Perfect Palindromic Lac Operator DNA Sequence Exists As a Stable

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Proc. Natl Acad. Sci. USA Vol. 80, pp. 1797-1801, April 1983 Biochemistry Perfect palindromic lac operator DNA sequence exists as a stable cruciform structure in supercoiled DNA in vitro but not in vivo (psoralen/chromosome structure) RICHARD R. SINDEN, STEVEN S. BROYLES, AND DAVID E. PETTIJOHN Department of Biochemistry, Biophysics and Genetics, University of Colorado Health Sciences Center, Denver, Colorado 80262 Communicated by William B. Wood, December 17, 1982 ABSTRACT A perfect palindromic 66-base pair (bp) DNA se- MATERIALS AND METHODS quence derived from the lac operator and cloned into plasmid pMB9 [Betz, J. L. & Sadler, J. R. (1981) Gene 13, 1-12] can exist in a 66- Bacterial Strains, Growth Conditions, and Plasmid Prep- bp linear form or as two 33-bp cruciform arms. The fraction of the aration. Escherichia coli K-12 strains pOCE12/HB101 and sequence in the cruciform depends on the superhelical density of pOCE13/HB101 containing a single and two tandem 66-bp the plasmid DNA. Relaxed DNA contains no cruciforms. The pal- palindromic lac operator DNA sequences, respectively, cloned indrome in the cruciform structure is cut by EcoRd endonuclease into pMB9 were used (23). Supercoiled plasmid molecules were at the base of the cruciform arms, releasing 33-bp fragments; when purified and molecules of varying superhelical density were in the linear form only 66-bp fragments are produced. The cru- prepared as described (24) by using a HeLa topoisomerase ex- ciform structure is fixedbytrimethylpsoralen crosslinks inthe cru- tract (25). Superhelical densities were measured as described ciform arms. This together with the EcoRP cutting provides an as- (26). say for the cruciform structures in the DNA of living cells. Using Photobinding of 4,5',8-Trimethylpsoralen. 4,5',8-Trime- this assaywe showthatthecruciform structure rarelyif ever exists thylpsoralen (Me3psoralen) and irradiation conditions have been in vivo, but after DNA isolation >90% of the sequence is in cru- described in detail (27). Samples were irradiated by using two ciforms. Results suggest that theplasmid DNA as organizedin vivo General Electric F15T8 BLB bulbs at an incident light in- either lacks sufficient torsional tension to form this cruciform or tensity of 1.6 kJ-m 2-min-'. The dose ranges used in vitro were the palindrome is restrained in the linear form by other bound <48 kJ m-2. For photobinding in cells, cells were perme- molecules. abilized by treatment with EDTA (28). Two-minute exposure to EDTA was terminated by the addition of MgCl2. Photo- A palindromic or inverted repeated DNA sequence has the binding immediately followed permeabilization (dose range, unique property that base pairing can potentially occur not <24 kJ m2). only between the two complementary strands of DNA but also Gel Electrophoresis. Restriction enzymes noted in the text within each single DNA strand. In the latter configuration bases (Bethesda Research Laboratories) were used according to the at the symmetric center of the palindrome are at the ends of manufacturer's directions. Plasmid DNAs and restriction frag- "hairpin" or cruciform arms with respect to flanking, non- ments were analyzed by electrophoresis on 0.8% agarose gels palindromic sequences (Fig. 1). Palindromes have been iden- as described (24). For determination of the superhelical den- tified in DNA from many organisms and are often found at sity of various DNAs, electrophoresis was as described by Keller operator and transcription termination regions in bacterial and (26). Thirty-three- and 66-bp fragments were analyzed on 14 bacteriophage DNA (1-3), as well as in DNA replication origins X 10 X 0.15 cm 5% polyacrylamide gels in 40 mM Tris borate of prokaryotes (4-6) and eukaryotes (7-11). Considering the buffer (pH 8.3) containing 10% glycerol. Current was kept at prevalence of palindromes at such important regulatory sites, 6-8 mA to avoid heating. it has been tempting to speculate about possible biological sig- nificance of cruciform structures. The thermodynamics of cruciform formation and their sta- RESULTS bility have been discussed in detail (12-14). Recent studies EcoRI Cuts Arms of Cruciform Structures from Super- with single-strand nucleases and electron microscopy have coiled DNA. The base sequence of the 66-bp palindrome in- provided evidence that cruciforms do exist in supercoiled DNA serted into the EcoRI site of pMB9 and the possible cruciform (14-18), as first suggested by Lebowitz and co-workers (19, configuration of this sequence are shown in Fig. 1. Digestion 20). The probability of cruciform existence depends on the of the linear form by EcoRI restriction endonuclease produces superhelical density of DNA (18). This