Indentification, Enumeration and Diversity of Nitrifying Bacteria in the Laurentian Great Lakes

Home , Nitrification, Nitrifying bacteria, Nitrite oxidoreductase

IDENTIFICATION, ENUMERATION AND DIVERSITY OF NITRIFYING BACTERIA IN THE LAURENTIAN GREAT LAKES

Anirban Ray

A Thesis

Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirement for the degree of

MASTER OF SCIENCE December 2012

Committee:

Dr. George Bullerjahn, Advisor

Dr. Robert Michael McKay

Dr. Zhaohui Xu

Anirban Ray

ABSTRACT

Dr. George Bullerjahn, Advisor

In the past 100 years the nitrate levels in Lake Superior have increased more than five times (Sterner et al. 2007). Based on stable isotope assays, previous research has shown that most of this nitrate is coming from in-lake nitrification process in the lake

(Finlay et al. 2007), reflecting an imbalanced nitrogen cycle. By contrast, in Lake Erie the nitrate levels are declining. Lake Erie is the shallowest of the Great Lakes. The shallowness of the lake, the warmer temperature of the water, and nutrient inputs from urban and agricultural sources make it most biologically productive of the Great lakes.

Nitrification is a major process in the nitrogen cycle mainly carried out by the nitrifying microbial community (both Archaea and Bacteria), during which ammonia (NH3)

- - is converted to Nitrite (NO2 ) and then to nitrate (NO3 ) by ammonia oxidizers (both

Bacteria and Archaea) and Nitrite oxidizers (Bacteria only) respectively. Ammonia is oxidized by the enzyme ammonia monooxygenase, and hydroxylamine oxidoreductase

- – (HAO). Nitrite (NO2 ) converted to nitrate (NO3 ) by Nitrite oxidizers (Bacteria) and enzyme nitrite oxidoreductase, carries this reaction.

In this thesis, I investigated the microbial nitrifier community structure by identifying and enumerating the ammonia-oxidizing bacteria (AOB) and nitrite oxidizing bacteria (NOB) present in these two lakes using the technique of fluorescence in-situ hybridization (FISH). This is the first study on Lake Superior and Lake Erie proving the overview of the abundance and diversity of these organisms. This study is focusing on

iv understanding the nitrifying microbial community structure, contribution to other studies dealing with how these organisms function in the nitrogen cycling in these lakes.

Therefore, the goal of this study is to provide measure of abundance of AOB and NOB in

Lake Superior and Lake Erie as well as the diversity of AOB in these lakes.

Dedicated to the memory of my mother Mrs. Nupur Ray,

who could not be there to see this day of my life.

ACKNOWLEDGMENTS

First and foremost, I want to extend my deep appreciation for my thesis advisor and mentor Dr. George Bullerjahn for all his guidance and patience throughout the two years I spent in his laboratory. Without him, this thesis will not be possible. Words are not enough to express my thankfulness to him for accepting me in his lab, and for the invaluable advice and his immense tolerance and understanding of every stupid mistake I made in the lab. Thank you for being an invaluable resource to my academic life, and also for providing constant motivation to do quality work, all the time providing an immense level of independence to do my work on my own.

I want to thank my co-advisor Dr. Mike Mckay for his continuous support and advice in this work throughout. I also want to extend my gratitude to my thesis committee member

Dr. Zhaohui Xu for accepting to be a member of my committee, and for her inputs in this thesis. I would like to specially thank all the members of the Bullerjahn-McKay lab,

Maitreyee Mukherjee, Mike Schlais, Mark Rozmarynowycz, Nigel D’Souza, Zhi Zhu,

Benjamin Beall, and Olga Kutovaya. Thank you all for the helpful suggestions you gave me and for your friendship.

A special thanks goes to my lovely wife for believing in me, for her immense understanding and patience, and for her valuable advices. Last but not the least; I want to thank my parents and my friends in the US and in India for supporting me all through this time.

Thank you all very much for everything.

vii

TABLE OF CONTENTS

Page

INTRODUCTION ...... 1

MATERIAL AND METHODS ...... 14

Study sites ...... 14

Catalyzed reporter deposition- fluorescence in-situ hybridization

(CARD-FISH) ...... 18

Sample processing ...... 18

Fluorescently labeled probes ...... 18

Permeabilization…………………………………………………………….. 20

Hybridization ...... 20

Tyramide amplification ...... 23

Microscopy ...... 23

Polymerase chain reaction (PCR) ...... 24

PCR amplification of the amoA gene fragment ...... 24

PCR amplification of the 16S rRNA gene ...... 25

Cloning, sequencing and phylogeny inference……………………………………... 25

RESULT……………………………………………………………………………...... 27

In-situ characterization of the nitrifying bacterial population in Great lakes………. 27

NOB in Lake Superior: 2010……………………………………………………….. 29

NOB in Lake Superior: 2011……………………………………………………….. 31

AOB in Lake Superior: 2011……………………………………………………….. 33

viii

NOB in Lake Erie: 2011…………………………………………………………….. 35

AOB in Lake Erie: 2011………………………………………………………….. . 37

Bacterial amoA diversity study in Great lakes……………………………………… 39

DISCUSSION……………………………………………………………………………… 44

REFERENCES……………………………………………………………………………. . 49

LIST OF FIGURES

Figure Page

1 Biological Nitrogen Cycle...... 5

2 Basic steps of fluorescence in-situ hybridization (FISH)…………………………… 11

3 General principle of the catalyzed reporter deposition-FISH (CARD-FISH)...... 13

4 Map of the study sites: Lake Superior...... 15

5 Map of the study sites: Lake Erie ...... 16

6 FISH images……………………………………………………………………….. 28

7 Total NOB cells per mL measured from Lake Superior: 2010 ...... 32

8 Total NOB cells per mL measured from Lake Superior: 2011 ...... 34

9 Total AOB cells per mL measured from Lake Superior: 2011 ...... 36

10 Total NOB cells per mL measured from Lake Erie: 2011…...…………………… . 38

11 Total AOB cells per mL measured from Lake Erie: 2011………………………. ... 40

12 PCR amplification of amoA gene sequences from Lake Superior (Station CD1)

and Lake Erie (Station CCB3)………………………………………………………. 41

13 Bacterial amoA colony PCR product from Lake Superior and Lake Erie…………... 42

14 Phylogenetic tree based on amoA sequences from Lake Superior…………………... 43

15 Phylogenetic tree based on amoA sequences from Lake Erie……………………….. 44

LIST OF TABLES

Table Page

1 Lake Superior and Lake Erie sampling stations LAT/LONG………………… ...... 17

2 Oligonucleotide probe sequences used for FISH in this study……………………… 19

3 Standard hybridization Buffer used for FISH in this study…………………………. 22

4 Standard Washing Buffer used for FISH in this study………………………...... 26

1. INTRODUCTION

1.1 Nitrification

Approximately 78.09% by volume of Earth’s atmosphere is constituted of dinitrogen gas (N2), which cannot be used directly by most organisms. Over the past evolutionary history only a few bacteria and archaea have developed the ability to convert dinitrogen into ammonia (NH3). Nitrogen is one the most important elements for life, because it is a major component in proteins and nucleic acids. Nitrogen can exist in numerous oxidation states from the +5 state (nitrate) to -3 state (ammonium and amino-nitrogen), hence nitrogen can act as an electron donor as well as an electron acceptor. The nitrogen cycle gains particular interest in the many environments because nitrogen can be a limiting nutrient to primary producers. The nitrogen cycle consists of several steps that include nitrogen fixation, ammonium oxidation, assimilatory and dissimilatory nitrate reduction, ammonification, denitrification and ammonium assimilation (Fig.1).

The biological process where ammonia is oxidized as an energy source to nitrate is called nitrification (Fig. 1). Although nitrification is carried out by the aerobic obligate chemolithoautotrophs, some methylotrophs and a few heterotrophic fungi and bacteria can also perform this oxidation. In anaerobic niches, ammonia produced by the deamination of amino acids, urea, or uric acids or via dissimilatory nitrate reduction diffuses into the aerobic environment, where it is oxidized by the aerobic nitrifiers. The aerobic nitrifying microbes are often found at the junction between aerobic – anaerobic interfaces, where they capture the ammonia as it diffuses from the anaerobic environments (Strous, M., and M. S.

M. Jetten. 2004)

The nitrification process is carried out in two steps. At first ammonia is oxidized to nitrite. Oxidation of ammonia is performed by the Ammonia-oxidizing Bacteria (AOB) and

Ammonia-oxidizing Archaea (AOA). Nitrosopumilus maritimus, an AOA species from a marine environment that has been brought into pure culture, has been studied extensively regarding its phylogeny (Könneke et al. 2005). Whereas ammonia oxidation is carried out by AOB and AOA, AOA appear to dominate the marine environment (Venter et al. 2004;

Könneke et al. 2005; Schleper et al. 2005) suggesting that AOA of the phylum

Thaumarchaeota, may play a vital role in the ammonia oxidation in marine environments.

