Developmental Biology 369 (2012) 133–149

Contents lists available at SciVerse ScienceDirect

Developmental Biology

journal homepage: www.elsevier.com/locate/developmentalbiology

Genomes and Developmental Control Analysis of transcriptional codes for zebrafish dopaminergic neurons reveals essential functions of Arx and Isl1 in prethalamic dopaminergic neuron development

Alida Filippi a, Chamaiphorn Jainok a, Wolfgang Driever a,b,n a Developmental Biology, Institute Biology 1, Faculty of Biology, University of Freiburg, Hauptstrasse 1, D-79104 Freiburg, Germany b BIOSS Centre for Biological Signalling Studies and FRIAS Freiburg Institute for Advanced Studies, University of Freiburg, Albertstrasse 19, D-79104 Freiburg, Germany article info abstract

Article history: Distinct groups of dopaminergic neurons develop at defined anatomical sites in the brain to modulate Received 19 January 2012 function of a large diversity of local and far-ranging circuits. However, the molecular identity as judged Received in revised form from transcription factor expression has not been determined for all dopaminergic groups. Here, we 16 May 2012 analyze regional expression of transcription factors in the larval zebrafish brain to determine Accepted 12 June 2012 co-expression with the Tyrosine hydroxylase marker in dopaminergic neurons. We define sets of Available online 20 June 2012 transcription factors that clearly identify each dopaminergic group. These data confirm postulated Keywords: relations to dopaminergic groups defined for mammalian systems. We focus our functional analysis on Dopaminergic neuron prethalamic dopaminergic neurons, which co-express the transcription factors Arx and Isl1. Morpho- Transcription factors lino-based knockdown reveals that both Arx and Isl1 are strictly required for prethalamic dopaminergic Zebrafish neuron development and appear to act in parallel. We further show that Arx contributes to patterning Diencephalon Telencephalon in the prethalamic region, while Isl1 is required for differentiation of prethalamic dopaminergic Neuronal specification neurons. & 2012 Elsevier Inc. All rights reserved.

Introduction thalamus (A11), tuberal hypothalamus (A12), prethalamic zona incerta (A13), and preoptic area/rostral hypothalamus (A14, A15). Dopaminergic (DA) neurons modulate circuits controlling a More detailed studies will be required to identify not only wide array of behaviors as well as important aspects of physiol- anatomical features but also molecular characteristics of these ogy (Bjorklund and Dunnett, 2007; Iversen and Iversen, 2007). DA groups. Several modes of DA transcriptional specification may Most research focuses on the development of DA neurons of the be envisioned. First, complex regional transcriptional codes, ventral midbrain in mammals, because the degeneration of different for each DA group, may independently converge towards substantia nigra neurons causes Parkinson’s disease (Ang, 2006; the specification of the DA neurotransmitter phenotype, for Smidt and Burbach, 2007). However, DA neurons develop in example, through multiple independent enhancers in DA differ- mammals, like in other vertebrates, in several distinct clusters entiation genes. Alternatively, DA group-specific sets of distinct at specific anatomical locations in mes-, di- and telencephalon members of defined families of transcription factors may con- (Smeets et al., 2000; Bjorklund and Dunnett, 2007). While signal- verge on regulatory elements. Evolutionary conservation of some ing and transcription factors regulating dopaminergic neurons of factors specifying DA neurons from Caenorhabidtis elegans to substantia nigra and ventral tegmental area have been intensively human (Flames and Hobert, 2009) has nurtured the quest to studied (Prakash and Wurst, 2006), much less is known about the identify regulatory code elements common to DA or, more developmental control of other DA groups in the forebrain. generally, monoaminergic differentiation (Flames and Hobert, In mammalian fore- and midbrain, a total of 10 major populations 2011). Further studies of DA development in different brain of DA neurons develop in the olfactory bulb (group A16), in the regions and throughout vertebrate evolution are needed to inner nuclear layer of the retina (A17), in the diencephalon (A11- uncover common mechanisms, which may also help to discover 15), and in the mesencephalon (A8-A10) (Hokfelt¨ et al., 1984). The group specific features controlling individual projection behaviors diencephalic DA groups are distributed in nuclei of the dorsal and physiological traits. Some DA groups are evolutionary conserved, e.g. those in the olfactory bulb and the amacrine cells in the retina are present in n Corresponding author. Fax: þ49 761 203 2597. zebrafish and mouse. Other prominent systems have undergone E-mail address: [email protected] (W. Driever). anatomically significant changes in the course of evolution, e.g.

0012-1606/$ - see front matter & 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ydbio.2012.06.010 134 A. Filippi et al. / Developmental Biology 369 (2012) 133–149 the mesdiencephalic system of mammals, which is absent in that link teleostean and mammalian DA group specification, we zebrafish, or the zebrafish pretectal system, which is not formed are far away from knowing DA group specific transcriptional in the mature mouse brain. The zebrafish has emerged as a widely codes. The comparison of zebrafish and mammalian systems used teleost model to study catecholaminergic and specifically DA would enable identification of core transcriptional regulators, systems organization and development, because it is highly and help to elucidate the regulatory logic. It may be possible that amenable to genetic, experimental embryological and pharmaco- different members of the same core classes or families of factors logical analysis (Rink and Wullimann, 2002; Panula et al., 2010; accommodate analogous functions in the distant brain regions in Schweitzer et al., 2011; Yamamoto and Vernier, 2011). Using which DA neurons develop, or completely distinct codes may marker proteins for the detection of catecholaminergic (Tyrosine converge on regulation of transmitter, electrical and projection hydroxylase TH - two paralogous genes, th and th2), dopaminergic phenotypes. Even in the second case, evolutionary comparison (Dopamine transporter dat/slc6a3), and noradrenergic neurons should help to identify core mechanisms for each DA group. (Dopamine beta hydroxylase dbh), all catecholaminergic groups In this study, we used previous knowledge from mammalian have been mapped anatomically from embryonic through larval systems, as well as gene expression data from public databases, to to adult stages (Holzschuh et al., 2001; Candy and Collet, 2005; identify transcription factors co-expressed in each of the DA Chen et al., 2009; Filippi et al., 2010; Yamamoto et al., 2010). groups of the early larval zebrafish brain. As result, we present Furthermore, projection patterns of all these dopaminergic groups molecular identity profiles for each DA group, which support have been characterized in larval zebrafish (Tay et al., 2011). evolutionary relations of these groups to mammalian systems. Zebrafish DA groups corresponding to most mammalian groups We then focus our attention on the prethalamic group of DA can be identified: a cluster of groups termed DC2, 4, 5, 6 in the neurons, which has not been previously studied in zebrafish. ventral diencephalic posterior tubercular and hypothalamic areas, Using knockdown antisense technology, we demonstrate that the all of which depend on the Otp transcription factor activity transcription factors Arx and Isl1, which are co-expressed in (corresponding to A11; (Ryu et al., 2007); a prethalamic group mature prethalamic DA neurons, are also required for differentia- (termed DC0/1—potentially corresponding to A13); medial (DC3) tion of the DA phenotype. and caudal (DC7) hypothalamic groups (corresponding to A14 and A12); preoptic DA neurons (A15); an olfactory bulb (A16) and amacrine retinal group. In addition, zebrafish have a pretectal DA group, which has no corresponding structure in adult mammals, Materials and methods but a pretectal DA group has been reported in human embry- ogenesis (Puelles and Verney, 1998). Finally, zebrafish have an Zebrafish maintenance endogenous subpallial dopamine system, which may correlate with a small number of DA neurons reported in the primate Zebrafish were kept and bred according to standard procedures striatum (Betarbet et al., 1997). While zebrafish lack a direct (http://zfin.org). Fertilized eggs were raised at 28.5 1Cinmedium anatomical counterpart of mammalian A8–A10 groups and have containing 0.2 mM phenylthiourea in order to inhibit pigmentation. no DA neurons in the mesencephalon, it has been discussed Embryos were staged according to (Kimmel et al., 1995). whether the teleostean diencephalic ascending system (Rink and Wullimann, 2001), or the endosubpallial system (Tay et al., 2011), may substitute some of the mesostriatal circuit function. Whole mount in situ hybridization and immunofluorescence At the molecular level, a potential conservation of pathways involved in specification and differentiation of mammalian DA For whole mount in situ hybridization (WISH) expression neurons has been investigated in zebrafish by analyses of expression analysis, digoxigenin-labeled antisense riboprobes were gener- and function of transcription factors previously shown to be essential ated for each gene (Table 1). To characterize the phenotype of the for specific DA groups in mammals. With respect to Nurr1/Nr4a2, morphant embryos, the following additional neuronal markers Pitx3 and Lmx1b, which are crucial in mammalian mesdiencephalic were used: ascl1a (Allende and Weinberg, 1994), dat/slc6a3 development (Smidt and Burbach, 2007), none of these transcription (Holzschuh et al., 2001), ddc (probe based on RefSeqNM_213342.1 factors appeared to be expressed by zebrafish ventral diencephalic DA nucleotides 1063–2377), elavl3/HuC (Good, 1995), gad1/gad67 and neurons establishing ascending projections (Filippi et al., 2007). gad2/gad65 (Martin et al., 1998), vglut2a/slc17a6b and vglut2b/ Furthermore, morpholino knockdown analyses failed to reveal a slc17a6a (Higashijima et al., 2004). Standard colorimetric in situ function for Nr4a2, Pitx3 and Lmx1b in the development of zebrafish hybridization was performed (Hauptmann and Gerster, 1994). neurons with ascending projections (DC2,4–5 groups; Filippi et al., Fluorescent in situ hybridization (FISH) was carried out as 2007;butseeBlin et al., 2008; Luo et al., 2008). However, Nr4a2 is described (Filippi et al., 2007). co-expressed in and required for differentiation of preoptic, pretectal, After completion of the whole mount FISH, embryos were and amacrine DA neurons in zebrafish (Filippi et al., 2007). Other equilibrated in PBTD (Phosphate buffered saline; 0.1% Tween20; studies revealed that DC2,4–6 groups depend on the expression of the 1% DMSO) for 10 min, and blocked for at least 1 h in blocking transcription factor Orthopedia (Otp) in regard to their specification solution (PBTD; 10% goat serum; 1% protease-free Bovine Serum and/or differentiation (Del Giacco et al., 2006; Ryu et al., 2007). The Albumin) at room temperature. They were then incubated in fresh analysis of Otp mutant mouse embryos revealed that A11 group DA blocking solution containing a rabbit polyclonal anti-TH primary neurons do not differentiate in the absence of Otp function (Ryu antibody (1:500 dilution; Ryu et al., (2007)), overnight at 4 1C. et al., 2007), suggesting that zebrafish DC2,4–6 DA groups are This antibody has been shown to bind specifically to TH (TH1) and homologous to the mammalian A11 group. This idea is also not to the paralogous TH2 (Filippi et al., 2010). The following day, supported by the similar projection behaviors of Otp-dependent/ the embryos were extensively washed with PBTD containing 1% A11 DA neurons in zebrafish and mouse, which in both species goat serum, and subsequently incubated in blocking solution integrate ascending telencephalic and descending diencephalospinal containing a goat anti-rabbit Alexa555-conjugated secondary projections (Bjorklund and Skagerberg, 1979; Takada et al., 1988; antibody (1:1000 dilution; Molecular Probes), overnight at 4 1C. Takada, 1993; Tay et al., 2011). After washing out the secondary antibody with several changes of Thus, while an anatomical framework has been established PBTD, the embryos were equilibrated in 80% glycerol, and and some conserved molecular mechanisms have been identified mounted for imaging. A. Filippi et al. / Developmental Biology 369 (2012) 133–149 135

Table 1 Transcription factors analyzed for expression in specific groups of CA neurons.

