Analysis of Transcriptional Codes for Zebrafish Dopaminergic Neurons
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6. -
Chromatin State Barriers Enforce an Irreversible Mammalian Cell Fate Decision
bioRxiv preprint doi: https://doi.org/10.1101/2021.05.12.443709; this version posted May 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Chromatin state barriers… Blanco et al. 2021 Chromatin state barriers enforce an irreversible mammalian cell fate decision M. Andrés Blanco1,19,*,†,, David B. Sykes6,8,19, Lei Gu2,15,17,18,19, Mengjun Wu2,4,15, Ricardo Petroni1, Rahul Karnik7,8,9, Mathias Wawer10, Joshua Rico1, Haitao Li1, William D. Jacobus2,12,15, Ashwini Jambhekar2,15,11, Sihem Cheloufi5, Alexander Meissner7,8,9,13, Konrad Hochedlinger6,7,8,14, David T. Scadden6,8,9,*, and Yang Shi2,3,* 1 Department of Biomedical Sciences, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA 19104 USA 2 Division of Newborn Medicine, Boston Children’s Hospital, Boston, MA 02115, USA 3 Ludwig Institute for Cancer Research, Oxford Branch, Oxford University, UK 4 Current address: The Bioinformatics Centre, Department of Biology and Biotech Research and Innovation Centre (BRIC), University of Copenhagen, Copenhagen, Denmark 5 Department of Biochemistry, Stem Cell Center, University of California, Riverside, Riverside, CA 92521, USA. 6 Center for Regenerative Medicine, Massachusetts General Hospital, Boston, MA, 02114, USA. 7 Broad Institute of MIT and Harvard, Cambridge, MA, USA 8 Harvard Stem Cell Institute, Cambridge, Massachusetts, -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Detailed Review Paper on Retinoid Pathway Signalling
1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process. -
Pitx3 KNOCKOUT MICE ENTRAIN to SCHEDULED FEEDING DESPITE
Pitx3 KNOCKOUT MICE ENTRAIN TO SCHEDULED FEEDING DESPITE FREE-RUNNING LIGHT ENTRAINED RHYTHMS A Thesis Presented to the Faculty of California State Polytechnic University, Pomona In Partial Fulfillment Of the Requirements for the Degree Master of Science In Biological Sciences By Lori L. Scarpa 2019 SIGNATURE PAGE THESIS: Pitx3 KNOCKOUT MICE ENTRAIN TO SCHEDULED FEEINDING DESPITE FREE-RUNNING LIGHT ENTRAINED RHYTHMS AUTHOR: Lori L. Scarpa DATE SUBMITTED: Fall 2019 Department of Biological Sciences Dr. Andrew D. Steele Thesis Committee Chair Biological Sciences Dr. Juanita Jellyman Biological Sciences Dr. Robert Talmadge Biological Sciences ii ACKNOWLEDGEMENTS Funding for this project was provided by the Whitehall Foundation and California State Polytechnic University of Pomona, California. I would like to thank the many people who assisted in the daily labors required to complete this project: Raymundo Miranda, Michael Sidikpramana, Jeffrey Falkenstein, Michael Williams, Jaskaran Dhanoa, and many other members of the Steele lab. I would like to specially recognize fellow graduate students in the Steele lab, Damien Wolfe and Andrew Villa, for their unconditional encouragement and support. I would like to thank Dr. Juanita Jellyman for her kindness and nurturing spirit. Dr. Jellyman never wavered her belief in me and it was this that kept me working harder towards my goals. Lastly, I would like thank Dr. Andrew Steele for accepting me into his lab, for being my personal mentor, and for pushing me towards success. Through him, I have grown to become a better scientist and found greater inspiration in my pursuit to further study neuroscience. Thank you, Dr. Steele, for your support and patience, and for playing a leading role in my success as a graduate student in your lab. -
Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database. -
Noninvasive Sleep Monitoring in Large-Scale Screening of Knock-Out Mice
bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Noninvasive sleep monitoring in large-scale screening of knock-out mice reveals novel sleep-related genes Shreyas S. Joshi1*, Mansi Sethi1*, Martin Striz1, Neil Cole2, James M. Denegre2, Jennifer Ryan2, Michael E. Lhamon3, Anuj Agarwal3, Steve Murray2, Robert E. Braun2, David W. Fardo4, Vivek Kumar2, Kevin D. Donohue3,5, Sridhar Sunderam6, Elissa J. Chesler2, Karen L. Svenson2, Bruce F. O'Hara1,3 1Dept. of Biology, University of Kentucky, Lexington, KY 40506, USA, 2The Jackson Laboratory, Bar Harbor, ME 04609, USA, 3Signal solutions, LLC, Lexington, KY 40503, USA, 4Dept. of Biostatistics, University of Kentucky, Lexington, KY 40536, USA, 5Dept. of Electrical and Computer Engineering, University of Kentucky, Lexington, KY 40506, USA. 6Dept. of Biomedical Engineering, University of Kentucky, Lexington, KY 40506, USA. *These authors contributed equally Address for correspondence and proofs: Shreyas S. Joshi, Ph.D. Dept. of Biology University of Kentucky 675 Rose Street 101 Morgan Building Lexington, KY 40506 U.S.A. Phone: (859) 257-2805 FAX: (859) 257-1717 Email: [email protected] Running title: Sleep changes in knockout mice bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