AOA and AOB oxidize ammonia via the enzyme ammonia monooxygenase (Amo), yielding hydroxylamine. Hydroxylamine is oxidized to nitrite via hydroxylamine oxidoreductase (HAO) in AOB species, whereas the enzymatic fate of hydroxylamine in

AOA is not fully understood. The next step in nitrification yields nitrate by the oxidation of nitrite by chemolithotropic nitrite oxidizing bacteria (NOB). Together these processes have contributed to the N cycle in Lake Superior. In Lake Superior, the site that is the focus of our work, nitrate levels have increased several folds over the past century with more increases observed in recent years (Sterner et al. 2007; Sterner 2011). Such increases have been linked to in-lake nitrification processes in an imbalanced N cycle (Finlay et al. 2007).

This thesis is focused on understanding the abundance of nitrifying microbes in Lake

Superior.

1.2 Nitrate reduction

Nitrate can be assimilated and incorporated into biomass by plants, fungi, and microbes. The assimilatory reduction of nitrate (Fig. 1) yields ammonium that is

3 incorporated into the amino acid pool. During aerobic respiration microbes are able to take the energy from oxidation of organic material and reduce using nitrate. However, under anaerobic conditions, nitrate can replace oxygen as a respiratory electron acceptor (Blasco et al. 1990). Below is discussed the difference between assimilatory and dissimilatory nitrate reduction.

1.2.1. Assimilatory nitrate reduction

During assimilatory nitrate reduction (Fig. 1) nitrate is taken up by microbes and nitrate is reduced to ammonium by the soluble enzyme nitrate reductase and nitrite reductase. Ammonium is first incorporated into the amino acids glutamine and glutamate.

Most microorganisms prefer to use ammonium directly from the environment, rather than reducing nitrate to ammonium.

1.2.2. Dissimilatory nitrate reduction

Dissimilatory nitrate reduction (Fig. 1) process is divided into two separate pathways. The first pathway is called dissimilatory nitrate reduction to ammonium

(DNRA), using nitrate as a terminal electron acceptor to produce energy via the electron transport chain. The end product of DNRA is ammonium:

- + + - NO3 + 4H2 + 2H → NH4 + 3H2O [∆G = +603kJ/8e transfer]

The reduction of nitrate to nitrite in the electron transport chain is an energy- producing respiratory step. Further reduction of nitrite to ammonium is catalyzed by the

NADH-dependent reductase (energy dependent). During this process, NADH is regenerated to NAD+, and the availability of an NAD+ pool helps in oxidation of carbon

4 substrates. Therefore, this pathway is predominant in carbon-rich environments like stagnant water, sewage sludge, sediment and the rumen.

1.2.3. Denitrification

Denitrification (Fig. 1) is the process where nitrate is reduced to form gaseous nitrogen. The overall reaction for denitrification is as follows:

- + - 2 NO3 + 5H2 + 2H → N2 + 6H2O [∆G = -888kJ/8e transfer]

Denitrification process is involved in four steps. The first step is reduction of nitrate to nitrite. This reduction is catalyzed by a membrane-bound nitrate reductase enzyme. The second step involves the reduction of nitrite to nitric oxide. This reaction is catalyzed by the nitrite reductase. Next, the enzyme nitric oxide reductase is catalyzing the conversion of nitric oxide to nitrous oxide. The fourth enzyme in the pathway is nitrous oxide reductase, which catalyzes the conversion of nitrous oxide to dinitrogen gas.

Fig.1. The biological nitrogen cycle (Ward, B. B. et al. 2011, Nitrification).

1.3 Nitrifying microorganisms

In 1890 Winogradsky discovered chemolithotrophic bacteria, and isolated ammonia- oxidizing bacteria (AOB) and nitrite-oxidizing bacteria (NOB). For a century or more, both AOB and NOB were thought to be the only nitrifying taxa which are capable of autrotrophic nitrification. Ammonia oxidizing bacteria (AOB) contain a conserved functional gene (amoA) that encodes the large subunit of the first enzyme ammonia monooxygenase (AMO), and this gene has been employed as phylogenetic marker for

AOB. However, more recent metagenomic studies of marine crenarchaeota sequences revealed that they also posses amoA (Venter et al. 2004; Treusch et al. 2005) which has radically changed our view of the nitrification process in marine systems.

1.3.1 Ammonia-oxidizing Bacteria

Ammonia-oxidizing bacteria are generally obligate chemolithoautotrophs, meaning that AOB have the ability to use ammonia as source of energy and carbon dioxide as a sole source of carbon (Hooper et al. 1997). Based on genome sequences of all the strains isolated from the terrestrial and freshwater environments, it has shown that most AOB belong to a single evolutionary group within the β-subclass of the class Proteobacteria, although some gamma-proteobacteria are AOB. The betaproteobacteria (e.g. Nitrosomonas europaea, Nirosomonas eutropha, and Nitrosospira multiformis) and gamma- proteobacteria (e.g. Nitrosococcus oceani) may suggest that they share from a single chemolithoautotrophic ammonia-oxidizing ancestor. The genomes of AOB have shown that they contain special enzymes to perform the oxidation of ammonia. Conversion of ammonia to nitrite by the AOB under aerobic condition involves in two-step process. A

7 membrane-bound, multisubunit enzyme, ammonia monooxygenase (AMO) catalyzes the oxidation of ammonia to hydroxylamine (NH2OH). A periplasm-associated enzyme, hydroxylamine oxidoreductase (HAO) catalyzes the oxidation of hydroxylamine to nitrite.

The overall conversion is given below.

+ - AMO HAO - + - 2H + NH3 + 2e + O2 NH2OH + H2O NO2 + 5H + 4e

In the first reaction, one oxygen atom is incorporated into hydroxylamine and other is reduced to water. In this overall conversion four electrons are released and channeled through cytochromes c554 and cm552, to the ubiquinone pool of the electron transport chain.

Whereas, the metabolism of the AOA is less well understood, their abundance in aquatic and soil environments reveal their importance in N cycle, especially in environments where free ammonium is scarce. Indeed the Km for ammonium oxidation is 1-2 orders of magnitude lower than for AOB (Martens-Habbena et al. 2009)

1.3.2. Nitrite Oxidizing Bacteria

- Nitrite oxidizing bacteria (NOB) catalyze the oxidation of nitrite (NO2 ) to nitrate

- (NO3 ). This oxidation process is the next step of nitrification in the biogeochemical nitrogen cycle. NOB strictly depends on ammonia oxidizers that convert ammonia to nitrite. NOB are phylogenetically heterogenous aerobic chemolithotrophs. They are divided into several genera: Nitrobacter, Nitrococcus, Nitrospira, and Nitrospina. A membrane- bound enzyme, nitrite oxidoreductase (Nxr) catalyzes the oxidation of nitrite to nitrate.

Nitrite oxidoreductase consists of two subunits: one alpha subunit (large) and one beta subunit (small). The alpha subunit has the active site adjacent to a molybdopterin cofactor.

The beta subunit has a multiple iron-sulfur cluster which transports electrons between the enzyme and the membrane-bound electron-transport chain (Kisker et al. 1998).

The oxidation of nitrite to nitrate is given below:

- Nxr - 2NO2 + O2 2NO3 + Energy

Virtually all the information about nitrite oxidation is derived from the studies of limited isolates of Nitrobacter species. However from the recent studies it has shown that

Nitrospira is also a dominant NOB in many environments including soil and wastewater treatment plants (Juretschko et al. 1998).

1.4 The Laurentian Great Lakes and the nitrogen cycle

Lake Superior is the largest freshwater lake in the world by surface area and it is the third largest lake in the world by volume, comprising 10% of the world’s fresh water. The lake is the deepest of the Laurentian Great lakes, having a maximum depth of 404 m. Lake

Superior is also characterized as one of the most oligotrophic lakes in the world (Munawar et al. 2009). Phosphorus and nitrogen concentrations are two biogeochemical parameters considered to be extremes in Lake Superior. Lake Superior has increased in nitrate level 5 fold over the past century (Sterner et al. 2007). It also been found that total phosphorus

(TP) concentration in Lake Superior is extremely low (Sterner 2011). This has yielded a major stoichiometric imbalance of N:P in the lake which may be of importance in structuring the planktonic community in the lake. The ratio of TP:TN has been measured between 30/0.08 = 375 and 32/0.08 = 400 in Lake Superior (Sterner 2011). The major cause of the increase nitrate level in Lake Superior is unknown, but the source of N is

9 largely from in-lake sources, indicating an unbalanced microbially driven nitrogen cycle

(Finlay et al. 2007).