evidence seems con- a linear 66-bp fragment. Digestion of the cruciform structure vincing that palindromic DNA sequences under sufficient tor- produces two 33-bp hairpins or cruciform arms. DNA frag- sional tension can exist as cruciforms; however, we wished to ments of this size released by EcoRI have been observed (23). develop a procedure for assaying cruciforms that can be used This test can be applied to distinguish whether the palin- to detect these structures in vivo. dromic sequence is in a linear or cruciform structure. Psoralen crosslinks in double-helical DNA (21) should fix When supercoiled pOCE12 DNA was digested with EcoRI cruciforms and thus provide a basis for their detection in vivo the cloned 66-bp palindromic fragment was produced, as ex- (22). Here we describe the application of this approach to pected. In addition, a 33-bp fragment expected for the cru- studies in vitro and in vivo of a perfect 66-base pair (bp) pal- ciform arm was consistently observed (Fig. 2). A 33-bp frag- indromic lac operator sequence cloned into pMB9 (23). ment was not observed in pOCE12 DNA, linearized with HindIII prior to treatment with EcoRI. The observance of the The publication costs of this article were defrayed in part by page charge 33-bp fragment suggested that EcoRI was recognizing and cut- payment. This article must therefore be hereby marked "advertise- ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact. Abbreviations: bp, base pair(s); Me3psoralen, 4,5',8-trimethylpsoralen. 1797 Downloaded by guest on September 28, 2021 1798 Biochemistry: Sinden et aL Proc. Natl. Acad. Sci. USA 80 (1983) EcoRI A. EcoRk A-.1 ABCDEFGH I JKLMNOPQ -10 I 1 1 21 314 41 51 61 71 81 TATAGGAGCATAGAATTCCACAAATTGTTATCCGCTCACATTCCACAT6TG6ATT6TGAGCGGATACAATM6TGGAATTCTMTTTTCGCT ....ItTI I-ri I~ "-IIIIfrr -^a ATATCCTCGTATCTfAAGGTGMAACAATAGGCGAGTGTTAACGTGTACACCTTAACA CTCGCCTATTGTTAAACACCAGuATTAMAAA s 66-bp palindromic operator I I' 76-bp palindromic sequence pOCE12 A-T B. C G A T C G 31-C G T A-4111 C. NATIVE DUPLEX CRUCIFORM 35 5 21 38 66 AT A 'I il AATT C _ GG C 66 l1*! I.-i*61 TTAA A T |denaturation C G 66 C G 33 T A ~~T T AATT--6' A AI T A A EcoRI A T renoturation I A.1 1 A T ----TTAA G C-71 A T FIG. 2. Electrophoretic analysis of EcoRI digests of supercoiled and -20 -l0 T A 81 91 cA AT relaxed pOCE12 DNA. Direction of electrophoresis is top to bottom. CTTATCAATATAAGGA TTTTCGCTTAAGAACTT GAATAGTTATATCCTCG AAAAAGCGAACTCTTGM Lanes A-E contain digests of 10 jig of supercoiled pOCE12 DNA at TA TT D. CROSS-LINKED CROSS-LINKED constant DNA concentrations (100 and 5, 20, 50, 100, and 200 T A NATIVE DUPLEX CRUCIFORM Ag/ml) C G units, respectively, of EcoRI per ml. Lanes G-K contain digests with T A EcoR! T A A T constant EcoRI/DNA ratios (1 unit/pg of DNA) but increasing con- A T Cl A T 3 66 _ centrations of both enzyme and DNA; the former were 10, 20, 40, 100, G C AATT r- G C - - TTAA 4 and 1,000 units, respectively, per ml. In lane G the amount of applied T A DNA was greater than in lane which enhances the 33-bp band. Re- I I H, I-A action mixtures in lanes are identical to those for lanes A-E, ex- denaauraiion M-Q 11 renaOtration I cept that pOCE12 DNA was linearized previously by digestion with A T HindI. The higher molecular weight bands in these lanes are the G C AATT >- CA G C HindIII-EcoRI fragments of 354 and 387 bp. Positions of migration for TA G C the 33- and 66-bp fragments are indicated. Lanes F and L contain a 40- T -TTAA !A^T -A bp "ladder" used as a molecular weight marker (gift of J. R. Sadler). FIG. 1. Sequence and expected structures ofthe 66-bp palindromic DNA sequence. (A) The 66-bp lac operator palindrome and surround- DNA torsional tension (22). A crosslink in one arm of the cru- ing DNA sequences (23, 29, 30). Including the EcoRI sites and the ciform should effectively stabilize both arms because the lin- flanking AT:TA base pairs, the complete palindromic sequence is 76 ear form could not reform. Alternatively, an interstrand cross- In are a bp. pOCE13 there two 66-bp palindromes making perfect 142- link in the linear palindromic sequence should prevent transition bppalindromic sequence. The arrow between bases 35 and36 shows the center of twofold rotational symmetry. (B) Cruciform configuration of to the cruciform. the 76-bp palindromic DNA sequence. Although this sequence is per- To test this, varied numbers of Me3psoralen crosslinks were fectly palindromic, presumably there is a short 3- to 4-base nonpaired introduced into supercoiled DNA. The crosslinked plasmid loop at the ends of the arms (31). The EcoRI sites are at the base of the cruciform arms. (C) Denaturation and renaturationproducts of66- and 33-bp fragments resulting from EcoRI digestion of the linear and cru- structures.
Recommended publications
  • The Grammar of Transcriptional Regulation

