DOCSLIB.ORG

Modélisation Des Mécanismes Moléculaires De La Perception Des Odeurs Claire De March

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Modélisation Des Mécanismes Moléculaires De La Perception Des Odeurs Claire De March Modélisation des mécanismes moléculaires de la perception des odeurs Claire De March To cite this version: Claire De March. Modélisation des mécanismes moléculaires de la perception des odeurs. Autre. Université Nice Sophia Antipolis, 2015. Français. NNT : 2015NICE4068. tel-01432834 HAL Id: tel-01432834 https://tel.archives-ouvertes.fr/tel-01432834 Submitted on 12 Jan 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE DE NICE-SOPHIA ANTIPOLIS - UFR Sciences Ecole Doctorale des Sciences Fondamentales et Appliquées T H E S E pour obtenir le titre de Docteur en Sciences de l'UNIVERSITE de Nice-Sophia Antipolis Discipline : Chimie présentée et soutenue par Claire de MARCH MODELISATION DES MECANISMES MOLECULAIRES DE LA PERCEPTION DES ODEURS Thèse dirigée par Jérôme GOLEBIOWSKI soutenue le 23 octobre 2015 Jury : Dr. Loïc BRIAND CSGA, Dijon Rapporteur Pr. Bernard OFFMANN Université de Nantes Rapporteur Dr. Moustafa BENSAFI Université Claude Bernard, Lyon Examinateur Pr. Xavier FERNANDEZ Université de Nice-Sophia Antipolis Examinateur Dr. Gilles SICARD Université Aix-Marseille Examinateur Pr. Jérôme GOLEBIOWSKI Université de Nice-Sophia Antipolis Directeur de thèse Remerciements Mes travaux de thèses ont été réalisés dans l’équipe Arôme, Parfum, Synthèse et Modélisation de l’Institut de Chimie de Nice sous la responsabilité du Professeur Jérôme Golebiowski. Je tiens à le remercier chaleureusement pour sa disponibilité et son implication durant ces trois années. M’autorisant à dépasser mon rôle d’étudiante et étant toujours d’un grand soutien, il a su me faire évoluer vers la chercheuse que je désirerais être et a largement contribué au succès de cette thèse. Je remercie également la fondation Edmond Roudnitska et son conseil d’administration, Michel Roudnitska, Catherine Rouby, Maurice Chastrette, Anne-Marie Mouly et André Holley pour m’avoir fait confiance il y a trois ans en finançant ce doctorat. Plus particulièrement, je tiens à remercier vivement le docteur Gilles Sicard pour avoir soutenu ce projet. Il a veillé au bon déroulement de mes travaux de recherche tout au long de cette thèse en m’ apportant une partie de la richesse de ses connaissances en perception des odeurs. Je lui en suis très reconnaissante. Je tiens à remercier les rapporteurs de cette thèse, Dr. Loïc Briand et Pr. Bernard Offmann pour avoir accepté de l ’évaluer . Ils sont de grands experts dans leur domaine respectif et me font l’honneur d’être associé s à ce travail. Merci au Pr. Xavier Fernandez, avec qui j’ai débuté mon expérience à l’ICN, de finir cette aventure avec moi en acceptant d’examiner ces travaux. Je remercie Dr. Moustafa Bensafi d’avoir accepté mon invitation à être membre du jury. Je tenais à sa présence et je suis heureuse qu’il parti cipe au jury de cette thèse. Un grand merci à tous nos collaborateurs, Dr. Nicolas Baldovini, Dr. Anne-Marie Le Bon, Dr. Minghong Ma de l’université de Pennsylvanie, Dr. Hiroaki Matsunami de l’université Duke, Pr. Cheil Moon et SangE un Ryu du DGIST pour leurs données expérimentales et l’initiation de nombreux projets. Je n’oublie pas l’équipe de modélisation avec qui j’ai passé la plu part de mon temps et qui aura été une sorte de famille adoptive à Nice. Au patriarche, Serge, merci d’avoir tenté à tes dépens de faire de moi une cuisinière alsacienne. Je repars avec la règle des trois : beurre/crème fraiche/lardon. Merci à Tonton Fabien, toujours présent pour discuter claquettes et politique. Seb, merci pour ta bonne humeur, ta convivialité et tes conseils sur le docking. Merci à Martine, mon alliée féminine. Un remerciement particulier à l’ un de ses membres, Julien Diharce, mon grand frère, qui ne m’a jamais laissée sombrer devant certaines de mes lacunes et a toujours su me proposer une bière au bon moment. Et Jean- Baptiste, le ‘ptit’ dernier, merci d’avoir supporté ta peste de grande sœur . Ton arrivée a été une bouffée d’air frais. Et bien entendu, un grand merci aux lards et aux poneys. Enfin, j ’ai une pensée particulière pour ma famille qui était si loin pendant cette thèse et pourtant si présente. Merci pour leur soutien et leur enthousiasme qui m’ont permis de souffler et de tenir le coup durant ces trois années. Table des matières INTRODUCTION………….