sediments and soil environments that ammonia oxidizing archaea (AOA) are numerically
dominant over ammonia oxidizing bacteria (AOB) (Leininger et al. 2006, Park et al. 2008), and
second because AOA are more efficient at scavenging scarce ammonia (Martens-Habbena 2009).
Finally preliminary amoA phylogenetic analysis (this study) indicating that the Lake Superior
AOB community was much less diverse, as compared to the AOA community, with perhaps as
few as one or two unique AOB. Thus given the oligotrophic nature of Lake Superior along with
preliminary FISH data showing the numerical dominance of freshwater AOA over AOB in the lake (Small et al., 2013) cultivation of a Lake Superior AOA was chosen in order to better understand in-lake ammonia oxidation processes. Cultivation of these microbes will first be done to establish an understanding of basic activities such as rate of growth and nitrification, and will later be used to determine utilization /production of other water column components (such as copper, nitrate, nitrous oxide).
1.4B Community Diversity of Lake Superior AOAs
Throughout the cultivation of Lake Superior archaeal (AOA) cultures, comparisons with specific genes amplified directly from environmental water samples will be made to continue to 17
establish the diversity of the AOA community and to illustrate where the cultivated AOA fits
into the lake community. Extraction and amplification of the ammonia monoxygenase subunit
A (amoA), 16S rRNA, and nitrite reductase genes nirK from both cultured and environmental
samples will be conducted to help define the role of these microbes in their environment and in the overall lake nitrogen cycle. Cultures will be compared to Fluorescence In-situ Hybridization
data (FISH) (Mukherjee dissertation 2013) from a variety of lake depths to further establish the
role of these cultured AOAs in the lake’s microbial community. Thus any cultivated AOA’s in
this study will be compared to the global community of ammonia oxidizing archaea in order to
establish whether the endemic Superior AOA are unique genotypes.
1.4C Characterization of the AOA culture
Characterization of actively growing AOA culture was performed using a variety of tools
establishing peak cell abundances/growth rates and peak nitrification rates. The determination
of peak nitrification rates was accomplished through the manipulation of key nutrients and
through the establishment of ideal growth conditions.
1.4D Nitrifier Denitrification Processes
Ammonia oxidizing archaea and bacteria play a key role in the global nitrogen cycle. In
Lake Superior much of the preliminary work to establish a nitrogen budget has been done
through both direct and indirect measurement of nitrate, nitrite and ammonium from water
samples. However, there is limited information on the amount of the greenhouse gas nitrous
oxide being produced from in lake processes. It was believed until recently that the production
of nitrous oxide in the water column would be negligible considering the low availability of
organic carbon and the high concentration of oxygen, thereby preventing traditional
denitrification pathways. However, chemoautotrophs such as AOB have the copper containing 18
enzyme NirK that is responsible for reduction of nitrite to nitric oxide thus leading to the production of nitrous oxide (Casciotti and Ward, 2001; Treusch et al., 2005) . With the recent detection of archaeal nirK homologues in the Thaumarchaeotal culture N. maritumus (Walker et
al., 2010) and with an awareness of the copper rich nature of the lake, we have hypothesized that
the production of nitrous oxide by AOA is possible and perhaps likely. The measurement of this
missing N source could also help to reconcile some inconsistencies from the current budget. It
is clear that AOB require the ammonia monooxygenase enzyme to produce hydroxylamine and
then HAO to produce nitrite. However, in archaeal ammonia oxidation only this first enzyme is
present. The remainder of the metabolic oxidation/reduction pathway is still largely unknown. It
has been proposed that AOB use this denitrification activity in the detoxification of nitrites from
their surroundings, however, it is unlikely that AOA would possess this reductase for this
purpose as they are generally more competitive in low ammonium environments (Martens-
Habbena et al., 2009; Di et al., 2010; Herrmann et al., 2011) where they would be unlikely to
build to toxic levels. Therefore detection of the a novel freshwater AOA nirK gene homologue
and detection of nitrous oxide produced by a Lake Superior AOA enrichment culture might not
only help to reconcile the nitrogen budget, but may also help to better describe the physiology of
this unique type of archaeal chemoautotrophy.
19
CHAPTER 2 MATERIALS AND METHODS
2.1A Sample Collection; Water Column
Lake Superior water samples were collected at 5 and ~150 meter depths from 2 pelagic
stations CD-1 and WM (Table 2.1a) and a near shore station Michipochten (figure 3.1d) during
both mixing and stratified periods between 2010 and 2012 . One hundred milliliters of lake
water was filtered through 0.22µm polycarbonate membranes. Two additional water samples
were collected for nirK detection in July of 2012 at a depth of ~150 meters from stations El-2
and El-7 (Table 2.1a). From these water samples 200ml was filtered onto a 0.2µm sterivex filter.
All filtered material was stored at -80C until DNA extraction could be performed.
2.1 B Sample Collection; Sediment
Sediment DNA extractions were conducted from stations WM and Sterner C (figure 2.1a
and table 2.1a) in Lake Superior. Samples were taken from surface sediment (0-5cm deep) at both stations; 0.45g of sediment was taken from station WM and 0.60g sediment was taken from
Sterner C.
20
Figure 2.1a Sampling sites throughout Lake Superior: Sample sites throughout Lake Superior where all AOA and AOB water and sediment samples were collected.
21
Lake
Superior Amplified Sample Collection
Station Sequences type Depth Latitude Longitude date
Sterner sediment
C Archaeal amoA overlay 0-5 cm 46.802 -91.858 Jul-2010
Archaeal and water 150
CD1 Bacterial amoA column meters 47.065 -91.432 Oct-2010
Archaeal and water
CD1 Bacterial amoA column 5 meters 47.065 -91.432 May-2010
water 150
CD1 Archaeal nirK column meters 47.065 -91.432 Aug-2012
water
WM Bacterial amoA column 5 meters 47.333 -89.8 Oct-2010
water
column
(used for 155
WM Archaeal amoA culture) meters 47.333 -89.8 Mar-2011
water 150
EL2 Archaeal nirK column meters 47 -85.5 Jul-2012
water 132
EL7 Archaeal nirK column meters Jul-2012
Table 2.1A: Lake Superior sample collections sites, depths and collection dates. 22
2.2A DNA Extraction from Environmental Samples; Water Column
Two milliliters of TE buffer was added to a 15 ml Falcon tube containing seston filtered onto a 0.22 µm polycarbonate membrane. The tube was shaken and vortexed for 2 minutes to release biomass. The membrane was then removed and cells were transferred to a 2 ml microcentrifuge tube. Cells were centrifuged at 4500 x g for 10 minutes. The supernatant was discarded. DNA was extracted from the cell pellet using the Qiagen DNeasy Blood and Tissue
Kit using STET buffer (10mM Tris-HCL, pH8.0, 0.1M NaCl, 1mM EDTA-Na ) with 20 mg/ml lysozyme instead of the Qiagen lysis buffer. DNA extracted from this protocol₂ was stored for further analysis at -20 °C.
2.2B DNA Extraction from Environmental Samples; Sediment
The MO BIO Ultra Clean Microbial DNA isolation kit was used to extract DNA from sediment. Samples were divided into 50 mg amounts and resuspended in 300 ul of MicroBead
Solution and gently vortexed for 5sec. prior to extraction.
2.2C DNA Extraction from plate cultures
DNA extracted from plate cultures was done by adding 2ml of liquid ATCC#2265 media to the surface of each plate. The surface of each plate was then streaked with a sterile 10ul disposable loop (Fisher) to create a slurry of cells in the 2ml of solution. The liquid slurry was then removed by pipetting and placed in a 2ml Eppendorf tube. Cells were spun down at 4500 x g for 10min. The supernatant was poured off and the extraction procedure was continued with step 2 on page 45 of the Qiagen DNeasy Blood and Tissue Kit as described above.
2.2D DNA Extraction from flask cultures
DNA extracted from flasks (liquid) cultures was performed by first filtering 10-20ml culture onto a 25mm 0.2µm polycarbonate membrane. The membrane was then added to a 12 23
ml sterile Falcon tube. Two hundred µl STET/lysozyme buffer was added to the Falcon tube and
the contents were vortexed for 1 min in order to effectively release all cells from the membrane.
The membrane was discarded and the liquid remaining in the Falcon tube added to a 2 ml
Eppendorf tube. The extraction process was carried out using the MO BIO ultra clean Microbial
DNA isolation kit. Three hundred µl of MicroBead solution was added to the 2 ml Eppendorf
tube and the extraction processes completed as described above for sediment.
2.3A Amplification of Bacterial and Archaeal amoA gene sequences
amoA specific primers amoA1F: 5’ GGGGTTTCTACTGGTGGT 3’ and amoA2R: 5’
CCCCTCKGSAAAGCCTTCTTC 3’ (Park et al. 2008) were used to amplify a 550bp region of
the bacterial ammonia monooxygenase alpha subunit gene from environmental DNA extracts.
The primers amoA26F: 5’ GACTACATMTTCTAYACWGAYTGGGC 3’ and amoA417R: 5’
GGKGTCATRTATGGWGGYAAYGTTGG 3’ (Park et al. 2008) were used to amplify a 400bp
region of the archaeal amoA gene from environmental samples. All PCR amplifications were performed using 50 µl reaction volumes containing 5 µl of 10X PCR reaction buffer (500 mM
KCL, 100 mM Tris-HCL[pH 9.0] 1% Triton X-100), 5 µl of DNA extract, 200 µM concentrations of deoxynucleoside triphosphates, 10 pM/µl bacterial primers (or 25 pM/µl archaeal primers), 2.5 mM MgCl and 0.25 µl of Taq DNA polymerase 5 u/µl (Promega). The
PCR reactions were carried out in₂ a BIO-RAD MJ Mini thermal cycler. The amplification steps for bacterial amoA primers were 94oC for 5min, followed by 35 cycles of 94 oC for 1 min, 58 oC
for 1 min, and 72 oC for 1min followed by a longer final step of 72 oC for 15 min to ensure the
ends are 3’polyadenylated for subsequent TOPO vector ligation. PCR amplification steps for
archaeal amoA primers were 95 oC for 5 min, followed by 35 cycles of 95 oC for 30 s, 60 oC for 24
30 s, and 45 oC for 30 s. A final step of 72 oC for 15 min was used again to enhance subsequent
TOPO vector ligations.
2.3B Amplification of Archaeal 16SrDNA and amoA gene sequences from cultures
In addition to amoA26F and amoA417R the primers amoAF:
GCTCTAATTATGACAGTATAC and amoAR: CCCCTCKGSAAAGCCTTCTTC (Park et al.
2008) were used to amplify a larger (650bp) sequence of the archaeal amoA gene from cultures.
PCR reaction mixes were prepared in the same concentrations as described above. Amplification steps for reactions using amoAF and amoAR primers were 95 oC for 10 min followed by 35
cycles of 95 oC for 1 min, 54 oC for 1 min, and 72 oC for 1 min with a final step of 72 oC for 10
min. Bacterial 16S rRNA gene PCR reactions were performed in a BIO-RAD thermal cycler
using universal bacterial 16S primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R
(5’-GGTTACCTTGTTACGACTT-3’).
2.3C Amplification of Archaeal nirK sequences
The primers fwd: AnirKa-58F (ACBYTATTCGGAAGYACATACACA), rev: AnirK-
1102R (TRMTGCRTATRCACCTGGKTC) were used to amplify nirK-like sequences from both
environmental samples and cultures. PCR conditions used to amplify this sequence were as
follows: an initial 95 °C for 10 min followed by 30 cycles of 94 °C denaturation for 1min 50 °C
annealing for 1 min and 72 °C extension for 1 min. Amplifications were carried out in a BIO-
RAD MJ Mini thermal cycler.