    The Grammar of Transcriptional Regulation

    Hum Genet (2014) 133:701–711 DOI 10.1007/s00439-013-1413-1 REVIEW PAPER The grammar of transcriptional regulation Shira Weingarten-Gabbay · Eran Segal Received: 11 June 2013 / Accepted: 24 December 2013 / Published online: 5 January 2014 © Springer-Verlag Berlin Heidelberg 2014 Abstract Eukaryotes employ combinatorial strategies to regulatory motifs (Levine and Tjian 2003) and exploit motif generate a variety of expression patterns from a relatively geometry as another dimension of combinatorial power small set of regulatory DNA elements. As in any other lan- for regulating transcription. Understanding the fundamen- guage, deciphering the mapping between DNA and expres- tal principles governing transcriptional regulation could sion requires an understanding of the set of rules that govern allow us to predict expression from DNA sequence, with basic principles in transcriptional regulation, the functional far-reaching implications. Most notably, in many human elements involved, and the ways in which they combine to diseases, genetic changes occur in non-coding regions such orchestrate a transcriptional output. Here, we review the cur- as gene promoters and enhancers. However, without under- rent understanding of various grammatical rules, including standing the grammar of transcriptional regulation, we the effect on expression of the number of transcription factor cannot tell which sequence changes affect expression and binding sites, their location, orientation, affinity and activity; how. For example, even for a single binding site, we do not co-association with different factors; and intrinsic nucleo- know the quantitative effects on expression of its location, some organization. We review different methods that are orientation, and affinity; whether these effects are general, used to study the grammar of transcription regulation, high- factor-specific, and/or promoter-dependent; and how they light gaps in current understanding, and discuss how recent depend on the intrinsic nucleosome organization.
  • Technical Glossary