Transcription factors REF. Expression in CA neurons

arx Aristaless related homeobox [1] Yes ascl1b/zash1b Achaete-scute complex-like 1b [2] No atoh1a Atonal homolog 1a [3] No atoh1b Atonal homolog 1b [4] No barhl2 BarH-like 2 [5] No dbx1a developing brain homeobox 1a [6] No dlx2a Distal-less homeobox gene 2a [7] Yes dlx5a/dlx4 Distal-less homeobox gene 5a [7] Yes emx2 Empty spiracles homeobox 2 [8] Yes etv1/er81 Ets variant gene 1 [9] Yes etv5a Ets variant gene 51 [9] No foxA1 Forkhead box A1 [10] No foxA2 Forkhead box A2 [11] No foxb1.2 Forkhead box B1.2 [12] No gata3 GATA-binding protein 3 [13] Yes gsx1/gsh1 GS homeobox 1 [14] No hmx3/nkx5.1 Homeo box (H6 family) 3 [15] Yes isl1 islet1 [16] Yes lhx1a/lim1 LIM homeobox 1a [17] Yes lhx1b/lim6 LIM homeobox 1b [18] Yes lhx2b LIM homeobox 2b [19] No lhx5/lim5 LIM homeobox 5 [20] Yes lmx1b.1 LIM homeobox transcription factor 1, beta 1 [21] Yes lmx1b.2 LIM homeobox transcription factor 1, beta 2 [21] No meis2a/meis2.2 Myeloid ecotropic viral integration site 2a [22] Yes meis2b/meis2.1 Myeloid ecotropic viral integration site 2b [23] No nkx2.1a/titf1a NK2 homeobox 1a [24] Yes nkx2.1b/titf1b NK2 homeobox 1b [25] Yes nkx2.2a NK2 transcription factor related 2a [26] Yes nr4a2a Nuclear receptor subfamily 4, group A, member 2a [27] Yes nr4a2b Nuclear receptor subfamily 4, group A, member 2b [28] Yes olig2 Oligodendrocyte lineage transcription factor 2 [29] No otpa Orthopedia homolog a [30] Yes otpb Orthopedia homolog b [30] Yes otx1b Orthodenticle homolog 1b [31,32] Yes otx2 Orthodenticle homolog 2 [31,32] Yes pax6a Paired box gene 6a [33] Yes pbx1a Pre-B-cell leukemia transcription factor 1a [34] Yes pitx3 Paired-like homeodomain transcription factor 3 [35,36] No pou12/pou3f3 POU domain gene 12 [37] Yes pou47/pou3f2 POU domain gene 47 [37] Yes pou50/pou3f1 POU domain gene 50 [38] Yes prox1a Prospero-related homeobox gene 1a [39] Yes six3a Sine oculis homeobox homolog 3a [40] Yes sox2 SRY-box containing gene 2 [41] Yes tbr1b T-box brain 1b [42] No tfap2a Transcription factor AP-2 alpha [43] Yes zic1 zic family member 1 (odd-paired homolog, Drosophila) [44] Yes zic2a Zic family member 2 (odd-paired homolog, Drosophila), a [45] Yes

References: [1] (Miura et al., 1997); [2] (Allende and Weinberg, 1994); [3] (Kim et al., 1997); [4] (Adolf et al., 2004); [5] (Colombo et al., 2006); [6] (Fjose et al., 1994); [7] (Akimenko et al., 1994); [8] (Morita et al., 1995); [9] (Roussigne´ and Blader, 2006); [10] (Roussigne´ and Blader, 2006); [11] (Strahle¨ et al., 1993); [12] (Odenthal and Nusslein-Volhard,¨ 1998); [13] (Neave et al., 1995); [14] (Cheesman and Eisen, 2004); [15] (Adamska et al., 2000); [16] (Korzh et al., 1993); [17] (Toyama et al., 1995b); [18] (Toyama and Dawid, 1997); [19] (Ando et al., 2005); [20] (Toyama et al., 1995a); [21] (O’Hara et al., 2005); [22] (Waskiewicz et al., 2001); [23] (Zerucha and Prince, 2001); [24] (Rohr and Concha, 2000); [25] (Shanmugalingam et al., 2000); [26] (Barth and Wilson, 1995); [27] (Filippi et al., 2007); [28] (Escriva et al., 1997); [29] (Park et al., 2002); [30] (Del Giacco et al., 2006); [31,32] (Li et al., 1994; Mori et al., 1994); [33] (Krauss et al., 1991); [34] (Palti et al., 2007); [35,36] (Dutta, 2005; Shi et al., 2005); [37] (Sampath and Stuart, 1996); [38] (Hauptmann and Gerster, 1996); [39] (Glasgow and Tomarev, 1998); [40] (Seo et al., 1998); [41](Okuda et al., 2006); [42] (Yonei-Tamura et al., 1999); [43] (Holzschuh et al., 2003); [44] (Grinblat et al., 1998); [45] (Grinblat and Sive, 2001).

Imaging Morpholino injections

Transmitted light images were acquired using a Zeiss Axioskop We used two different morpholino antisense oligos to knock- compound microscope with DIC optics and a Zeiss AxioCam MRc down arx function. The splice blocking arxE2I2-MO (50–TAC- digital camera. Fluorescently labeled embryos were documented TATGCGTCATATTTACCTGGTG–30) targets the second exon- by confocal image stacks using a Zeiss LSM 510 or a Zeiss LSM intron boundary. The translation blocking arxATG-MO (50– 5 DUO laser scanning confocal microscope. Images shown are ATCGTCGTCGTACTGACTGCTCATG–30) targets the 50-end of arx either single planes, or z-projections of defined sets of consecutive mRNA, at bp 1toþ24 (BC163872). To knockdown isl1 focal planes assembled with the Zeiss LSM software. The projec- function we used the splice blocking morpholino isl1E2- tions were exported as TIFF image format files and subsequently MO (50–TTAATCTGCGTTACCTGATGTAGTC–30)(Hutchinson and assembled into figures and processed with the Adobe Photoshop Eisen, 2006). All morpholinos were synthesized by Gene Tools CS2 software. (Corvallis, USA). 136 A. Filippi et al. / Developmental Biology 369 (2012) 133–149

Fig. 1. Expression of transcription factors characterizing DA neurons in the telencephalon. For orientation, a lateral (A, 43 mm projection) and a dorsal (B, 30 mm projection) overview of a 96 hpf zebrafish brain immunostained for TH are shown. The telencephalic DA groups are framed by a circle in A and indicated by arrows in B. In this and in the following figures, TH-immunoreactive cells are always displayed in red and the analyzed transcription factors in green. The dorsalmost telencephalic DA cells express the subpallial markers dlx2a (C–D00) and dlx5a (E–F00), but not tbr1b (G–H00), which labels the dorsal telencephalon. etv1 is expressed only in a subset of subpallial DA neurons (I–J00), but it prominently labels DA cells in the olfactory bulb (K–L00). The images shown in C, E, G, I, and K are overviews of the head of 96 hpf larvae (15–30 mm projections), whereas D–D00, F–F00, H–H00, J–J00, and L–L00 are high magnifications (25 mm projections) of the areas framed in C, E, G, I, and K, respectively. Abbreviations: OB, olfactory bulb; PO, preoptic group; Pr, pretectal group; SP, subpallium; TC, telencephalic cluster; vDC, ventral diencephalic cluster; 1–6; diencephalic DA neuronal groups numbered according to Rink and Wullimann (2002). Anterior is to the left. Scale bars: 50 mm. A. Filippi et al. / Developmental Biology 369 (2012) 133–149 137

Fig. 2. Expression of transcription factors characterizing DA neurons of the prethalamus (group 1). A and B: overviews are like in Fig. 1A,B. Here, group 1 is framed by a circle in A. For each analyzed transcription factor, an overview of the whole head of 96 hpf embryos is presented in C, E, G, I, K, M and O (20–35 mm projections encompassing the prethalamus). A high magnification of prethalamic group 1 within the framed areas is shown in D, F, H, J, L, N and P, respectively (5–20 mm projections). An additional enlarged view of the framed areas in D, F, H, J, L, N and P is shown for each transcription factor at the right side of each row. Abbreviations: HB, hindbrain; PO, preoptic group; Pr, pretectal group; T, tectum; TC, telencephalic cluster; vDC, ventral diencephalic cluster; 1-6; diencephalic DA neuronal groups. Anterior is to the left. Scale bars: 50 mm.

Morpholinos were diluted in deionized water and 0.05% Isl1/2, and the intensity of the immunoreactivity in controls and phenol red, and injected into one-cell stage embryos. The volume morphant embryos was evaluated at the confocal microscopy of the injected drop was approximately 0.5 nl, as measured in (Fig. S1B-G). Halocarbon oil on a micrometer slide. Morpholino concentrations were adjusted to reach (at constant injection volume) the follow- ing amounts per embryo: 8 ng arxE2I2-MO, 2.5 ng arxATG-MO Results and 8 ng isl1E2-MO. In addition, we co-injected an equal amount of p53-MO (Robu et al., 2007) to determine whether any aspects Selection of candidate transcription factors with expression domains of the observed phenotypes may be caused by p53 activation. related to catecholaminergic neurons Control embryos were injected with an equal amount of standard control morpholino (ctr-MO, Gene Tools). To reveal additional transcription factors that characterize the The efficiency of the arxE2I2-MO was verified by RT-PCR using identity of the distinct catecholaminergic (CA) neuronal groups, cDNA synthesized from 24 and 96 hpf embryos injected with ctr- and that may contribute to specification and differentiation of MO, arxE2I2-MO or arxE2I2-MOþp53-MO (Fig. S1A). The follow- these groups, we searched public databases for transcription ing primers were used: factors with expression domains in anatomical regions containing CA neurons. We selected candidate transcription factors predo- arx_F: 50–GAGCGCAAAGTTTACCAGCACCC–30 (anneals to minantly based on information in the Zebrafish Model Organism exon 1) Database ZFIN (http://zfin.org), but also included in our analysis arx_R: 50–CGCTTCTGTCAGATCCAGCCTCATC–30 (anneals to some genes that have been previously linked to CA development exon 3) in other vertebrate systems (Table 1). We analyzed the expression of each gene with relation to CA neurons in whole fixed embryos The efficiency of Isl1 knockdown was verified directly by by fluorescent in situ hybridization, followed by immunofluores- immunohistochemistry, using a mouse monoclonal anti-Isl1/2 cence for anti-Tyrosine Hydroxylase (TH), the rate-limiting antibody (1:400; 39.4D5 Developmental Studies Hybridoma Bank, enzyme in CA synthesis, to visualize CA neurons. The brains of Iowa, USA). A goat anti-mouse secondary antibody conjugated whole mount zebrafish embryos were analyzed by confocal with Alexa488 (Molecular Probes) was used to detect the anti- microscopy. We chose four developmental stages (24, 48, 72 138 A. Filippi et al. / Developmental Biology 369 (2012) 133–149

