WO 2011/011767 Al
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Novel Binding Partners of PBF in Thyroid Tumourigenesis
NOVEL BINDING PARTNERS OF PBF IN THYROID TUMOURIGENESIS By Neil Sharma A thesis presented to the College of Medical and Dental Sciences at the University of Birmingham for the Degree of Doctor of Philosophy Centre for Endocrinology, Diabetes and Metabolism, School of Clinical and Experimental Medicine August 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. SUMMARY Thyroid cancer is the most common endocrine cancer, with a rising incidence. The proto-oncogene PBF is over-expressed in thyroid tumours, and the degree of over-expression is directly linked to patient survival. PBF causes transformation in vitro and tumourigenesis in vivo, with PBF-transgenic mice developing large, macro-follicular goitres, effects partly mediated by the internalisation and repression of the membrane-bound transporters NIS and MCT8. NIS repression leads to a reduction in iodide uptake, which may negatively affect the efficacy of radioiodine treatment, and therefore prognosis. Work within this thesis describes the use of tandem mass spectrometry to produce a list of potential binding partners of PBF. This will aid further research into the pathophysiology of PBF, not just in relation to thyroid cancer but also other malignancies. -
Core Transcriptional Regulatory Circuitries in Cancer
Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage. -
Expression of Membrane Proteins in Escherichia Coli
From Biogenesis to Over- expression of Membrane Proteins in Escherichia coli Samuel Wagner Stockholm University © Samuel Wagner, Stockholm 2008 ISBN 978-91-7155-594-6, Pages i-81 Printed in Sweden by Universitetsservice AB, Stockholm 2008 Distributor: Department of Biochemistry and Biophysics, Stockholm University To Claudia. Abstract In both pro- and eukaryotes 20-30% of all genes encode α-helical transmem- brane domain proteins, which act in various and often essential capacities. Notably, membrane proteins play key roles in disease and they constitute more than half of all known drug targets. The natural abundance of membrane proteins is in general too low to con- veniently isolate sufficient material for functional and structural studies. Therefore, most membrane proteins have to be obtained through overexpres- sion. Escherichia coli is one of the most successful hosts for overexpression of recombinant proteins, and T7 RNA polymerase-based expression is the major approach to produce recombinant proteins in E. coli. While the pro- duction of soluble proteins is comparably straightforward, overexpression of membrane proteins remains a challenging task. The yield of membrane lo- calized recombinant membrane protein is usually low and inclusion body formation is a serious problem. Furthermore, membrane protein overexpres- sion is often toxic to the host cell. Although several reasons can be postu- lated, the basis of these difficulties is not completely understood. It is gener- ally believed, that the complex requirements of membrane protein biogenesis significantly contribute to the difficulty of membrane protein overexpres- sion. Therefore, an understanding of membrane protein biogenesis is a pre- requisite for understanding membrane protein overexpression and for de- signing rational strategies to improve overexpression yields. -
Dog Coat Colour Genetics: a Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem
www.als-journal.com/ ISSN 2310-5380/ August 2020 Review Article Advancements in Life Sciences – International Quarterly Journal of Biological Sciences ARTICLE INFO Open Access Date Received: 02/05/2020; Date Revised: 20/08/2020; Dog Coat Colour Genetics: A Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem Authors’ Affiliation: 1. Institute of Abstract Biotechnology, Gulab Devi Educational anis lupus familiaris is one of the most beloved pet species with hundreds of world-wide recognized Complex, Lahore - Pakistan breeds, which can be differentiated from each other by specific morphological, behavioral and adoptive 2. Decode Genomics, traits. Morphological characteristics of dog breeds get more attention which can be defined mostly by 323-D, Town II, coat color and its texture, and considered to be incredibly lucrative traits in this valued species. Although Punjab University C Employees Housing the genetic foundation of coat color has been well stated in the literature, but still very little is known about the Scheme, Lahore - growth pattern, hair length and curly coat trait genes. Skin pigmentation is determined by eumelanin and Pakistan 3. Department of pheomelanin switching phenomenon which is under the control of Melanocortin 1 Receptor and Agouti Signaling Biology, Tabuk Protein genes. Genetic variations in the genes involved in pigmentation pathway provide basic understanding of University - Kingdom melanocortin physiology and evolutionary adaptation of this trait. So in this review, we highlighted, gathered and of Saudi Arabia comprehend the genetic mutations, associated and likely to be associated variants in the genes involved in the coat color and texture trait along with their phenotypes. -