Download The
PROBING THE INTERACTION OF ASPERGILLUS FUMIGATUS CONIDIA AND HUMAN AIRWAY EPITHELIAL CELLS BY TRANSCRIPTIONAL PROFILING IN BOTH SPECIES by POL GOMEZ B.Sc., The University of British Columbia, 2002 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2010 © Pol Gomez, 2010 ABSTRACT The cells of the airway epithelium play critical roles in host defense to inhaled irritants, and in asthma pathogenesis. These cells are constantly exposed to environmental factors, including the conidia of the ubiquitous mould Aspergillus fumigatus, which are small enough to reach the alveoli. A. fumigatus is associated with a spectrum of diseases ranging from asthma and allergic bronchopulmonary aspergillosis to aspergilloma and invasive aspergillosis. Airway epithelial cells have been shown to internalize A. fumigatus conidia in vitro, but the implications of this process for pathogenesis remain unclear. We have developed a cell culture model for this interaction using the human bronchial epithelium cell line 16HBE and a transgenic A. fumigatus strain expressing green fluorescent protein (GFP). Immunofluorescent staining and nystatin protection assays indicated that cells internalized upwards of 50% of bound conidia. Using fluorescence-activated cell sorting (FACS), cells directly interacting with conidia and cells not associated with any conidia were sorted into separate samples, with an overall accuracy of 75%. Genome-wide transcriptional profiling using microarrays revealed significant responses of 16HBE cells and conidia to each other. Significant changes in gene expression were identified between cells and conidia incubated alone versus together, as well as between GFP positive and negative sorted cells. -
Investigating the Role of the ETS Transcription Factor ELK1 in Stem Cell Transcription
Investigating the role of the ETS transcription factor ELK1 in stem cell transcription A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health 2017 Ian E. Prise Division of Molecular & Cellular Function School of Biological Sciences I. Table of Contents II. List of Figures ...................................................................................................................................... 5 III. Abstract .............................................................................................................................................. 7 IV. Declaration ......................................................................................................................................... 8 V. Copyright Statement ........................................................................................................................... 8 VI. Experimental Contributions ............................................................................................................... 9 VII. Acknowledgments .......................................................................................................................... 10 1. Introduction ...................................................................................................................................... 12 1.I Pluripotency ................................................................................................................................. 12 1.II Chromatin -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Identification of Novel Sleep Related Genes from Large Scale Phenotyping Experiments in Mice
University of Kentucky UKnowledge Theses and Dissertations--Biology Biology 2017 IDENTIFICATION OF NOVEL SLEEP RELATED GENES FROM LARGE SCALE PHENOTYPING EXPERIMENTS IN MICE Shreyas Joshi University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/ETD.2017.159 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Joshi, Shreyas, "IDENTIFICATION OF NOVEL SLEEP RELATED GENES FROM LARGE SCALE PHENOTYPING EXPERIMENTS IN MICE" (2017). Theses and Dissertations--Biology. 42. https://uknowledge.uky.edu/biology_etds/42 This Doctoral Dissertation is brought to you for free and open access by the Biology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Biology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line