By contrast, Lake Erie is shallower and divided mainly into three separate basins.

Each of these basins, due to their very different limnological and physical characteristics, can be actually treated as three different lakes. The western basin is on average about 7.3 meters deep with a maximum depth of 19 meters. The central basin is averages an 18.5 meters deep with maximum depth of 25 meters. The eastern basin of Lake Erie averages about 24 meters deep with a maximum of 64 meters. Lake Erie is the shallowest of the

Great Lakes; it warms quickly in spring and summer and cools rapidly during fall. The shallowness of the basins, the warmer temperature of the water, and nutrient inputs from urban and agricultural sources make it most biologically productive of the Great Lakes.

The major source of total inflow (about 80%), into Lake Erie is the Detroit River whereas the major source of nutrient inputs (especially phosphorus) to the western basin of Lake

Erie is the Maumee River delivering agricultural runoff (Baker and Richards 2002).

Moreover, high nutrient concentration and high turbidity due to sediment plumes support algal growth in Lake Erie (Moorhead et al. 2008).

1.5 Fluorescence in situ Hybridization (FISH)

The objectives of this thesis are to employ methods to detect and enumerate nitrifying microbes in the Great Lakes. Fluorescence in situ Hybridization (FISH) is a

DNA-based tool developed in early 1980s, used in some applications to identify and enumerate specific microbial community members in environmental samples. In this technique a fluorescently labeled probe are used which will hybridize to a ribosomal RNA

10 that contains its complementary sequence. Fluorescence microscopy is used to detect the positively hybridized cells from the fluorescence labeled probes. FISH of bacteria was developed more than two decades ago (Giovannoni et al., 1988; DeLong et al., 1989;

Amann et al., 1990b) and considered as a major breakthrough in microbial ecology.

Fluorescently labeled oligonucleotide probes of 15-30 nucleotides capable of hybridizing to rRNA of desired taxa are employed to detect the microbe(s) of interest.

FISH begins with fixation of the sample containing the target cell (Fig. 2). Fixation of the target cell gives structural stabilization to prevent lysis of the cell during hybridization. At the same time, whole cell fixation also permeabilizes the cell wall to allow access of the oligonucleotide probes to its target rRNA. Repeated washing steps help to remove the unbound probes and leave only probe-rRNA pairs. Only cells having the target sequence of their rRNA will be fluorescent. Finally, cells can be viewed under epifluorescence microscopy and counted.

In this research, FISH with oligonucleotide probes are used to detect the bacterial nitrifying community, i.e. ammonia-oxidizing bacteria and nitrite-oxidizing bacteria which are involved in the nitrification of the lakes.

Fig. 2. Basic steps of fluorescence in-situ hybridization (FISH) (Amann and Fuchs

2008).

Samples are fixed and the cell membrane permeabilized. Oligonucleotide probes are added to the sample and allowed to hybridize to the target cells. Subsequent washing removes the unbound probes leaving only those probe-rRNA pairs intact. Finally samples are ready for single-cell identification and enumeration by epifluorescence microscopy.

1.5.1. Catalyzed Reporter Deposition-FISH (CARD-FISH)

CARD-FISH, or catalyzed reporter deposition-FISH is a method in which the hybridization signal can be amplified to yield higher sensitivity (Amann and Fuchs 2008).

Signal amplification is dependent on a horseradish peroxidase (HRP) activity linked to the oligonucleotide probe resulting in the deposition of the fluorescently labeled tyramide molecules (Fig.3).

Amplification of the signal is obtained by the conjugation of multiple fluorescent tyramide molecules by horseradish peroxidase. Activated tyramide molecules bind to the target cells permanently, therefore give a strong and stable fluorescent signal. For the CARD-FISH procedure, samples must be embedded in agarose to prevent significant cell loss in washing and enzyme treatment during hybridization (as described in 1.5 above).

1.6 Objectives of this Thesis

Given the unexplained increase in nitrate in Lake Superior and the importance of AOA,

AOB and NOB in maintaining the nitrogen cycle, I employed CARD-FISH to detect key

NOB in Lakes Superior and Erie to help characterize the nitrifying community during both the stratified (summer) and isothermally mixed periods. Furthermore, I examined the diversity of the Lake Superior and Erie AOB community by sequence analysis of amoA genes. Due to the low diversity of other major microbial texa in Lake Superior (Ivanikova et al. 2007), I hypothesize that the AOB present will represent small number of distinct

AOB species.

Fig. 3. General principle of catalyzed reporter deposition-FISH (CARD-FISH)

(Amann and Fuchs 2008).

Signal amplification is obtained by the peroxidase activity. HRP-labeled probes yield the deposition of fluorescently labeled tyramide molecules.

2. MATERIALS AND METHODS

2.1 Sampling site and stations

Water samples were collected from the Lake Superior stations WM and CD1 during May, August, October 2010 and April 2011. Samples were collected at different depths from the surface to 245m of the lake at CD1. Core sampling was also done at this site. During July 2011, a seventeen day research cruise was undertaken in collaboration with University of Minnesota, during which water samples were collected from Lake Superior (Fig. 4), Lake Erie (Fig. 5). Lake Superior sampling stations are

EL0, EL2, CD1, Sleeping Giant, Whitefish Bay, Black Bay, and Michipicoten. Lake

Erie sampling stations are CCB3, 1326, 880(86), 23, 91M, and Maumee Bay. The lat/longs of each station are provided in Table 1.

Fig. 4. Location of the Lake Superior sampling stations in May, August, October 2010 and April, July 2011.

Fig. 5. Location of the Lake Erie sampling stations in July 2011.

Table 1. Lake Superior and Lake Erie sampling stations LAT/LONG.

Freshwater environmental sampling stations LOCATION STATION LAT. LONG.

Lake Superior CD1 47.00800 -91.43200

WM 47.33300 -89.80000

EL0 47.75000 -87.50000

EL2 47.00000 -85.50000

Whitefish bay 46.66700 -84.83300

Michipicoten 47.12300 -84.65500

Sleeping Giant 48.22282 -88.90600

Black Bay 48.50000 -88.60766

Lake Erie 880(84) 41.91700 -81.63300

CCB1326 41.73300 -81.69800

91M 41.84100 -82.91700

St. 23 42.30000 -79.53000

CCB3 42.10090 -81.27714

2.2 Catalyzed Reporter Deposition-Fluorescence in-situ Hybridization

(CARD-FISH)

2.2.1. Sample processing

Water samples were fixed with for 1 hour in particle-free formaldehyde solution

(final concentration 2% [vol/vol]) and 5-10 ml of fixed water samples were filtered through white polycarbonate membrane filters (diameter 2.5 mm, pore size 0.1 µm; type

GTTP 2500; Millipore Corporation, Billerica, MA) and rinsed with double-distilled water

(ddH2O). The air-dried filters were stored at -20˚C until further processing (Sekar et al.

2003).

2.2.2. Fluorescently labeled probes

The protocol specified by Sekar et al. (2003) and Pernthaler et al. (2002) was routinely followed for CARD-FISH. HRP-labeled oligonucleotide probes were used for detection of all ammonia oxidizing bacteria and nitrate oxidizing bacteria. For all ammonia oxidizing bacteria probe Nso1225 (All betaproteobacterial ammonia-oxidizing bacteria except Nitrosococcus mobilis) and Nsm156 (Nitrosomonas spp. and

Nitrosococcus mobilis) FISH probes were used. In addition, FISH probes NIT3

(Nitrobacter spp) and Ntspa712 (Nitrospira spp.) were used for the counts of total nitrate oxidizing bacteria. Control non-hybridizing probe NON338 was used each time as a negative control. All probes were labeled at their 5’ end with HRP. Sequences and references for all oligonucleotide probes used in this study are given in Table 2. All filters hybridized with CARD-FISH probes were counterstained with DAPI.

Table 2. Oligonucleotide probe sequences used for FISH in this study

Probe Sequence (5´-3´) Specificity Reference

Nso1225 CGCCATTGTATTACGTGTGA All β- Mobarry et al.

proteobacterial 1996

ammonia

oxidizing bacteria

except

Nitrosococcus

mobilis

Nsm156 TATTAGCACATCTTTCGAT Nitrosomonas Mobarry et al.

spp.and 1996

Nitrosococcus

mobilis

NIT3 CCTGTGCTCCATGCTCCG Nitrobacter spp. Wagner et al.