Edinburgh Research Explorer
Edinburgh Research Explorer International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list Citation for published version: Davenport, AP, Alexander, SPH, Sharman, JL, Pawson, AJ, Benson, HE, Monaghan, AE, Liew, WC, Mpamhanga, CP, Bonner, TI, Neubig, RR, Pin, JP, Spedding, M & Harmar, AJ 2013, 'International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list: recommendations for new pairings with cognate ligands', Pharmacological reviews, vol. 65, no. 3, pp. 967-86. https://doi.org/10.1124/pr.112.007179 Digital Object Identifier (DOI): 10.1124/pr.112.007179 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Pharmacological reviews Publisher Rights Statement: U.S. Government work not protected by U.S. copyright General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 1521-0081/65/3/967–986$25.00 http://dx.doi.org/10.1124/pr.112.007179 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:967–986, July 2013 U.S. -
Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors
11902 • The Journal of Neuroscience, September 8, 2010 • 30(36):11902–11916 Development/Plasticity/Repair Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors Kangxin Jin,1,2 Haisong Jiang,1,2 Zeqian Mo,3 and Mengqing Xiang1,2 1Center for Advanced Biotechnology and Medicine and Department of Pediatrics, 2Graduate Program in Molecular Genetics, Microbiology and Immunology, and 3Department of Cell Biology and Neuroscience, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854 The establishment of functional retinal circuits in the mammalian retina depends critically on the proper generation and assembly of six classes of neurons, five of which consist of two or more subtypes that differ in morphologies, physiological properties, and/or sublaminar positions. How these diverse neuronal types and subtypes arise during retinogenesis still remains largely to be defined at the molecular level. Here we show that all four family members of the early B-cell factor (Ebf) helix-loop-helix transcription factors are similarly expressedduringmouseretinogenesisinseveralneuronaltypesandsubtypesincludingganglion,amacrine,bipolar,andhorizontalcells, and that their expression in ganglion cells depends on the ganglion cell specification factor Brn3b. Misexpressed Ebfs bias retinal precursors toward the fates of non-AII glycinergic amacrine, type 2 OFF-cone bipolar and horizontal cells, whereas a dominant-negative Ebf suppresses the differentiation of these cells as well as ganglion cells. Reducing Ebf1 expression by RNA interference (RNAi) leads to an inhibitory effect similar to that of the dominant-negative Ebf, effectively neutralizes the promotive effect of wild-type Ebf1, but has no impact on the promotive effect of an RNAi-resistant Ebf1. -
Human Transcription Factor Protein-Protein Interactions in Health and Disease
HELKA GÖÖS GÖÖS HELKA Recent Publications in this Series 45/2019 Mgbeahuruike Eunice Ego Evaluation of the Medicinal Uses and Antimicrobial Activity of Piper guineense (Schumach & Thonn) 46/2019 Suvi Koskinen AND DISEASE IN HEALTH INTERACTIONS PROTEIN-PROTEIN FACTOR HUMAN TRANSCRIPTION Near-Occlusive Atherosclerotic Carotid Artery Disease: Study with Computed Tomography Angiography 47/2019 Flavia Fontana DISSERTATIONES SCHOLAE DOCTORALIS AD SANITATEM INVESTIGANDAM Biohybrid Cloaked Nanovaccines for Cancer Immunotherapy UNIVERSITATIS HELSINKIENSIS 48/2019 Marie Mennesson Kainate Receptor Auxiliary Subunits Neto1 and Neto2 in Anxiety and Fear-Related Behaviors 49/2019 Zehua Liu Porous Silicon-Based On-Demand Nanohybrids for Biomedical Applications 50/2019 Veer Singh Marwah Strategies to Improve Standardization and Robustness of Toxicogenomics Data Analysis HELKA GÖÖS 51/2019 Iryna Hlushchenko Actin Regulation in Dendritic Spines: From Synaptic Plasticity to Animal Behavior and Human HUMAN TRANSCRIPTION FACTOR PROTEIN-PROTEIN Neurodevelopmental Disorders 52/2019 Heini Liimatta INTERACTIONS IN HEALTH AND DISEASE Efectiveness of Preventive Home Visits among Community-Dwelling Older People 53/2019 Helena Karppinen Older People´s Views Related to Their End of Life: Will-to-Live, Wellbeing and Functioning 54/2019 Jenni Laitila Elucidating Nebulin Expression and Function in Health and Disease 55/2019 Katarzyna Ciuba Regulation of Contractile Actin Structures in Non-Muscle Cells 56/2019 Sami Blom Spatial Characterisation of Prostate Cancer by Multiplex -