2.4 Construction of Clone Libraries
The pCR4 TOPO vector (Invitrogen) was used to clone amplicons from the above PCR
reactions as described in the user manual. TOP10F chemically competent Escherichia coli cells
were transformed with the TOPO cloning reaction and incubated at 37 oC overnight on 100µg/ml 25
ampicillin LB (Luria Bertani) agar plates. Positive colonies were screened by colony PCR with primers used for initial amplifications. Colony PCR was carried out under the same conditions
(same reaction mixtures) as used in initial amplifications. Positive colonies (yielding the correct size insert) were either directly PCR purified and sent for DNA sequencing.
2.5 DNA Sequencing
Clones in which 16S rRNA gene, and/or amoA inserts (for bacterial and archaeal sequences) were identified were sent to the University of Chicago Sequencing Center for high throughput sequencing reactions. DNA samples were sent in a volume of 20 µl with a concentration of ~50 ng/µl along with an insert specific forward and reverse primer set in a volume of ~30 µl in a concentration of ~4 pm/µl. Each type of sample was sequenced on both strands.
Sequences were analyzed on the MEGA4 M4: Alignment Explorer program (Kumar et al. 2007). From the aligned sequences, replicates were identified and eliminated and a complement of Lake Superior bacterial and archaeal sequences was developed. Phylogeny of these sequences were compared to other known bacterial and archaeal 16S and amoA sequences available from GenBank. The sequences were examined using the MEGA4 neighbor joining program (testing inferred phylogeny using 1000 replications). Accepted archaeal amoA trees
yielded minimum bootstrap values of greater than 60% while accepted bacterial trees had slightly lower bootstrap minima.
2.6A Culture Establishment
Water samples used to establish Lake Superior AOA/AOB cultures was taken from stations CD-1 (October 2010) at a depth of 150m during stratification, and from station WM at
155m (March 2011) before summer stratification (Table 2.1A). Samples taken for culture from 26
CD-1 were prepared in 3 different ways. First 150-200ml of lake water was filtered through 0.7
µm GF|F glass fiber filteres (Whatman). Then 10 ml of the filtrate, and in separate preparation
the previously made GF|F filters were used directly to inoculated specific AOA culture media.
These samples were prepared as such due to the small size of known marine AOA, many of
which can pass through pore sizes 0.7 µm and smaller. Next, the remaining GF|F filtrate was
further filtered through 0.2 µm polycarbonate membranes (Millipore) and a similar procedure
was followed. Ten ml of the 0.2 µm filtrate was added to specific media and then the 0.2 µm
polycarbonate membrane itself was used to inoculate the AOA culture media.
Water samples from station WM were prepared as follows. Two hundred ml of lake water,
containing AOA cells for culture were first filtered through a 0.7 µm GF|F. The filters from this
first step were discarded. The filtrate was then further suction filtered onto 0.2 or 0.1 µm
polycarbonate membranes. These membranes were then added directly to media preparations.
2.6B Media Development for AOA Culture
It has been shown that ammonia oxidizing archaea can grow under a variety of temperatures with a wide range of ammonium availabilities. The tropical marine aquarium isolate Nitrosopumilus maritumus strain SCM1 grows at 28˚C and is supplemented with 500mM ammonium (Konneke et al., 2005) while an enrichment of the moderate thermophile
Nitrososphera gargensis grows at 46˚C and has an ammonium dependent autotrophic growth maximum concentration of 3mM (Lebedeva et al., 2005). As a result four initial culture temperature conditions were established based on in lake average temperatures during stratified periods as well as maximum highs and lows. Three of the four initial ammonium concentrations were chosen based on enrichment cultures established from the two major Thaumarchaeotal groupings 1.1a and 1.1b as well as the model AOB Nitrosomonas europaea culture. The fourth 27 ammonium concentration was chosen based on the highly oligotrophic conditions of Lake
Superior itself.
The development of Lake Superior archaeal cultures was performed by filtering 150-
200ml of fresh lake water onto 0.45 polycarbonate membranes. The ATCC medium #2265 was used as a base for culture, amended with lower concentrations of ammonium sulfate (from
50mM to 25mM and 1mM) along with the addition of 80µg/µl of spectinomycin. Membranes filtered with lake water were then either immersed in 100ml of this amended ATCC 2265 medium or incubated on the surface of plates of the same medium with 1.2% agarose as the solidifying agent. Cultures were grown at 4˚C and 20˚C in complete darkness. Subculturing of liquid cultures was done by adding 10ml of old culture to 100ml of fresh amended ATCC 2265 medium. Plates were subcultured either by the streak plate method from one plate to another or by centrifuging 20ml of liquid culture at 3000 x g (centrifuge) for 10min, pouring off the supernatant and resuspending the pellet in 1ml of fresh media (amended ATCC 2265) and distributing cells with a loop to various daughter plate cultures.
2.6C Methods for Maintenance of Culture Purity; 15N- NH + assimilation assay
In order to remove pre-existing high concentrations of normal₄ (14N) ammonium an entire
50ml archaeal culture was filtered onto a 0.22µm polycarbonate membrane. The filtrate was discarded and the cellular contents of the membrane were washed in 20ml of ammonium free
ATCC 2265 media to re-suspend cells in solution. One milliliter from this solution was added to six different concentrations of 15N ammonium (200nM, 600nM, 1µM, 10µM, 100µM, and
200µM ammonium) ATCC2265 media. All 15N cultures were prepared to a final volume of
110ml media per flask. Each concentration was prepared in duplicate with two additional 1µM concentrations where only filtrate (filtered through 0.45µm filters) from the parent culture was 28
added. Cultures were incubated in the dark at 20 ˚C. 35ml from each culture was taken at day
0, 2, and 4 of incubation and stored in acid washed HDPE bottles (at -20 ˚C until the experiment
was completed). Samples were sent to the University of California - Davis to be analyzed by
Mass Spectrometry to detect 15N conversion from ammonium to nitrite and/or nitrate.
2.7A Colorimetric Nitrite detection assay
Cultures used for the nitrification assay were grown in triplicate under two sets of
temperatures and with two different concentrations of ammonium sulfate. One set was grown in
the dark in 1 mM ammonium ATCC 2265 media at 20 °C and 4 °C while a second set was
grown under the same conditions but with an ammonium concentration 500 µM. The nitrifying
bacterium Nitrosomonas europaea was grown in tandem with the archaeal cultures for this assay
and used as a model for the efficacy of the media and conditions being used. Two ml aliquots
were taken from each culture (sterile Milli-Q water used as a negative control) twice a week for
the first month and then once a week for a second month to determine build-up of nitrite in each
culture. Colorimetric detection of nitrite levels in cultures was measured by the addition of 200
µl sulfanilic acid and incubating 10 min for complete saturation of the compound followed by
200 µl of N-N-dimethyl-alpha-naphthylamine and incubating 30 min before reading the
absorbance of each aliquot at 520 nm.
2.7B Colorimetric Ammonium detection assay
Two sets of triplicate cultures were used to detect of ammonium utilization. Both sets
consisted of cultures inoculated directly from previously existing Lake Superior AOA stock
cultures. In the first set 16 ml of whole parent culture was transferred to 100 ml fresh 500 µM ammonium media. The second set of cultures was transferred in the same manner as above except with first syringe filtering 16 ml of the parent culture through a 0.45 µm polycarbonate 29
membrane before adding it to the 100 ml of fresh 500 µM media. Detection was performed using a modified Phenol/Hypochlorite method (Solorzano 1969).
Ammonium concentration was detected by first taking 250 µl of culture or water samples and adding them to sterile 15 ml Falcon tubes. Two hundred and fifty µl of sterile Millipore water was then added to the sample. Next, 400 µl of Sodium Phosphate (Na PO ) buffer was added to the solution with mixing (capping and inverting the Falcon tube). Then₃ ₄ 1ml of Phenate
Reagent A (15 ml of Phenol Stock, 0.02 g Sodium Nitroprusside diluted to 100 ml) was added with swirling followed by inversion of the falcon tube. Five hundred microliters of Reagent B
(equal volumes of commercial bleach [3.5%] and 27% NaOH) diluted to 50 ml was added to the
Falcon tube with swirling followed by inversion. Samples were capped and placed on a shaker
for 25min. Optical Densities of samples were measured at 630nm.
Lake Superior AOA amended #2265 media contains much less ammonium than the original
stock medium. Nonetheless, the typical LS amended concentration of 500µM ammonium is still
several orders of magnitude higher than what exists in Lake Superior itself. As a result, a control
to determine oxidation or loss of ammonium by abiotic processes was included in the studies.
Triplicate 125 ml Erlenmeyer flasks were filled with 50 ml of sterile uninoculated 500 µM
ammonium AOA #2265 amended media. Samples from each flask were taken every ~4 days
and ammonium concentrations were measured as described above for the colorimetric detection
of ammonium.
2.7C Nitrous Oxide detection using Gas Chromatography
AOA cultures set up for nitrous oxide detection were grown in 100 ml (acid washed)
Wheaton serum bottles. Each bottle was filled with 25 ml fresh 500 µM ammonium AOA
media. The bottles were then inoculated with 5 ml of stock culture leaving ~70 ml head space. 30
Bottles were capped with 20 mm butyl rubber stoppers and crimped closed with 20 mm open top
aluminum seals. Nitrous oxide measurements were set up to be measured over four different
time periods. Each time series was prepared in triplicate and was matched with a blank set of
bottles containing either sterile media or heat killed AOA culture. Extraction of gases was
performed by pulling 15 ml of gas from the headspace of the serum bottles with 20ml BD
syringes fitted with a stopcock and an 18 gauge needle. To balance pressures, an equivalent
volume of sterile Millipore water was added simultaneously to the serum bottle with a separate
syringe. With the gas sample drawn into the syringe, the stopcock was closed and the 18 gauge needle was replaced with a 21 gauge needle (to minimize leakage from gas storage vial).
Syringe contents were added (overpressured with ~8-15 ml gas) into 6 ml Labco evacuated exetainers. All gas samples were sent to Environment Canada (Burlington, ON) and GC detection and measurement of nitrous oxide was performed Dr. Richard Bourbonniere.
2.7D AOA culture negative control for all N measurement assays
All nitrogen assays were conducted with triplicate cultures of sterile amended ATCC
#2265 media. Initial ammonium concentrations varied with assay specific requirements.
Samples were taken from these negative control cultures along with experimental AOA inoculations to determine any abiological nitrification activity. Samples from these cultures were also used as negative controls for DNA extraction processes and subsequent PCR amplification and sequencing of amoA gene sequences.
2.7E Copper utilization and dependence using Cyclam
The copper chelator Cyclam (1,4,8,11-Tetraazacyclotetradecane) was used to determine the effect of copper availability on the growth and activity (nitrification rate) of Lake Superior
AOA cultures. Culture based experiments were set up with various concentrations of available 31
copper. All cultures contained 5.3 µM copper. Availability of the copper was titrated by the amount of Cyclam added. Variable conditions for copper availability included: no chelation of
copper, complete chelation by Cyclam addition, and half saturation of chelation by Cyclam.
Triplicate cultures prepared and measured for each condition. All cultures were filled with 50 ml of 500 µM ammonium ATCC#2265 amended media in 125 ml Erlenmeyer flasks. Nitritre production in cultures was measured as described in the colorimetric nitrite assay described above every four days for a total of 25 days.