……………………………………………………………………………………………………….. 1 PARTIE 1 : LES MECANISMES DE LA PERCEPTION DES ODEURS……………… .. ……………………… .…. 7 Article 1 - V ers l’étude des Relations Structure -Odeur à l’ère post génomique………………… 9 Article 2 - Les étapes moléculaires de la perception des odeurs décrites par les approches de modélisation moléculaire.. …………………………………………………………………………. 51 PARTIE 2 : MODELISATION MOLECULAIRE DES RECEPTEURS OLFACTIFS…… .. ………………………… 77 Articles 3 et 4 - La modélisation moléculaire des ROs : de la séquence à la structure…….… 79 PARTIE 3 : RELATIONS STRUCTURE-FONCTION DES RECEPTEURS OLFACTIFS ……… .. ………………. 107 Articles 5 et 6 - Lien olfactophore-code combinatoire de ROs ………………………… .……………… 109 Article 7 - Le calcul de l’affinité odorant/récepteur discrimine les agonistes des non - agonistes de hOR1G1 ……………………………………………………………………………………………… .………. 145 Article 8 - Le spectre de reconnaissance d’un RO est modulé par son affinité avec les odorants mais aussi par sa barrière d’activation………………………………………………… .….…… .…. 157 Articles 9 et 10 - Activation des récepteurs - vers la déorphanisation computationnelle….. 179 CONCLUSIONS ET PERSPECTIVES………………………………………………………………………………………….. 207 ANNEXE ………………………………………………………………..……………………………………………………………… 213 Introduction Introduction 1 Introduction 2 Introduction Pourquoi la molécule de (+)-carvone déclenche-t-elle une odeur de carvi alors que son énantiomère, la (-)-carvone, évoque la menthe verte ? P ourquoi le musc cétone et l’androsténol, qui présentent deux structures chimiques radicalement dissemblables, provoquent tous deux une odeur musquée ? La réponse à ces questions de chimiste nécessite d’aller au -delà des frontières des disciplines. Elle se cache dans la façon dont notre cerveau, dans sa fascinante complexité, traite l’in formation moléculaire portée par ces odorants. Notre perception des odeurs résulte de l’interaction entre une molécule et les neurones olfactifs situés à l’extrémité supérieure de notre cavité nasale. Afin d’être en mesure de discriminer un nombre spectaculaire de molécules odorantes, notre cerveau a établi une stratégie qui repose sur un code dit « combinatoire » d’activation neuronale. Au niveau cellulaire, près de 400 sous-types de neurones olfactifs expriment chacun un seul type de protéine réceptrice : le récepteur olfactif. Un modèle universel qui relierait la structure des molécules odorantes à une odeur reste - bien que possible en principe – à établir. A l’heure actuelle , la recherche de nouveaux composés odorants repose principalement sur la synthèse de dérivés de molécules odorantes connues et est très sujette à la sérendipité. Contrairement à la vision où le stimulus est bien caractérisé d’un point de vue physique et dont la perception repose sur trois types de capteurs, la complexité de l'espace odorant et la taille de notre répertoire de récepteurs olfactifs ont freiné notre compréhension du codage et du traitement des odeurs. Par exemple, il n’y a, à ce jour, aucun consensus sur les caractéristiques clés de la perception des odeurs comme le nombre d’ odeurs que l’ humain est capable de discriminer ou comment des fonctionnalités telles que la valence hédonique ou l’identification d’une note olfactive sont codées. L’odorat ainsi que le goût sont les deux sens dit s « chimiques » qui permettent à l’homme