DOCSLIB.ORG

Investigating the Genetic Basis of Altered Activity Profiles in the Blind

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigating the Genetic Basis of Altered Activity Profiles in the Blind Investigating the genetic basis of altered activity profiles in the blind Mexican cavefish, Astyanax mexicanus A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biological Sciences of the McMicken College of Arts and Sciences by by Brian M. Carlson B.S. Biology, Xavier University, May 2010 Committee Chair: Dr. Joshua B. Gross June 2015 ABSTRACT Organisms that have evolved to exploit extreme ecological niches may alter or abandon survival strategies that no longer provide a benefit, or may even impose a cost, in the environment to which they have adapted. Cave environments are characterized by perpetual darkness, isolation and relatively constant temperature and humidity. Accordingly, cave-adapted species tend to converge on a suite of regressive and constructive morphological, physiological and behavioral alterations, including loss or reduction of eyes and pigmentation, increased locomotor activity and reduction or alteration of behavioral rhythmicity. The cave environment and the associated changes in locomotor behavior make species of cavefish prime natural models in which to examine the complex genetic architecture underlying these behavioral phenotypes. The principal goal of this dissertation was to investigate the genetic basis of altered locomotor activity patterns in the blind Mexican tetra, Astyanax mexicanus. Initially, a custom locomotor assay rig and experimental protocols were developed to assess, characterize and compare activity patterns in surface and Pachón cavefish. The results of these assays clarified differences between the morphotypes, provided evidence that Pachón cavefish retain a weakly-entrainable circadian oscillator with limited capacity to self-sustain entrained rhythms and suggested that patterns in spatial “tank usage” data may be the result of a positive masking effect in response to light stimulus in both morphotypes. In order to facilitate downstream genetic analysis, a high-density genotyping-by-sequencing (GBS) based linkage map was constructed. This map provided much finer mapping ability than any previously published linkage map in this species. Further, the large number of markers enabled the anchoring of ~80% of the total length of the unassembled Astyanax mexicanus draft genome to the newly developed linkage map, which in turn assisted with downstream comparison of linkage groups and quantitative trait loci (QTL) between maps. ! ii! This greatly facilitated the process of screening for potential candidate genes. Employing the new linkage map and the assay protocols developed for this work, a large F2 surface x Pachón mapping pedigree was assayed and the resulting data was subjected to QTL analysis. QTL results suggest that loci on at least six different linkage groups are associated with patterns in either velocity or tank usage; however, the regions of the genome mediating each of these components are distinct from one another. Further, comparison of linkage groups between maps indicated that the QTL for locomotor activity described here are different than those published in previous studies. Finally, critical genomic intervals underlying activity QTL were screened for candidate genes. A total of 36 potential candidates were identified and genomic and transcriptomic resources were leveraged to highlight several prime candidates for further analysis, as well as to demonstrate that it is unlikely that either catastrophic changes to components of the core molecular clockwork or truncation of members of well-characterized photoreceptor families are behind the altered activity profiles observed in the Pachón cave population. ! iii! ! iv! ACKNOWLEDGEMENTS As my doctoral training draws to a close and I ready myself to begin what I hope will be a long, successful and satisfying career as an educator, a scientist and a mentor, I would like to take this opportunity to express my sincerest gratitude and heartfelt appreciation to the following people, all of whom have contributed in some significant way to my success in this endeavor: Drs. Dorothy Engle, George Farnsworth and the rest of the biology faculty at Xavier University, who provided me with my first opportunities to explore what it’s like to be a “real biologist,” ensured that I was extremely well-prepared to excel in a doctoral program, and provided an example of effective teaching and genuinely interested mentoring that continues to inspire me to this day. It remains my sincere hope that I might some day have the opportunity to return to my alma mater and help provide future students with the same excellent learning environment and educational opportunities that were given to me. Dr. Irene Luken and Mrs. Hedy Fye for giving me the knowledge