    Technical Glossary

    WBVGL 6/28/03 12:00 AM Page 409 Technical Glossary abortive infection: Infection of a cell where there is no net increase in the production of infectious virus. abortive transformation: See transitory (transient or abortive) transformation. acid blob activator: A regulatory protein that acts in trans to alter gene expression and whose activity depends on a region of an amino acid sequence containing acidic or phosphorylated residues. acquired immune deficiency syndrome (AIDS): A disease characterized by loss of cell-mediated and humoral immunity as the result of infection with human immunodeficiency virus (HIV). acute infection: An infection marked by a sudden onset of detectable symptoms usually followed by complete or apparent recovery. adaptive immunity (acquired immunity): See immunity. adjuvant: Something added to a drug to increase the effectiveness of that drug. With respect to the immune system, an adjuvant increases the response of the system to a particular antigen. agnogene: A region of a genome that contains an open reading frame of unknown function; origi- nally used to describe a 67- to 71-amino acid product from the late region of SV40. AIDS: See acquired immune deficiency syndrome. aliquot: One of a number of replicate samples of known size. a-TIF: The alpha trans-inducing factor protein of HSV; a structural (virion) protein that functions as an acid blob transcriptional activator. Its specificity requires interaction with certain host cel- lular proteins (such as Oct1) that bind to immediate-early promoter enhancers. ambisense genome: An RNA genome that contains sequence information in both the positive and negative senses. The S genomic segment of the Arenaviridae and of certain genera of the Bunyaviridae have this characteristic.
  • Unitary Structure of Palindromes in DNA

    Unitary Structure of Palindromes in DNA

    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.21.453288; this version posted July 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Unitary Structure of Palindromes in DNA Mehmet Ali Tibatan1, ∗ and Mustafa Sarısaman2, y 1Department of Biotechnology, Istanbul University, 34134, Vezneciler, Istanbul, Turkey 2Department of Physics, Istanbul University, 34134, Vezneciler, Istanbul, Turkey We investigate the quantum behavior encountered in palindromes within DNA structure. In par- ticular, we reveal the unitary structure of usual palindromic sequences found in genomic DNAs of all living organisms, using the Schwinger’s approach. We clearly demonstrate the role played by palin- dromic configurations with special emphasis on physical symmetries, in particular subsymmetries of unitary structure. We unveil the prominence of unitary structure in palindromic sequences in the sense that vitally significant information endowed within DNA could be transformed unchangeably in the process of transcription. We introduce a new symmetry relation, namely purine-purine or pyrimidine-pyrimidine symmetries (p-symmetry) in addition to the already known symmetry rela- tion of purine-pyrimidine symmetries (pp-symmetry) given by Chargaff’s rule. Therefore, important vital functions of a living organisms are protected by means of these symmetric features. It is un- derstood that higher order palindromic sequences could be generated in terms of the basis of the highest prime numbers that make up the palindrome sequence number. We propose that violation of this unitary structure of palindromic sequences by means of our proposed symmetries leads to a mutation in DNA, which could offer a new perspective in the scientific studies on the originand cause of mutation.
  • Palindromes in DNA—A Risk for Genome Stability and Implications in Cancer

    Palindromes in DNA—A Risk for Genome Stability and Implications in Cancer

    International Journal of Molecular Sciences Review Palindromes in DNA—A Risk for Genome Stability and Implications in Cancer Marina Svetec Mikleni´cand Ivan Krešimir Svetec * Faculty of Food Technology and Biotechnology, University of Zagreb, Pierottijeva 6, 10000 Zagreb, Croatia; [email protected] * Correspondence: [email protected]; Tel.: +385-1483-6016 Abstract: A palindrome in DNA consists of two closely spaced or adjacent inverted repeats. Certain palindromes have important biological functions as parts of various cis-acting elements and protein binding sites. However, many palindromes are known as fragile sites in the genome, sites prone to chromosome breakage which can lead to various genetic rearrangements or even cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans. Here, we bring an overview of current understanding and knowledge on molecular mechanisms of palindrome recombinogenicity and discuss possible implications of DNA palindromes in carcinogenesis. Furthermore, we overview the data on known palindromic sequences in the human genome and efforts to estimate their number and distribution, as well as underlying mechanisms of genetic rearrangements specific palindromic sequences cause. Keywords: DNA palindromes; quasipalindromes; palindromic amplification; palindrome-mediated genetic recombination; carcinogenesis Citation: Svetec Mikleni´c,M.; Svetec, I.K. Palindromes in DNA—A Risk for Genome Stability and Implications in Cancer.
  • Molecular Biology and Applied Genetics