de détecter les molécules présentes dans son environnement. L’étape clé des mécanismes de la perception des odeurs est l’interaction de ces molécules avec nos neurones olfactifs. Ceux-ci expriment des protéines permettant de transformer les signaux chimiques portés par les molécules odorantes en influx neuronaux activant différentes zones de notre cerveau, qu’il interprètera comme une odeur. Linda Buck et Richard Axel qui ont été récompensés par le prix Nobel de médecine en 2004 pour leur découverte[1] des Récepteurs Olfactifs (ROs), qui sont, à ce jour, décomptés au nombre de 396 chez l’homme. [2] Lors de la perception d’une odeur, c hacune de ces protéines interagit avec un odorant et contribue ainsi à un code combinatoire d’activation de récepteurs. (Figure 1) Cette « carte d’identité » est supposée être liée à l’odeur de cette molécule . De plus, des phénomènes dits péri-récepteurs interviennent lors de l’inhalation de composés odorants. Ces phénomènes impliquent d’autres types de protéines ou d’enzymes, dont le rôle, le nombre ou les caractéristiques biologiques sont encore mal connus.[3] Ces inconnues contribuent à 3 Introduction complexifier les premières études de relation entre la structure d’une molécule et son odeur par la difficulté de prendre en compte les protagonistes biologiques impliqués. Malgré tout, sur le principe, on associe à chaque odeur son propre code combinatoire de récepteurs. Cette stratégie à 396 variables utilisée par notre cerveau est en accord
Load more

Recommended publications
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • Database Tool the Systematic Annotation of the Three Main GPCR
    Database, Vol. 2010, Article ID baq018, doi:10.1093/database/baq018 ............................................................................................................................................................................................................................................................................................. Database tool The systematic annotation of the three main Downloaded from https://academic.oup.com/database/article-abstract/doi/10.1093/database/baq018/406672 by guest on 15 January 2019 GPCR families in Reactome Bijay Jassal1, Steven Jupe1, Michael Caudy2, Ewan Birney1, Lincoln Stein2, Henning Hermjakob1 and Peter D’Eustachio3,* 1European Bioinformatics Institute, Hinxton, Cambridge, CB10 1SD, UK, 2Ontario Institute for Cancer Research, Toronto, ON M5G 0A3, Canada and 3New York University School of Medicine, New York, NY 10016, USA *Corresponding author: Tel: +212 263 5779; Fax: +212 263 8166; Email: [email protected] Submitted 14 April 2010; Revised 14 June 2010; Accepted 13 July 2010 ............................................................................................................................................................................................................................................................................................. Reactome is an open-source, freely available database of human biological pathways and processes. A major goal of our work is to provide an integrated view of cellular signalling processes that spans from ligand–receptor
    [Show full text]
  • OR2AG1 (NM 001004489) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214778 OR2AG1 (NM_001004489) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR2AG1 (NM_001004489) Human Tagged ORF Clone Tag: Myc-DDK Symbol: OR2AG1 Synonyms: OR2AG3; OR11-79 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC214778 representing NM_001004489 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTCTGGAACTTCACCTTGGGAAGTGGCTTCATTTTGGTGGGGATTCTGAATGACAGTGGGTCTC CTGAACTGCTCTGTGCTACAATTACAATCCTATACTTGTTGGCCCTGATCAGCAATGGCCTACTGCTCCT GGCTATCACCATGGAAGCCCGGCTCCACATGCCCATGTACCTCCTGCTTGGGCAGCTCTCTCTCATGGAC CTCCTGTTCACATCTGTTGTCACTCCCAAGGCCCTTGCGGACTTTCTGCGCAGAGAAAACACCATCTCCT