and skills necessary to correctly pronounce words like “zeitgeber” and work my way through old journal articles with titles like, “Untersuchungen über den Lichtsinn und dessen Lokalisation bei dem Höhlenfisch Anoptichtys jordani Hubbs and Innes (Characidae).” Drs. Daniel Buchholz, John Layne, Herman Mays and Kenneth Petren for taking time out of your busy schedules to provide me with the guidance and support necessary to ensure that I was successful in my coursework and research efforts over the past five years. Dr. Joshua Gross for being the most intelligent, kind, supportive and inspiring doctoral advisor that I could have ever asked for. I cannot imagine any better environment in which to ! v! grow as a student, a scientist and a person than working with you against the backdrop of the warm and inviting lab culture that you so carefully cultivate. You’ve somehow managed to find the perfect balance between lab boss and lab dad and I am confident that any students fortunate enough to spend time in your lab will be forever changed for the better because of it; no one could be a stronger advocate for his or her students than you’ve been for us. Drs. Kathryn Rafferty and Kathleen Koenig for providing me the tools, training and opportunities that have allowed me to develop and grow as an educator throughout the course of my graduate career. Mandy Powers for being my confidant, lunch buddy and partner in crime for the last several years. I wish you success and many happy Pandora jam sessions as you work toward a red robe and funny hat of your own. Bethany Stahl for keeping me on my toes. Slacking off was never an option when I knew I’d constantly have to compare my own drive, work ethic and scientific output to the bar you somehow always managed to set just the tiniest bit higher than mine. Keep it up! Tyler Bussian, Allison Furterer, Ian Klinger, Wendy Lu, Brad Meyer and Sam Onusko for dedicated assistance in pushing my projects forward, no matter how tedious the task. I hope that the time and effort that you contributed toward making my projects a success comes back to you three fold! The rest of the Gross Lab family, both past and present. I wish you all nothing but success and happiness in whatever awaits you. ! vi! Dr. Merritt Oleski for letting me take over your conference room while I worked furiously to finish my dissertation and for distracting me with conversations about our shared belief in the value of basic science research when you could tell I needed a break. Please consider the contents of this dissertation as a few humble data points for inclusion in the Library of Alexandria, Version 2.0. Mr. L. for being the person most genuinely excited to talk with me about my research. My friends, family and the Brethren of J.B. Covert Lodge #437 and Alembic Lodge #793 (“Ole 793”) for supporting me, keeping me grounded and providing me with much needed distractions as I’ve worked hard to achieve my goals and make something of myself. Most importantly, however, I would like to dedicate this dissertation and all of the time and labor that went into writing it to the following, without any of whom it is absolutely inconceivable that I would be where I am today: To my wife, Julie Carlson, who has never waivered in her love and support for me and whose quiet strength and encouragement were all that kept me going through the roughest, most stressful portions of this experience. After well over a hundred pages of tedious proofreading and weeks of late nights, cranky moods, neglected chores and general unpleasantness on my part, I am positive that someone is traveling to the Vatican to advance her cause for living sainthood even as we speak. To my parents, Mary and Harry Brownfield and Daniel and Kathy Carlson, who have invested untold amounts of time, energy and resources into making sure that I always had the very ! vii! best education that they could afford, that I never truly wanted for anything and that there was never any doubt in my mind that I was loved and that they are proud of me. As a small expression of my gratitude for everything that you’ve done for me: Dad: Please consider the results of all of my analyses as the solution to the biggest damn “fish problem” I could come up with. Mom: Please consider the figures and tables contained within this tome as a poor substitute for all of the “artist’s renderings” that you’ve missed since I went away to college. Finally, to the memory of my late grandfather, Rudolph Flis, who taught me through word and deed the importance of family, faith and service to others… and that it’s nearly impossible to stay stressed or unhappy when you’re listening to a good polka. Thanks especially for that last one, Grandpa; it’s come in quite handy these past few weeks. ! viii! PREFACE Once we were blobs in the sea, and then fishes, and then lizards and rats, and then monkeys, and hundreds of things in between.