    Molecular Biology and Applied Genetics

    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
  • Evidence for Two Mechanisms of Palindrome-Stimulated Deletion in Escherichia Coli: Single-Strand Annealing and Replication Slipped Mispairing

    Evidence for Two Mechanisms of Palindrome-Stimulated Deletion in Escherichia Coli: Single-Strand Annealing and Replication Slipped Mispairing

    Copyright 2001 by the Genetics Society of America Evidence for Two Mechanisms of Palindrome-Stimulated Deletion in Escherichia coli: Single-Strand Annealing and Replication Slipped Mispairing Malgorzata Bzymek1 and Susan T. Lovett Department of Biology and Rosenstiel Basic Medical Sciences Research Center, Brandeis University, Waltham, Massachusetts 02454-0110 Manuscript received January 31, 2001 Accepted for publication March 19, 2001 ABSTRACT Spontaneous deletion mutations often occur at short direct repeats that ¯ank inverted repeat sequences. Inverted repeats may initiate genetic rearrangements by formation of hairpin secondary structures that block DNA polymerases or are processed by structure-speci®c endonucleases. We have investigated the ability of inverted repeat sequences to stimulate deletion of ¯anking direct repeats in Escherichia coli. Propensity for cruciform extrusion in duplex DNA correlated with stimulation of ¯anking deletion, which was partially sbcD dependent. We propose two mechanisms for palindrome-stimulated deletion, SbcCD dependent and SbcCD independent. The SbcCD-dependent mechanism is initiated by SbcCD cleavage of cruciforms in duplex DNA followed by RecA-independent single-strand annealing at the ¯anking direct repeats, generating a deletion. Analysis of deletion endpoints is consistent with this model. We propose that the SbcCD-independent pathway involves replication slipped mispairing, evoked from stalling at hairpin structures formed on the single-stranded lagging-strand template. The skew of SbcCD-independent deletion endpoints with respect to the direction of replication supports this hypothesis. Surprisingly, even in the absence of palindromes, SbcD affected the location of deletion endpoints, suggesting that SbcCD- mediated strand processing may also accompany deletion unassociated with secondary structures. N vivo, large DNA palindromes are intrinsically unsta- and Wang 1983).
  • Evolutionary Advantage of a Broken Symmetry in Autocatalytic Polymers Tentatively Explains Fundamental Properties of DNA

    Evolutionary Advantage of a Broken Symmetry in Autocatalytic Polymers Tentatively Explains Fundamental Properties of DNA

    Evolutionary advantage of a broken symmetry in autocatalytic polymers tentatively explains fundamental properties of DNA Hemachander Subramanian1∗, Robert A. Gatenby1;2 1 Integrated Mathematical Oncology Department, 2Cancer Biology and Evolution Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida. ∗To whom correspondence should be addressed; E-mail: hemachander.subramanian@moffitt.org. August 17, 2018 Abstract The macromolecules that encode and translate information in living systems, DNA and RNA, exhibit distinctive structural asymmetries, in- cluding homochirality or mirror image asymmetry and 30-50 directionality, that are invariant across all life forms. The evolutionary advantages of these broken symmetries remain unknown. Here we utilize a very simple model of hypothetical self-replicating polymers to show that asymmetric autocatalytic polymers are more successful in self-replication compared to their symmetric counterparts in the Darwinian competition for space and common substrates. This broken-symmetry property, called asym- metric cooperativity, arises with the maximization of a replication poten- tial, where the catalytic influence of inter-strand bonds on their left and right neighbors is unequal. Asymmetric cooperativity also leads to ten- tative, qualitative and simple evolution-based explanations for a number of other properties of DNA that include four nucleotide alphabet, three nucleotide codons, circular genomes, helicity, anti-parallel double-strand orientation, heteromolecular base-pairing, asymmetric base compositions, and palindromic instability, apart from the structural asymmetries men- tioned above. Our model results and tentative explanations are consistent with multiple lines of experimental evidence, which include evidence for the presence of asymmetric cooperativity in DNA. arXiv:1605.00748v3 [q-bio.BM] 9 Mar 2017 Introduction Living systems, uniquely in nature, acquire, store and use information au- tonomously.
  • Molecular Mechanism of Directional CTCF Recognition of a Diverse Range of Genomic Sites