Fig. 3. Expression of transcription factors characterizing DA neurons of the ventral diencephalon (groups 2–7). A and B: overviews are like in Fig. 1A,B. Here, the diencephalic groups from 2 to 6 are framed by a circle in A, group 7 in the caudal hypothalamus is indicated by an arrow. In B, group 7 is not comprised in the optical planes used to generate the z-projection, and the other groups are numbered according to Rink and Wullimann (2002). At the left side of each row the analyzed transcription factors are indicated (see results). Abbreviations: HB, hindbrain; PO, preoptic group; Pr, pretectal group; T, tectum; TC, telencephalic cluster; 1-7; diencephalic DA neuronal groups 1 to 7. All images from C to S are dorsal views, anterior is to the left. All larvae are shown at 96 hpf, unless specified. Scale bars: 50 mm. and 96 hpf) for analysis, representing the formation of the earliest synthesized predominantly through the activity of TH, as the CA neurons (24 hpf) until full development of all larval CA groups expression of the paralogous th2 gene has been shown to be very (96 hpf) (Holzschuh et al., 2001). During these stages dopamine is weak during early development (Chen et al., 2009; Filippi et al., A. Filippi et al. / Developmental Biology 369 (2012) 133–149 139

2010). The TH antibody used in our study recognizes the product Prethalamic DA group of the th gene only, but detects the majority of embryonic and early larval DA neurons. We will structure the report on the Two studies have previously investigated transcription factor results of our expression analysis by the major subdivisions of the expression in prethalamic A13 DA neurons in mouse (Andrews brain, addressing each embryonic and larval CA group. While et al., 2003; Grimm et al., 2004). The expression of arx, a member co-expression of transcription factors and TH in CA neurons was of the aristaless family of transcription factors, was reported in analyzed at several stages, the presentation is focused on the A13 DA neurons based on microarray data (Grimm et al., 2004). 96 hpf stage, when all CA groups are developed. If not specifically Our results show that arx is also co-expressed with TH in all indicated, we observed co-expression also at earlier stages as zebrafish prethalamic DA neurons (Fig. 2C–D00). soon as TH and transcription factor expression become A marker for prethalamus is dlx gene expression (Puelles and detectable. Rubenstein, 2003). The role of Dlx proteins in prethalamic A13 DA neuron development has been investigated in mouse (Andrews et al., 2003). Our analysis revealed that zebrafish prethalamic DA neurons express both dlx2a and dlx5a (Fig. 2E–H00). Furthermore, Dopaminergic groups of the telencephalon using double immunohistochemistry, Andrews et al. showed that developing prethalamic DA neurons express DLX1/2, ISL1 and Two groups of DA neurons develop in the zebrafish telence- LHX1/5, as well as PAX6, although this latter factor does not phalon: one in the olfactory bulb (OB, counterpart of mammalian appear to be expressed in all THir neurons. Similarly, in our A16 group) and one in the subpallium (SP) (Fig. 1A,B). Based on analysis, we observed the expression of isl1 (Fig. 2I–J00) and lhx5 histological analysis of TH-immunoreactive (THir) cell distribu- (Fig. 2K–L00) in prethalamic DA neurons. Interestingly, pax6a tion in sectioned material, the subpallial group has been identi- appeared to be expressed only in a subset of DA neurons, but fied to reside in a subpallial region at the boundary between most cells adjacent to prethalamic DA neurons expressed pax6a dorsal and ventral telencephalon of the zebrafish adult brain (Fig. 2O–P00). This finding is similar to that reported for mouse (Kaslin and Panula, 2001; Rink and Wullimann, 2002). In the PAX6 (Andrews et al., 2003). In addition, we found that lhx1a embryonic brain the boundary between pallium and subpallium expression appears to only partially overlap with THir prethala- is not anatomically distinct, and thus difficult to assess on mic neurons (not shown, Fig. 8). Moreover, we observed co- sectioned or whole mount materials. Within the telencephalon, expression of TH with meis2a (Fig. 2M–N00). Meis2 has not been the combined expression of dlx genes discriminates the dorsal and previously linked to prethalamic DA neurons, but has been shown ventral territories of the telencephalon, and can be used to define to be expressed in olfactory bulb DA neurons and other inter- the subpallium (Mueller et al., 2008; Moreno et al., 2009), while neurons in mouse (Allen et al., 2007). These similarities in gene tbr gene expression characterizes the pallium (Mueller et al., expression suggest that the molecular mechanisms controlling DA 2008). We observed that all telencephalic DA neurons outside the specification and differentiation in the prethalamus are conserved olfactory bulb express both dlx2a and dlx5a (Fig. 1C–F00), whereas between fish and mammals, and support the idea that zebrafish they do not express tbr1b (Fig. 1G–H00). This observation provides prethalamic DA neurons are homologous to the mammalian A13 molecular evidence that these DA neurons are restricted to the DA group. subpallial territory. In addition, we found that subpallial DA neurons also express sox2 (Okuda et al., 2006) (not shown), while Posterior tubercular and hypothalamic Otp-dependent groups etv1/er81 (Roussigne´ and Blader, 2006) is expressed in a subset of subpallial DA neurons (Fig. 1I,J). The DA groups 2–7 reside in the basal plate of the diencepha- We investigated only some representative markers in the case lon, extending from the posterior tuberculum to the hypothala- of the OB DA neurons, which are located in a highly conserved mus (Rink and Wullimann, 2002) (see Fig. 3A,B for anatomical and well understood anatomical region of the brain (data not orientation). Group 2 DA neurons are the earliest th-expressing shown). We observed in OB DA neurons co-expression of some cells to appear in the ventral diencephalon at around 19 hpf transcription factors that have been previously linked to periglo- (Holzschuh et al., 2001), followed by groups 3, 4 and 6, all merular DA neuron development in rodents, including arx detectable by 48 hpf. It has been shown that groups 2, 4, 5 and (Yoshihara et al., 2005), dlx5a (Allen et al., 2007) and pax6a 6 express the transcription factor otp (Del Giacco et al., 2006; Ryu (Kohwi et al., 2005)(Fig. 8). All OB DA neurons express etv1/ et al., 2007), which is essential for their specification (Ryu et al., er81 (Fig. 1K,L), a finding in line with previous reports showing 2007). In mice, the only DA group that specifically expresses Otp that etv1 is expressed in mouse OB DA neurons and contributes to and is affected in homozygous Otp mutant embryos is the A11 their differentiation (Flames and Hobert, 2009). group in the dorsal diencephalon. Interestingly, A11 DA neurons also express Nkx2.1, a hypothalamic and telencephalic marker (Ryu et al., 2007), which led to the hypothesis that the mouse A11 Dopaminergic groups of the diencephalon DA group would be a migrated group of hypothalamic origin. In zebrafish, as a result of the teleost genome duplication, two In zebrafish, DA neurons in the diencephalon have been orthologs of Nkx2.1 can be found, named nkx2.1a and nkx2.1b. distinguished according to their anatomical position, cell shape, nkx2.1a is exclusively expressed in the hypothalamus, whereas and degree of TH-immunoreactivity (Rink and Wullimann, 2002). nkx2.1b can be detected also in the telencephalon. Our results We follow this numeric nomenclature to designate the groups of show that the DA groups 2 and 4 at 48 hpf are not comprised DA neurons that arise in the prethalamus (group 1, alar plate), in within the broad nkx2.1a hypothalamic domain (shown in the posterior tuberculum and hypothalamus (groups 2–7, basal Fig. 3G,H), but they do express nkx2.1b at earlier stages plate), the pretectum (group 8, alar plate), and the preoptic region (Fig. 3C–D00, 28 hpf). Unfortunately, we were not able to obtain a (several groups in magnocellular and parvocellular preoptic good signal for nkx2.1b by fluorescent in situ hybridization at nuclei; not numbered). Recently, a different numbering for the 48 hpf and later stages, due to a very low expression level in the DA groups was employed (Chen et al., 2009; Sallinen et al., 2009), diencephalon. Therefore we limited the analysis to the 28 hpf but here we will keep the original nomenclature in order to avoid stage, when the few detectable THir neurons are group 2 DA confusion. neurons. In contrast, the more caudal Otp-dependent DA groups 140 A. Filippi et al. / Developmental Biology 369 (2012) 133–149

5 and 6 co-expressed nkx2.1a (shown for group 6 in Fig. 3H). Ventral hypothalamic and preoptic DA groups Compared to the findings in mouse, we suggest the zebrafish data to reflect subfunctionalization of the nkx2.1a und nkx2.1b para- The liquor-contacting DA neurons of group 3 clearly develop logous genes, with either nkx2.1a or nkx2.1b expressed in subsets within the hypothalamic nkx2.1a expression domain and co- of zebrafish A11-type neurons. Our finding further supports the express this transcription factor (Fig. 3M–M00). Therefore, DA notion that zebrafish DA groups 2 and 4 are homologous to group 3 belongs to the hypothalamus proper, and not to the mammalian A11 DA neurons. posterior tuberculum, as originally suggested by Rink and At the same stage, the LIM homeobox transcription factor lhx5 Wullimann (2002). Group 3 DA neurons also expressed nkx2.2a (Toyama et al., 1995a; Machluf et al., 2011) was strongly (Fig. 3O-O00). Similar to reports for Xenopus, nkx2.2a was expressed expressed in a diencephalic domain dorsal and medial to the adjacent to otp-expressing cells (Dominguez et al., 2011), but not group 2 THir neurons, which appeared to lie outside of the main co-expressed with TH in zebrafish DC2/4-6 DA neurons. lhx5 domain but still expressed low levels of lhx5 transcripts We further observed pou50/pou3f1 and prox1a quite selectively (Fig. 3E–F00). Thus, group 2 DA neuron progenitors may arise in the expressed in the group 3 region (Fig. 3P–Q00), while sox2 was lhx5-expressing domain and downregulate its transcription dur- expressed in a broader domain along the midline that also ing terminal differentiation. In contrast, the posterior groups 4–6 includes group 3 cells (Fig. 3R–R00). were strongly and quite specifically labeled by the expression of Finally, we observed the expression of dlx5a in both group 3 the LIM homeodomain transcription factor lhx1a (Fig. 3I–J00), as (Fig. 3N–N00) and group 7 DA neurons, the latter representing a well as at lower levels by lhx5 (Fig. 3K–L). Lhx1/Lim1 has population of liquor-contacting cells lining the ventricle of the previously been invoked in hypothalamic DA neuron develop- posterior recess in the caudal hypothalamus (Fig. 3S–S00). Similar ment (Ohyama et al., 2005). to dlx5a, dlx2a was also broadly expressed in the hypothalamus