2.8 Flow Cytometric Analysis
AOA population complexity and cell counts were conducted on a BD FACS Calibur flow cytometer. Samples used for flow cytometric analysis were prepared as follows: 0.5-1 ml was taken from AOA cultures and fixed with 2% (working concentration) paraformaldehyde fixative in a 2ml cryotube. Fixed cell mixtures were incubated at 26 °C for 20 min before being flash frozen with liquid nitrogen. Cells were then stored at
-80 °C until completion of the given experiment. Cells were then thawed at 26 °C and 10 or 20
µl of Cybergold was added to the 0.5 or 1 ml sample respectively. Cells were incubated in the dark for 10 min before analysis on the cytometer.
32
CHAPTER 3 RESULTS
3.1A Bacterial and Archaeal amoA detection
To identify ammonia oxidizing microbes in Lake Superior, two sets of primers (Konneke et al. 2005) amoA1F and amoA2R (bacterial; yielding a ~500bp sequence) and amoA26F and
amoA417R (archaeal; yielding a ~410bp sequence) were used to detect the presence of amoA
sequences at 2 different stations throughout the lake. Water samples were initially obtained from
surface waters (5 meter depth). One to two liters of Lake Superior water from each station was
then filtered through 0.22µm polycarbonate membranes. DNA extracted from the membranes
showed the presence of bacterial and archaeal amoA sequences at station CD-1 while only
bacterial amoA sequences could be amplified from the 5m depth at station WM (figure
3.1a)(figure3.1d).
Figure 3.1a Detection of AOB/AOA amoA sequences from stations WM and CD-1: Shows the
detection of archaeal amoA sequences from Station CD-1 (~410bp) left and bacterial amoA
sequences amplified from both Stations WM and CD-1 (~500bp) right. 33
3.1B Alternative Archaeal amoA primers
Archaeal amoA sequences from Station WM were detected from water samples taken from a depth of 150meters (Figure 3.1b). For this sampling experiment a newer set of archaeal amoA primers was used; amoAF and amoAR which yielded a longer amoA fragment (~680bp) but did not amplify any new or different sequences as compared to the previously observed phylotypes (Francis et al. 2005). In subsequent extractions from 2 additional sites (NCD and
EH-001) both bacterial and archaeal amoA sequences were detected (data not shown).
Figure 3.1b Detection of AOA amoA sequences from station WM: Lane 1 negative control;
Lane 2, 3 and 4 show WM established culture extracts; Lane 5, 6 and 7 show WM environmental water sample extracts from a depth of 150 meters. 34
3.1C Bacterial and Archaeal amoA detection from sediment
All sediment samples were taken from 0-5cm of sediment overlay from Sterner C and
WM (figure 3.1d). Samples were collected from two stations: WM and Sterner C. Both AOA and AOB primer sets were added to the Polymerase Chain Reaction (as they do not hybridize) observable on the 1.5% agarose gel below. Only ammonia oxidizing archaeal
(AOA) sequences were detected from station Sterner C (figure 3.1c). This is consistent with recent data from Annette Bollmann’s lab, in which group 1.1a Thaumarchaeota dominate
(Bolleman et al. 2014, in press). (AOA) sequences were detected from station Sterner C (figure
3.1c).
Figure 3.1c Detections of archaeal amoA sequences from sediment: amoA detection from
sediment; Lane 1 show the 100bp DNA Ladder, Lane2 negative control, Lane 3 and 4 show 35
archaeal amoA sequences. No bacterial amoA’s visible; Lane 5 and 6 no amoA sequences
detected from bacteria or archaea.
3.2 Bacterial amoA Community Analysis
Forty bacterial amoA clones from each of the two stations (CD-1 and WM) were
sequenced. All but one Lake Superior isolate was shown to have ~80% sequence identity to
other ammonia oxidizing bacteria. Seventy-nine of the 80 clones grouped in the Beta group of the family Proteobacteria and were shown to be most closely related to the ammonia oxidizers in the genus Nitrosospira. Further DNA sequence analysis of the isolates from both stations using
ClustalW showed that all sequences could be separated into two different phylotypes. Each subgroup was characterized by two single nucleotide polymorphisms. Phylogenetic analysis showed that no other previously detected environmental isolates from either freshwater, or marine ecosystems grouped within the Lake Superior cluster (Figure 3.2).
36
Figure 3.2 Neighbor- joining tree of bacterial amoA sequences: Neighbor-joining tree showing all bootstrap values with 1000 replications of bacteria amoA sequences using Mega 4.
Station CD-1 (Green triangle clones) versus Station WM (Red circles).
37
3.3 Archaeal amoA detection in the water column:
Over 250 archaeal sequences were amplified (with both sets of AOA amoA primers previously described) from station CD-1, near CD-1 (nearshore) and WM (Table 3.1C). All sequences were compared in MEGA 4 and a Neighbor Joining tree was developed. Like the bacterial amoA sequences very low microbial diversity was observed. Archaeal sequence analysis showed slightly higher diversity as compared to bacterial ammonia oxidizers. Three or four different groups of amoA sequences could be identified representing two clusters of sequences grouping within the AOA Freshwater clade (Figure 3.3). However, unlike the bacterial phylotypes, both clusters of archaeal sequences grouped within the larger freshwater clade. Figure 3.3 shows the presence of the two major clusters discovered in Lake Superior. The first type of sequence grouped with other freshwater and groundwater isolates while we were unable to find any environmental isolates from the literature or databases that would group
within the second cluster of sequences. Accordingly we have labeled this second more highly
conserved group of archaeal amoA sequences the Lake Superior group. A third grouping of
amoA sequences was obtained from a nearshore site that grouped with the 1.1b soil group of
AOAs. Sequences amplified from offshore sediment were shown to group with other Lake
Superior water column isolates, not with those associated with the 1.1b group.
38
Figure 3.3 Neighbor-joining tree of archaeal amoA sequences: Neighbor-joining tree (above) showing all bootstrap values with 1000 replications of archaeal amoA sequences using MEGA 5. 39
Nearly all environmental and culture isolates group within the unique Freshwater (Lake
Superior) cluster.
3.4A Archaeal nirK-like sequence detection from environment and cultures
To further our understanding of the nitrogen cycle in Lake Superior detection of nirK-like
sequences was used to examine the potential for nitrite reductase activity (nitric/nitrous oxide
production) by archaea. Archaeal nirK-like sequences were detected among water sample from
three stations across Lake Superior. nirK-like sequences were detectable in all stations sampled
(figure 3.4a). All samples were taken at depths below 130meters in July of 2012 during the summer stratification period.
Figure 3.4a Detection of nirK-like sequences from AOA culture and open lake samples:
Lane 1 show the 100bp DNA ladder, Lane 2 nirK-like sequences amplified from Station CD-
1 (depth of 150 m), Lane 3 nirK-like sequences from Station EL-7 (depth of 132 m), Lane 4
and 5 negative controls; Lane 6, nirK-like sequences from Station EL-2 (depth of 120 m). 40
3.4B Archaeal nirK-like phylogenetic analysis
Approximately 200 clones were developed and sequenced. A neighbor joining tree was constructed with MEGA 4 comparing sequences found in Lake Superior alongside a limited set of available nirK-like archaeal sequences from around the world (Figure 3.4b). Lake Superior
environmental and culture extracted sequences grouped along with other freshwater sequences
similarly to the trees of amoA (this study) and 16S phylogenies (Mukherjee et al, 2013).
Sediment samples were not analyzed for AOA nirK sequences.
41
Figure 3.4b Neighbor-joining tree of archaeal nirk-like from Lake Superior and AOA enrichment cultures: Neighbor-joining tree showing 1000 replicates of nirK-like archaeal sequences observed in Lake Superior compared to the limited group of archaeal nirK-like sequences throughout the world and analyzed on MEGA 5. Blue branches represent sequences that group within the 1.1a Marine Thaumarchaeaotal phylum, with the pink circle showing the location of the nirK-like sequence extracted from Lake Superior AOA enrichment cultures. 42
3.5A Culture Establishment
The ammonia oxidizing microbe Nitrosomonas europaea was used as a model for
culturing similar microbes (AOA/AOB) from Lake Superior. Thus we used the ATCC medium
# 2265 (previously designed to culture Nitrosomonas) as the foundation for establishment of a
Lake Superior AOA/AOB culture. One hundred and fifty milliliters Lake Superior water was
filtered onto 0.22µm polycarbonate membranes and placed on either 1.2% agarose “2265” plates
or in 100ml of the same liquid medium. Culture media was initially amended using 5mM
ammonium with 5.3µM copper sulfate (due to the lake’s rich copper deposits and oligotrophic
nature) instead of the ATCC recommended 50mM ammonium and 0.53µM copper sulfate
concentrations. Cultures were then incubated at 4oC or 20oC for 30 days in the dark. DNA
extraction followed by PCR amplification of amoA gene sequences was performed to detect the presence of both archaeal and bacterial ammonia oxidizing organisms. Initial DNA extracts from cultures showed the presence of both bacterial and archaeal amoA sequences (figures 3.5a and b). 43
Figure 3.5a Gel image of amoA sequences from AOA enrichment cultures: Archaeal amoA from two plate; NP and two liquid: NL cultures.
Figure 3.5b Gel image of amoA sequences from AOB enrichment cultures: Bacterial amoA sequences amplified from the same two plate; NP and liquid; NL cultures as seen in figure 3.5a. 44
3.5B Culture Morphology
Cultures were monitored monthly to detect the persistence of Lake Superior AOA and
AOB. Addition of the antibiotics kanamycin and spectinomycin was used in half of the cultures.
This was done to both reduce heterotrophic bacterial (non ammonia oxidizing microbes) contamination as an attempt to establish a culture containing only an archaeal ammonia oxidizer.
This resulted in the development of two different plate morphologies described as oblate and punctiform. These morphologies persisted even after antibiotics were removed from subsequent daughter cultures (figure 3.5c).
Figure 3.5c Plate culture images of two AOA enrichment culture morphologies: Plate cultures showing two different growth morphologies developed in the presence (A) or absence (B) of kanamycin and streptomycin
3.5C Culture Growth Conditions
Two sets of cultures were followed to determine ideal growth conditions. One set was grown with 100µg/ml of the antibiotics kanamycin and streptomycin at both 25C and 10C. The second set was grown under the same two temperatures but without the addition of the antibiotics. After another thirty day incubation period (in the dark) bacterial amoA was no longer detectable in the six cultures treated with antibiotics regardless of temperature, but still present in four of the six other cultures not treated with antibiotics (data not shown). Archaeal amoA 45
sequences were observed in all conditions (Figure 3.5e). Both bacterial and archaeal amoA
amplified sequences from cultures were sequenced to compare the cultured Lake Superior
ammonia oxidizers to the sequences obtained from direct Lake Superior environmental water
samples (pink versus blue circles respectively; figure 3.3).
3.5D Viability of AOA and AOB cultures
Three months after the initial cultures were created the presence of archaeal amoA sequences was still detectable in both culture morphologies from agarose plate cultures and in all liquid cultures while bacterial amoA sequences were sporadically (and faintly) detected in a both streptomycin and streptomycin free culture extracts (figure 3.5e).
Figure 3.5e Gel images of AOA/AOB enrichments populations based on amoA 46
and bacterial 16S rDNA analysis: Agarose Gel A shows archaeal amoA sequences (~390 bp)
extracted from liquid cultures L1S and L2S contained the antibiotic Streptomycin while cultures
L1 and L2 show amoA sequences from cultures that contained no antibiotics. Agarose Gel B
shows bacterial amoA sequences(~ 500bp) extracted from the same cultures as the above GelA.
Bacterial amoA sequences are absent. Agarose Gel C shows bacterial 16SrDNA sequences (
~1400bp) amplified from the same cultures as Gel A and B indicating the presence of other non
AOB type bacterial inhabitants. All gels have a 100bp DNA ladder for reference.