TTGGAGGCTGTGCCCTTCAGATGTTCCTGGCACTGACAATGGGTGGTGCTGAGGACCTCCTACTGGCCTT CATGGCCTATGACAGGTATGTGGCCATTTGTCATCCTCTGACATACATGACCCTCATGAGCTCAAGAGCC TGCTGGCTCATGGTGGCCACGTCCTGGATCCTGGCATCCCTAAGTGCCCTAATATATACCGTGTATACCA TGCACTATCCCTTCTGCAGGGCCCAGGAGATCAGGCATCTTCTCTGTGAGATCCCACACTTGCTGAAGGT GGCCTGTGCTGATACCTCCAGATATGAGCTCATGGTATATGTGATGGGTGTGACCTTCCTGATTCCCTCT CTTGCTGCTATACTGGCCTCCTATACACAAATTCTACTCACTGTGCTCCATATGCCATCAAATGAGGGGA GGAAGAAAGCCCTTGTCACCTGCTCTTCCCACCTGACTGTGGTTGGGATGTTCTATGGAGCTGCCACATT CATGTATGTCTTGCCCAGTTCCTTCCACAGCACCAGACAAGACAACATCATCTCTGTTTTCTACACAATT GTCACTCCAGCCCTGAATCCACTCATCTACAGCCTGAGGAATAAGGAGGTCATGCGGGCCTTGAGGAGGG
    [Show full text]
  • Olfactory Receptors Involved in the Perception
    (19) TZZ¥ZZ__T (11) EP 3 004 157 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C07K 14/705 (2006.01) C07K 14/72 (2006.01) 01.11.2017 Bulletin 2017/44 G01N 33/50 (2006.01) G01N 33/566 (2006.01) G01N 33/68 (2006.01) (21) Application number: 13730138.8 (86) International application number: (22) Date of filing: 31.05.2013 PCT/EP2013/061243 (87) International publication number: WO 2014/191047 (04.12.2014 Gazette 2014/49) (54) OLFACTORY RECEPTORS INVOLVED IN THE PERCEPTION OF SWEAT CARBOXYLIC ACIDS AND THE USE THEREOF AN DER WAHRNEHMUNG VON SCHWEISSCARBONSÄUREN BETEILIGTE GERUCHSREZEPTOREN UND VERWENDUNG DAVON RÉCEPTEURS OLFACTIFS IMPLIQUÉS DANS LA PERCEPTION D’ACIDES CARBOXYLIQUES DE SUEUR ET LEUR UTILISATION (84) Designated Contracting States: • VEITHEN, Alex AL AT BE BG CH CY CZ DE DK EE ES FI FR GB 1476 Genappe (BE) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR (74) Representative: Vanhalst, Koen et al De Clercq & Partners cvba (43) Date of publication of application: E. Gevaertdreef 10a 13.04.2016 Bulletin 2016/15 9830 Sint-Martens-Latem (BE) (73) Proprietor: ChemCom S.A. (56) References cited: 1070 Brussels (BE) WO-A1-2012/029922 WO-A2-01/27158 WO-A2-2006/094704 US-A1- 2003 207 337 (72) Inventors: • CHATELAIN, Pierre 1150 Brussels (BE) Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Male Fragrances That Evoke a Feral Growl, Full-Blown Tempests Or The
    A WHIFF OF DANGER Male fragrances that evoke a feral growl, full-blown tempests or the swaggering brio of ancient Rome are a bullseye for those who embrace their masculinity, says Lucia van der Post. Photograph by Omer Knaz he first scent I ever truly fell in love with was Schiaparelli’s Shocking, made by the great Jean Carles, and I came across it because my father wore it. I still remember the shock of pleasure when that first light floral note hit me, then the sense of surprise as the herbs, sandalwood and honey began to emerge, and finally it became sexier and more earthy as the oakmoss and what I now know Tto be civet took over. I remember, too, old-fashioned child that I was, that I thought it strange that my markedly heterosexual father wore a scent that seemed so voluptuous and so clearly aimed at women. Today, nobody would think anything of it. Speak to connoisseurs of perfume and as one they reject the notion of male and female scents. As Roja Dove, éminence grise of the perfume world, puts it: “For years floral notes were associated with feminine perfumes and – since men were considered strutting, predatory things – woody, mossy, earthy materials were linked with masculine ones, but the boundaries nowadays have become much more blurred. A rose, after all, has neither a penis nor a vagina – a rose on a man is a masculine rose, a rose on a woman is a feminine rose.” Violet, a note that one would have thought was largely feminine, was much beloved by Italian dandies in the late 19th and early 20th centuries, and it was an overdose of violet that made Geoffrey Beene’s Grey Flannel (£45 for 60ml EDT, to which much-respected perfume scholar Luca Turin awards five stars, calling it “a masterpiece”) such a success when it was launched in Clockwise from far left: 1975.