Fig. 4. Expression of transcription factors characterizing DA neurons of the preoptic area and the pretectum. A: lateral overview is like in Fig. 1A. Here, the pretectal (Pr) and preoptic (PO) groups are framed by circles. B and C are dorsal z-projections encompassing the optical planes through the PO area (B, 34 mm projection) and the pretectum (C, 25 mm projection). D–G00 and H–L00 are higher magnified dorsal views of the PO (7–11 mm projections) and Pr (7–9 mm projections), respectively, at 96 hpf. The analyzed genes are indicated at the left side of each row. Abbreviations: ac, anterior commissure; AC, amacrine cells of the retina; HB, hindbrain; LC, locus coeruleus; PO, preoptic group; poc, postoptic commissure; Pr, pretectal group; T, tectum; TC, telencephalic cluster; vDC, ventral diencephalic cluster. Anterior is to the left. Scale bars: 50 mm. A. Filippi et al. / Developmental Biology 369 (2012) 133–149 141 adjacent to, but not co-localizing with, groups 3 and 7 DA and mouse A13 DA neurons (Andrews et al., 2003). This suggests neurons. This suggests that, despite the extensive overlap of their that also the molecular pathways driving DA specification and expression domains, dlx2a and dlx5a might be involved in the differentiation in the prethalamus may be conserved between fish development of different cellular subtypes in the hypothalamus. and mammals. Therefore, we wanted to study the role of genes Additional ventral diencephalic DA groups develop in the that, based on their expression, are potentially involved in preoptic (PO) area. In the adult zebrafish brain, the PO group is prethalamic DA differentiation. Among the transcription factors large and extends from the anterior part of the preoptic area, characterizing zebrafish group 1 DA neurons, arx and isl1 expres- close to the anterior commissure, to its posterior part until it sion have been reported in mouse A13 DA group (Andrews et al., reaches the postoptic commissure. The PO group is likely com- 2003; Grimm et al., 2004), but their roles in DA differentiation posed by at least two populations of cells (Ma, 2003; McLean and have not been assessed. Fetcho, 2004). The earliest PO neurons detectable in the zebrafish embryo develop in the posterior part of the preoptic area, dorsal Arx is required for the formation of DA neurons in the prethalamus to the optic chiasm, and their axonal projections join the post- and in the preoptic area optic commissure. These early neurons likely comprise the posterior population located in the suprachiasmatic nucleus in We knocked down Arx expression by antisense morpholino the adult brain. We have previously shown that the PO neurons microinjections and analyzed DA neuron development in mor- express the orphan nuclear receptors nr4a2a and nr4a2b, both of phant larvae by in situ hybridization to th and anti-TH immuno- which are required for the specification of the neurotransmitter histochemistry at 72 and 96 hpf (Fig. 5A L,U). We observed a phenotype (Filippi et al., 2007). In addition, we observed co- significant decrease in the number of both prethalamic (Fig. 5A–I, expression of TH with arx (Fig. 4D–D00), dlx2a (Fig. 4E–E00), dlx5a arrows) and preoptic DA group neurons (Fig. 5J–L). The same (Fig. 4F–F00), and six3a (Fig. 4G–G00), as well as pou47/pou3f2 (not phenotype was obtained with both the splice site and the shown, Fig. 8). Furthermore, lhx1a was expressed in cells adjacent translation targeting morpholinos (Fig. 5U, see materials and to these PO DA neurons (data not shown, Fig. 8), potentially methods). This result was not caused by non-specific cell death, representing a population of lhx1a- and lhx5-positive neurons that as the same effect was observed in larvae co-injected with p53- has been suggested to give rise to additional DA neurons (Dulcis MO, which prevents the p53-mediated apoptosis induced by and Spitzer, 2008). some morpholinos (Robu et al., 2007)(Fig. 5C,F,I,L). Surprisingly, the DA neurons in the olfactory bulb appeared to develop fairly Pretectal DA groups normal, in contrast to reports in mouse, where Arx mutants displayed a loss of th-expressing periglomerular cells (Yoshihara In the zebrafish pretectum (Pr, alar plate, prosomere 1; et al., 2005). Fig. 4A,C), a DA group develops that has no direct counterpart in To investigate whether also other DA differentiation markers the mature mammalian brain, although in the embryonic human were affected in arx morphant embryos, we analyzed the expres- a transient population of TH-expressing cells develops adjacent to sion of slc6a3/dat (specific marker of DA neurons) and ddc the posterior commissure (Puelles and Verney, 1998). In agree- (general marker of aminergic neurons, labeling also serotonergic ment with its position remote from other forebrain groups, Pr DA cells). We found that the prethalamic expression domains of neurons were found to co-expressed a number of transcription slc6a3/dat (Fig. 4M–P) and ddc (Fig. 4Q–T) were also reduced in factors not found in other groups: emx2, gata3, otx1b, otx2, and morphant larvae when compared to controls. Thus, Arx appears to zic1 (Fig. 4H–L00). Among these, otx2 appeared to be weakly be essential for proper expression of the DA neurotransmitter expressed only in some THir neurons, suggesting that it may play phenotype in the prethalamus. a role in DA neurons progenitors only. The transcription factor zic2a in the Pr had an expression pattern similar to that of zic1, Knockdown of Isl1 leads to a reduction of prethalamic DA neurons but was more weakly expressed and may have labeled only a subset of DA neurons (Fig. 8; data not shown). However, Pr DA Functional inhibition of Isl1 by morpholino injection resulted neurons also share expression of some more broadly expressed in a significant decrease in th expression in the prethalamus, as transcription factors with other groups, including pbx1a, pou12/ assessed by in situ hybridization (Fig. 6A–F,R) and immunohis- pou3f3 and pou47/pou3f2, and nr4a2 (Fig. 8). In contrast we tochemistry (Fig. 6G–I) at 96 hpf. The analysis of slc6a3/dat observed only partial overlap with the LIM homeodomain tran- (Fig. 6J–M) and ddc (Fig. 6N–Q) expression also showed a reduc- scription factors lhx1a and lhx5 (Fig. 8). tion of their prethalamic domains, arguing for a role of isl1 in the formation of group 1 DA neurons. This result was confirmed by sa0029 Noradrenergic groups of the hindbrain the analysis of th expression in the isl1 mutant line (de Pater et al., 2009), which also displayed a reduction of prethalamic DA Only noradrenergic (NA) neurons develop in the zebrafish neurons (Fig. S2). In addition, isl1 morphant larvae displayed a hindbrain, one group in the locus coeruleus (LC) and another drastic reduction of ddc expression in the epiphysis (Fig. 6N,P, large and diverse population in the caudal medulla oblongata arrowheads), indicating that Isl1 function is essential for the (MO). The expression of lmx1b.1 and tfap2a in zebrafish LC and development of serotonergic neurons in this organ as well. MO NA neurons has been previously reported by our group (Holzschuh et al., 2003; Filippi et al., 2007). Among the transcrip- Prethalamic dorso/ventral patterning is impaired in Arx morphants tion factors considered in the present study, we detected tran- scripts of meis2a, pbx1a and pou47/pou3f2 in LC NA neurons As both Arx and Isl1 knockdown resulted in a similar DA (Fig. 8, data not shown). In addition, we observed partial overlap phenotype in the prethalamus, we asked whether they may act in of TH with pbx1a and lhx1a in the MO (Fig. 8, data not shown). the same pathway and might regulate each other. When we analyzed isl1 expression in arx morphant larvae at 72 hpf, we did Analysis of Arx and isl1 functions in DA neurons development not observe any significant difference compared to controls (Fig. S3A,B). In the reciprocal experiment, arx prethalamic expression Our expression analysis revealed a remarkable conservation of was also not affected by Isl1 knockdown at 72 hpf (Fig. S3I,J). As it the transcription factor code characterizing prethalamic zebrafish has been recently shown in mouse that Isl1 directly regulates Arx 142 A. Filippi et al. / Developmental Biology 369 (2012) 133–149

Fig. 5. arx is required for the formation of DA neurons in the prethalamus and in the preoptic area. Morpholino-injected embryos were analyzed by WISH to detect th (A-F, 96 hpf), slc6a3/dat (M-P, 72 hpf) or ddc (Q-T, 72 hpf) expression, as well as by anti-TH immunofluorescence (G-L, 72 hpf). Arx knockdown by Morpholino injection results in a reduction in the number of prethalamic group 1 DA neurons (arrows in B, E, H) and of the preoptic group (K, arrowhead points to the postoptic commissure). This phenotype is not caused by Morpholino off-target p53-mediated cell death, as we obtain the same result when co-injecting p53-MO as a control (C, F, I, L). Moreover, the prethalamic expression domains of slc6a3/dat (M–P) and ddc (Q–T) are also reduced in morphant embryos when compared to controls (arrows point to the prethalamus). U: Evaluation of the effect of Arx knockdown on th expression for each DA cluster. Both ATG (left) and splice (right) targeting morpholinos affected DC1 and PO groups development, also when co-injected with the p53-MO (þ). The groups of the arx morphant larvae were compared with those of control MO injected larvae, which all developed normally and are summarized here in the left-most lanes (ctr). A–C,M,N,Q,R are lateral views; D–L, O, P, S, T are dorsal views; anterior is to the left. Scale bars: 100 mm. Abbreviations: AC, amacrine cells; DC1-6, diencephalic groups 1–6; LC, locus coeruleus; MO, medulla oblongata; OB, olfactory bulb; PO, preoptic area; poc, postoptic commissure; Pr, pretectum; SP, subpallium; TC, telencephalic cluster; vDC, ventral diencephalic cluster. transcription in the pancreatic islet (Liu et al., 2011), we also Next, we checked whether other transcription factors analyzed arx expression in the developing pancreas of isl1MO- expressed in prethalamic DA neurons are dependent on Arx or injected embryos at 30 hpf and observed that it was strongly Isl1 function. We did not observe any change in dlx2a and dlx5a downregulated (inset in Fig. S4A,B). Its prethalamic expression, expression in arx and isl1 morphant embryos (Fig. S3C–F and instead, was not affected at this stage either (Fig. S4A-D, arrows), K–N), suggesting that general brain patterning is not impaired by suggesting that Isl1 regulates arx expression in the pancreas but Arx and Isl1 knockdown. Further, we did not observe significant not in the prethalamus. Thus, Arx and Isl1 appear to influence DA changes in meis2a expression, neither in arx (Fig. S3G,H) nor neuron development in the prethalamus independently. in isl1 (Fig. S3O,P) morphant embryos. The analysis of pax6a A. Filippi et al. / Developmental Biology 369 (2012) 133–149 143