1996

Ntspa712 CGCCTTCGCCACCGGCCTTCC Nitrospira spp Alexander et al.

2007

NON338 ACTCCTACGGGAGGCAGC Negative control Wallner et al.

1993

2.2.3. Permeabilization

Cell wall permeabilization was achieved by dappinng both sides of each filter into low gelling point agarose (0.1% [wt/vol] in MQ water) to avoid cell loss (Pernthaler et al.

2002). Next, filters were placed face-down onto a parafilm covered clean glass slide for 30 min at 37˚C. Filters were dehydrated in 96% (vol/vol) for 2 min, followed by incubation in a fresh lysozyme (Sigma-Aldrich) solution in a petri dish (10 mg ml-1, dissolved in

0.05M EDTA, pH 8.0; 0.1M Tris-HCl, pH 8.0) for 60 min at 37˚C. The filters were washed with excess MQ water. To inhibit the endogenous peroxidase activity, filters were immediately incubated in 0.01 M HCl for 10-20 min at 20˚C. Following washing in MQ water, dehydration with 96% ethanol, filters were stored at -20˚C until further processing (Pernthaler et al. 2001).

2.2.4. Hybridization

Polycarbonate filters were cut into five sections for FISH and whole-cell in situ hybridizations were performed using the HRP-labeled probes Nso1225 (all betaproteobacterial ammonia-oxidizing bacteria except Nitrosococcus mobilis), Nsm156

(Nitrosomonas spp. and Nitrosococcus mobilis), NIT3 (Nitrobacter spp), Ntspa712

(Nitrospira spp.), and NON338 (negative control). For probes NON338, Nso1225, a formamide concentration of 35% was used. For other probes Nsm156, NIT3 and Ntsp712, a formamide concentration of 5%, 40% and 50% were used respectively. Filter sections were hybridized with 5´-HRP labeled oligonucleotide probes as described previously

(Pernthaler et al. 2002). Hybridization buffer (Table 3) used for probes NON338 and

Nso1225 contained 5 M NaCl, 1M Tris-HCL, pH 8.0; 20% (wt/vol) sodium dodecyl sulfate (SDS), 35% (vol/vol) formamide, 10% blocking reagent (Roche, Basel) and 10% dextran sulfate (wt/vol). A 5% (vol/vol), 40% (vol/vol), and 50% (vol/vol) formamide concentration were used for probes Nsm156, NIT3, and Ntspa712 respectively.

The blocking reagent was prepared in maleic acid buffer (100 mM maleic acid, 150 mM NaCl, pH 7.5). Pretreated filter sections (i.e., preparations subjected to permeabilization) were placed in a 0.5 ml reaction vial and mixed 400µl of hybridization buffer with 5µl working probe solution (50 ng DNA µl-1). Each filter section was immersed in hybridization solution and incubated with shaking in a hybridization oven at

46˚C for 2-3 h. All filter sections were collected from the reaction vial and incubated with

50 ml prewarmed washing buffer (Table 4) at 48˚C for 10 min. Washing buffer for the probes was 5 M NaCl, 0.5 M EDTA (pH 8.0), 1.0 M Tris-HCl (pH 8.0), and 20% (wt/vol) sodium dodecyl sulfate.

Table 3. Standard hybridization Buffer used for FISH in this study

Stock reagent Volume Final concentration in

Hybridization buffer

5M NaCl 360µl 900mM

1 M Tris-HCl 40µl 20mM

Formamide % depending on probe

Distilled water 2 ml

20% SDS 2 µl 0.01%

10% Dextran sulfate

Table 4. Standard Washing Buffer used for FISH in this study

Stock reagent Volume Final concentration in

Hybridization buffer

5 M NaCl Concentration depending on

% formamide Buffer (see

table A in appendix)

1 M Tris-HCl 1 ml 20mM

0.5 M EDTA 0.5 ml 5 mM

Distilled water add to a final volume of 50

20% SDS 25 µl 0.02%

2.2.5. Tyramide amplification

After washing, all filter sections were moved in 50 mL of 1X phosphate-buffered saline (PBS, pH 7.3) and incubated at 15 min at room temperature. Excess liquid was blotted on a piece of blotting paper and the filter immersed in substrate mix containing 1 part of tyramide-Cy3 (1 mg ml-1) and 100 parts of amplification buffer (NEN Life Science

Products, Boston, MA.) and incubated at 46˚C for 45 min in the dark. The substrate mix contained 1X PBS (pH 7.5) and 0.15% H2O2. To remove excess liquid, the filter sections were placed on blotting paper and incubated in 1X PBS for 5 to 10 min at room temperature in the dark. The filters were next washed thoroughly in MQ water, followed by 96% ethanol for 2 min and air dried. Last, the filter sections were placed on a glass slide and mounted with 4´,6´-diamidino-2-phenylindol (DAPI, final concentration 1µg ml-

1) . Before microscopy, slides could be stored at -20˚C for several days without loss of signal intensity. All preparations were done in triplicate.

2.2.6. Microscopy

All filter sections were embedded in AF1 mounting solution (Citifluor Ltd.,

Leicester) and visualized with a Zeiss Axioplan microscope (Carl Zeiss, Jene, Germany), equipped with an HBO 100-W Hg vapor lamp. The appropriate filter sets for the tyramide-

Cy3 signal and the DAPI signal were used, equipped with 100 X Plan Apochromat objectives. Tyramide-Cy3 stained cells were counted first in one microscope field followed by the visualization of the DAPI-stained cells. At least 100 cells were counted in more than 10 randomly selected fields across the filter sections. All the images from

24 tyramide-Cy3 and DAPI- stained cells were taken by a SPOT camera mounted on the

Axioplan II microscope and processed by a PC-based image acquiring software.

2.3 Polymerase chain reaction (PCR)

2.3.1. PCR amplification of the amoA gene fragment

DNA was extracted from Lake Superior station CDI (150m) and Lake Erie station

CCB3 (20m). Four liters of water from both the stations were passed through a 0.22 µm

Sterivex cartridge (Millipore Corporation, Billerica, MA) to collect biomass.

Environmental DNA from the sterivex cartridges was then extracted using the QIAGEN

Sterivex DNA isolation Kit (MO BIO Laboratories, Inc.). For PCR amplification of the

AOB amoA gene fragment, were performed by using the primer pair amoA-1F (Rotthauwe et al. 1997) and amoA-r NEW (Hornek et al. 2006). The reaction mixtures were consisting of 15pM concentration of each primer and PCR master mix in a total volume of 50 µl. The

PCR master-mix was prepared containing MQ water, 5X Go Taq buffer, dNTP mix

(10mM), TAQ polymerase (5U µl-1). Thermal cycling was carried out with an initial denaturation step at 94˚C for 5 min followed by 40 cycles of denaturation ast 94˚C for 1 min, annealing at 53˚C (amoA-1F at 55˚C and amoA –r NEW at 63˚C) for 1 min, and elongation at 72˚C for 1 min. Cycling was completed by a final elongation step at 72˚C for

10 min. Positive controls containing purified DNA from lake water samples were included in all the amplification sets along with a negative control (lacking DNA).

2.3.2. PCR amplification of the 16S rRNA gene

PCR for all isolates were performed by using the 16S r-RNA primer pair 616F and

630R (Juretschko et al. 1998). The reaction mixtures contained of 15 pM primers and PCR master mix in a total volume of 50 µl. The PCR master-mix was prepared as above.

Thermal cycling was performed with an initial denaturation step at 94˚C for 30 s, followed by 30 cycles of denaturation at 94˚C for 15 s, annealing at 48˚C (616F at 55˚C and 630R at 50˚C) for 20 s, and elongation at 72˚C for 30 s. Cycling was completed by a final elongation step at 72˚C for 1 min. Positive controls containing purified DNA from lake water samples were included in all the amplification sets along with negative control (no

DNA added). The amplified PCR products were purified and examined using the standard protocol. All the sequences and the references of primers are given in the Table 5.

2.3.3. Cloning, sequencing and phylogenetic analysis

All 16S rDNA and amoA PCR products were purified using an agarose gel extraction kit and ligated according to the manufacturer’s recommendations into the cloning vector (pCR4) supplied with the TOPO TA cloning kit (Invitrogen Corp., San

Diego, Calif.). Sanger didecay sequencing was performed using the T3 primer. After sequencing and appropriate BLAST searches (Altschul et al.1990), phylogenetic analysis of the bacterial amoA sequences was performed using MEGA 4.1 software (Kumar et al.

2008). Alignment of the 16S rDNA sequences was made using CLUSTAL-W pairwise and multiple alignment tools. Bootstrap values were set to at least 100 replicates.

Phylogenetic trees based on comparative analysis of the amoA gene fragment were computed by performing neighbor-joining analysis.