Comparison of bacterial amoA sequences amplified from cultures showed that they
grouped within the main cluster of environmental amoA clones extracted directly from Lake
Superior water samples (red square figure 3.2). Similarly, archaeal amoA sequences amplified
from the cultures also grouped with the main Lake Superior group of freshwater archaeal
ammonia oxidizing environmental isolates (pink circles figure 3.3). Bacterial bands were often
faint or absent from all cultures, while archaeal amplicons were readily detectable.
3.5E Establishment of cultures containing a sole ammonia oxidizing microbe
After a year of culture maintenance, bacterial amoA sequences were no longer detectable
in any agarose plate or liquid cultures (figure 3.5f), although bacterial 16S analysis of cultures
indicated that some non-AOB contaminants in the beta proteobacteria phylum were still present
in the cultures. 47
Figure 3.5f Gel images showing persistence of AOA/AOB in enrichment cultures: Gel A is a
1.2% agarose gel showing amoA sequences as an indicator of AOA persistence in 1 out of 3 plate cultures Lane 1 (present), 2 (absent) and 3 (absent) cultures; and all Liquid cultures in
Lanes 4 and 5. Gel B is a 1.2% agarose gel showing the same 5 cultures with no AOB amoA amplicons, indicating absence of AOB in enrichment cultures.
3.5F AOA culture characterization
The presence of archaeal amoA was detected continuously from both types of culture.
Cultures were regularly monitored to detect persistence of any AOB by PCR for 16S genes and amoA. No bacterial nitrifyers were detected over the course of the five year AOA culture maintenance, indicating all nitrification processes occurring in the following studies have come from Lake Superior AOA alone. Despite the loss of AOB, the two morphologies previously described were still observable. Flow cytometric analysis showed that oblate versus punctiform morphologies most likely represented higher versus lower amounts of contaminant heterotrophic organism (figure 3.5g). With the development of a stable exclusively AOA enrichment culture, 48 studies could now be done to further define the role of these organisms in the Lake Superior nitrogen cycle.
Figure 3.5g Flow cytometry images of AOA enrichment culture complexity: Flow cytometry image 1 shows 4-5 populations in the “whole cell”/oblate AOA enrichment culture. Image 2 shows the presence of fewer (~2) populations in the “filtered cell”/punctiform AOA cultures. 49
Both images are representatives of a single replicate culture taken on day 21 of a 28 day incubation period.
3.6 nirK-Like sequences from Lake Superior
In order to determine the presence of potential archaeal nirK (nitrite reductase gene) activity, DNA extracted from water samples at three different stations; EL-2, EL-6, and CD-1 was analyzed for nirK-like archaeal sequences. Archaeal nirK-like sequences were observed in all three environmental DNA samples and yielded a ~ 650bp sequence (figure 3.6a).
Figure 3.6a Gel images of AOA nirk-like sequences from water samples: nirK-like gene sequences from Lake Superior water samples taken from two different stations and depths.
Station CD-1 from a depth of 132 m; and Station EL-2 from a depth of 150 m. 50
Clone libraries were made from sequences amplified from Station CD-1 and from culture
extracts taken from the ongoing enrichment culture line LSWM (figure 3.4b). Of the 50 clones
taken from the enrichment culture extract only one phylotype was observable. nirK-like
sequences were only detectable in cultures containing archaeal amoA sequences, however all amoA positive cultures did not always show the presence of nirk-like sequences (figure3.6b).
Lanes 2,3 and 4 in figure 3.6b are comparable to the same lanes in figure 3.1a showing the presence of nirK- like sequences in all DNA extracts showing archaeal amoA bands from the same culture extract, while the environmental DNA comes from surface versus deep water samples.
Figure 3.6b Gel image of AOA nirk-like sequences from three culture extracts: nirK-like archaeal sequences amplified from cultures taken from water samples at station WM; Lanes 2, 3 and 4. Lanes 5, 6 and 7 show nirK-like sequences taken from environmental water samples 51
taken from surface waters near Station WM. Lane 1 is the negative control and lane 8 is a 1 kb
DNA ladder.
3.7 Description of 3 experimental groups
In this study three progressive experiments were done with AOA enrichment cultures.
The first group is explained presently in section 3.7 and is representative of the oldest group of
AOA parent cultures.
Section 3.8 shows results from experiment group 2. These cultures represent a set of
daughter cultures which have been sub-cultured with additional rounds of antibiotic treatment
and/or additional filtration methods.
Section 3.9 shows the results of the third and most recent set of AOA daughter cultures.
These data are representative of the AOA enrichment cultures which have been laboratory
maintained for ~2-3years.
3.7A Preliminary Growth Assay: Experiment Group 1
The two sets of culture morphologies were grown in the dark for a twenty-two day incubation period. Punctiform liquid sister cultures L and G were grown at 10°C and 25°C respectively and compared to oblate sister cultures N and H (10°C and 25°C ). In both sets of conditions culture G and H had the highest growth rate determined by total cell counts by flow cytometry. All cultures were grown on 4mM ammonium with 100µg/ml streptomycin and kanamycin. Figure 3.7a shows total cell numbers measured during bi-weekly sampling of the
above described four cultures. 52
Figure 3.7a AOA cell abundance of initial enrichment cultures as measured by flow cytometry: Archaeal enrichment culture cell abundance measured by flow cytometry and based on growth at two different temperatures for two different AOA morphologies (oblate and punctiform). Cultures grown at 25 oC grew to slightly higher cell abundances than their sister cultures grown at 10 oC. Both total cell abundances and growth rates did not change based on culture morphologies alone.
3.7B Nitrification based on culture morphology: Experiment Group 1
Both culture morphologies (punctiform and oblate) were grown in duplicate at two different temperatures (10oC or 25oC) and with a 4mM ammonium. Culture samples were taken bi-weekly to be tested for nitrite production in the media. Measurements were stopped at 28 days. At which point, a rate of nitrification was determined. During this experiment cell population types were tracked (using flow cytometry over the course of a month) to determine 53 that no additional contaminants were introduced to the cultures during the experiment. The data show a rapid increase in nitrite production (figure 3.7b) just before the log phase of growth
(figure 3.7a). The average rate of nitrification observed during this log phase of growth show a rate of nitrification to be 0.20µmol/day or 5.5µmol/month, with the highest rate measured being
0.33µmol/day (or 10µmol/month). These data showed a nearly identical rate of nitrification regardless of colony morphology. Nitrate production was not detected in in any of the cultures in this preliminary assay.
Figure 3.7b AOA nitrite production relative to culture morphology and temperature:
Nitrite production among two AOA enrichment culture morphologies grown at 10oC and
25oC. All cultures showed peak rates of nitrification starting at day 12 just before peak AOA growth rates. (fig. 3.7a, day 15). Highest total nitrite productions do not correlate directly 54 with highest cell abundances (in this experimental group).
3.7C Preliminary growth assay flow cytometry
Flow cytometric analysis of these four cultures showed that each culture community was populated by ~4:6 (punctiform : oblate) different non-photoautotrophic organisms (figure3.7c).
At this point it was not possible to determine which subpopulation was representative of the
AOA, however the growth rate (when based on total cell counts) does correlate with times and rates of peak nitrification acitivities.
Figure 3.7c Flow cytometry image of oblate culture morphology: Cultures exhibiting oblate plate morphologies show the presence of more (between 4 and 6) unique enrichment populations within a given enrichment than those cultures exhibiting punctiform plate morphologies, as observed by flow cytometry.
3.8A Flow Cytometry to determine culture purity; Experiment group 2 55
Flow cytometry was used to enumerate cells in culture and to help determine the purity of
each culture type over a thirty day incubation period. It was determined that between the two
morphologies of plate culture the plates containing the punctiform morphology contained the
least complex group of microbial populations. Punctiform archaeal cultures displayed the
presence of around three different types of populations, while four to seven where observed in
oblate enrichment cultures. Both oblate and punctiform cultures contained only one or two
ammonia oxidizing archaea as determined by amoA sequence (WM culture clones Figure 3.3).
Modified archaeal cultures were grown on only 500µM NH (much lower than in the initial experiments) and in media containing three antibiotics (80µg₄⁺ of the antibiotics spectinomycin, kanamycin and gentamycin). With these modifications subsequent cultures were shown by additional flow cytometric analysis (figure 3.8a) to have an even less diverse group of microbial populations (2 major subpopulations). It was these subsequent cultures that were used to determine more accurate growth and nitrification rates.
56
Figure 3.8a Flow cytometry images plotted with various populations within two AOA nrichment culture morphologies: AOA enrichment culture population comparison between filtered (punctiform; A1 and B1) and whole cell (oblate; A2 and B2) culture types. Growth patterns and population dynamics are shown using flow cytometry for three different time 57 points in filtered (B1) and whole cell (B2) enrichments over the course of the one month incubation. Regions R7 and R8 encompass areas where filtered AOA type cells were expected to be located (based on size and complexity). R6 represents an area which combines both, R7 and R8 as well as most of the additional populations observed in whole cell cultures (B2). A1
(filtered) and A2 (whole cell) show growth rate and total cell abundance measurements of the three regions (R6,R7and R8).
Figure 3.8a shows population dynamics for the same parent archaeal culture which was either; filtered or unfiltered (labeled whole cells) through a 0.2µm filter before inoculation in fresh 500µM ATCC #2256 amended media
Total cell numbers (figure 3.8b) and cell counts for two specific populations were monitored in this growth assay; populations R7 and R8 (figure 3.8a) over the course of forty days. Both the total cell and specific population numbers were lower than the previous growth experiment. This did not diminish total nitrite production rates, indicating a higher percentage of AOA to contaminant microbes. 58
Figure 3.8b Total cell abundances of filtered and whole cell enrichment cultures: Total cell abundances of both filtered (blue) and whole cell (red) enrichment cultures as measured by flow cytometry. Both culture types grew to relatively low cell densities however, whole cell cultures grew to nearly twice the total abundance of the filtered culture type.
3.8B Nitrification and Ammonium Depletion; Experiment group 2
Figure 3.8c shows nitrite production versus ammonium depletion/usage in the two sets of the ammonia oxidizing cultures from the growth assay described above (filtered cultures had 3 or fewer bacterial contaminants, while whole cell cultures had ~4-6). These two lines are described as “Filtered” or “Whole” cell inoculations. Filtered cultures showed a nearly fifteen-
fold greater ammonium depletion than nitrite production, while the whole cell cultures showed
only a ten-fold greater ammonium depletion than nitrite production. However a more clear
ammonium usage curve was observed in the filtered culture line. Nitrite production was nearly 59 identical between the two culture lines with the exception a slightly higher peak nitrite production rate in the first week of growth.
Figure 3.8c Conversion of ammonium to nitrite in experiment group two enrichment cultures: The conversion of NH to NO ¯ by different culture types. Filtered cultures had a clear pattern of NH depletion (Blue₄⁺ diamonds)₂ versus NO ¯ production (Green triangles).
Whole cell cultures ₄⁺showed a less clear pattern of NH ¯depletion₂ (Red Squares) versus NO ¯ production (Purple crosses). Stoichiometric conversion₄ of N was not observed in either ₂ culture type.
3.9A Experiment Group 3; Detection of Nitrite, Nitrous Oxide and Ammonium Depletion
Nitrite production was measured at a rate of 176nmole/day over the course of two weeks, with a peak rate of nitrite production of 0.96µmole/day between days 4 and 6. Nitrous oxide 60 production was measured at 179nmole/day over the two week incubation period having a peak nitrous oxide production rate of 1.15µmole/day.