Fig. 6. Knockdown of Isl1 leads to a reduction of prethalamic DA neurons. The analyses of th expression (A–F) and of TH protein distribution (G–I) show a significant reduction in the number of prethalamic group 1 DA neurons (arrows) in the morphant embryos (B, C, E, F, H, I) compared to the controls (A, D, G). Similarly, slc6a3/dat (J–M) and ddc (N–Q) display a reduction of their prethalamic expression domains in Isl1 morphants (arrows, compare J with L and K with M for slc6a3/dat; N with P and O with Q for ddc), arguing for a role of isl1 in the specification of group 1 DA neurons. In addition, ddc expression in the epiphysis is lost in the morphants (arrowheads, compare N with P). The embryos were analyzed at 96 hpf. R: Evaluation of the effect of Isl1 knockdown on th expression for each DA cluster. The groups of the isl1 morphant larvae were compared with those of control MO injected larvae, which all developed normally and are summarized here in the left-most lanes (ctr). A–C, J, L, N, P are lateral views; D–I, K, M, O, Q are dorsal views, anterior is to the left. Scale bars: 100 mm. Abbreviations are like in Fig. 5. 144 A. Filippi et al. / Developmental Biology 369 (2012) 133–149 expression, however, revealed a specific downregulation of its prethalamic region of arx morphants (Fig. 7C1–D2 and S5C,D, prethalamic domain in arx morphants compared to controls, at arrows), whereas no differences, neither in pax6a nor in lhx1a both 30 (Fig. 7A1–B2, arrows) and 72 hpf (Fig. S5A,B, arrows). This expression, were observed in isl1 morphant embryos compared to reduction was restricted to the prethalamus, as all other pax6a the controls (Fig. S6A–H). Conversely, the expression of the expression domains appeared unaffected by Arx knockdown. ventral marker nkx2.2a appeared significantly expanded at Similarly, we observed a reduction of lhx1a expression in the the level of the prethalamus in arx morphants compared to the

Fig. 7. Patterning defects in the prethalamus of arx morphants. Embryos were analyzed by WISH at 30 (A1–D2, K1–L2) or 48 (E1–J2) hpf. The prethalamic expression domains of pax6a (A1–B2, arrows) and lhx1a (C1–D2, arrows) were significantly reduced in arx morphant embryos (B1, B2, D1, D2) compared to controls (A1, A2, C1, C2), whereas an increase in nkx2.2a (E1–F2) expression could be observed at 48 hpf in the prethalamus of arx morphants (F1, F2, arrowhead) compared to controls (E1, E2). olig2 (G1-H2) expression was not perturbed by Arx knockdown at 48 hpf. A specific reduction of gad1/2 (I1–J2) and ascl1a (K1–L2) expression was observed in the prethalamus of the morphants at 48 and 30 hpf, respectively. Abbreviations: HB, hindbrain; Hyp, hypothalamus; PTh, prethalamus; T, tectum, Th, Thalamus; TC, telencephalon. A1-L1 are lateral views; A2-L2 are dorsal views. Anterior is to the left. Scale bars: 100 mm. A. Filippi et al. / Developmental Biology 369 (2012) 133–149 145 controls (Fig. 7E1–F2 and S5E,F, arrowheads), whereas it remained The pretectal DA group is characterized by the transcription unaffected by Isl1 knockdown (Fig. S6I-J). factors emx2, gata3, otx1b, otx2, and zic1, providing it with a Our results suggest that Arx may play a role in dorso/ventral molecular identity very distinct from other DA groups. zic1 patterning of the prethalamus. Arx function appears restricted to defines the position of this group to be in the dorsal region of this area, as the expression of olig2, another Shh-dependent prosomere 3 (Ferran et al., 2007). factor, did not reveal abnormalities in the formation of the zona With respect to Otp-dependent DA neurons, an open question limitans intrathalamica or in the size of other adjacent brain has been the origin of this group in the posterior tuberculum at territories in arx morphants embryos compared to controls the alar/basal plate boundary. In mammals, the Otp-dependent (Fig. 7G1–H2). Arx knockdown does not affect the pattern of A11 DA neurons are located in the alar plate, but they co-express general neuronal differentiation, as assessed by elavl3 expression Nkx2.1, which suggested a migrated hypothalamic origin (Ryu (Fig. S7A-D). et al., 2007). The expression of nkx2.1b in subsets of DC2 and DC4, To determine whether prethalamic neuronal types other than and of nkx2.1a in DC5/6 neurons support the common hypotha- DA might be affected by Arx knockdown, we analyzed the lamic origin of all Otp-dependent DA groups. Further, we find distribution of GABAergic and glutamatergic markers in arxMO lhx1a, lhx1b and lhx5 expressed in most of Otp-dependent DA injected embryos. Whereas expression of vglut2 did not reveal any neurons, indicating that Lhx family genes may contribute to abnormalities in the distribution of glutamatergic groups in the transcriptional specification of DC2 and DC4-6 neurons. Indeed, morphant brains (Fig. S7E-H), the analysis of gad1/2 expression Morpholino knockdown of lhx5 has been shown to affect differ- revealed a significant reduction in the number of prethalamic entiation of Otp-dependent DA neurons (Machluf et al., 2011). GABAergic neurons (Fig. 7I1-J2). Accordingly, also the expression nkx2.1a and nkx2.2a expression in group 3 DA neurons confirms of ascl1a, a zebrafish Mash1 ortholog which is known to drive their anatomical assignment to the medial hypothalamus. DC3 is also GABAergic differentiation in the vertebrate forebrain (Casarosa the only DA group in our study expressing prox1. Interestingly, it has et al., 1999), was affected in arx morphants (Fig. 7K1–L2). While recently been demonstrated that morpholino knockdown of Prox1 the intensity of ascl1a staining in the forebrain overall appeared results in a reduction of Otp-dependent DA neurons (Pistocchi et al., to be slightly reduced in arx morphants, the ascl1a prethalamic 2008). Our finding that prox1a isexpressedonlyinDC3butnotinthe expression domain was particularly affected (Fig. 7K1–L2, Otp-dependent DA neurons (DC2, 4–6) suggests that Prox1a may act arrows). This suggests that Arx function is required for ascl1a non-cellautonomously, or may only be expressed in precursors of proneural activity in the prethalamus. these cells but not in mature Otp-dependent DA neurons. The In summary, our results suggest that the inhibition of Arx activity expression of dlx5a in DC3 and DC7 hypothalamic DA neurons reveals leads to an impairment of dorso/ventral patterning of the prethalamic that zebrafish hypothalamic groups share dlx5a as a potential domain and loss of prethalamic DA and GABAergic neurons. The role transcriptional determinant with mammalian Dlx5 expressing arcuate of Isl1 in prethalamic DA differentiation appears independent of Arx. nucleus DA neurons (Yee et al., 2009), and may thus relate to the A12 group. We also asked whether there may be additional subgroups, or Discussion molecular heterogeneities among the DA groups initially defined by anatomical location. Most anatomically defined groups appear In this study, we have systematically analyzed the expression to coincide with group-specific common transcription factor of transcription factors in DA neurons of zebrafish larvae to define signatures (Fig. 8). However, we also observed expression of the molecular identity of each DA neuronal group. Our study transcription factors in subsets of DA neurons within a group provides insights into four aspects of DA systems development. only, either separating domains, or appearing in a salt-and- First, we identified sets of transcription factors characteristic for pepper fashion. This is indicated in Table 8 by ‘‘þ/a’’ for over- each anatomically distinct group of DA neurons. This knowledge lapping expression only in a subset of THir cells in the considered makes it easier to compare zebrafish DA groups with those in area. In some cases, this may represent true heterogeneity, as for other vertebrate systems. Second, we analyzed our data to example with arx positive and arx negative subpallial DA neurons. determine whether they may define new DA subtypes. Third, However, these findings may also be caused by the fact that DA we will discuss potential transcriptional codes by which families neurons are continuously added to most of the groups during the of transcription factors may act together in DA differentiation. developmental stages analyzed (Mahler et al., 2010). Therefore, Fourth, we have investigated the function of the Arx and Isl1 fully matured neurons may be located next to TH expressing transcription factors in prethalamic DA neurons and demonstrate neurons that just exited the precursor population, and may still that both are essential for DA differentiation. express precursor-specific transcription factors. Fig. 8 gives an overview on transcription factor expression in Fig. 8 does not provide any evidence for a core transcriptional code specific DA neuron groups. The table focuses on transcription factors that would be common to all or most DA neuronal groups in that are informative with respect to regional identities in the brain. zebrafish. However, the overview suggests that there are combina- It also includes some previously published data, however, we did not tions of transcription factor families that specify several DA groups. consider transcription factors transiently expressed, or expressed These families include dlx genes, lhx/lim genes, nkx genes, pou3 class during neurogenesis before onset of TH expression, like ngn1 (Jeong genes, and some nuclear orphan receptors in the diencephalon. In the et al., 2006). The data confirm previously published anatomical telencephalon it is only etv1. On the other hand, genes like otp, sim1, correlations between DA groups in zebrafish and mammals, and gata3, otx or zic2a appear to be specific to DA groups in restricted resolve several open issues with respect to group identities. brain regions only. Combining these two observations, we speculate For the subpallial DA group, the expression of dlx2a and dlx5a that DA neuronal differentiation may be specified by a combination of confirms that all neurons of this DA group, which extends along the region-specific members of a small shared group of transcription subpallial/pallial border, actually reside within the subpallium factor families that may contribute to DA identity, in combination (Mueller et al., 2008). Thus, this group is indeed a restricted with selected region-specific factors that may attribute characteristic endostriatal DA system. etv1 expression in both OB and subpallial features (e.g. projection patterns) to each DA group. DA neurons suggests that an evolutionary ancient code for DA Finally, we analyzed in detail the contribution of transcription development is used in the telencephalon that dates back to factors identified in this study to differentiation of prethalamic DA nematodes (Flames and Hobert, 2009). neurons. Our analysis indicates that similar molecular codes appear 146 A. Filippi et al. / Developmental Biology 369 (2012) 133–149