    [Show full text]
  • A Rose Extract Protects the Skin Against Stress Mediators: a Potential Role of Olfactory Receptors
    Supplementary data A Rose extract protects the skin against stress mediators: a potential role of olfactory receptors Romain Duroux 1,*, Anne Mandeau 1, Gaelle Guiraudie-Capraz 2, Yannick Quesnel 3 and Estelle Loing 4 1 IFF-Lucas Meyer Cosmetics, Toulouse, France 2 Aix-Marseille University, CNRS, INP, Marseille, France 3 ChemCom S.A., Brussels, Belgium 4 IFF-Lucas Meyer Cosmetics, Quebec, Canada * Correspondence: [email protected] Supplemental methods Keratinocytes cell culture and skin explants Skin organ cultures were prepared from tissues samples derived from volunteers undergoing routine therapeutic procedures, in collaboration with Alphenyx (Marseille). For this study, skin samples were derived from abdominal or breast tissues of healthy women (30-40 years old). Samples were received 1 day post-surgery and used directly for microdissection or cell extraction. Microdissected human skin was cultured at 37°C under 5% CO2, in DMEM (Dutscher, #L0060-500) plus 10% FBS (Sigma Aldrich, #F7524), 1% Penicillin/Streptomycin (Sigma Aldrich, #P0781-100), and 1% of minimum medium non-essential amino acids 10X (Gibco, #11140-035). For keratinocyte culture, cells were isolated from human skin epidermis. Briefly, skin samples were cut into small pieces and immersed in Thermolysin (Sigma Aldrich, #T7902-100mg) at 4°C overnight. Epidermis was then carefully detached from dermis before being incubated with Trypsin-EDTA for 15 minutes at 37°C. Trypsin inhibitor was next added, the mixture centrifuged and the supernatant discarded before adding KGM2 Medium (Promocell, #C- 20011) with 1% Penicillin/Streptomycin (Sigma Aldrich, #P0781-100). NHEK were then maintained in culture at 37 °C under 5 % CO2 and 95 % relative humidity.
    [Show full text]
  • The Odorant Receptor OR2W3 on Airway Smooth Muscle Evokes Bronchodilation Via a Cooperative Chemosensory Tradeoff Between TMEM16A and CFTR
    The odorant receptor OR2W3 on airway smooth muscle evokes bronchodilation via a cooperative chemosensory tradeoff between TMEM16A and CFTR Jessie Huanga,1,2, Hong Lama,1, Cynthia Koziol-Whiteb,c, Nathachit Limjunyawongd, Donghwa Kime, Nicholas Kimb, Nikhil Karmacharyac, Premraj Rajkumarf, Danielle Firera, Nicholas M. Dalesiog, Joseph Judec, Richard C. Kurtenh, Jennifer L. Pluznickf, Deepak A. Deshpandei, Raymond B. Penni, Stephen B. Liggette,j, Reynold A. Panettieri Jrc, Xinzhong Dongd,k, and Steven S. Anb,c,2 aDepartment of Environmental Health and Engineering, The Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205; bDepartment of Pharmacology, Rutgers-Robert Wood Johnson Medical School, The State University of New Jersey, Piscataway, NJ 08854; cRutgers Institute for Translational Medicine and Science, New Brunswick, NJ 08901; dSolomon H. Snyder Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; eCenter for Personalized Medicine, Morsani College of Medicine, University of South Florida, Tampa, FL 33612; fDepartment of Physiology, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; gDepartment of Anesthesiology and Critical Care Medicine, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; hDepartment of Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock, AR 72205; iDivision of Pulmonary and Critical Care Medicine, Department of Medicine, Center for Translational Medicine, Jane and Leonard Korman
    [Show full text]
  • The Potential Druggability of Chemosensory G Protein-Coupled Receptors
    International Journal of Molecular Sciences Review Beyond the Flavour: The Potential Druggability of Chemosensory G Protein-Coupled Receptors Antonella Di Pizio * , Maik Behrens and Dietmar Krautwurst Leibniz-Institute for Food Systems Biology at the Technical University of Munich, Freising, 85354, Germany; [email protected] (M.B.); [email protected] (D.K.) * Correspondence: [email protected]; Tel.: +49-8161-71-2904; Fax: +49-8161-71-2970 Received: 13 February 2019; Accepted: 12 March 2019; Published: 20 March 2019 Abstract: G protein-coupled receptors (GPCRs) belong to the largest class of drug targets. Approximately half of the members of the human GPCR superfamily are chemosensory receptors, including odorant receptors (ORs), trace amine-associated receptors (TAARs), bitter taste receptors (TAS2Rs), sweet and umami taste receptors (TAS1Rs). Interestingly, these chemosensory GPCRs (csGPCRs) are expressed in several tissues of the body where they are supposed to play a role in biological functions other than chemosensation. Despite their abundance and physiological/pathological relevance, the druggability of csGPCRs has been suggested but not fully characterized. Here, we aim to explore the potential of targeting csGPCRs to treat diseases by reviewing the current knowledge of csGPCRs expressed throughout the body and by analysing the chemical space and the drug-likeness of flavour molecules. Keywords: smell; taste; flavour molecules; drugs; chemosensory receptors; ecnomotopic expression 1. Introduction Thirty-five percent of approved drugs act by modulating G protein-coupled receptors (GPCRs) [1,2]. GPCRs, also named 7-transmembrane (7TM) receptors, based on their canonical structure, are the largest family of membrane receptors in the human genome.