Ammonium usage occurred at 7.14µmole/day with peak ammonium depletion between days 4 and 6 at 25µmole/day (figure 3.9a)
3.9B Experiment Group 3; AOA Culture Nitrogen Stoichiometry values
The combined totals for nitrite and nitrous oxide production over the two week incubation period account for ~10% of the total ammonium loss/usage. However during the peak nitrification/denitrification activity (which occurred between days 4 and 6) combined nitrite and nitrous oxide totals accounted for nearly 17% of all ammonium usage (figure 3.9b).
Figure 3.9a Nitrogen conversion measurements including nitrous oxide in experiment group three cultures: N conversion measured over a two week period. Cultures were inoculated in modified ATCC #2265 media containing 450µM NH . Early N O (green diamonds) production indicated a mechanism for denitrification₄⁺ that tapered₂ off at day 14, while 61 nitrification (oxidation) of NH (blue triangles) to NO ¯ (purple crosses) continued to steadily rise. Combined NO ¯₄⁺ and N O production are₂ shown as red squares.
₂ ₂
Figure 3.9b Ratios of nitrogen species during for experiment group three during a two week incubation: The ratio of N measured in experimental group three enrichment cultures during the two week incubation. Day zero shows that all N is tied up as NH . Day four showed that
~16% of measured N in the enrichment is now in the form of NO ¯ (red)₄⁺ or N O (green). The ratio of both NO ¯ and N O represents a lower ratio of N by day₂ six and day ₂14. These ratios point to N activity₂ and are₂ not showing direct accumulations (total concentrations) of the different N species. 62
3.9C Experiment Group 3 extended
Ammonium depletion steadily slowed after the first two week incubation period while nitrite production persisted. The extended experiment showed that the nitrite production rate increased from 176nmole/day observed in the two week experiment to 233 nmole/day in the extended thirty day period. Figure 3.9c shows that the ammonium depletion rate decreased from
7.14 µmoles/day to 3.33 µmoles/day over the thirty day extended experiment. Ammonium depletion plateaued at day 20 while nitrite production continued to steadily increase.
Figure 3.9c Ammonium depletion versus nitrite production over extended incubation with group three enrichment cultures: NH depletion (blue diamonds) versus Nitrite accumulation (red squares) with two additional₄⁺ weeks of incubation (after all N O measurements were recorded). From day fourteen to day thirty NO ¯ production₂ rates continued to increase while NH depletion decreased. Total NO ¯₂ production alone represented ~11.5% of NH loss₄⁺ (more than the combined totals ₂of N O and NO ¯ observed during the first two week time₄⁺ period fig 3.9a). ₂ ₂ 63
3.10 Natural Ammonium Conversion Measurement
The natural conversion of ammonium to atmospheric ammonia is dependent on three
factors; the atmospheric concentration of ammonia, the concentration of ammonium in solution,
and the pH of the media/solution. Ammonium concentration, alkaline pH (Thomas 1982) and
turbulence (Jayaweera and Mikkelsen 1990) increase the percentage conversion of ammonium
volatized to ammonia. Figure 3.10 shows a 1.96µmole/day rate of natural ammonium loss with
an initial pH of 8.4 and a final pH of 7.5. Peak ammonium loss occurred between days 7 and 15
at a rate of 3.88µmoles/day. These data show that conversion of ammonium to ammonia
represent nearly ten percent (7.7%) of the net loss of ammonium occurring over the course of a
month.
Figure 3.10 Natural ammonium conversion/loss as measured with sterile AOA media:
Average NH loss observed in three sterile flasks containing modified ATCC #2265 with
635µM NH ₄⁺. Natural NH loss accounted for a nearly 50µM depletion over the course of
the twenty-five₄⁺ day incubation.₄⁺ The rate of NH loss began to decline at day 15 (possibly due
to pH fluctuation from 8.4 – 7.5 data not shown).₄⁺ 64
3.11 Analysis of Copper availability/recruitment on nitrification
Lake Superior AOA cultures were analyzed for their dependence on copper as a required
cofactor in cytochromes used in ammonia oxidation and electron transport. Dependence was
measured by blocking copper uptake with the copper chelator, cyclam. All cultures initially
contained 5.3µM copper sulfate. AOA cultures were then treated with enough cyclam to block
either all copper; orange, half copper; yellow or not treated with cyclam; red (figure 3.11).
Culture showed no difference in their ability to produce nitrite under the three different
conditions. Rates of nitrite production were all ~ 115nmoles/day. Similar peak nitrification
rates were also observed at ~138nmoles/day occurring during the same peak days of nitrification
(between days 12 and 19).
Figure 3.11 Copper availability/recruitment versus rate of nitrification in AOA enrichment
cultures: AOA enrichment cultures treated with the copper chelating agent Cyclam, to
determine copper dependence with regard to nitrification activity. All media had an intial concentration of 5.3µM of copper sulfate. Copper availability was governed by either: 65
complete (orange diamonds), partial (1/2 copper bound) chelation with Cyclam or with no
addition (red triangles) of Cyclam. All cultures produced equivalent total NO ¯ amounts and showed similar rates of NO¯ production activity. ₂
₂
66
CHAPTER 4 DISCUSSION
4.1 Identification of a novel freshwater AOA and AOB from Lake Superior
Ammonia oxidizing archaea and bacteria have been shown to play a vital role in the global nitrogen cycle with most previous studies focusing on their activities in marine and soil ecosystems. The aim of this study was focused on a culture based characterization of AOA and
AOB communities in Lake Superior in an effort to better understand the role of these organisms in a freshwater ecosystem and to help reconcile a current measured N:P stoichiometric imbalance
(Sterner et al., 2007,2011). This study began with a broad approach looking at both AOA and
AOB endemic to Lake Superior. However, based on previous data indicating high numerical dominance of AOAs over AOBs (Mukherjee 2013) a much lower AOB community diversity (as compared to Lake Superior AOAs [this study]), and limits on AOB cultivation, focus was turned primarily toward AOAs only.
The results of this study show the presence of novel communities of both AOA and AOB throughout the water column and at a variety of stations (figure 4.1a) throughout Lake Superior.
We have further shown based on homology of amoA, 16S rDNA and nirK gene sequences to environmental extracts that a representative of this novel ammonia oxidizing archaeal community can be cultivated. Through culture based nitrification studies we have been able to reconcile some of the cause for the stoichiometric imbalance. In general AOA function better under highly oligotrophic low ammonium conditions. When carbon and phosphorus are low, nitrate assimilation driven by phytoplankton is constrained (Small et al., 2013) while the novel chemoautotrophic archaea described in this study will continue to produce nitrite at low, but steady levels. The dilemma leading to nitrate buildup may actually be due to factors such as P 67
limitation which constrains N utilization by phytoplankton more than it constrains
chemoautotrophy by nitrifyers.
4.2 Lake Superior AOA detection and phylogeny: amoA sequences
Using FISH (Mukherjee 2013) showed that AOA are present in pelagic Lake Superior in
abundances approaching 104 L -1. AOB were not detected in most samples. Phylogenetic analysis of Lake Superior archaeal amoA sequences showed the emergence of a previously undescribed freshwater clade. Ninety-seven percent of the all Lake Superior archaeal amoA
sequences grouped within the 1.1a marine group however all but 2% of those sequences grouped
within the more specific freshwater clade. The remaining 3% grouping within the 1.1b soil
group were obtained from DNA extracted from station Sterner C and is possible that they reflect
soil AOA infiltration from near shore runoff.
Lake Superior 16S gene (Mukherjee 2013) sequence phylogenies paralleled amoA phylogeny
reducing the likelihood for primer bias in determining the AOA community structure. In fact, in
recent studies the analysis of archaeal nirK-like sequences has been shown (in some instances) to
illuminate greater diversity in previously describe AOA communities (Bartossek et al., 2010).
Although the nirK-like phylogeny done in this study is incomplete, it does indicate greater
diversity among Lake Superior AOA. It also does not mimic the amoA and 16S trees but a Lake
Superior Freshwater clade does remain an intact cluster.
4.3 Lake Superior AOA enrichment culture
With Lake Superior being deep (400 m) and dark and with most AOAs localized to areas
far below (120 m)the epilimnion (Small et al, 2013, Mukherjee 2013) it was not surprising to see
that the two culture morphologies were both active at lower temperatures (figure 3.7a).
However cultures grown at 25 °C showed a minor increase in growth rate while the converse was 68 observed with nitrite production at the same temperature. It is possible that the slight preference for the warmer temperature observed in figure 3.7a was the result of contaminant (mesophilic) heterotrophs that had not been diluted out prior to subculturing in this early experiment. This is further confirmed by the higher rate of nitrite production observed in punctiform culture “L” at the lower 10 °C temperature (figure 3.7b) but not in the oblate cultures. Nonetheless it does not appear that year round in-lake conditions reach temperatures that would greatly inhibit growth and/or metabolic activities of AOA. The insensitivity to temperature suggests the steady growth/nitrification rate contributes to nitrate buildup year-round. However, since the AOA are sensitive to light (French et al. 2012) nitrification is constrained in the photic zone (Small et al.
2013). Nonetheless, the rates of nitrification are 60-100 times that of the rate of NO ¯ increase in the lake, so there are mechanisms of NO ¯ losses that need to be considered (Small₃ et al.,
2013). ₃
4.4A Nitrogen stoichiometry in AOA cultures
Our results indicate a slow but steady usage of ammonium over the course of a month.
Peak nitrite production was measured at ~300 nmoles/day. The natural ammonium conversion experiment (figure 3.10) showed ~45-50 µM depletion in ammonium levels with no microbial activity. Combined peak nitrification/denitrification activity during our AOA culture studies showed nearly half as much reactive nitrogen was produced per day than consumed (Table 4.4).
This may be due to the activity of non-chemoautotrophic contaminants (which begin to release ammonium from dead cells). It is also an indication that the 0.45µm polycarbonate membrane used to filter culture samples for ammonium was too large and allowed a higher amount of the small AOA cells to pass through. Finally, since little is known about the second enzyme
(HAO?) used by archaea in ammonium oxidation to nitrite and even less is known about the role 69 of the nirK-like enzyme just recently detected in AOAs (Bartossek et al., 2010) it is possible that there is some production occurring of a reactive nitrogen intermediary that we were not aware of during this study.
4.4B nirK- activity
Given the fact that nitrification rates in Lake Superior are 60-100 fold lower than the
AOA nitrification rates in situ (Small et al. 2013), we looked for pathways of N loss mediated by
AOA. Specifically the reduction of NO ¯ to N O is present at 30nM in the water column (Small, unpublished data). In a previous AOA ₂enrichment₂ study (from soil AOAs) it was shown that despite typical denitrifying conditions being anaerobic or low oxygen dependent, there was no difference in the amount of N O produced in low versus high O conditions (Jung et al.,2011).
We have also confirmed the production₂ of low levels of nitrous ₂oxide production. About 10% of the nitrogen in our cultures is converted to N O. This represents a little less than half of the total
NO ¯ produced through the oxidation of ammonium₂ in the presence of ambient O . This may be an indication₂ that in a highly oxygenated aquatic system such as Lake Superior nitrous₂ oxide production is occurring as a consequence of nitrifyer denitrification by the AOA community.
4.4C Comparing AOA Culture Growth and Nitrification Rates
AOA cultures grew to relatively low cell densities: 4.0 x 10^5 cells/ml filtered versus 6.8 x 10^5 cells/ml for unfiltered whole cell cultures and peaked at 4 weeks (between 28-32 days).