Fig. 8. Summary of the expression analysis of the considered transcription factors relative to each THir group. For each transcription factor, only the results relative to the latest stage analyzed are reported here. ‘‘þ’’ (red) indicates overlapping expression of transcription factor and TH; ‘‘-‘‘ (light grey) indicates no co-expression; ‘‘a’’ (blue) indicates TH immunoreactivity and gene expression in adjacent cells, but no co-expression; ‘‘þ/a’’ (orange) indicates overlapping expression only in a subset of THir cells in the considered area; ‘‘þ/low’’ (yellow) indicates likely co-expression but low signal intensities, only slightly above the background level, therefore the result is difficult to interpret. ‘‘low/‘‘ (grey) indicates low expression levels and likely no co-expression. Dark grey shade for nkx2.1b indicates that these CA groups are not differentiated at time of analysis (28 hpf). The table also includes data of transcription factor expression already published elsewhere: (1) (Filippi et al., 2007); (2) (Ryu et al., 2007); (3) (Lohr et al., 2009). Abbreviations: OB, olfactory bulb; SP, subpallium; PTh 1, prethalamic group 1; PO, preoptic group; ACL, amacrine cell layer; Pr, pretectum; Hy 3, hypothalamic group 3; Hy 7, hypothalamic group 7; DC2,4,5,6, diencephalic groups 2,4,5,6; LC, locus coeruleus; MO, medulla oblongata; n.d., not determined. to specify zebrafish DA group 1 and mouse A13 DA neurons in the Drosophila islet-1 is expressed in a subset of differentiated DA and prethalamus. Indeed, zebrafish prethalamic DA neurons express a set serotonergic interneurons in the ventral nerve cord (Thor and of transcription factors (dlx2a/5a, lhx1/5, isl1, and in part also pax6a) Thomas, 1997). In islet-1 mutants these DA and serotonergic neurons that have been shown to be required for proper specification and/or lose their transmitter identity and characteristic axonal projection differentiation of mouse A13 neurons (Mastick and Andrews, 2001; pattern. Targeted expression of Isl in postmitotic cells of islet-1 Andrews et al., 2003). In addition, we found that group 1 DA cells mutantsisabletorescueTH,Serotonin, and Ddc expression, indicat- express arx, a member of the aristaless family of transcription factors ing that Isl function in Drosophilamaybedirectlyinvolvedinthe (Sherr, 2003). Previously, only microarray expression analysis has transcriptional control of these neurotransmitters (Thor and Thomas, linked arx expression to A13 DA neurons in mice (Grimm et al., 2004). 1997). In our isl1 morphant embryos, the expression of dcc (a marker In their analysis of the role of DLX factors during A13 DA neuron which labels both catecholaminergic and serotonergic neurons) was development, Andrews et al. (2003) proposed a model in which two absent not only in the prethalamic area but also in the pineal gland parallel transcriptional pathways drive differentiation in the pretha- (see Fig. 6N,P), an organ where isl1 is prominently expressed (Inoue lamus. In one pathway, the expression of DLX1/2 in progenitors cells et al., 1994). These findings together point towards a conserved role and mature neurons controls ISL1, PAX6 and TH expression. In a of Isl1 in neuronal differentiation of a subset of DA as well as second pathway, PAX6 expression in progenitors is responsible for serotonergic neurons. LHX1 expression in neurons. Our knockdown experiments of Arx and Arx appears to function in prethalamic DA development by a Isl1 function have revealed that they are both required for TH different mechanism. Whereas most of the analyzed markers (dlx2a, expression in prethalamic DA neurons, but they appear to act in dlx5a, isl1, meis2a, olig2, elavl3) appeared normal in Arx morphant independent parallel pathways, as neither factor is required for the embryos, we could observe a specific reduction of prethalamic pax6a expression of the other. expression, accompanied by a similar reduction of lhx1a in the same The loss of Isl1 function did neither result in diencephalic area. Thus Arx may be acting upstream of pax6a at the progenitor morphological defects nor affect the expression of any of the analyzed level, and contribute to the activation of lhx1a expression in transcription factors, suggesting that Isl1 may contribute to a late differentiated neurons, indicating a pathway similar to the one phase in DA differentiation. This would be consistent with the suggested by Andrews et al. (2003). Moreover, Arx knockdown observed ISL1 expression in mouse, which is restricted to the neuron resulted in dorsal expansion of the nkx2.2a expression domain, layer of the prethalamus (Andrews et al., 2003). In a similar fashion indicating ventralization of the prethalamus. This effect could be A. Filippi et al. / Developmental Biology 369 (2012) 133–149 147 due to downregulation of pax6a, or to a lack of repression of nkx2.2a Adolf, B., Bellipanni, G., Huber, V., Ballycuif, L., 2004. atoh1.2 and beta3.1 are two by Arx, given that Arx has been shown to be able to act both as a new bHLH-encoding genes expressed in selective precursor cells of the zebrafish anterior hindbrain. Gene Expr. Patterns 5, 35–41. repressor or an activator (Seufert et al., 2005; McKenzie et al., 2007). Akimenko, M.A., Ekker, M., Wegner, J., Lin, W., Westerfield, M., 1994. Combinator- In mice, knockout of Arx results in a significant reduction of ial expression of three zebrafish genes related to distal-less: part of a homeo- Dlx1 expression domains in the prethalamus and hypothalamus at box gene code for the head. J. Neurosci. 14, 3475–3486. E12.5, with consequent loss of anterior thalamic structures and Allen, Z.J., Waclaw, R.R., Colbert, M.C., Campbell, K., 2007. Molecular identity of olfactory bulb interneurons: transcriptional codes of periglomerular neuron expansion of the third ventricle by E19.5 (Kitamura et al., 2002). subtypes. J. Mol. Histol. 38, 517–525. Our Arx knockdown experiments, instead, did not affect the Allende, M.L., Weinberg, E.S., 1994. The expression pattern of two zebrafish expression of dlx genes, consistent with the finding that Dlx genes achaete-scute homolog (ash) genes is altered in the embryonic brain of the cyclops mutant. Dev. Biol. 166, 509–530. act upstream of Arx and regulate Arx expression in the developing Ando, H., Kobayashi, M., Tsubokawa, T., Uyemura, K., Furuta, T., Okamoto, H., 2005. mouse forebrain (Cobos et al., 2005; Colasante et al., 2008). Lhx2 mediates the activity of Six3 in zebrafish forebrain growth. Dev. Biol. Besides TH-expressing cells, also prethalamic GABAergic neu- 287, 456–468. Andrews, G.L., Yun, K., Rubenstein, J.L., Mastick, G.S., 2003. Dlx transcription rons were affected by Arx knockdown. As Arx has been shown to factors regulate differentiation of dopaminergic neurons of the ventral play a crucial role in GABAergic development (Friocourt and thalamus. Mol. Cell. Neurosci. 23, 107–120. Parnavelas, 2010), our data indicate that Arx function is conserved Ang, S.L., 2006. Transcriptional control of midbrain dopaminergic neuron devel- opment. Development 133, 3499–3506. in this respect. However, such function appears to be restricted to Barth, K.A., Wilson, S.W., 1995. Expression of zebrafish nk2.2 is influenced by sonic the prethalamic area in zebrafish, because all other GABAergic hedgehog/vertebrate hedgehog-1 and demarcates a zone of neuronal differ- forebrain territories develop normally. entiation in the embryonic forebrain. Development 121, 1755–1768. The specific reduction of pax6a and lhx1a expression in the Betarbet, R., Turner, R., Chockkan, V., DeLong, M.R., Allers, K.A., Walters, J., Levey, A.I., Greenamyre, J.T., 1997. Dopaminergic neurons intrinsic to the primate prethalamus of arx morphants, and the concomitant expansion of striatum. J. Neurosci. 17, 6761–6768. nkx2.2a domain, suggest that arx may play a role in regional Bjorklund, A., Skagerberg, G., 1979. Evidence for a major spinal cord projection dorsoventral specification. The perturbed local dorsoventral pattern from the diencephalic A11 dopamine cell group in the rat using transmitter- specific fluorescent retrograde tracing. Brain Res. 177, 170–175. may affect the area that will give rise, among others, to group 1 DA Bjorklund, A., Dunnett, S.B., 2007. Dopamine neuron systems in the brain: an neurons. On the other hand, it has been recently shown by update. Trends Neurosci. 30, 194–202. chromatin immunoprecipitation experiments that ARX directly Blin, M., Norton, W., Bally-Cuif, L., Vernier, P., 2008. NR4A2 controls the differ- entiation of selective dopaminergic nuclei in the zebrafish brain. Mol. Cell binds to the TH promoter in transfected neuroblastoma cells Neurosci. 39, 592–604. (Quille´ et al., 2011), suggesting that Arx may be involved in direct Campbell, G., Tomlinson, A., 1998. The roles of the homeobox genes aristaless and regulation of TH expression. The prethalamic DA phenotype we distal-less in patterning the legs and wings of Drosophila. Development 125, 4483–4493. observe in the zebrafish larva may be caused by Arx action at Candy, J., Collet, C., 2005. Two tyrosine hydroxylase genes in teleosts. Biochim. different levels during prethalamic development. This interpretation Biophys. Acta. 1727, 35–44. is consistent with the observation that Arx regulates diverse Casarosa, S., Fode, C., Guillemot, F., 1999. Mash1 regulates neurogenesis in the processes such as regionalization, proliferation, cell differentiation ventral telencephalon. Development 126, 525–534. Cheesman, S.E., Eisen, J.S., 2004. gsh1 demarcates hypothalamus and intermediate and neuronal migration in different model organisms (Campbell and spinal cord in zebrafish. Gene Expr. Patterns. 5, 107–112. Tomlinson, 1998; Kitamura et al., 2002; Melkman and Sengupta, Chen, Y., Priyadarshini, M., Panula, P., 2009. Complementary developmental 2005; Seufert et al., 2005; Tucker et al., 2005; Yoshihara et al., 2005; expression of the two tyrosine hydroxylase transcripts in zebrafish. Histo- chem. Cell Biol. 132, 375–381. Colombo et al., 2007; Friocourt et al., 2008). Cobos, I., Broccoli, V., Rubenstein, J.L.R., 2005. The vertebrate ortholog of Aristaless is regulated by Dlx genes in the developing forebrain. J. Comp. Neurol. 483, 292–303. Acknowledgements Colasante, G., Collombat, P., Raimondi, V., Bonanomi, D., Ferrai, C., Maira, M., Yoshikawa, K., Mansouri, A., Valtorta, F., Rubenstein, J.L.R., Broccoli, V., 2008. Arx is a direct target of Dlx2 and thereby contributes to the tangential We thank the zebrafish community for sharing reagents, and S. migration of GABAergic interneurons. J. Neurosci. 28, 10674–10686. sa0029 Colombo, A., Reig, G., Mione, M., Concha, M.L., 2006. Zebrafish BarH-like genes define Gotter¨ for expert zebrafish care. The isl1 allele was obtained discrete neural domains in the early embryo. Gene Expr. Patterns. 6, 347–352. from the Sanger Zebrafish Mutation Project (http://www.sanger.ac. Colombo, E., Collombat, P., Colasante, G., Bianchi, M., Long, J., Mansouri, A., uk/Projects/D_rerio/zmp/). The anti-Islet1 monoclonal antibody (by Rubenstein, J.L.R., Broccoli, V., 2007. Inactivation of Arx, the murine ortholog T.M. Jessel) was obtained from the Developmental Studies Hybridoma of the X-linked lissencephaly with ambiguous genitalia gene, leads to severe disorganization of the ventral telencephalon with impaired neuronal migra- Bank (The University of Iowa). We thank Thomas Mueller for critical tion and differentiation. J. Neurosci. 27, 4786–4798. discussion, and Martha Manoli and Meta Rath for comments on the de Pater, E., Clijsters, L., Marques, S.R., Lin, Y.-F., Garavito-Aguilar, Z.V., Yelon, D., manuscript. This work was supported by the German Research Bakkers, J., 2009. Distinct phases of cardiomyocyte differentiation regulate growth of the zebrafish heart. Development 136, 1633–1641. Foundation (DFG-SFB780-B6) and by the European Commission Del Giacco, L., Sordino, P., Pistocchi, A., Andreakis, N., Tarallo, R., Di Benedetto, B., (FP7, DOPAMINET, mdDANeurodev, ZFHEALTH). C.J. was supported Cotelli, F., 2006. Differential regulation of the zebrafish orthopedia 1 gene by a fellowship of the government of Thailand. The funders had no during fate determination of diencephalic neurons. BMC Dev. Biol. 6, 50. Dominguez, L., Gonzalez, A., Moreno, N., 2011. Ontogenetic distribution of the role in study design, data collection and analysis, decision to publish, transcription factor nkx2.2 in the developing forebrain of Xenopus laevis. or preparation of the manuscript. Front. Neuroanat. 5, 11. Dulcis, D., Spitzer, N.C., 2008. Illumination controls differentiation of dopamine neurons regulating behaviour. Nature 456, 195–201. Dutta, S., 2005. pitx3 defines an equivalence domain for lens and anterior pituitary Appendix A. Supporting information placode. Development 132, 1579–1590. Escriva, H., Safi, R., Hanni,¨ C., Langlois, M.C., Saumitou-Laprade, P., Stehelin, D., Supplementary data associated with this article can be found in Capron, A., Pierce, R., Laudet, V., 1997. Ligand binding was acquired during evolution of nuclear receptors. Proc. Natl. Acad. Sci. USA 94, 6803–6808. theonlineversionathttp://dx.doi.org/10.1016/j.ydbio.2012.06.010. Ferran, J.L., Sanchez-Arrones, L., Sandoval, J.E., Puelles, L., 2007. A model of early molecular regionalization in the chicken embryonic pretectum. J. Comp. Neurol. 505, 379–403. Filippi, A., Durr,¨ K., Ryu, S., Willaredt, M., Holzschuh, J., Driever, W., 2007. References Expression and function of nr4a2, lmx1b, and pitx3 in zebrafish dopaminergic and noradrenergic neuronal development. BMC Dev. Biol. 7, 135. Filippi, A., Mahler, J., Schweitzer, J., Driever, W., 2010. Expression of the paralogous Adamska, M., Le´ger, S., Brand, M., Hadrys, T., Braun, T., Bober, E., 2000. Inner ear tyrosine hydroxylase encoding genes th1 and th2 reveals the full complement and lateral line expression of a zebrafish Nkx5-1 gene and its downregulation of dopaminergic and noradrenergic neurons in zebrafish larval and juvenile in the ears of FGF8 mutant, ace. Mech. Dev. 97, 161–165. brain. J. Comp. Neurol. 518, 423–438. 148 A. Filippi et al. / Developmental Biology 369 (2012) 133–149