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Pitx3 KNOCKOUT MICE ENTRAIN to SCHEDULED FEEDING DESPITE
    Pitx3 KNOCKOUT MICE ENTRAIN TO SCHEDULED FEEDING DESPITE FREE-RUNNING LIGHT ENTRAINED RHYTHMS A Thesis Presented to the Faculty of California State Polytechnic University, Pomona In Partial Fulfillment Of the Requirements for the Degree Master of Science In Biological Sciences By Lori L. Scarpa 2019 SIGNATURE PAGE THESIS: Pitx3 KNOCKOUT MICE ENTRAIN TO SCHEDULED FEEINDING DESPITE FREE-RUNNING LIGHT ENTRAINED RHYTHMS AUTHOR: Lori L. Scarpa DATE SUBMITTED: Fall 2019 Department of Biological Sciences Dr. Andrew D. Steele Thesis Committee Chair Biological Sciences Dr. Juanita Jellyman Biological Sciences Dr. Robert Talmadge Biological Sciences ii ACKNOWLEDGEMENTS Funding for this project was provided by the Whitehall Foundation and California State Polytechnic University of Pomona, California. I would like to thank the many people who assisted in the daily labors required to complete this project: Raymundo Miranda, Michael Sidikpramana, Jeffrey Falkenstein, Michael Williams, Jaskaran Dhanoa, and many other members of the Steele lab. I would like to specially recognize fellow graduate students in the Steele lab, Damien Wolfe and Andrew Villa, for their unconditional encouragement and support. I would like to thank Dr. Juanita Jellyman for her kindness and nurturing spirit. Dr. Jellyman never wavered her belief in me and it was this that kept me working harder towards my goals. Lastly, I would like thank Dr. Andrew Steele for accepting me into his lab, for being my personal mentor, and for pushing me towards success. Through him, I have grown to become a better scientist and found greater inspiration in my pursuit to further study neuroscience. Thank you, Dr. Steele, for your support and patience, and for playing a leading role in my success as a graduate student in your lab.
    [Show full text]
  • Noninvasive Sleep Monitoring in Large-Scale Screening of Knock-Out Mice
    bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Noninvasive sleep monitoring in large-scale screening of knock-out mice reveals novel sleep-related genes Shreyas S. Joshi1*, Mansi Sethi1*, Martin Striz1, Neil Cole2, James M. Denegre2, Jennifer Ryan2, Michael E. Lhamon3, Anuj Agarwal3, Steve Murray2, Robert E. Braun2, David W. Fardo4, Vivek Kumar2, Kevin D. Donohue3,5, Sridhar Sunderam6, Elissa J. Chesler2, Karen L. Svenson2, Bruce F. O'Hara1,3 1Dept. of Biology, University of Kentucky, Lexington, KY 40506, USA, 2The Jackson Laboratory, Bar Harbor, ME 04609, USA, 3Signal solutions, LLC, Lexington, KY 40503, USA, 4Dept. of Biostatistics, University of Kentucky, Lexington, KY 40536, USA, 5Dept. of Electrical and Computer Engineering, University of Kentucky, Lexington, KY 40506, USA. 6Dept. of Biomedical Engineering, University of Kentucky, Lexington, KY 40506, USA. *These authors contributed equally Address for correspondence and proofs: Shreyas S. Joshi, Ph.D. Dept. of Biology University of Kentucky 675 Rose Street 101 Morgan Building Lexington, KY 40506 U.S.A. Phone: (859) 257-2805 FAX: (859) 257-1717 Email: [email protected] Running title: Sleep changes in knockout mice bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Evidence for Rapid Phenotypic and Behavioural Shifts in a Recently Established Cavefish Population
    applyparastyle “fig//caption/p[1]” parastyle “FigCapt” Biological Journal of the Linnean Society, 2020, 129, 143–161. With 5 figures. Downloaded from https://academic.oup.com/biolinnean/article-abstract/129/1/143/5637080 by University of Minnesota Libraries - Twin Cities user on 13 January 2020 Evidence for rapid phenotypic and behavioural shifts in a recently established cavefish population SUZANNE E. McGAUGH1*, SAM WEAVER1, ERIN N. GILBERTSON1, BRIANNA GARRETT1, MELISSA L. RUDEEN1, STEPHANIE GRIEB1, JENNIFER ROBERTS1, ALEXANDRA DONNY1, PETER MARCHETTO2 and ANDREW G. GLUESENKAMP3 1Ecology, Evolution, and Behavior, University of Minnesota, 140 Gortner Lab, 1479 Gortner Ave, Saint Paul, MN 55108, USA 2Department of Bioproducts and Biosystems Engineering, University of Minnesota, 218 BAE, 1390 Eckles Ave., Saint Paul, MN 55108, USA 3Center for Conservation and Research, San Antonio Zoo, 3903 N St Mary’s St., San Antonio, TX 78212, USA Received 25 August 2019; revised 16 September 2019; accepted for publication 17 September 2019 Cave colonization offers a natural laboratory to study an extreme environmental shift, and diverse cave species from around the world often have converged on robust morphological, physiological and behavioural traits. The Mexican tetra (Astyanax mexicanus) has repeatedly colonized caves in the Sierra de El Abra and Sierra de Guatemala regions of north-east Mexico ~0.20–1 Mya, indicating an ability to adapt to the cave environment. The time frame for the evolution of these traits in any cave animal, however, is poorly understood. Astyanax mexicanus from the Río Grande in South Texas were brought to Central Texas beginning in the early 1900s and colonized underground environments.