    Molecular Mechanism of Directional CTCF Recognition of a Diverse Range of Genomic Sites

    Cell Research (2017) :1365-1377. © 2017 IBCB, SIBS, CAS All rights reserved 1001-0602/17 $ 32.00 ORIGINAL ARTICLE www.nature.com/cr Molecular mechanism of directional CTCF recognition of a diverse range of genomic sites Maolu Yin1, 2, Jiuyu Wang1, Min Wang1, Xinmei Li1, 2, Mo Zhang3, 4, 5, Qiang Wu3, 4, 5, Yanli Wang1, 2, 6 1Key Laboratory of RNA Biology, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China; 2University of Chinese Academy of Sciences, Beijing 100049, China; 3Center for Comparative Biomedicine, MOE Key Laboratory of Systems Biomedicine, Institute of Systems Biomedicine, Collaborative Innovative Center of Systems Biomedicine, SCSB, Shanghai Jiao Tong University (SJTU), Shanghai 200240, China; 4State Key Laboratory of On- cogenes and Related Genes, SJTU Medical School, Shanghai 200240, China; 5School of Life Sciences and Biotechnology, SJTU, Shanghai 200240, China; 6Collaborative Innovation Center of Genetics and Development, Shanghai 200438, China CTCF, a conserved 3D genome architecture protein, determines proper genome-wide chromatin looping interac- tions through directional binding to specific sequence elements of four modules within numerous CTCF-binding sites (CBSs) by its 11 zinc fingers (ZFs). Here, we report four crystal structures of human CTCF in complex with CBSs of the protocadherin (Pcdh) clusters. We show that directional CTCF binding to cognate CBSs of the Pcdh enhancers and promoters is achieved through inserting its ZF3, ZFs 4-7, and ZFs 9-11 into the major groove along CBSs, result- ing in a sequence-specific recognition of module 4, modules 3 and 2, and module 1, respectively; and ZF8 serves as a spacer element for variable distances between modules 1 and 2.
  • Palindromic Sequence Impedes Sequencing-By- Ligation Mechanism

    Palindromic Sequence Impedes Sequencing-By- Ligation Mechanism

    Huang et al. BMC Systems Biology 2012, 6(Suppl 2):S10 http://www.biomedcentral.com/1752-0509/6/S2/S10 PROCEEDINGS Open Access Palindromic sequence impedes sequencing-by- ligation mechanism Yu-Feng Huang1†, Sheng-Chung Chen1†, Yih-Shien Chiang2, Tzu-Han Chen1, Kuo-Ping Chiu1,2,3* From 23rd International Conference on Genome Informatics (GIW 2012) Tainan, Taiwan. 12-14 December 2012 Abstract Background: Current next-generation sequencing (NGS) platforms adopt two types of sequencing mechanisms: by synthesis or by ligation. The former is employed by 454 and Solexa systems, while the latter by SOLiD system. Although the pros and cons for each sequencing mechanism have more or less been discussed in a number of occasions, the potential obstacle imposed by palindromic sequences has not yet been addressed. Methods: To test the effect of the palindromic region on sequencing efficacy, we clonally amplified a paired-end ditag sequence composed of a 24-bp palindromic sequence flanked by a pair of tags from the E. coli genome. We used the near homogeneous fragments produced from MmeI digestion of the amplified clone to generate a sequencing library for SOLiD 5500xl sequencer. Results: Results showed that, traditional ABI sequencers, which adopt sequencing-by-synthesis mechanism, were able to read through the palindromic region. However, SOLiD 5500xl was unable to do so. Instead, the palindromic region was read as miscellaneous random sequences. Moreover, readable tag sequence turned obscure ~2 bp prior to the palindromic region. Conclusions: Taken together, we demonstrate that SOLiD machines, which employ sequencing-by-ligation mechanism, are unable to read through the palindromic region.
  • Restriction Endonucleases