Fjose, A., Izpisu´ a-Belmonte, J.C., Fromental-Ramain, C., Duboule, D., 1994. Expres- Luo, G.R., Chen, Y., Li, X.P., Liu, T.X., Le, W.D., 2008. Nr4a2 is essential for the sion of the zebrafish gene hlx-1 in the prechordal plate and during CNS differentiation of dopaminergic neurons during zebrafish embryogenesis. Mol. development. Development 120, 71–81. Cell Neurosci. 39, 202–210. Flames, N., Hobert, O., 2009. Gene regulatory logic of dopamine neuron differ- Ma, P.M., 2003. Catecholaminergic systems in the zebrafish. IV. Organization and entiation. Nature 458, 885–889. projection pattern of dopaminergic neurons in the diencephalon. J. Comp. Flames, N., Hobert, O., 2011. Transcriptional control of the terminal fate of Neurol. 460, 13–37. monoaminergic neurons. Annu. Rev. Neurosci. 34, 153–184. Machluf, Y., Gutnick, A., Levkowitz, G., 2011. Development of the zebrafish Friocourt, G., Kanatani, S., Tabata, H., Yozu, M., Takahashi, T., Antypa, M., Rague´nes, hypothalamus. Ann. N. Y. Acad. Sci. 1220, 93–105. O., Chelly, J., Fe´rec, C., Nakajima, K., Parnavelas, J.G., 2008. Cell-autonomous Mahler, J., Filippi, A., Driever, W., 2010. DeltaA/DeltaD regulate multiple and roles of ARX in cell proliferation and neuronal migration during corticogenesis. temporally distinct phases of notch signaling during dopaminergic neurogen- J. Neurosci. 28, 5794–5805. esis in zebrafish. J. Neurosci. 30, 16621–16635. Friocourt, G., Parnavelas, J.G., 2010. Mutations in ARX Result in Several Defects Martin, S.C., Heinrich, G., Sandell, J.H., 1998. Sequence and expression of glutamic Involving GABAergic Neurons. Front. Cell Neurosci. 4, 4. acid decarboxylase isoforms in the developing zebrafish. J. Comp. Neurol. 396, Glasgow, E., Tomarev, S.I., 1998. Restricted expression of the homeobox gene prox 253–266. 1 in developing zebrafish. Mech. Dev. 76, 175–178. Mastick, G.S., Andrews, G.L., 2001. Pax6 regulates the identity of embryonic Good, P.J., 1995. A conserved family of elav-like genes in vertebrates. Proc. Natl. diencephalic neurons. Mol. Cell Neurosci. 17, 190–207. Acad. Sci. USA 92, 4557–4561. McKenzie, O., Ponte, I., Mangelsdorf, M., Finnis, M., Colasante, G., Shoubridge, C., Grimm, J., Mueller, A., Hefti, F., Rosenthal, A., 2004. Molecular basis for catecho- Stifani, S., Ge´cz, J., Broccoli, V., 2007. Aristaless-related homeobox gene, the laminergic neuron diversity. Proc. Natl. Acad. Sci. USA 101, 13891–13896. gene responsible for West syndrome and related disorders, is a Groucho/ Grinblat, Y., Gamse, J., Patel, M., Sive, H., 1998. Determination of the zebrafish transducin-like enhancer of split dependent transcriptional repressor. Neu- forebrain: induction and patterning. Development 125, 4403–4416. roscience 146, 236–247. Grinblat, Y., Sive, H., 2001. zic Gene expression marks anteroposterior pattern in McLean, D.L., Fetcho, J.R., 2004. Ontogeny and innervation patterns of dopami- the presumptive neurectoderm of the zebrafish gastrula. Dev. Dyn. 222, nergic, noradrenergic, and serotonergic neurons in larval zebrafish. J. Comp. 688–693. Neurol. 480, 38–56. Hauptmann, G., Gerster, T., 1994. Two-color whole-mount in situ hybridization to Melkman, T., Sengupta, P., 2005. Regulation of chemosensory and GABAergic vertebrate and Drosophila embryos. Trends Genet. 10, 266. motor neuron development by the C. elegans Aristaless/Arx homolog alr-1. Hauptmann, G., Gerster, T., 1996. Complex expression of the zp-50 pou gene in the Development 132, 1935–1949. embryonic zebrafish brain is altered by overexpression of sonic hedgehog. Miura, H., Yanazawa, M., Kato, K., Kitamura, K., 1997. Expression of a novel Development 122, 1769–1780. aristaless related homeobox gene ‘Arx’ in the vertebrate telencephalon, Higashijima, S.-I., Mandel, G., Fetcho, J.R., 2004. Distribution of prospective diencephalon and floor plate. Mech. Dev. 65, 99–109. glutamatergic, glycinergic, and GABAergic neurons in embryonic and larval Moreno, N., Gonzalez, A., Retaux, S., 2009. Development and evolution of the zebrafish. J. Comp. Neurol. 480, 1–18. subpallium. Semin. Cell Dev. Biol. 20, 735–743. Hokfelt,¨ T., Martensson, R., Bjorklund,¨ A., Kleinau, S., Goldstein, M., 1984. Mori, H., Miyazaki, Y., Morita, T., Nitta, H., Mishina, M., 1994. Different spatio- Distributional maps of tyrosine-hydroxylase-immunoreactive neurons in the temporal expressions of three otx homeoprotein transcripts during zebrafish rat brain. In: Bjorklund,¨ A., Hokfelt,¨ T. (Eds.), Handbook of Chemical Neuroa- embryogenesis. Brain Res. Mol. Brain Res. 27, 221–231. natomy. Vol2: Classical Neurotransmitters in the CNS, Part 1. Elsevier, Morita, T., Nitta, H., Kiyama, Y., Mori, H., Mishina, M., 1995. Differential expression Amsterdam, pp. 277–379. of two zebrafish emx homeoprotein mRNAs in the developing brain. Neurosci. Holzschuh, J., Ryu, S., Aberger, F., Driever, W., 2001. Dopamine transporter Lett. 198, 131–134. expression distinguishes dopaminergic neurons from other catecholaminergic Mueller, T., Wullimann, M.F., Guo, S., 2008. Early teleostean basal ganglia neurons in the developing zebrafish embryo. Mech. Dev. 101, 237–243. development visualized by zebrafish Dlx2a, Lhx6, Lhx7, Tbr2 (eomesa), and Holzschuh, J., Barrallo-Gimeno, A., Ettl, A.K., Durr, K., Knapik, E.W., Driever, W., GAD67 gene expression. J. Comp. Neurol. 507, 1245–1257. 2003. Noradrenergic neurons in the zebrafish hindbrain are induced by Neave, B., Rodaway, A., Wilson, S.W., Patient, R., Holder, N., 1995. Expression of retinoic acid and require tfap2a for expression of the neurotransmitter zebrafish GATA 3 (gta3) during gastrulation and neurulation suggests a role in phenotype. Development 130, 5741–5754. the specification of cell fate. Mech. Dev. 51, 169–182. Hutchinson, S.A., Eisen, J.S., 2006. Islet1 and Islet2 have equivalent abilities to O’Hara, F.P., Beck, E., Barr, L.K., Wong, L.L., Kessler, D.S., Riddle, R.D., 2005. promote motoneuron formation and to specify motoneuron subtype identity. Zebrafish Lmx1b.1 and Lmx1b.2 are required for maintenance of the isthmic Development 133, 2137–2147. organizer. Development 132, 3163–3173. Inoue, A., Takahashi, M., Hatta, K., Hotta, Y., Okamoto, H., 1994. Developmental Odenthal, J., Nusslein-Volhard,¨ C., 1998. fork head domain genes in zebrafish. Dev. regulation of islet-1 mRNA expression during neuronal differentiation in Genes Evol. 208, 245–258. embryonic zebrafish. Dev. Dyn. 199, 1–11. Ohyama, K., Ellis, P., Kimura, S., Placzek, M., 2005. Directed differentiation of Iversen, S.D., Iversen, L.L., 2007. Dopamine: 50 years in perspective. Trends neural cells to hypothalamic dopaminergic neurons. Development 132, Neurosci. 30, 188–193. 5185–5197. Jeong, J.Y., Einhorn, Z., Mercurio, S., Lee, S., Lau, B., Mione, M., Wilson, S.W., Guo, S., Okuda, Y., Yoda, H., Uchikawa, M., Furutani-Seiki, M., Takeda, H., Kondoh, H., 2006. Neurogenin1 is a determinant of zebrafish basal forebrain dopaminergic Kamachi, Y., 2006. Comparative genomic and expression analysis of group B1 neurons and is regulated by the conserved zinc finger protein Tof/Fezl. Proc. sox genes in zebrafish indicates their diversification during vertebrate evolu- Natl. Acad. Sci. USA 103, 5143–5148. tion. Dev. Dyn. 235, 811–825. Kaslin, J., Panula, P., 2001. Comparative anatomy of the histaminergic and other Palti, Y., Rodriguez, M.F., Gahr, S.A., Hansen, J.D., 2007. Evolutionary history of the aminergic systems in zebrafish (Danio rerio). J. Comp. Neurol. 440, 342–377. ABCB2 genomic region in teleosts. Dev. Comp. Immunol. 31, 483–498. Kim, C.H., Bae, Y.K., Yamanaka, Y., Yamashita, S., Shimizu, T., Fujii, R., Park, H.C., Panula, P., Chen, Y.C., Priyadarshini, M., Kudo, H., Semenova, S., Sundvik, M., Yeo, S.Y., Huh, T.L., Hibi, M., Hirano, T., 1997. Overexpression of neurogenin Sallinen, V., 2010. The comparative neuroanatomy and neurochemistry of induces ectopic expression of HuC in zebrafish. Neurosci. Lett. 239, 113–116. zebrafish CNS systems of relevance to human neuropsychiatric diseases. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages Neurobiol. Dis. 40, 46–57. of embryonic development of the zebrafish. Dev. Dyn. 203, 253–310. Park, H.C., Mehta, A., Richardson, J.S., Appel, B., 2002. olig2 is required for zebrafish Kitamura, K., Yanazawa, M., Sugiyama, N., Miura, H., Iizuka-Kogo, A., Kusaka, M., primary motor neuron and oligodendrocyte development. Dev. Biol. 248, Omichi, K., Suzuki, R., Kato-Fukui, Y., Kamiirisa, K., Matsuo, M., Kamijo, S.-i., 356–368. Kasahara, M., Yoshioka, H., Ogata, T., Fukuda, T., Kondo, I., Kato, M., Dobyns, Pistocchi, A., Gaudenzi, G., Carra, S., Bresciani, E., Del Giacco, L., Cotelli, F., 2008. W.B., Yokoyama, M., Morohashi, K.-i., 2002. Mutation of ARX causes abnormal Crucial role of zebrafish prox1 in hypothalamic catecholaminergic neurons development of forebrain and testes in mice and X-linked lissencephaly with development. BMC. Dev. Biol. 8, 27. abnormal genitalia in humans. Nat. Genet. 32, 359–369. Prakash, N., Wurst, W., 2006. Development of dopaminergic neurons in the Kohwi, M., Osumi, N., Rubenstein, J.L.R., Alvarez-Buylla, A., 2005. Pax6 is required mammalian brain. Cell Mol. Life Sci. 63, 187–206. for making specific subpopulations of granule and periglomerular neurons in Puelles, L., Verney, C., 1998. Early neuromeric distribution of tyrosine-hydroxy- the olfactory bulb. J. Neurosci. 25, 6997–7003. lase-immunoreactive neurons in human embryos. J. Comp. Neurol. 394, Korzh, V., Edlund, T., Thor, S., 1993. Zebrafish primary neurons initiate expression 283–308. of the LIM homeodomain protein Isl-1 at the end of gastrulation. Development Puelles, L., Rubenstein, J.L., 2003. Forebrain gene expression domains and the 118, 417–425. evolving prosomeric model. Trends Neurosci 26, 469–476. Krauss, S., Johansen, T., Korzh, V., Moens, U., Ericson, J.U., Fjose, A., 1991. Zebrafish Quille´, M.-L., Carat, S., Que´me´ner-Redon, S., Hirchaud, E., Baron, D., Benech, C., pax[zf-a]: a paired box-containing gene expressed in the neural tube. EMBO J. Guihot, J., Placet, M., Mignen, O., Fe´rec, C., Houlgatte, R., Friocourt, G., 2011. 10, 3609–3619. High-throughput analysis of promoter occupancy reveals new targets for arx, a Li, Y., Allende, M.L., Finkelstein, R., Weinberg, E.S., 1994. Expression of two zebrafish gene mutated in mental retardation and interneuronopathies. PLoS ONE 6, orthodenticle-related genes in the embryonic brain. Mech. Dev. 48, 229–244. e25181. Liu, J., Hunter, C.S., Du, A., Ediger, B., Walp, E., Murray, J., Stein, R., May, C.L., 2011. Rink, E., Wullimann, M.F., 2001. The teleostean (zebrafish) dopaminergic system Islet-1 regulates Arx transcription during pancreatic islet alpha-cell develop- ascending to the subpallium (striatum) is located in the basal diencephalon ment. J. Biol. Chem. 286, 15352–15360. (posterior tuberculum). Brain Res. 889, 316–330. Lohr, H., Ryu, S., Driever, W., 2009. Zebrafish diencephalic A11-related dopami- Rink, E., Wullimann, M.F., 2002. Development of the catecholaminergic system in nergic neurons share a conserved transcriptional network with neuroendo- the early zebrafish brain: an immunohistochemical study. Brain Res. Dev. crine cell lineages. Development 136, 1007–1017. Brain Res. 137, 89–100. A. Filippi et al. / Developmental Biology 369 (2012) 133–149 149