    [Show full text]
  • The Origins and Evolution of Sleep Alex C
    © 2018. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2018) 221, jeb159533. doi:10.1242/jeb.159533 REVIEW The origins and evolution of sleep Alex C. Keene1,2,* and Erik R. Duboue1,3,* ABSTRACT times vary widely, ranging from less than 5 h to 10 h or more (Webb Sleep is nearly ubiquitous throughout the animal kingdom, yet little is and Agnew, 1970; Kronholm et al., 2006). Despite a widespread known about how ecological factors or perturbations to the appreciation for the diversity in sleep duration between and within environment shape the duration and timing of sleep. In diverse species, surprisingly little is known about the relationship between ’ animal taxa, poor sleep negatively impacts development, cognitive sleep and an animal s ecological and evolutionary history. abilities and longevity. In addition to mammals, sleep has been Large differences in sleep duration and timing among humans characterized in genetic model organisms, ranging from the suggests that existing genetic variation among individuals potently nematode worm to zebrafish, and, more recently, in emergent affects sleep (Hartmann, 1973; Kronholm et al., 2006; He et al., models with simplified nervous systems such as Aplysia and 2009). While many laboratory studies investigating the molecular jellyfish. In addition, evolutionary models ranging from fruit flies to mechanisms of sleep regulation have relied on highly inbred model cavefish have leveraged natural genetic variation to investigate the systems including mice, zebrafish and fruit flies, the study of sleep relationship between ecology and sleep. Here, we describe the in outbred populations has revealed that geographical location, contributions of classical and emergent genetic model systems to evolutionary history and naturally occurring genetic variation investigate mechanisms underlying sleep regulation.
    [Show full text]
  • Identification of Novel Sleep Related Genes from Large Scale Phenotyping Experiments in Mice
    University of Kentucky UKnowledge Theses and Dissertations--Biology Biology 2017 IDENTIFICATION OF NOVEL SLEEP RELATED GENES FROM LARGE SCALE PHENOTYPING EXPERIMENTS IN MICE Shreyas Joshi University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/ETD.2017.159 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Joshi, Shreyas, "IDENTIFICATION OF NOVEL SLEEP RELATED GENES FROM LARGE SCALE PHENOTYPING EXPERIMENTS IN MICE" (2017). Theses and Dissertations--Biology. 42. https://uknowledge.uky.edu/biology_etds/42 This Doctoral Dissertation is brought to you for free and open access by the Biology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Biology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Summary Report of Freshwater Nonindigenous Aquatic Species in U.S
    Summary Report of Freshwater Nonindigenous Aquatic Species in U.S. Fish and Wildlife Service Region 4—An Update April 2013 Prepared by: Pam L. Fuller, Amy J. Benson, and Matthew J. Cannister U.S. Geological Survey Southeast Ecological Science Center Gainesville, Florida Prepared for: U.S. Fish and Wildlife Service Southeast Region Atlanta, Georgia Cover Photos: Silver Carp, Hypophthalmichthys molitrix – Auburn University Giant Applesnail, Pomacea maculata – David Knott Straightedge Crayfish, Procambarus hayi – U.S. Forest Service i Table of Contents Table of Contents ...................................................................................................................................... ii List of Figures ............................................................................................................................................ v List of Tables ............................................................................................................................................ vi INTRODUCTION ............................................................................................................................................. 1 Overview of Region 4 Introductions Since 2000 ....................................................................................... 1 Format of Species Accounts ...................................................................................................................... 2 Explanation of Maps ................................................................................................................................