Role of Phospholipases in Adrenal Steroidogenesis
229 1 W B BOLLAG Phospholipases in adrenal 229:1 R29–R41 Review steroidogenesis Role of phospholipases in adrenal steroidogenesis Wendy B Bollag Correspondence should be addressed Charlie Norwood VA Medical Center, One Freedom Way, Augusta, GA, USA to W B Bollag Department of Physiology, Medical College of Georgia, Augusta University (formerly Georgia Regents Email University), Augusta, GA, USA [email protected] Abstract Phospholipases are lipid-metabolizing enzymes that hydrolyze phospholipids. In some Key Words cases, their activity results in remodeling of lipids and/or allows the synthesis of other f adrenal cortex lipids. In other cases, however, and of interest to the topic of adrenal steroidogenesis, f angiotensin phospholipases produce second messengers that modify the function of a cell. In this f intracellular signaling review, the enzymatic reactions, products, and effectors of three phospholipases, f phospholipids phospholipase C, phospholipase D, and phospholipase A2, are discussed. Although f signal transduction much data have been obtained concerning the role of phospholipases C and D in regulating adrenal steroid hormone production, there are still many gaps in our knowledge. Furthermore, little is known about the involvement of phospholipase A2, Endocrinology perhaps, in part, because this enzyme comprises a large family of related enzymes of that are differentially regulated and with different functions. This review presents the evidence supporting the role of each of these phospholipases in steroidogenesis in the Journal Journal of Endocrinology adrenal cortex. (2016) 229, R1–R13 Introduction associated GTP-binding protein exchanges a bound GDP for a GTP. The G protein with GTP bound can then Phospholipids serve a structural function in the cell in that activate the enzyme, phospholipase C (PLC), that cleaves they form the lipid bilayer that maintains cell integrity. -
Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
An Automated Pipeline for Inferring Variant-Driven Gene
www.nature.com/scientificreports OPEN MAGPEL: an autoMated pipeline for inferring vAriant‑driven Gene PanEls from the full‑length biomedical literature Nafseh Saberian1, Adib Shaf 1, Azam Peyvandipour1 & Sorin Draghici 1,2* In spite of the eforts in developing and maintaining accurate variant databases, a large number of disease‑associated variants are still hidden in the biomedical literature. Curation of the biomedical literature in an efort to extract this information is a challenging task due to: (i) the complexity of natural language processing, (ii) inconsistent use of standard recommendations for variant description, and (iii) the lack of clarity and consistency in describing the variant-genotype-phenotype associations in the biomedical literature. In this article, we employ text mining and word cloud analysis techniques to address these challenges. The proposed framework extracts the variant- gene‑disease associations from the full‑length biomedical literature and designs an evidence‑based variant-driven gene panel for a given condition. We validate the identifed genes by showing their diagnostic abilities to predict the patients’ clinical outcome on several independent validation cohorts. As representative examples, we present our results for acute myeloid leukemia (AML), breast cancer and prostate cancer. We compare these panels with other variant‑driven gene panels obtained from Clinvar, Mastermind and others from literature, as well as with a panel identifed with a classical diferentially expressed genes (DEGs) approach. The results show that the panels obtained by the proposed framework yield better results than the other gene panels currently available in the literature. One crucial step in understanding the biological mechanism underlying a disease condition is to capture the relationship between the variants and the disease risk1.