This could be the result of the ultra-oligotrophic nature of Lake Superior where maximum environmental AOA cell densities are only ~6.0 x 10^4 (Mukherjee 2012 and Ray 2012). The overall culture growth rate was lower than the rates observed with the N. maritimus enrichment culture (Konneke et a., 2005) which had a ~ 1 day generation time versus the Lake Superior culture which had a doubling time of ~3.8 days. Nonetheless, it is likely that nitrite production 70 rates for this novel freshwater AOA are actually higher than those measured for the N. maritimus culture and for rates measured from the North Sea (Wuchter et al., 2006) at 4.0 and 4.6 fmol cell-
1 day-1, respectively. Minimum per cell rates for Lake Superior AOA culture nitrification based on total cell counts in filtered and whole cultures showed rates of 3.9 and 2.2 fmol cell-1 day-1, respectively. It should be noted that the AOAs in these cultures represent only a subset of the culture community and so the values above are a low end estimate of per cell nitrification.
Filtered/Punct Whole/Oblate Filtered/Punct Filtered/Punct Whole/Oblate (Filt/Punct)Adj for (Whole/Oblate)Adj for Filtered/Punct Culture Description NO - nm/day NO - nm/day N O nm/day NH nm/day NH nm/day Natural NH nm/day Natural NH nm/day NO₂- and N O nm/day
₂ ₂ ₂ ₄⁺ ₄⁺ ₄⁺ ₄⁺ ₂ Experiment set 1 260 155 2957 1957 1317 317 331
Peak Rates 302 268 481
Experiment set 2 93 85 1758 3208 118 1568 164
Peak Rates 250 233 429
Experiment set 3 225 71 3125 1485 296
Peak Rates 248 179 427
Peak Rate avg. 266.67 250.5 179 445.67
Average rates 192.67 120 71 2613.33 2582.5 973.33 942.5 263.67 Percent total reactive N per culture/month 20 -27% 13-26% 6-12.5% 50-73% 27 - 50%
Table 4.4: Nitrogen stoichiometry in AOA enrichment cultures
4.5 Copper recruitment and requirements for oxidative pathways
The copper utilization and recruitment study conducted on our novel Lake Superior AOA culture indicated that these unique microbes have an exceedingly high affinity for copper. This is one feature that both separates them from their bacterial nitrifyer counterparts and may account for their numerical dominance over the AOB in Lake Superior. Figure 1 (Glass and
Orphan 2012) shows three pathways for microbial nitrite/nitrous oxide production. One of the 71
key differences in the proposed AOA pathway is the use of copper as the only one metallic co- factor. Two of the iron dependent metalloenzymes in the middle (Bacterial) nitrification pathway, HAO and NOR have been bypassed in the archaeal pathway.
The Lake Superior AOAs characterized in this study have shown the ability to produce both nitrite and nitrous oxide. Thus it would make sense that microorganisms with higher copper requirements as compared to other ammonia oxidizing microbes would have an extremely high affinity for copper and would thrive in a copper rich lake such as Lake Superior.
4.6 The role AOA activity with regard to the existing nitrogen budget for Lake Superior
It was shown during the preliminary analysis of the nitrogen cycle (Kumar et al., 2008) that Lake Superior has a much higher concentration of nitrate than ammonium, and that the rate of ammonium utilization is much higher than nitrate consumption. In our studies we have shown that nitrite production is occurring at approximately one half to one third the rate to which ammonium is being used by the Lake Superior AOAs. This tells us a few things about the nature of the nitrogen cycle in Lake Superior. First, that however low the concentration of ammonium in Lake Superior it appears to be sufficient to enable AOAs to steadily produce nitrite/nitrate.
Second, it must be pointed out that the AOA are likely mobilizing a larger pool of ammonium from the sediments, and that sediment AOA are abundant (Bollman et al. 2014).
The measured activities of the cultured AOA in this study indicate that the build-up of nitrate in
Lake Superior is most likely driven by AOA activity. However with per cell rates of nitrification being similar to their marine counterparts it is likely that the high concentration of nitrate in Lake
Superior is more likely the result of constrained N uptake by phytoplankton, rather than the activity of ammonia oxidizing microbes (Small et al., 2013). The N:P ratio of Lake Superior is currently around ~8700 (26 µM Nitrate : 3 nM Phosphate), orders of magnitude higher than the 72
Redfield ratio of 16 observed in the open ocean. A recent study has shown that phosphorus
availability can strongly increase nitrate utilization/denitrifying activities by phytoplankton
(Small et al., 2013). Thus with regulations which have limited anthropogenic inputs of
phosphorus and with global (anthropogenic) inputs of nitrogen being nearly double what they
were a century ago, this likely only increases the inability of phytoplankton to remove nitrate
from Lake Superior (Finlay et al. 2014).
4.7A Further Study
It is clear that the freshwater AOAs described in this study have a high affinity for copper. This discovery supports the previously proposed copper-dependent ammonia oxidation pathway observed in other AOAs both soil (1.1b) and marine/freshwater (1.1a). However, there
is still a gap in our full understanding of the enzymatic activities occurring in archaeal ammonia
oxidation. Furthermore, having shown that freshwater AOAs from an ultra-oligotrophic habitat
have the potential for higher (per cell) rates of nitrification than their marine counterparts, could
this be the result of an even higher affinity/requirement for copper (than marine AOAs).
4.7B Examination of Lake Superior AOAs for Mixotrophic/Heterotrophic growth
Chemoatotrophic activity was initially shown through environmental studies of N. maritimus which demonstrated carbon fixation via the detection of isotopic CO in signature membrane lipids (Ouverney and Fuhrman 2000; Kuypers et al., 2001; Pearson et₂ al., 2004).
These early studies also looked at the incorporation of radiolabeled organic carbon as well and also showed incorporation in (AOA) signature lipids (Ingalls et al., 2006). This potential for heterotrophic/mixotrophic growth was further supported by the detection of a variety of organic molecule transporters observed upon annotation of N. maritimus’ genome sequence. More 73 recent studies by (Martens-Habbena et al., 2009) have shown that growth could be significantly stimulated with the addition of key heterotrophic metabolism intermediates.
4.7C Presence and activity of nirK-like sequences and nirK activities
The physiological importance of nirK in AOA is still somewhat unclear. In AOB the pathway of nitrification/denitrification has been well elucidated (figure 4). Under O limiting conditions AOB have the ability to perform “nitrifyer denitrification,” a process in which₂ they can utilize NO ¯ as an electron acceptor instead of O (Abeliovich and Vonshak, 1992; Bock et al., 1995; Schmidt₂ and Bock, 1997) leading to the production₂ of the greenhouse gas nitrous oxide. Ammonia oxidizing archaea have also been shown to produce nitrous oxide (Santoro et al., 2011 and this study) however unlike the denitrifying activity of AOB no other denitrifying enzymes have been identified in AOA (NOr for example) (Hallam et al., 2006; Walker et al.,
2010; Blainey et al., 2011). Further exploration of AOA nitrifyer denitrification in Lake
Superior AOA through additional culture and metagenomic studies could help to illuminate key enzymes in both the nitrifying and denitrifying pathways. There is some evidence that the absence of nitric oxide (NO) in growth media impedes growth (Schmidt et al., 2004) and decreases ammonia oxidation rates of AOB (Cantera and Stein, 2007a). Examining this phenomenon in AOA could help to direct the search for downstream denitrifying enzymes. It is possible that in an oligotrophic habit like Lake Superior these organisms have become well adapted to using a variety of reactive nitrogen species. In our study, based on amoA and nirK sequence phylogeny it does appear that freshwater AOA are distinct from their marine and terrestrial counterparts. Therefore a final comparison of Lake Superior AOA denitrifying activities to other marine and terrestrial AOAs along these same lines would be valuable. In our current study we have shown that the Lake Supeior AOA both produce nitrous oxide and have a 74
similar rate of nitrite production as compared to other AOA species. However, this final study
would help to quantify denitrifying activity and elucidate how unique the Lake Superior AOAs
are from this physiological standpoint.
4.7D Continued CultureWork
Attempts to develop an axenic ammonia oxidizing archaeal culture have been
unsuccessful thus far. It is possible that these microbes may require syntropic interactions with
other microbes in order to grow in culture. To isolate the previously identified ammonia
oxidizing archaea, further work with antibiotics and copper chelators in the culture media is
being performed. In the meantime, Fluorescence in-situ hybridization (FISH) is being done with
bacterial and crenarcheotal 16S rDNA probes to determine total cell abundances in archaeal
cultures and help to identify the types of microbes present with the ammonia oxidizers. Current
amoA gene sequence PCR amplification, 16S rRNA amplification and FISH analysis indicate
that although the cultures are not axenic they do have only one type of ammonia oxidizing
organism. Furthermore, after preliminary FISH analysis, it appears that cultures being grown on
antibiotic media have low cell abundances which correlate with flow cytometric cell counts. It has yet to be determined via FISH whether the ratio of ammonia oxidizing microbes to non-
ammonia oxidizing microbes is higher in 0.45µm filtered cultures versus whole cell cultures.
As mentioned above characterization of ammonia oxidizing archaeal cultures using freshwater crenarchaeotal 16S rRNA gene primers has been done (Mukherjee 2013) from sequences previously obtained by a nested PCR amplification approach using the universal archaeal 16S rDNA primers 21F and 958R followed by a second reaction using primers arch915R and arch519F (Coolen et al., 2004). Phylogenetic analysis of 16S rDNA sequences obtained with
these new freshwater specific 16S rDNA archaeal primers showed highly similar phylogeny to 75
amoA trees for AOA cultures. 16S rDNA analysis also showed most environmental samples to
group within the “Freshwater AOA clade.”
4.7E Metagenomic analysis
A culture sample has been sent for metagenomic analysis. With the data obtained from
this survey it is hypothesized that we will be able to firmly identify the ratio of AOAs to
contaminant/naturally occurring heterotrophs in the system. This may help to describe what this
organism would need to grow axenically or if it may requires some symbiotic interaction with
other native microbes to survive in culture. We should also be able to identify the
presence/absence of both nitrifying and denitrifying genes associated with ammonia oxidation
physiology. This study will also allow us to further compare Lake Superior AOAs to the model
N. maritimus and perhaps eventually provide enough genetic information to fill the void as a new model organism for freshwater ammonia oxidizing archaea.
76
REFERENCES
Abeliovich, A., and A. Vonshak. (1992) “Anaerobic metabolism of Nitrosomonas europaea.”
Arch. Microbiol 158: 267-270.
Arp, D.J., L. A. Sayavedra-Soto, N. G. Hommes. (2002) “Molecular biology and biochemistry of ammonia oxidation by Nitrosomonas europaea.” Arch Microbiol 178(4): 250-255.
Babock, L. L., and K. Spiroff. (1970) “Recovery of copper from Michigan stamp sands.” Inst.
Mineral Res. V. 1. Mich. Technol. Univ. U.S. Bureau of Mines Proj. GO180241 (SWD-18). 57.
Bartossek, R., G. Nicol, A. Lanzen, H. P. Klenk. and C. Schleper. (2010)
“Homologues of nitrite reductases in ammonia-oxidizing Archaea: diversity and genomic context.” Environ. Microbiol 12: 1075–1088.
Bell, S.D. and S.P. Jackson. (1998) “Transcription in archaea.” Cold Spring Harb. Symp. Quant.
Biol. 63: 41-51.
Berges, J. A, Y. Jiang, R. W. Sterner, G. S. Bullerjahn, N.A. Ivanikova, and R.M. L. McKay
(2013) “Identification of factors constraining nitrate assimilation in Lake Superior,
Laurentian Great Lakes.” Hydrobiologia DOI 10.1007/s10750-013-1637-z.
Blainey P.C., A. C. Mosier, A. Potanina, C.A. Francis and S.R. Quake. (2011) “Genome of a low-salinity ammonia-oxidizing archaeon determined by single-cell and metagenomic analysis.”