    [Show full text]
  • Developmental Genetic Modularity of Cichlid Fish Dentitions
    This is a repository copy of Biting into the Genome to Phenome Map: Developmental Genetic Modularity of Cichlid Fish Dentitions. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/109900/ Version: Accepted Version Article: Hulsey, C.D., Fraser, G.J. orcid.org/0000-0002-7376-0962 and Meyer, A. (2016) Biting into the Genome to Phenome Map: Developmental Genetic Modularity of Cichlid Fish Dentitions. Integrative and Comparative Biology, 56 (3). pp. 373-388. ISSN 1540-7063 https://doi.org/10.1093/icb/icw059 This is a pre-copyedited, author-produced version of an article accepted for publication in Integrative and Comparative Biology following peer review. The version of record Integr. Comp. Biol. (2016) 56 (3): 373-388 is available online at: https://doi.org/10.1093/icb/icw059. Reuse Unless indicated otherwise, fulltext items are protected by copyright with all rights reserved. The copyright exception in section 29 of the Copyright, Designs and Patents Act 1988 allows the making of a single copy solely for the purpose of non-commercial research or private study within the limits of fair dealing. The publisher or other rights-holder may allow further reproduction and re-use of this version - refer to the White Rose Research Online record for this item. Where records identify the publisher as the copyright holder, users can verify any specific terms of use on the publisher’s website. Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request.
    [Show full text]
  • A Chromosome Level Genome of Astyanax Mexicanus Surface Fish for Comparing Population
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title 2 A chromosome level genome of Astyanax mexicanus surface fish for comparing population- 3 specific genetic differences contributing to trait evolution. 4 5 Authors 6 Wesley C. Warren1, Tyler E. Boggs2, Richard Borowsky3, Brian M. Carlson4, Estephany 7 Ferrufino5, Joshua B. Gross2, LaDeana Hillier6, Zhilian Hu7, Alex C. Keene8, Alexander Kenzior9, 8 Johanna E. Kowalko5, Chad Tomlinson10, Milinn Kremitzki10, Madeleine E. Lemieux11, Tina 9 Graves-Lindsay10, Suzanne E. McGaugh12, Jeff T. Miller12, Mathilda Mommersteeg7, Rachel L. 10 Moran12, Robert Peuß9, Edward Rice1, Misty R. Riddle13, Itzel Sifuentes-Romero5, Bethany A. 11 Stanhope5,8, Clifford J. Tabin13, Sunishka Thakur5, Yamamoto Yoshiyuki14, Nicolas Rohner9,15 12 13 Authors for correspondence: Wesley C. Warren ([email protected]), Nicolas Rohner 14 ([email protected]) 15 16 Affiliation 17 1Department of Animal Sciences, Department of Surgery, Institute for Data Science and 18 Informatics, University of Missouri, Bond Life Sciences Center, Columbia, MO 19 2 Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 20 3 Department of Biology, New York University, New York, NY 21 4 Department of Biology, The College of Wooster, Wooster, OH 22 5 Harriet L. Wilkes Honors College, Florida Atlantic University, Jupiter FL 23 6 Department of Genome Sciences, University of Washington, Seattle, WA 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020.