Table 5. PCR Primers and their sequences used in this study

Target organism Primer set Sequences (5’-3’) Reference

used

amoA-1F GGGGTTTCTACTGGTGGT Rotthauwe et β-proteobacterial al. 1997 amoA amoA-r CCCCTCBGSAAAVCCTTCTTC Hornek et al. NEW 2006

All Bacterial 16S 6116F AGAGTTTGATYMTGGCTCAG Juretschko et rDNA (ammonia al. 1998 and nitrite oxidizers) 630R CAKAAAGGAGGTGATCC Juretschko et al. 1998

3. RESULT

3.1 In-situ characterization of the nitrifying bacterial population in Great lakes

The total bacterial nitrifying consortium in Lake Superior and Lake Erie was analyzed by fluorescence in-situ hybridization with a set of specific oligoucleotide probes

(Table 2). In lakes Superior and Erie, more than 99% of the AOB were detected with probe

Nso1225. However, a few bacterial cells (1%) were detected by

Nitrosomonas/Nitrosococcus probe Nsm156. Fluorescence in situ hybridization with NOB probe NIT3 revealed significant number of Nitrobacter-like cells to be present in the samples analyzed. However, fewer of Nitrospira-like cells were detected with the probe

Ntspa712 in the samples analyzed. Hybridization of the two samples with probe NIT3 and

Ntspa712 demonstrated the abundance of total Nitrobacter-like cells.

FISH images are provided in the Fig. 6.

Fig. 6. Fluorescence microscopic images of ammonia oxidizing β-proteobacteria

(Nitrosospira-like bacteria) hybridized with probe Nso1225 (A) and Nitrobacter-like bacteria hybridized with probe NIT3 (B) and the respective DAPI counterstain (C and

D).

3.2 NOB in Lake Superior: 2010

Total NOB from Lake Superior were detected with probes NIT3 and Ntspa712.

Samples taken from depth profiles during the stratified period (August and October 2010) and isothermal mixing (May 2010, April 2011) revealed differences in surface vs. deep populations (Fig. 7a and 7b).

During the stratified period, fewer total NOB cells (≤104 cells ml-1) were seen on the surface in both stations WM (Fig. 7a) and CDI (Fig. 7b). However, in May 2010 samples from both WM and CDI station NOB were found throughout the water column. Filters probed with probe Nso1225 and Nsm156 reveled low numbers of AOB in all samples (<10 mL-1), and only 3 out of 41 samples yielded counts higher than 10 mL-1. This is consistent with parallel studies showing that the ammonia oxidizing community is dominated by

Archaea (M. Mukherjee, in preparation; Small et al. 2013 in press).

Total cells per mL 0 10000 20000 30000 40000 50000 60000 0

20 Total NOB WM May 2010 40 Total NOB WM Aug. 2010

60 Total NOB WM Oct. 2010 80

100 Total NOB WM Apr. 2011 Depth (m) Depth

120

140

160

180

Total cells per mL 0 10000 20000 30000 40000 50000 60000 70000 0

50 Total NOB CDI May 2010

100 Total NOB CDI Aug. 2010

150 Total NOB CDI Oct. 2010

Depth (m) Depth Total NOB CDI Apr. 2011 200

250

300

Fig. 7. Total NOB cells per mL measured from the Lake Superior in May, August,

October 2010 and April 2011. a) Station WM, b) Station CDI.

3.3 NOB in Lake Superior: 2011

The total number of NOB cells per mL during stratification in July 2011 was found to be much higher than 2010 water samples. The average number of total NOB cells in

2011 water samples from different stations was found to be >104 cells mL-1 (Fig. 8). Station

CDI showed higher numbers of both NOBs (Nitrobacter sp. and Nitrospira sp.) at all depths compared to EL0 and EL2. In station EL0 showed both Nitrobacter sp. and Nitrospira sp only at depth. No NOB were detected on 5m, 10m, and 30m samples. At station EL2, both

Nitrobacter sp. and Nitrospira sp were present only in the 160m and 145m samples. In all other samples from station EL2 no NOB were found.

Station CDI, EL0, and EL2 yielded the higher number of NOB detected to date. NOB were far more abundant at depth that at the surface. During stratification, the NOB appear to form a linear depth profile reflecting the distribution of AOA (M. Mukherjee Ph.D dissertation).

Total cells per mL

0 5000 10000 15000 20000 25000 0

100 Total NOB CDI

Depth (m) Depth 150 Total NOB EL0

Total NOB EL2 200

250

300

Fig. 8. Total NOB cells per mL measured from the Lake Superior in July 2011.

Stations: CDI, EL0, and EL2.

3.4 AOB in Lake Superior: 2011

Whole-cell in situ hybridization was done on the water samples from Lake Superior with the oligonucleotide probe set (Table 2). The AOB detected were mostly Nitrosospira- like cells. Only about 1% of the AOB-positive were estimated to be Nitrosomonas-like or

Nitrosococcus mobilis. The majority (>97%) of the AOB-positive cells were Nitrosospira- like. Unlike the 2010 water sample, AOB were detected in 2011 water samples from Lake

Superior. Stations CDI, EL0, and EL2 in Lake Superior showed significant number of AOB

(Fig. 9). The average number of total AOB cells in 2011 water samples from different stations was found to be ≤103 cells mL-1, although these numbers remain below the average

AOA abundance of 5x104 cells mL-1 (M. Mukherjee, Ph.D dissertation).

AOB-positive cells were detected in station CDI, EL0, and EL2. Ammonia oxidizing bacteria were found more at depth and less at the surface. Station CDI showed maximum number of AOB. These microbes were found at depths 50m, 100m, 150m, 200m, and 245m.

In Station EL2 AOB detected at 60m, 100m, 150m, 185m, and 195m depths. However, in station EL0 AOB were only found at 100m and 160m.

Total cells per mL

0 2000 4000 6000 8000 10000 12000 0

Total AOB CDI 100

150 Total AOB EL0 Depth Depth (m)

200 Total AOB EL2

250

300

Fig. 9. Total AOB cells measured from the Lake Superior in July 2011. Station CDI,

EL0, and EL2.

3.5 NOB in Lake Erie: 2011

During July 2011, water samples were collected from several Lake Erie stations

(CCB3, 880(84), 23) of Lake Erie, and analyzed as above by CARD-FISH. Total NOB cells mL-1 in Lake Erie were lower compared to Lake Superior water samples. The average NOB cells per ml in Lake Erie were approximately 103 cells ml-1 (Fig. 10). Overall the NOB abundance was restricted to deeper waters in the stratified central basin (880) and eastern

(23) basin. Both Nitrobacter sp. and Nitrospira sp. were present in all depth in station

880(84). Highest number of NOB (≥105 cells ml-1) were found at central basin offshore station 880(84). At station CCB3 (central basin station) only Nitrobacter sp was detected on depths 15m, 18m, and 22m. However, only Nitrobacter sp was present in eastern basin station EC23. NOB cells were found on depths 10m, 20m, 30m, 42m, 50m, and 60m in station EC23. Interestingly no AOB and NOB were found in station CCB1326.

Total cells per mL

0 10000 20000 30000 40000 0

20 Total NOB 880(84)

30 Total NOB EC23 Depth (m) Depth

40 Total NOB CCB3

Fig.10. Total NOB cells per mL measured from the Lake Erie in July 2011. Stations:

880(84), EC23, and CCB3.

3.6 AOB in Lake Erie: 2011

During July 2011, water samples were collected from Lake Erie eastern basin (23) and western basin stations CCB3 and 880(84).The probe set (Table 2) for AOB were used to analyze water samples by fluorescence in-situ hybridization. Total AOB cells per mL-1 in

Lake Erie were higher compared to Lake Superior water samples (July 2011) (Fig. 11).

Overall, as seen with NOB the AOB abundance was largely restricted to deeper water. AOB were present in all depth in station 880(84). Again similar to the NOB counts, total AOB cells in station 880(84) were found at higher numbers (≥104 cells ml-1). Whereas in station

EC23, fewer AOB were detected than at 880(84), and only at depths of 10m and 20m.

Notably no AOB were detected at station CCB3.

Total cells per mL

0 5000 10000 15000 0

Total AOB 880(84)

30 Depth (m) Depth Total AOB EC23 40

Fig.11. Total AOB measured from Lake Erie in July 2011. Station: 880(84), EC23.