PLoS ONE 6: e16626. 77
Blume, R. M., T. Chase, and S.W. Watson. (1969) “Fatty acids in the lipids of marine and terrestrial nitrifying bacteria.” Journal of Bacteriology 99: 366-370.
Bock, E., I. Schmidt, R. Stuven, and D. Zart. (1995) “Nitrogen loss caused by denitrifying
Nitrosomonas cells using ammonium or hydrogen as electron donors and nitrite as electron acceptor.” Arch. MicrobioL 163(1): 16-20.
Bollmann, A., G.S. Bullerjahn, and R.M. McKay. (2014) “Abundance and diversity of
Ammonia-oxidizing Archaea and Bacteria in sediments of Lake Erie and Superior.” (In press).
Brochier-Armanet, C. et al. (2008)” Mesophilic Crenarchaeota: proposal for a third archaeal phylum, the Thaumarchaeota.” Nat. Rev. Microbiol. 6: 245–252.
Bult, C.J., O. White, G.J. Olsen, L. Zhou, R.D. Fleischmann, G.G. Sutton, J.A. Blake, L.M.
FitzGerald, R.A. Clayton, and J.D. Gocayne. (1996) “Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii.” Science 273: 1058–1073.
Cantera, J.J.L., and L. Y. Stein. (2007a) “Role of nitrite reductase in the ammonia-oxidizing pathway of Nitrosomonas europaea.” Arch Microbiol 188: 349–354.
Casciotti, K. L., and B. B. Ward. (2001) “Dissimilatory nitrite reductase genes from autotrophic ammonia-oxidizing bacteria.” Appl. Environ. Microbiol 67: 2213-2221.
Coolen, M.J., E. C. Hopman, W.I.C. Rijpstra, G. Muyzer, S. Schouten, J.K. Volkman, and J.
S.S. Damste. (2004) “Evolution of the methane cycle in Ace Lake (Antarctica) during the 78
Holocene: response of methanogens and methanotrophs to environemental change.” Org
Geochem 35: 1157-1167.
Crossett, K. M., T. J. Culliton, P. C. Wiley, and T. R. Goodspeed. (2004) “Population trends along the coastal United States: 1980–2008.” National Oceanic and Atmospheric Administration,
National Ocean Service, Management and Budget Office, Special Projects, Silver Spring,
Maryland.
DeLong, E. F. (1992) “Archaea in coastal marine environments.” Proc Natl Acad Sci USA
89: 5685-5689
DeLong, E.F. (1998) “Everything in moderation: archaea as ‘non-extremophiles’.”
Curr. Opin. Genet. Dev. 8: 649–654.
Di, H., K. Cameron, J. Shen, C. Winefield, M. O’Callaghan, S. Bowatte, and J. He.
(2010) “Ammonia-oxidizing bacteria and archaea grow under contrasting soil nitrogen conditions.” FEMS Microbiol. Ecol. 64: 167–174.
Edwards, W. J., J. D. Conroy, and D. A. Culver. (2005) Hypolimnetic oxygen depletion dynamics in the central basin of Lake Erie. 31(2): 262-271.
Finlay, J. C., R. W. Sterner, and S. Kumar. (2007) “Isotopic Evidence for In-lake Production of
Accumulating Nitrate in Lake Superior.” Ecological Applications 17 (8): 2323–2332.
79
Francis, C.A., K.J. Roberts, J.M. Beman, A.E. Santoro, and B.B. Oakley. (2005) “Ubiquity and
diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean.” PNAS
102 (41): 14683–14688.
French, E., J. A. Kozlowski, M. Mukherjee, G. Bullerjahn, and A. Bollmann. (2012)
“Enrichment and characterization of three ammonia-oxidizing Archaea from freshwater
environments.” Appl. Environ. Microbiol. doi: 10.1128/AEM.00432-12.
Fuller, K., H. Shear and J. Wittig. (1995) “The Great Lakes: an environmental atlas and resource book, Environment Canada (Canada).” Ontario Region; United States. Environmental Protection
Agency. Great Lakes National Program Office Chicago, Ill. (USA).
Fuhrman, J. A., K. McCallum, and A. A. Davis. (1992) “Novel major archaebacterial group from marine plankton.” Nature 356: 148–149.
Garcia, J. L., B. K. C. Patel, and B. Ollivier. (2000) “Taxonomic, phylogenetic, and ecological diversity of methanogenic Archaea.” Anaerobe 6: 205–226.
Gardner, W. S., P. J. Lavrentyev, J.F. Cavaletto, M.J. McCarthy, B.J. Eadie T.H. Johengen, and J. B. Cotner. (2004) “Distribution and dynamics of nitrogen and microbial plankton in southern Lake Michigan during spring transition 1999 – 2000.” J. Geophys. Res. 109: C03007, doi:10.1029/2002JC001588.
80
Glass J., and V. J. Orphan. (2012) “Trace metal requirements for microbial enzymes involved in
the production and consumption of methane and nitrous oxide.” Front. Microbiol 3:
61.10.3389/fmicb.2012.00202.
Hall, G. H. (1986) “Nitrification in lakes.” In Prosser, J. I. (ed) Nitrification
IRL Press, Oxford, Washington D. C., pp 127-156.
Hallam S.J., K. T. Konstantinidis, N. Putnam, C. Schleper, Y. Watanabe, J. Sugahara,
C. Preston, J. de la Torre, P.M. Richardson, and E. F. DeLong. (2006) “Genomic analysis of the uncultivated marine crenarchaeote Cenarchaeum symbiosum.” Proc Natl Acad Sci USA 103:
18296–18301.
Hatzenpichler, R., E.V. Lebedeva, E. Spieck, K. Stoecker, A. Richter, H. Daims, and M.
Wagner. (2008) “A moderately thermophilic ammonia-oxidizing crenarchaeote from a hot spring.” PNAS. 105: (6) 2134-2139. doi:10.1073/pnas.0708857105.
Head, I. M., W. Hiorns, T. Embley, A. McCarthy, and J. Saunders. (1993) “The phylogeny of autotrophic ammonia-oxidizing bacteria as determined by analysis of 16S ribosomal RNA gene sequences.” J. Gen. Microbiol. 13: 1147-1153.
Herrmann, M., A. Scheibe, S. Avrahami, and K. Kusel. (2011) “Ammonium availability affects the ratio of ammonia-oxidizing bacteria to ammonia-oxidizing archaea in simulated creek ecosystems.” Appl Environ Microbiol 77: 1896–1899. 81
Ingalls, A.E., S. R. Shah, R.L. Hansman, L. I. Aluwihare, G.M. Santos, E.R. Druffel,
and A. Pearson. (2006) “Quantifying archaeal community autotrophy in the mesopelagic ocean using natural radiocarbon.” Proc. Natl. Acad. Sci. USA 103:
6442–6447.
Ivanikova, N.V., R.M. McKay, and G. S. Bullerjahn. (2005) “Construction and characterization of a cyanobacterial bioreporter capable of assessing nitrate assimilatory capacity in freshwaters.”
Limnol. Oceanogr. Methods 3: 86–93
Ivanikova, N.V., R.M. McKay, and G. S. Bullerjahn. (2007) “Nitrate utilization by phytoplankton in Lake Superior is impaired by low nutrient (P, Fe) availability and seasonal light limitation: a cyanobacterial bioreporter study.” J. Phycol 43: 475-48.
Jayaweera, G.R., and D.S. Mikkelsen. (1990a) “Ammonia volatilization from flooded soil systems. A computer model: I.Theoretical aspects.” Soil Sci. Soc. Am. 1.54: 1447-1455.
Jung, M.Y., S. J. Park, D. Min, J.S. Kim, W.I.C. Rijpstra, J.S. Sinninghe Damste, G.J. Kim, E.
L. Madsen, and S.K. Rhee (2011) “Enrichment and characterization of an autotrophic ammonia- oxidizing archaeon of mesophilic crenarchaeal group I.1a from an agricultural soil.” Appl.
Environ. Microbiol. 77: 8635–8647.
Kates, M., B. Palamet, C.N. Joo, D.J. Kushner, and N.E. Gibbons. (1966) “Aliphatic diether analogs of glyceride-derived lipids.IV. The occurrence of di-O-dihydrophytylglycerol ether containing lipids in extremely halophilic bacteria.” Biochemistry 5: 4092-4099.
82
Kates, M., P.S. Sastry, and L.S. Yengoyan. (1963) “ Isolation and characterization of a diether
analog of phosphatidyl glycerophosphate from Halobacterium cutirubrum.” Biochim. Biophys.
Acta. 70: 705-707.
Kerfoot, C. W., G. Lauster, and J. A. Robbins. (1994) “Paleolimnological study of copper mining around Lake Superior: Artificial varves from Portage Lake provide a high resolution record.” Limnol. Oceanogr. 39: 649–669.
Könneke, M., A. E. Bernhard, J. R. de la Torre, C. B. Walker, J. B. Waterbury, and D. A. Stahl.
(2005) “Isolation of an Autotrophic Ammonia-oxidizing Marine Archaeon.” Nature 437 (7058):
543–546.
Koops, H.P., B. Bottcher, U. C. Moller, A. Pommerening-Roser, and G. Stehr. (1991)
“Classification of eight new species of ammonia-oxidizing bacteria: Nitrosomonas communis sp. nov., Nitrosomonas ureae sp. nov., Nitrosomonas aestuarii sp. nov., Nitrosomonas marina sp. nov., Nitrosomonas nitrosa sp. nov., Nitrosomonas eutropha sp. nov., Nitrosomonas oligotropha sp. nov. and Nitrosomonas halophila sp. nov.” J Gen Microbiol 137: 1689–1699.
Krouk, G., N. M. Crawford, G. M. Coruzzi, and Y. F. Tsay. (2010) “Nitrate signaling: adaptation to fluctuating environments.” Current Opinion in Plant Biology 13: 266–273.
Kumar, S., R.W. Sterner, and J. C. Finlay. (2008) “Nitrogen and carbon uptake dynamics in
Lake Superior.” J Geophys Res Biogeosci 113: G04003.
83
Kumar, S., R.W. Sterner, J.C. Finlay, and S. Bravold. (2007) “Spatial and Temporal Variation of
Ammonium in Lake Superior.” Journal of Great Lakes Research. 33(3): 581-591.
Kuypers, M.M.M., P. Blokker, J. Erbacher, H. Kinkel, R.D. Pancost, S. Schouten, and J.S.S. Damste. (2001) “Massive expansion of marine archaea during a mid-
Cretaceous oceanic anoxic event.” Science 293: 92–94.
Lai, D., J. R. Springstead and H. G. Monbouquette. (2008) “Effect of growth temperature on ether lipid biochemistry in Archaeoglobus fulgidus.”
Extremophiles 12: 271-278.
Lebedeva, E.V., M. Alawi, C. Fiencke, B. Namsaraev, E. Bock, and E. Spieck. (2005)
“Moderately thermophilic nitrifying bacteria from a hot spring of the Baikal rift zone.”
FEMS Microbiol Ecol 54: 297–306.
Leininger, S., T. Urich, M. Schloter, L. Schwark, J. Qi, G. W. Nicol, J. I. Prosser, S. C. Schuster, and C. Schleper. (2006) “Archaea Predominate Among Ammonia-oxidizing Prokaryotes in
Soils.” Nature 442 (7104): 806–809.
Macdonald, R. M. (1986) “Nitrification in soil: an introductory history.” In Nitrification, pp. 1-
16. Edited by J. I. Prosser. Oxford: IRL Press.
Martens-Habbena, W., P. M. Berube, H. Urakawa, J. R. de la Torre, and D. A. Stahl. (2009)
“Ammonia Oxidation Kinetics Determine Niche Separation of Nitrifying Archaea and Bacteria.”