Robu, M.E., Larson, J.D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S.A., Ekker, Takada, M., 1993. Widespread dopaminergic projections of the subparafascicular S.C., 2007. p53 activation by knockdown technologies. PLoS Genet. 3, e78. thalamic nucleus in the rat. Brain Res. Bull. 32, 301–309. Rohr, K.B., Concha, M.L., 2000. Expression of nk2.1a during early development of Tay, T.L., Ronneberger, O., Ryu, S., Nitschke, R., Driever, W., 2011. Comprehensive the thyroid gland in zebrafish. Mech. Dev. 95, 267–270. catecholaminergic projectome analysis reveals single-neuron integration of zebra- Roussigne´, M., Blader, P., 2006. Divergence in regulation of the PEA3 family of ETS fish ascending and descending dopaminergic systems. Nat. Commun. 2, 171. transcription factors. Gene Expr. Patterns 6, 777–782. Thor, S., Thomas, J.B., 1997. The Drosophila islet gene governs axon pathfinding Ryu, S., Mahler, J., Acampora, D., Holzschuh, J., Erhardt, S., Omodei, D., Simeone, A., and neurotransmitter identity. Neuron 18, 397–409. Driever, W., 2007. Orthopedia homeodomain protein is essential for dience- Toyama, R., Curtiss, P.E., Otani, H., Kimura, M., Dawid, I.B., Taira, M., 1995a. The phalic dopaminergic neuron development. Curr. Biol. 17, 873–880. LIM class homeobox gene lim5: implied role in CNS patterning in Xenopus and Sallinen, V., Torkko, V., Sundvik, M., Reenila,¨ I., Khrustalyov, D., Kaslin, J., Panula, P., zebrafish. Dev. Biol. 170, 583–593. 2009. MPTP and MPPþ target specific aminergic cell populations in larval Toyama, R., O’Connell, M.L., Wright, C.V., Kuehn, M.R., Dawid, I.B., 1995b. Nodal zebrafish. J Neurochem. 108, 719–731. induces ectopic goosecoid and lim1 expression and axis duplication in Sampath, K., Stuart, G.W., 1996. Developmental expression of class III and IV POU zebrafish. Development 121, 383–391. domaingenesinthezebrafish.Biochem.Biophys.Res.Commun.219,565–571. Toyama, R., Dawid, I.B., 1997. lim6, a novel LIM homeobox gene in the zebrafish: Schweitzer, J., Lohr, H., Filippi, A., Driever, W., 2011. Dopaminergic and noradre- comparison of its expression pattern with lim1. Dev. Dyn. 209, 406–417. nergic circuit development in zebrafish. Dev. Neurobiol. 72, 256–268. Tucker, M., Sieber, M., Morphew, M., Han, M., 2005. The Caenorhabditis elegans Seo, H.C., Drivenes, Ellingsen, S., Fjose, A., 1998. Expression of two zebrafish aristaless orthologue, alr-1, is required for maintaining the functional and homologues of the murine Six3 gene demarcates the initial eye primordia. structural integrity of the amphid sensory organs. Mol. Biol. Cell 16, Mech. Dev. 73, 45–57. 4695–4704. Seufert, D.W., Prescott, N.L., El-Hodiri, H.M., 2005. Xenopus aristaless-related Waskiewicz, A.J., Rikhof, H.A., Hernandez, R.E., Moens, C.B., 2001. Zebrafish Meis homeobox (xARX) gene product functions as both a transcriptional activator functions to stabilize Pbx proteins and regulate hindbrain patterning. Devel- and repressor in forebrain development. Dev. Dyn. 232, 313–324. opment 128, 4139–4151. Shanmugalingam,S.,Houart,C.,Picker,A.,Reifers,F.,Macdonald,R.,Barth,A.,Griffin,K., Yamamoto, K., Ruuskanen, J.O., Wullimann, M.F., Vernier, P., 2010. Two tyrosine Brand, M., Wilson, S.W., 2000. Ace/Fgf8 is required for forebrain commissure hydroxylase genes in vertebrates: new dopaminergic territories revealed in formation and patterning of the telencephalon. Development 127, 2549–2561. Sherr, E.H., 2003. The ARX story (epilepsy, mental retardation, autism, and cerebral the zebrafish brain. Mol. Cell Neurosci. 43, 394–402. malformations): one gene leads to many phenotypes. Curr. Opin. Pediatr. 15, Yamamoto, K., Vernier, P., 2011. The evolution of dopamine systems in chordates. 567–571. Front. Neuroanat. 5, 21. Shi, X., Bosenko, D.V., Zinkevich, N.S., Foley, S., Hyde, D.R., Semina, E.V., Vihtelic, Yee, C.L., Wang, Y., Anderson, S., Ekker, M., Rubenstein, J.L., 2009. Arcuate nucleus T.S., 2005. Zebrafish pitx3 is necessary for normal lens and retinal develop- expression of NKX2.1 and DLX and lineages expressing these transcription ment. Mech. Dev. 122, 513–527. factors in neuropeptide Y(þ), proopiomelanocortin(þ), and tyrosine hydro- Smeets, W.J., Marı´n, O., Gonza´lez, A., 2000. Evolution of the basal ganglia: new xylase(þ) neurons in neonatal and adult mice. J. Comp. Neurol. 517, 37–50. perspectives through a comparative approach. J. Anat. 196, 501–517. Yonei-Tamura, S., Tamura, K., Tsukui, T., Izpisu´ a Belmonte, J.C., 1999. Spatially and Smidt, M.P., Burbach, J.P., 2007. How to make a mesodiencephalic dopaminergic temporally-restricted expression of two T-box genes during zebrafish embry- neuron. Nat. Rev. Neurosci. 8, 21–32. ogenesis. Mech. Dev. 80, 219–221. Strahle,¨ U., Blader, P., Henrique, D., Ingham, P.W., 1993. Axial, a zebrafish gene Yoshihara, S., Omichi, K., Yanazawa, M., Kitamura, K., Yoshihara, Y., 2005. Arx expressed along the developing body axis, shows altered expression in cyclops homeobox gene is essential for development of mouse olfactory system. mutant embryos. Genes Dev. 7, 1436–1446. Development 132, 751–762. Takada, M., Li, Z.K., Hattori, T., 1988. Single thalamic dopaminergic neurons project Zerucha, T., Prince, V.E., 2001. Cloning and developmental expression of a to both the neocortex and spinal cord. Brain Res. 455, 346–352. zebrafish meis2 homeobox gene. Mech. Dev. 102, 247–250.