3.7 Bacterial amoA diversity study in Great lakes

Environmental DNA samples from the July 2011 cruise were extracted from Lake

Superior (CDI 150m) and Lake Erie (CCB3 20m). The amoA amplification experiments were performed with the specific primer set (Table 5), yielding the expected 491-bp amoA fragment from the environmental samples (Fig. 12). The amplicons were excised and purified from the agarose gel for subsequent cloning. The colony PCR products retrieved from Lake Superior and Lake Erie were used to generate an amoA gene library (Fig.13). A total of 200 clones derived from both water samples were randomly selected for comparative sequence analysis. All of the sequences obtained from both lakes were highly similar to each other (≥ 99% sequence similarity across the library). All putative AOB identified in the clone libraries were members of the β subdivision of the class

Proteobacteria. Nucleic acid sequence analysis of the both amoA fragments reveled that both the sequences clustered with corresponding amoA sequences of Nitrosospira-like clade (Fig.

14 and Fig. 15).

Fig. 12. PCR amplification of amoA fragment from Lake Superior

(CDI) and Lake Erie (CCB3). PCR amplification was performed with primers amoA-1F amoA-r NEW.

Lanes: 1: 100 bp DNA ladder

2: Lake Superior

3: Lake Erie

4: control

Fig. 13. Bacterial amoA colony PCR products from Lake Superior (A) and Lake Erie

(B) amoA clones.

Fig. 14. Neighbor-joining phylogenetic tree of amoA sequences obtained from Lake

Superior station CD-I from 150m. (Generated in MEGA4). Clones from this study are identified with the closed circle and the numbers of clones are given in parentheses. As an outgroup, the Nitrosomonas europaea amoA sequence and the ammonia-oxidizing archaeal amoA sequence of Nitropumilus maritimus were used.

LE7

Fig. 15. Neighbor-joining phylogenetic tree of amoA sequences obtained from Lake

Erie station CCB3 from 20m. (Generated in MEGA4). Clones from this study are identified with a closed circle. As an outgroup, the Nitrosomonas europaea amoA sequence and the ammonia-oxidizing archaeal amoA sequence of Nitropumilus maritimus were used.

DISCUSSIONS

Among the Great Lakes, Lake Superior and Lake Erie are two distinctly different lakes, despite the fact that they are both members of the same connected waterway. Lake

Superior is oligotrophic, characterized as one of the most oligotrophic lakes in the world

(Munawar et al. 2009). Phosphorus and nitrogen concentrations are two main biogeochemical parameters in Lake Superior. It has very high levels of dissolved nitrate

(26 µM) and nanomolar levels of dissolved phosphate. Lake Erie, in contrast is mesotrophic, consisting of three basins: the western, central, and eastern. There exists a trophic gradient from the west to east of the lake. The western basin is mostly eutrophic due to very high nutrient levels. The central basin is mesotrophic, whereas the eastern basin of the lake is a low-nutrient oligotrophic environment. As a result, Lake Erie can actually be considered as three different water bodies due to the major differences in trophic states from west to east. In this study, I have examined the nitrifying bacterial community in these two lakes, providing the first overview of the abundance and diversity of these organisms.

This is the first study on Lake Superior and Lake Erie focusing on understanding the nitrifying microbial community structure, contributing to other studies dealing with how these organisms function in the nitrogen cycling in these lakes.

Over the past century, the nitrate concentration in Lake Superior has increased five fold (Sterner et al. 2007). Finlay et al. (2007) confirmed that this high level of nitrate is

45 mostly coming from in-lake biological nitrification processes, and not due to atmospheric deposition. Overall, the extreme N:P ratio in the lake constrains productivity so that on average the chlorophyll concentration averages 1µg L-1 (Sterner 2011). Average nitrification rate in Lake Superior was determined to be 24.1 nm N L-1 d-1 (Small et al.

2013, in press). Hence it is very important to study and characterize the nitrifying community structure (both bacteria and archaea) that is responsible for this abnormal nitrate increase. Lake Erie is a good example of such an eutrophic lake where nutrient imbalances have caused major eutrophication, leading to the occurrences of the annual harmful algal blooms. Therefore, the objective of this thesis is to provide measures of abundance of ammonia-oxidizing bacteria (AOB) and nitrite-oxidizing bacteria (NOB) in

Lake Superior and Lake Erie as well as the diversity of AOB in these lakes. These parameters will inform additional studies aimed at understanding trophic state and physical factors including light and temperature gradients, in structuring the nitrifying communities in these lakes.

In general, the CARD-FISH results indicate that between the stratified months of July and October, AOB and NOB are restricted to the deeper water column in the lakes. They are typically excluded from the photic zone or the surface waters in both the lakes (Fig. 8; Fig.

10; Fig. 11). This observation parallels the distribution of ammonia-oxidizing archaea

(AOA) in these lakes (Small et al. 2013; Mukherjee et al., in preparation), and reflects the light inhibition of ammonia oxidizers (Merbt et al. 2012, French et al. 2012). Since NOB derive energy from AOA/AOB-generated nitrite, it is unsurprising that NOB abundance in general follows the profile of AOB. Additionally, it has been suggested that the lack of

AOA/AOB at the surface might also be influenced by the increased competition for

46 ammonium with heterotrophic bacteria (Small et al. 2013 in press), although this has not been tested experimentally. By contrast, during isothermal mixing as observed in May 2010 and April 2011 samples, the nitrifyers are distributed throughout the water column, with no significant differences seen between the surface vs. the deep water column samples (Fig.7).

Regarding the ammonia oxidizers, AOA are dominant in Lake Superior, and AOB abundance fell below the detection limits, amounting to less than 10 cells per mL in 2010 samples. By contrast, AOB are abundant in Lake Erie, especially at the mesotrophic central basin station 880(84). AOB number in Lake Erie were measured as high as >104 per mL.

The lower numbers of AOB detected at oligotrophic eastern basin station (EC23) indicates that lower nutrient environments may favor AOA over AOB, consistent with the observation that AOA are better scavengers for scarce ammonium (Martens-Habbena et al.

2009). Furthermore, these results are in agreement with the abundance and diversity of sediment AOA and AOB from Lake Superior and Lake Erie, in which AOA dominate in

Lake Superior, and AOB outnumber AOA in sediments from the Lake Erie western basin

(Annette Bollmann, personal communication).

PCR studies and phylogenetic analyses of Lake Superior AOB indicate a population of very low diversity (Fig. 13). All of the 107 Lake Superior partial amoA sequences obtained from Lake Superior Station CD1grouped into a freshwater Nitrosospira cluster, indicating a very low diversity of these organisms in the lake. These results reflect a similar low diversity with the amoA sequence study of ammonia oxidizing archaeal population of the lake, where only one population of the ammonia oxidizing archaea belonging to the freshwater Group I.1a cluster have been found to dominate in Lake Superior stations

(Mukherjee et al., in preparation). Overall, these data are consistent with other studies

47 showing that other abundant microbes of the lake including cyanobacteria and actinobacteria are restricted to a few specific phylogenetic clusters (Ivanikova et al. 2007, Sharma et al.

2009). The cold, oligotrophic low phosphate environment may select for key ecotypes that are well adapted to the extreme chemical and physical characteristics of the lake. Although preliminary, the relatively smaller number of Lake Erie central basin amoA clones also suggested a low diversity of AOB (Fig. 14). Most of the clones, although forming different branches, grouped with the Freshwater Nitrosospira-like clade. More clones obtained from

Lake Erie will give a clearer view of the diversity of AOB in this lake, and their relatedness to the Lake Superior AOB.

Further studies directed towards phylogenetic analysis of amoA clones obtained from various Lake Erie stations obtained from different depths may provide larger insights into the diversity of these organisms in Lake Erie. As far as this study is concerned, it is clear that Lake Superior AOB are of very low diversity, whereas the diversity of Lake Erie AOB is less clear due to the low number of amoA sequences analyzed.

Hence, combined with data by M. Mukherjee (Mukherjee dissertation and personal communication), we can conclude from this study that in Lake Superior, ammonia-oxidizing archaea (AOA) are the dominant nitrifiers compared to the ammonia oxidizing bacteria

(AOB). In Lake Erie, the scenario is different, where we see a higher abundance and diversity of the AOB, whereas the AOA are found to be minor population. This is assumed to be due to the differences in ammonium concentrations between Lake Superior and Lake

Erie, since because the AOA thrive better in low ammonium concentrations, whereas the

AOB are found to be abundant in a niche with higher ammonium concentrations. Indeed, ammonium concentration in Lake Superior average 0.21 µM (Kumar et al. 2007), whereas

+ Lake Erie (NH4 ) are consistently ten fold or higher (Makarewicz et al. 2000). The NOB are found to be present in almost similar numbers (approximately in the order of 103) indicating that the nitrite oxidizers are found in all the niches where ammonia oxidizers are present.