Nature 461 (7266): 976–979. 84
Martens-Habbena, W., H. Urakawa, K. C. Costa, A. M. Gee, D. A. Stahl. (2009) “Autotrophy-
mixotrophyheterotrophy: clues about the physiology of mesophilic ammonia-oxidizing
crenarchaeota.” Presented at Am. Soc. Microbiol. Gen. Meet., Philadelphia, PA.
Mukherjee, M. (2013) Identification, enumeration and diversity of ammonia-oxidizing archaea in
the Laurentian Great Lakes. (A Dissertation).
Nriagu, J.O., G. Lawson, H.K.T. Wong, and V. Cheam. (1996) “ Dissolved trace metals in
Lakes Superior, Erie, and Ontario.” Environ. Sci. Technol. 30: 178–187.
Ohashi, Y., W. Shi, N. Takatani, M. Aichi, S. Maeda, S. Watanabe, H. Yoshikawa, and T.
Omata. (2011). “Regulationofnitrateassimilation in cyanobacteria.” J. Exp.Bot. 62: 1411–1424.
Ouverney, C.C. and J. A. Fuhrman. (2000) “Marine planktonic archaea take up amino
acids. Appl.” Environ. Microbiol. 66: 4829–4833.
Park S., B. Park, and S. Rhee. (2008) “Comparative analysis of archaeal 16S rRNA and amoA
genes to estimate the abundance and diversity of ammonia-oxidizing archaea in marine sediments.” Extremeophiles. 12: 605-615.
Pearson, A., A.P. McNichol, B.C. Benitez-Nelson, J.M. Hayes and T.I. Eglinton.
(2001) “Origins of lipid biomarkers in Santa Monica Basin surface sediment: a case study using compound-specific D14C analysis.” Geochim. Cosmochim. Acta 65:
3123–3137. 85
Pearson, A., Z. Huang, A. E. Ingalls, C.S. Romanek, J. Wiegel, K. H. Freeman, R. H.
Smittenberg, and C.L. Zhang. (2004) “Nonmarine crenarchaeol in Nevada hot
springs.” Appl. Environ. Microbiol. 70: 5229–5237.
Pitcher, A., S. Schouten, and J.S.S. Damste. (2009) “In situ production of Crenarchaeol in two California hot springs.” Appl. Environ. Microbiol. 75: 4443–4451.
Prochazkova, L., B. Blazka, and M. Kralova. (1970) “Chemical changes involving nitrogen metabolism in water and particulate matter during primary production experiments.” Limnol.
Oceanogr. 15: 797-807.
Remde, A., and R. Conrad. (1990) “Production of nitric oxide in Nitrosomonas europaea by reduction of nitrite.” Archives of Microbiology 154 (2): 187-191.
Santoro A. E., C. Buchwald, M. R. McIlvin, and K. L. Casciotti. (2011) “Isotopic signature of
N2O produced by marine ammonia-oxidizing archaea.” Science 333: 1282–1285.
Schleper, C., G. Jurgens, and M. Jonuscheit. (2005) “Genomic studies of uncultivated
archaea.” Nat. Rev. Microbiol. 3: 479–488.
Schleper, C., and G. W. Nicol. (2010) “Ammonia-oxidizing Archaea—physiology, Ecology and
Evolution.” Advances in Microbial Physiology 57: 1-41.
86
Schloesser, D.W., R.G. Stickle, and T.B. Bridgeman. (2005). “Potential oxygen demand of
sediments from Lake Erie.” J. Great Lakes Res. 31: 272–283.
Schmidt, I. and E. Bock. (1997) “Anaerobic ammonia oxidation with nitrogen dioxide by
Nitrosomonas eutropha.” Arch Microbiol 167: 106-111.
Schmidt, I., R. J. M. Van Spanning, and M. S. M. Jetten. (2004) “Denitrification and ammonia
oxidation by Nitrosomonas europaea wild-type, and NirK and
NorB-deficient mutants.” Microbiology 150: 4107–4114 DOI 10.1099/mic.0.27382-0.
Schouten, S., E. C. Hopmans, M. Baas, H. Boumann, S. Standfest, M. Konneke,
D.A. Stahl, and J.S.S. Damste. (2008) “Intact membrane lipids of Candidatus
‘Nitrosopumilus maritimus’, a cultivated representative of the cosmopolitan mesophilic
Group I Crenarchaeota.” Appl. Environ. Microbiol. 74: 2433–2440.
Small, G. E., G. S. Bullerjahn, R. W. Sterner, B. F. N. Beall, S. Brovold, J. C. Finlay, R. M. L.
McKay, and M. Mukherjee. (2013) “Rates and controls of nitrification in a large oligotrophic
lake.” Limnol. Oceanogr., 58(1): 276–286. doi:10.4319/lo.2013.58.1.0276.
Solorzano, L. (1969) “Determinatioin of ammonia in natural waters by the pheynolhypochlorite
methods.” Limnol. Oceanogr., 14(5): 1969, 799-801 | DOI: 10.4319/lo.1969.14.5.0799
Spang A., R. Hatzenpichler, C. Brochier-Armanet, T. Rattei, P. Tischler, E. Spieck, W. Streit,
D.A. Stahl, M. Wagner, C. Schleper. (2010) “Distinct gene set in two different lineages of 87 ammonia-oxidizing archaea supports the phylum Thaumarchaeota.” Trends in Microbiology.
734: 1-10.
Stein, L. Y., and D. J. Arp. (1998) “Ammonium limitation results in the loss of ammonia- oxidizing activity in Nitrosomonas europaea. Appl. Environ. Microbiol. 64: 1514-1521.
Stein, L. Y., and D. J. Arp. (1998) “ Loss of ammonia monooxygenase activity in Nitrosomonas europaea upon exposure to nitrite.” Appl. Environ. Microbiol. 64: 4098-4102.
Sterner R.W., E. Anagnostou, S. Brovol, G.S. Bullerjahn, J. C. Finlay, S. Kumar, R.M. McKay and R.M. Sherrell. (2007) “Increasing stoichiometric imbalance in North America’s largest lake:
Nitrification of Lake Superior.” Geophys Res Lett. 34: L10406, doi: 10.1029/2006GL028861
Sterner R. W. (2011) “ C:N:P stoichiometry in Lake Superior: Freshwater sea as end member.”
Inland Waters 1: 29-46.
Thomas, R. L. and C.I. Dell. (1978) “Sediments of Lake Superior.” J. Great Lakes Res., 4:
264-275.
Thomas, R.G. (1982) “Volatilization from water,” Handbook of chemical property estimation methods. In LymanWJ, ReehlWF, RosenblattDH (ed), McGraw Hill Book Co., New York, NY. p 15.1–15.34.
Treusch, A.H., S. Leininger, A. Kletzin, S.C. Schuster, H.P. Klenk and C. Schleper. 88
(2005) “Novel genes for nitrite reductase and Amo-related proteins indicate a role
of uncultivated mesophilic crenarchaeota in nitrogen cycling.” Environ. Microbiol.
7: 1985–1995.
Treusch, A.H., A. Kletzin, G. Raddatz, T. Ochsenreiter, A. Quaiser, G. Meurer,
S.C. Schuster and C. Schleper. (2004a) “Characterization of large-insert DNA
libraries from soil for environmental genomic studies of Archaea.” Environ.
Microbiol. 6: 970–980.
M.R. Twiss, K. J. Rattan, R.M. Sherrell, and R. M. L. McKay. (2004) “Sensitivity of
Phytoplankton to Copper in Lake Superior.” J. Great Lakes Res. 30 (Supplement 1): 245–255.
Venter, J.C., K. Remington, J.F. Heidelberg, A.L. Halpern, D. Rusch, J.A. Eisen, D. Wu, I.
Paulsen, K.E. Nelson, W. Nelson, D.E. Fouts, S. Levy, A.H. Knap, M.W. Lomas, K. Nealson, O.
White, J. Peterson, J. Hoffman, R. Parsons, H. Baden-Tillson, C. Pfannkoch, Y.H. Rogers and H.
O. Smith. (2004) “Environmental genome shotgun sequencing of the Sargasso Sea.” Science
304: 66–74.
Visser E.W., P.L.E. Bodelier, G. Muyzer and H.J. Laanbroek. (2009) “A nested PCR approach
for improved recovery of archaeal 16S rRNA gene fragments from freshwater samples.” FEMS
Micrbiol Lett 298: 193-198.
Walker, C.B., J. de la Torre, M.G. Klotz, H. Urakawa, N. Pinel, D.J. Arp, C.Brochier-Armanet,
P.S.G. Chain, P.P. Chan, A. Gollabgir, J.Hemp, M. Heugler, E.A. Karr, M. Konneke, M. Shin, 89
T.J. Lawton, T. Lowe, W. Martens-Habbena, L. A. Sayavedra-Soto, D. Lang, S.M. Sievert, A.C.
Rosenzweig, G. Manning and D.A. Stahl, D.A. (2010) “Nitrosopumilus maritimus genome reveals unique mechanisms for nitrification and autotrophy in globally distributed marine crenarchaea.” Proc. Natl. Acad. Sci. USA 107: 8818–8823.
Woese, C.R. and G.E. Fox. (1977) “Phylogenetic structure of the prokaryotic domain: the primary kingdoms.” Proc. Natl. Acad. Sci. USA 74: 5088–5090.
Woese, C.R., W.G. Weisburg, C.M. Hahn, B.J. Paster, L.B. Zablen, B.J. Lewis,T.J. Macke,
W. Ludwig, E. Stackebrandt. (1985). “The phylogeny of the purple bacteria: the gamma subdivision. Systematic and Applied Microbiology 6: 25-33.
Woese, C.R. (1987) “Bacterial evolution.” Microbiol. Rev. 51: 221–271.
Woese, C.R., W.G. Weisburg, B. J. Paster, C. M. Hahn, R. S. Tanner, N. R. Krieg, H. P. Koops,
H. Harms, and E. Stackebrandt. (1984) “The phylogeny of purple bacteria: the beta subdivision.”
Syst. Appl. Microbiol 5: 327-336.
Woese, C.R., O. Kandler, and M.L. Wheelis. (1990) “Evolution Towards a natural system of organisms: Proposal for the domains Archaea, Bacteria, and Eucarya.” Proc. Nati. Acad. Sci.
USA. 87: 4576-4579.
Wuchter, C., S. Schouten, H.T. Boschker, and J.S.S Damste. (2003) “Bicarbonate uptake by marine Crenarchaeota.” FEMS Microbiol. Lett. 219: 203–207. 90
Wuchter, C., B. Abbas, M. J. L. Coolen, L. Herfort, J. Van Bleijswijk, P. Timmers, M. Strous, et al. (2006) “Archaeal Nitrification in the Ocean.” Proceedings of the National Academy of
Sciences 103 (33): 12317–12322.
91
APPENDIX A. ABBREVIATAIONS
AMO Ammonia Monooxygenase amoA Ammonia Monooxygenase Subunit A
AOA Ammonia-oxidizing Archaea
AOB Ammonia-oxidizing Bacteria
ETC Electron transport chain
FISH Fluorescence in situ hybridization
GDGT Glycerol dialkyl glycerol tetraethers
HAO Hydroxylamine Oxidoreductase
NirK Nitrite reductase nirK Nitrite reductase gene
NOB Nitrite-oxidizing Bacteria
NO Nitric oxide
NOR Nitric oxide reductase
NTP Nucleotide tri-phosphate
NxOR Nitroxyl oxidoreductase
PCR Polymerase Chain Reaction rRNA Ribosomal Ribonucleic Acid