    [Show full text]
  • Luis Espinasa Selected Publications Herman, A., Brandvain, Y., Weagley
    Luis Espinasa Selected Publications Herman, A., Brandvain, Y., Weagley, J., Jeffery, W.R., Keene, A.C., Kono, T.J.Y., Bilandžija, H., Borowsky, R.. Espinasa, L.. O'Quin, K., Ornelas-García, C.P., Yoshizawa, M., Carlson, B., Maldonado, E., Gross, J.B., Cartwright, R.A., Rohner, N., Warren, W.C., and McGaugh. S.E. (2018) The role of gene flow in rapid and repeated evolution of cave related traits in Mexican tetra, Astyanax mexicanus. Molecular Ecology. bioRxiv https://doi.org/10.1101/335182 Espinasa, L., Robinson, J., and Espinasa, M. (2018) Mc1r gene in Astroblepus pholeter and Astyanax mexicanus: Convergent regressive evolution of pigmentation across cavefish species. Developmental Biology 441: 305-310 Espinasa, L., Hoese, G., Toulkeridis, T., and Toomey, R. (2018) Corroboration that theMc1r Gly/Ser mutation correlates with the phenotypic expression of pigmentation in Astroblepus. Developmental Biology 441: 311-312 Blin, M., Tine, E., Meister, L., Elipot, Y., Bibliowicz, J., Espinasa, L., and Rétaux, S. (2018) Developmental evolution and developmental plasticity of the olfactory epithelium and olfactory skills in Mexican cavefish. Developmental Biology 441: 242-251 Espinasa, L., Robinson, J., Soares, D., Hoese, G., Toulkeridis, T., and Toomey, R. (2018) Troglomorphic features of Astroblepus pholeter, a cavefish from Ecuador, and possible introgressive hybridization. Subterranean Biology 27:17-29 Kopp, J., Avasthi, S., and Espinasa, L. (2018) Phylogeographical convergence between Astyanax cavefish and mysid shrimps in the Sierra de El Abra, Mexico. Subterranean Biology 26: 39-53 Espinasa, L., Legendre, L., Fumey, F., Blin, M., Rétaux, S., and Espinasa, M. (2018) A new cave locality for Astyanax cavefish in Sierra de El Abra, Mexico.
    [Show full text]
  • Identifying Fish in Aquarium
    What fish are in my aquarium? What fish are in the aquarium? What family do they belong to? How do they reproduce? What are their feeding strategies? Minnows Tetras Armored Catfish Family: Cyprinidae Family: Characidae Family: Callichthyidae Over 2000 species Over 900 species Over 130 species zebra danio black tetra leopard corydora Common Species in FL Common Species in FL Common Species in FL • Barbs • Neon tetra • Leopard corydora • Danios • Black tetra • Bronze corydora • Goldfish • Pacu • Panda corydora • Koi • Lemon tetra • Hoplo catfish • Rasboras • Mexican tetra • Tons of color variants • Freshwater sharks • Firehead tetra Reproduction: Reproduction: Reproduction: Egg layers/Broadcast spawner Egg layers/Broadcast spawner Adhesive eggs/bubble nests Feeding: Omnivore Feeding: Omnivore Feeding: Insectivore Commonly Cultured Freshwater Fish Groups Photo credit: UF-IFAS Publication Circular #54 Photos from: UF/IFAS Circular 54 Suckermouth Rainbowfishes Cichlids Catfish Family: Melanotaeniidae etc. Family: Callichthyidae Family: Loricariidae 53 species in 6 genera Over 1500 species Over 550 species banded rainbowfish zebra cichilid Common Species in FL Pleco catfish Common Species in FL Common Species in FL • Red rainbowfish • Angelfish • Discus • Common pleco • Australian rainbowfish • Oscar • Bristle-nose pleco • Boeseman’s rainbowfish • Jewel cichilid • Sailfin pleco • Neon dwarf rainbowfish zebra cichilid banded rainbowfish • Mbuna cichilid • Kribs cichilid Reproduction: Reproduction: Reproduction: Adhesive eggs/Male guards eggs
    [Show full text]