This also reveals that the ammonia oxidizers and the nitrite oxidizers are a consortium oxidizing ammonia to nitrite and nitrite to nitrate.

REFERENCES

Altmann, D., P. Stief, R. Amann, D. De-Beer, and A. Schramm. “In Situ Distribution and

Activity of Nitrifying Bacteria in Freshwater Sediment.” Environmental Microbiology 5, no.

9 (2003): 798–803.

Altschul, S. F., W. Gish, W. Miller, E. W. Myers, D. J. Lipman. “Basic Local Alignment Search

Tool.” Journal of Molecular Biology 215, no. 3 (1990): 403–410.

Amann, R., and B. M. Fuchs. “Single-cell Identification in Microbial Communities by Improved

Fluorescence in Situ Hybridization Techniques.” Nature Reviews Microbiology 6, no. 5

(2008): 339–348.

Beman, J. M., R. Sachdeva, and J. A. Fuhrman. “Population Ecology of Nitrifying Archaea and

Bacteria in the Southern California Bight.” Environmental Microbiology 12, no. 5 (2010):

1282–1292.

Blasco, F., C. Iobbi, J. Ratouchniak, V. Bonnefoy, and M. Chippaux. “Nitrate Reductases of

Escherichia Coli: Sequence of the Second Nitrate Reductase and Comparison with That

Encoded by the narGHJI Operon.” Molecular and General Genetics MGG 222, no. 1

(1990): 104–111.

Bodelier, P., J. A. Libochant, C. Blom, and H. J. Laanbroek. “Dynamics of Nitrification and

Denitrification in Root-oxygenated Sediments and Adaptation of Ammonia-oxidizing

Bacteria to Low-oxygen or Anoxic Habitats.” Applied and Environmental Microbiology 62,

no. 11 (1996): 4100–4107.

Burrell, P. C., C. M. Phalen, and T. A. Hovanec. “Identification of Bacteria Responsible for

Ammonia Oxidation in Freshwater Aquaria.” Applied and Environmental Microbiology 67,

no. 12 (2001): 5791–5800.

Daims, H., A. Brühl, R. Amann, K. H. Schleifer, and M. Wagner. “The Domain-specific Probe

EUB338 Is Insufficient for the Detection of All Bacteria: Development and Evaluation of a

More Comprehensive Probe Set.” Systematic and Applied Microbiology 22, no. 3 (1999):

434–444.

Dalsgaard, T., B. Thamdrup, and D. E. Canfield. “Anaerobic Ammonium Oxidation (anammox)

in the Marine Environment.” Research in Microbiology 156, no. 4 (2005): 457–464.

DeLong, E. F., L. T. Taylor, T. L. Marsh, and C. M. Preston. “Visualization and Enumeration of

Marine Planktonic Archaea and Bacteria by Using Polyribonucleotide Probes and

Fluorescent in Situ Hybridization.” Applied and Environmental Microbiology 65, no. 12

(1999): 5554–5563.

Finlay, J. C., R. W. Sterner, and S. Kumar. “Isotopic Evidence for In-lake Production of

Accumulating Nitrate in Lake Superior.” Ecological Applications 17, no. 8 (2007): 2323–

2332.

Francis, C. A., G. D. O’Mullan, and B. B. Ward. “Diversity of Ammonia Monooxygenase

(amoA) Genes Across Environmental Gradients in Chesapeake Bay Sediments.”

Geobiology 1, no. 2 (2003): 129–140.

French, E., J. A. Kozlowski, M. Mukherjee, G. Bullerjahn, and A. Bollmann. “Ecophysiological

Characterization of Ammonia-Oxidizing Archaea and Bacteria from Freshwater.” Applied

and Environmental Microbiology 78, no. 16 (2012): 5773–5780.

Galloway, J. N., F. J. Dentener, D. G. Capone, E. W. Boyer, R. W. Howarth, S. P. Seitzinger, G.

P. Asner, et al. “Nitrogen Cycles: Past, Present, and Future.” Biogeochemistry 70, no. 2

(2004): 153–226.

Glöckner, F. O., R. Amann, A. Alfreider, J. Pernthaler, R. Psenner, K. Trebesius, and K. H.

Schleifer. “An in Situ Hybridization Protocol for Detection and Identification of Planktonic

Bacteria.” Systematic and Applied Microbiology 19, no. 3 (1996): 403–406.

Head, I. M., W. D. Hiorns, T. M. Embley, A. J. McCarthy, and J. R. Saunders. “The Phylogeny

of Autotrophic Ammonia-oxidizing Bacteria as Determined by Analysis of 16S Ribosomal

RNA Gene Sequences.” Journal of General Microbiology 139, no. 6 (1993): 1147–1153.

Hiorns, W. D., R. C. Hastings, I. M. Head, A. J. McCarthy, J. R. Saunders, R. W. Pickup, and G.

H. Hall. “Amplification of 16S Ribosomal RNA Genes of Autotrophic Ammonia-oxidizing

Bacteria Demonstrates the Ubiquity of Nitrosospiras in the Environment.” Microbiology

141, no. 11 (1995): 2793–2800.

Hornek, R., A. Pommerening-Röser, H. P. Koops, A. H. Farnleitner, N. Kreuzinger, A.

Kirschner, and R. L. Mach. “Primers Containing Universal Bases Reduce Multiple amoA

Gene Specific DGGE Band Patterns When Analysing the Diversity of Beta-ammonia

Oxidizers in the Environment.” Journal of Microbiological Methods 66, no. 1 (2006): 147–

155.

Hovanec, T. A., and E. F. DeLong. “Comparative Analysis of Nitrifying Bacteria Associated

with Freshwater and Marine Aquaria.” Applied and Environmental Microbiology 62, no. 8

(1996): 2888–2896.

Ivanikova, N. V., L. C. Popels, R. M. L. McKay, and G. S. Bullerjahn. “Lake Superior Supports

Novel Clusters of Cyanobacterial Picoplankton.” Applied and Environmental Microbiology

73, no. 12 (2007): 4055–4065.

Juretschko, S., G. Timmermann, M. Schmid, K. H. Schleifer, A. Pommerening-Röser, H. P.

Koops, and M. Wagner. “Combined Molecular and Conventional Analyses of Nitrifying

Bacterium Diversity in Activated Sludge: Nitrosococcus mobilis and Nitrospira-like

Bacteria as Dominant Populations.” Applied and Environmental Microbiology 64, no. 8

(1998): 3042–3051.

Kim, Ok-Sun, P. Junier, J. F. Imhoff, and K. P. Witzel. “Comparative Analysis of Ammonia

Monooxygenase (amoA) Genes in the Water Column and Sediment-Water Interface of Two

Lakes and the Baltic Sea.” FEMS Microbiology Ecology 66, no. 2 (November 2008): 367–

378.

Kisker, C., H. Schindelin, D. Baas, J. Rétey, R. U. Meckenstock, and P. M. H. Kroneck. “A

Structural Comparison of Molybdenum Cofactor-containing Enzymes.” FEMS

Microbiology Reviews 22, no. 5 (2006): 503–521.

Könneke, M., A. E. Bernhard, J. R. de la Torre, C. B. Walker, J. B. Waterbury, and D. A. Stahl.

“Isolation of an Autotrophic Ammonia-oxidizing Marine Archaeon.” Nature 437, no. 7058

(2005): 543–546.

Koops, H. P., U. Purkhold, A. Pommerening-Röser, G. Timmermann, and M. Wagner. “The

Lithoautotrophic Ammonia-Oxidizing Bacteria.” The Prokaryotes, edited by Martin

Dworkin, Stanley Falkow, Eugene Rosenberg, Karl-Heinz Schleifer, and Erko Stackebrandt,

778–811. Springer New York.

Kowalchuk, G. A., and J. R. Stephen. “Ammonia-oxidizing Bacteria: a Model for Molecular

Microbial Ecology.” Annual Reviews in Microbiology 55, no. 1 (2001): 485–529.

Kowalchuk, G. A., J. R. Stephen, W. De Boer, J. I. Prosser, T. M. Embley, and J. W.

Woldendorp. “Analysis of Ammonia-oxidizing Bacteria of the Beta Subdivision of the Class

Proteobacteria in Coastal Sand Dunes by Denaturing Gradient Gel Electrophoresis and

Sequencing of PCR-amplified 16S Ribosomal DNA Fragments.” Applied and

Environmental Microbiology 63, no. 4 (1997): 1489–1497.

Kumar, S., M. Nei, J. Dudley, and K. Tamura. “MEGA: A Biologist-centric Software for

Evolutionary Analysis of DNA and Protein Sequences.” Briefings in Bioinformatics 9, no. 4

(2008): 299–306.