    Restriction Endonucleases

    Restriction Endonucleases Contents Introduction ........................................................................................................................ 1 The Discovery of Restriction Endonucleases ...................................................................... 1 Properties of Restriction Enzymes ...................................................................................... 3 Mechanism of Action of Restriction Enzymes .................................................................... 5 Molecular Weight Markers and Polymorphisms ................................................................ 6 References and Resources .................................................................................................. 8 Animation ............................................................................................................................ 9 Supplemental Material: Standard Nucleotide Degeneracy Code ..................................... 10 Introduction Restriction endonucleases are enzymes that cleave the sugar-phosphate backbone of DNA strands. The vast majority of these enzymes have been isolated from bacteria, where they carry out a host-defense function for the cell. These enzymes recognize a specific DNA base sequence and cleave both strands of a double-stranded DNA molecule at or near the recognition site. All restriction enzymes fall into one of three classes, based upon their molecular structure and need for specific co-factors. Class I endonucleases have a molecular weight around 300,000
  • DNA Secondary Structure Is Influenced by Genetic Variation and Alters Susceptibility to De Novo Translocation

    DNA Secondary Structure Is Influenced by Genetic Variation and Alters Susceptibility to De Novo Translocation

    Kato et al. Molecular Cytogenetics 2011, 4:18 http://www.molecularcytogenetics.org/content/4/1/18 RESEARCH Open Access DNA secondary structure is influenced by genetic variation and alters susceptibility to de novo translocation Takema Kato1,2, Hidehito Inagaki1, Maoqing Tong1, Hiroshi Kogo1, Tamae Ohye1, Kouji Yamada1, Makiko Tsutsumi1, Beverly S Emanuel2,3 and Hiroki Kurahashi1* Abstract Background: Cumulative evidence suggests that DNA secondary structures impact DNA replication, transcription and genomic rearrangements. One of the best studied examples is the recurrent constitutional t(11;22) in humans that is mediated by potentially cruciform-forming sequences at the breakpoints, palindromic AT-rich repeats (PATRRs). We previously demonstrated that polymorphisms of PATRR sequences affect the frequency of de novo t (11;22)s in sperm samples from normal healthy males. These studies were designed to determine whether PATRR polymorphisms affect DNA secondary structure, thus leading to variation in translocation frequency. Methods: We studied the potential for DNA cruciform formation for several PATRR11 polymorphic alleles using mobility shift analysis in gel electrophoresis as well as by direct visualization of the DNA by atomic force microscopy. The structural data for various alleles were compared with the frequency of de novo t(11;22)s the allele produced. Results: The data indicate that the propensity for DNA cruciform structure of each polymorphic allele correlates with the frequency of de novo t(11;22)s produced (r = 0.77, P = 0.01).
  • Patterns and Signals of Biology: an Emphasis on the Role of Post

    Patterns and Signals of Biology: an Emphasis on the Role of Post

    University of Nebraska at Omaha DigitalCommons@UNO Student Work 5-2016 Patterns and Signals of Biology: An Emphasis On The Role of Post Translational Modifications in Proteomes for Function and Evolutionary Progression Oliver Bonham-Carter Follow this and additional works at: https://digitalcommons.unomaha.edu/studentwork Part of the Computer Sciences Commons Patterns and Signals of Biology: An Emphasis On The Role of Post Translational Modifications in Proteomes for Function and Evolutionary Progression by Oliver Bonham-Carter A DISSERTATION Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Doctor of Philosophy Major: Information Technology Under the Supervision of Dhundy Bastola, PhD and Hesham Ali, PhD Omaha, Nebraska May, 2016 SUPERVISORY COMMITTEE Chair: Dhundy (Kiran) Bastola, PhD Co-Chair: Hesham Ali, PhD Lotfollah Najjar, PhD Steven From, PhD Pro Que st Num b e r: 10124836 A ll rig hts re se rve d INFO RMA TION TO A LL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will b e no te d . Also , if m a te ria l ha d to b e re m o ve d , a no te will ind ic a te the d e le tio n. Pro Que st 10124836 Pub lishe d b y Pro Que st LLC (2016). Co p yrig ht o f the Disserta tio n is he ld b y the Autho r.