    [Show full text]
  • WO 2019/068007 Al Figure 2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/068007 Al 04 April 2019 (04.04.2019) W 1P O PCT (51) International Patent Classification: (72) Inventors; and C12N 15/10 (2006.01) C07K 16/28 (2006.01) (71) Applicants: GROSS, Gideon [EVIL]; IE-1-5 Address C12N 5/10 (2006.0 1) C12Q 1/6809 (20 18.0 1) M.P. Korazim, 1292200 Moshav Almagor (IL). GIBSON, C07K 14/705 (2006.01) A61P 35/00 (2006.01) Will [US/US]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., C07K 14/725 (2006.01) P.O. Box 4044, 7403635 Ness Ziona (TL). DAHARY, Dvir [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (21) International Application Number: Box 4044, 7403635 Ness Ziona (IL). BEIMAN, Merav PCT/US2018/053583 [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (22) International Filing Date: Box 4044, 7403635 Ness Ziona (E.). 28 September 2018 (28.09.2018) (74) Agent: MACDOUGALL, Christina, A. et al; Morgan, (25) Filing Language: English Lewis & Bockius LLP, One Market, Spear Tower, SanFran- cisco, CA 94105 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/564,454 28 September 2017 (28.09.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/649,429 28 March 2018 (28.03.2018) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (71) Applicant: IMMP ACT-BIO LTD.
    [Show full text]
  • Olfactory Receptors in Non-Chemosensory Tissues
    BMB Reports Invited Mini Review Olfactory receptors in non-chemosensory tissues NaNa Kang & JaeHyung Koo* Department of Brain Science, Daegu Gyeongbuk Institute of Science and Technology (DGIST), Daegu 711-873, Korea Olfactory receptors (ORs) detect volatile chemicals that lead to freezing behavior (3-5). the initial perception of smell in the brain. The olfactory re- ORs are localized in the cilia of olfactory sensory neurons ceptor (OR) is the first protein that recognizes odorants in the (OSNs) in the olfactory epithelium (OE) and are activated by olfactory signal pathway and it is present in over 1,000 genes chemical cues, typically odorants at the molecular level, in mice. It is also the largest member of the G protein-coupled which lead to the perception of smell in the brain (6). receptors (GPCRs). Most ORs are extensively expressed in the Tremendous research was conducted since Buck and Axel iso- nasal olfactory epithelium where they perform the appropriate lated ORs as an OE-specific expression in 1991 (7). OR genes, physiological functions that fit their location. However, recent the largest family among the G protein-coupled receptors whole-genome sequencing shows that ORs have been found (GPCRs) (8), constitute more than 1,000 genes on the mouse outside of the olfactory system, suggesting that ORs may play chromosome (9, 10) and more than 450 genes in the human an important role in the ectopic expression of non-chemo- genome (11, 12). sensory tissues. The ectopic expressions of ORs and their phys- Odorant activation shows a distinct signal transduction iological functions have attracted more attention recently since pathway for odorant perception.
    [Show full text]
  • Predicting Human Olfactory Perception from Activities of Odorant Receptors
    iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski, Anandasankar Ray [email protected] odor perception HIGHLIGHTS Machine learning predicted activity of 34 human ORs for ~0.5 million chemicals chemical structure Activities of human ORs predicts OR activity could predict odor character using machine learning Few OR activities were needed to optimize r predictions of each odor e t c percept a AI r a odorant activates mul- h Behavior predictions in c Drosophila also need few r tiple ORs o olfactory receptor d o activities ts ic ed pr ity tiv ac OR Kowalewski & Ray, iScience 23, 101361 August 21, 2020 ª 2020 The Author(s). https://doi.org/10.1016/ j.isci.2020.101361 iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski1 and Anandasankar Ray1,2,3,* SUMMARY Odor perception in humans is initiated by activation of odorant receptors (ORs) in the nose. However, the ORs linked to specific olfactory percepts are unknown, unlike in vision or taste where receptors are linked to perception of different colors and tastes. The large family of ORs (~400) and multiple receptors activated by an odorant present serious challenges. Here, we first use machine learning to screen ~0.5 million compounds for new ligands and identify enriched structural motifs for ligands of 34 human ORs. We next demonstrate that the activity of ORs successfully predicts many of the 146 different perceptual qualities of chem- icals. Although chemical features have been used to model odor percepts, we show that biologically relevant OR activity is often superior.
    [Show full text]