Kumar, S., R. S. Sterner, J. C. Finlay, and S. Brovold. “Spatial and temporal variation of

ammonium in Lake Superior.” Journal of Great Lakes Research, no. 33 (2007): 581–591.

Loy, A., F. Maixner, M. Wagner, and M. Horn. “probeBase--an Online Resource for rRNA-

targeted Oligonucleotide Probes: New Features 2007.” Nucleic Acids Research 35, no.

Database (2007): D800–D804.

Makarewicz, J. C., P. Bertram, and T. W. Lewis. “Chemistry of the Offshore Surface Waters of

Lake Erie: Pre- and Post-Dreissena Introduction (1983–1993).” Journal of Great Lakes

Research, no. 26 (2000): 82-93.

Martens-Habbena, Willm, Paul M. Berube, Hidetoshi Urakawa, José R. de la Torre, and David

A. Stahl. “Ammonia Oxidation Kinetics Determine Niche Separation of Nitrifying Archaea

and Bacteria.” Nature 461, no. 7266 (2009): 976–979.

Merbt, Stephanie N., David A. Stahl, Emilio O. Casamayor, Eugènia Martí, Graeme W. Nicol,

and James I. Prosser. “Differential Photoinhibition of Bacterial and Archaeal Ammonia

Oxidation.” FEMS Microbiology Letters 327, no. 1 (2012): 41–46.

Mincer, Tracy J., Matthew J. Church, L. T. Taylor, C. Preston, D. M. Karl, and E. F. DeLong.

“Quantitative Distribution of Presumptive Archaeal and Bacterial Nitrifiers in Monterey

Bay and the North Pacific Subtropical Gyre.” Environmental Microbiology 9, no. 5 (2007):

1162–1175.

Mobarry, B. K., M. Wagner, V. Urbain, B. E. Rittmann, and D. A. Stahl. “Phylogenetic Probes

for Analyzing Abundance and Spatial Organization of Nitrifying Bacteria.” Applied and

Environmental Microbiology 62, no. 6 (1996): 2156–2162.

Nicolaisen, M. H., and N. B. Ramsing. “Denaturing Gradient Gel Electrophoresis (DGGE)

Approaches to Study the Diversity of Ammonia-oxidizing Bacteria.” Journal of

Microbiological Methods 50, no. 2 (2002): 189–203.

Pernthaler, A., J. Pernthaler, and R. Amann. “Fluorescence in Situ Hybridization and Catalyzed

Reporter Deposition for the Identification of Marine Bacteria.” Applied and Environmental

Microbiology 68, no. 6 (2002): 3094–3101.

Pernthaler, J., F. O. Glöckner, W. Schönhuber, and R. Amann. “Fluorescence in-situ

Hybridization (FISH) with rRNA-targeted Oligonucleotide Probes.” Methods in

Microbiology 30 (2001): 207–226.

Pratscher, J., M. G. Dumont, and R. Conrad. “Ammonia Oxidation Coupled to CO2 Fixation by

Archaea and Bacteria in an Agricultural Soil.” Proceedings of the National Academy of

Sciences 108, no. 10 (2011): 4170–4175.

Prosser, J. I., and G. W. Nicol. “Relative Contributions of Archaea and Bacteria to Aerobic

Ammonia Oxidation in the Environment.” Environmental Microbiology 10, no. 11 (2008):

2931–2941.

Purkhold, U. “16S rRNA and amoA-based Phylogeny of 12 Novel Betaproteobacterial

Ammonia-oxidizing Isolates: Extension of the Dataset and Proposal of a New Lineage

within the Nitrosomonads.” International Journal of Systematic and Evolutionary

Microbiology 53, no. 5 (2003): 1485–1494.

Purkhold, U., A. Pommerening-Röser, S. Juretschko, M. C. Schmid, H. P. Koops, and M.

Wagner. “Phylogeny of All Recognized Species of Ammonia Oxidizers Based on

Comparative 16S rRNA and amoA Sequence Analysis: Implications for Molecular

Diversity Surveys.” Applied and Environmental Microbiology 66, no. 12 (2000): 5368–

5382.

Reed, A. J., and R. E. Hicks. “Microbial Ecology of Lake Superior Bacteria and Archaea: An

Overview.” Aquatic Ecosystem Health & Management 14, no. 4 (2011): 386–395.

Rotthauwe, J. H., K. P. Witzel, and W. Liesack. “The Ammonia Monooxygenase Structural Gene

amoA as a Functional Marker: Molecular Fine-scale Analysis of Natural Ammonia-

oxidizing Populations.” Applied and Environmental Microbiology 63, no. 12 (1997): 4704–

4712.

Santoro, A. E., Karen L. Casciotti, and Christopher A. Francis. “Activity, Abundance and

Diversity of Nitrifying Archaea and Bacteria in the Central California Current.”

Environmental Microbiology 12, no. 7 (2010): 1989–2006.

Santoro, A. E., C. A. Francis, N. R. de Sieyes, and A. B. Boehm. “Shifts in the Relative

Abundance of Ammonia-oxidizing Bacteria and Archaea Across Physicochemical Gradients

in a Subterranean Estuary.” Environmental Microbiology 10, no. 4 (2008): 1068–1079.

Schramm, A., D. De Beer, M. Wagner, and R. Amann. “Identification and Activities In Situ of

Nitrosospiraand Nitrospira Spp. as Dominant Populations in a Nitrifying Fluidized Bed

Reactor.” Applied and Environmental Microbiology 64, no. 9 (1998): 3480–3485.

Sekar, R., A. Pernthaler, J. Pernthaler, F. Warnecke, T. Posch, and R. Amann. “An Improved

Protocol for Quantification of Freshwater Actinobacteria by Fluorescence in Situ

Hybridization.” Applied and Environmental Microbiology 69, no. 5 (2003): 2928–2935.

Sharma, A. K., K. Sommerfeld, G. S. Bullerjahn, A. R. Matteson, S. W. Wilhelm, J. Jezbera, U.

Brandt, W. F. Doolittle, and M. W. Hahn. “Actinorhodopsin Genes Discovered in Diverse

Freshwater Habitats and Among Cultivated Freshwater Actinobacteria.” The ISME Journal

3, no. 6 (2009): 726–737.

Small, G. E., G. S. Bullerjahn, R.W. Sterner, B. Beall, S. Brovold, J. C. Finlay, R. M. L. McKay,

and M. Mukherjee. “Rates and Controls of Nitrification in a Large Oligotrophic Lake.”

Limnology and Oceanography,Submitted.(2013).

Stephen, J. R., Y. J. Chang, S. J. Macnaughton, G. A. Kowalchuk, K. T. Leung, C. A. Flemming,

and D. C. White. “Effect of Toxic Metals on Indigenous Soil beta-subgroup

Proteobacterium Ammonia Oxidizer Community Structure and Protection Against Toxicity

by Inoculated Metal-resistant Bacteria.” Applied and Environmental Microbiology 65, no. 1

(1999): 95–101.

Sterner, R. W. “C: N: P Stoichiometry in Lake Superior: Freshwater Sea as End Member.”

Inland Waters 1, no. 1 (2011): 29–46.

Sterner, R. W., E. Anagnostou, S. Brovold, G. S. Bullerjahn, J. C. Finlay, S. Kumar, R. M. L.

McKay, and R. M. Sherrell. “Increasing Stoichiometric Imbalance in North America’s

Largest Lake: Nitrification in Lake Superior.” Geophysical Research Letters 34, no. 10

(2007).

Strous, Marc, and Mike S.M. Jetten. “Anaerobic Oxidation of Methane and Ammonium.” Annual

Review of Microbiology 58, no. 1 (October 2004): 99–117.

Tourna, M., M. Stieglmeier, A. Spang, M. Konneke, A. Schintlmeister, T. Urich, and M. Engel.

“Nitrososphaera Viennensis, an Ammonia Oxidizing Archaeon from Soil.” Proceedings of

the National Academy of Sciences 108, no. 20 (2011): 8420–8425.

Van de Graaf, A. A., A. Mulder, P. de Bruijn, M. S. Jetten, L. A. Robertson, and J. G. Kuenen.

“Anaerobic Oxidation of Ammonium Is a Biologically Mediated Process.” Applied and

Environmental Microbiology 61, no. 4 (1995): 1246–1251.

Wagner, M., G. Rath, H. P. Koops, J. Floods, and R. Amann. “In situ Analysis of Nitrifying

Bacteria in Sewage Treatment Plants. Water Science and Technology 34, no. 1-2 (1996):

237-244.

Ward, B. B., Arp, D. J., and Klotz, M. J. “ Nitrification.” ASM Press (2011). Book ISBN or Item

Number: 978-1-55581-481-6.