DOCSLIB.ORG

Download (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download (PDF) Supplementary information Fungal Carbonyl Sulfide Hydrolase of Trichoderma harzianum Strain THIF08 and Its Relationship with Clade D β-Carbonic Anhydrases Yoshihito Masaki1†#, Ryuka Iizuka1#, Hiromi Kato2, Yuka Kojima3, Takahiro Ogawa1,$, Makoto Yoshida1, Yasuhiko Matsushita4, and Yoko Katayama1,5* 1Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan; 2Graduate School of Life Sciences, Tohoku University, 2-1-1 Katahira, Sendai 980-8577, Japan; 3Institute of Global Innovation, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan; 4Gene Research Center, Tokyo University of Agriculture and Technology, 3–5–8 Saiwai-cho, Fuchu, Tokyo 183–8509, Japan; 5Independent Administrative Institution, Tokyo National Research Institute for Cultural Properties, 13-43 Ueno-Park, Taito-ku, Tokyo 110-8713, Japan # These authors contributed equally to this work. †Present address: Chemical Management Center, National Institute of Technology and Evaluation, 2-49-10 Nishihara, Shibuya-ku, Tokyo 151-0066, Japan $ Present address: Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2–24–16 Naka-cho, Koganei, Tokyo 184–8588, Japan Table S1. COS-degrading activity among various enzymes and associated enzyme kinetics* -1 -1 -1 Enzyme** Kingdom Organism name k cat (s ) K m (µM) k cat/K m (s M ) Reference COSase Bacteria Thiobacillus thioparus strain THI115 58 60 9.6×105 Ogawa et al ., 2013 7 CS2 hydrolase Archaea Acidianus sp. strain A1-3 1800 22 8.2×10 Smeulders et al ., 2011 7 CS2 hydrolase Bacteria Acidithiobacillus thiooxidans strain S1p 810 74 1.1×10 Smeulders et al ., 2013 8 CS2 hydrolase Bacteria Acidithiobacillus thiooxidans strain G8 2200 14 1.6×10 Smeulders et al ., 2013 β-CA Plantae Pisum sativum 93 39 2.4×106 Ogée et al ., 2016 α-CA Animalia Bos taurus 41 1.9×103 2.2×104 Haritos et al ., 2005 Nitrogenase Bacteria Azotobacter vinelandii 0.16 3.1×103 52 Seefeldt et al ., 1995 CO dehydrogenase Bacteria Rhodospirillus rubrum ATCC11170 0.52 2.2 2.4×105 Ensign, 1995 RuBisCO Bacteria Rhodospirillus rubrum 6.3 5.6×103 1.1×103 Lorimer and Pierce, 1989 RuBisCO Plantae Spinacia oleracea 3.8 1.8×103 2.2×103 Lorimer and Pierce, 1989 * Modified from Ogawa et al ., 2013. Adapted with permission from (J. Am. Chem. Soc. 2013, 135, 3818-3825). Copyright (2013) American Chemical Society. ** COSase, carbonyl sulfide hydrolase; CS2 hydrolase, carbon disulfide hydrolase; CA, carbonic anhydrase; RuBisCO, ribulose-1,5-bisphosphate carboxylase/oxygenase. Table S2. Oligonucleotides for cloning and sequencing Name Sequence (5' to 3') ITS5_primer GGAAGTAAAAGTCGTAACAAGG ITS4_primer TCCTCCGCTTATTGATATGC TEF1_primer GCCATCCTTGGAGATACCAGC TEF728_primer CATCGAGAAGTTCGAGAAGG 20kd_F01 GGAACCGTTTGCTCCAAGTGAGG 20kd_F02 CATTGCATTTCTCTTTTCACACAGC 20kd_R02 CTGAGATGAACTGGTGGTATTAATCTAC 20kd_R03 TTAAACATTAACCTTGTTAATCTTGCCCGTC 20kd_F06_EcoRIGCGAATTCATCGAAGGTCGTATGACCGTCGCCAGC 20kd_int1_R AGTCAAGACAAAAACCTTTCGGCCGGGAGGCATAG 20kd_int1_F CTATGCCTCCCGGCCGAAAGGTTTTTGTCTTGACT 20kd_int2_R GCATACCGCAGTCGGTGTGATGGATAACAACGAC 20kd_int2_F GTCGTTGTTATCCATCACACCGACTGCGGTATGC 20kd_R09_XhoI GCGCCTCGAGTTAAACATCAACCTTGTTAATCTTG 60kd_F01 CTCTAATCAAGCATCTTCCCTC 60kd_F02 AACATGGCCCCCGCAAACACTC 60kd_F04 GACCCTCCACTTCGTCTCCAAC 60kd_F05 CGCATTATCGTGAGGCATTTCGAACC 60kd_F06 TCCGCCTGCTGCATCAATCCATCACC 60kd_F07 GTTCCTTGCTGGTGCTCACGCCATGG 60kd_R01 CAACCAGGCGAGTCTGGGCCTG 60kd_R02 CGTACCAGACGCCAAGCAGACC 60kd_R03 CGAGATCAGAGCCACCAATGCC 60kd_R04 GATGATGTTGGTCAGCTTCTTG 60kd_R05 ACCCTCCTTTTTCTCTGCATTTTCGG 60kd_R06 TTCTTTTCTTACACCGTATTTAACTG 60kd_R09 GCGCTGGATCCGTCAGAGGTAATGGC GPI_F11_EcoRI GCGAATTCATCGAAGGTCGTATGGCCCCCGCAAACACTCTTCCC GPI_int1-R TTACCATGACGGGGCCGAGATCAGAGCCACCAATG GPI_int1-F ATTGGTGGCTCTGATCTCGGCCCCGTCATGGTAAC GPI_int2-R GGAGGTATTGGTCGAAGGGAGCAACCAGGCGAGTC GPI_int2-F GACTCGCCTGGTTGCTCCCTTCGACCAATACCTCC GPI_int3-R CGCCAAACAGAATGGAGCCAGTGGTGTACTTGGCG GPI_int3-F CGCCAAGTACACCACTGGCTCCATTCTGTTTGGCG GPI_R11_XhoI GCGCCTCGAGTTAGATCTTGGAGAACGACTTG Table S3. CS2 hydrolysis activity of purified protein of recombinant GST-fused COSase measured by the production of H2S* CS2** Protein 460 μM 80 mM 28.8 ± 9.2 ppmv GST-fused COSase ND (3.8 ± 1.2 nmol mg-1 min-1) GST ND ND *Sampling of the headspace gas was in 10 min after the addition of CS2. The amount of H2S produced represents average value of triplicate experiments. Standard deviation of value is shown at right. **ND means that concentrations of H2S in the headspace gas were lower than 100 pptv of detection limit. Table S4. Multiple sequence alignment of the active site of COSase, CS2 hydrolase and clade D β-CA family enzymes from Ascomycota , Basidiomycota , Bacteria and Archaea * Phylum/Division Class Organism name** Enzyme name*** Accession number Used sequence ★ ★ ★ Crenarchaeota Thermoprotei Acidianus sp. strain A1-3 CS2 hydrolase AEL19654 Trp 31 - Gly 92 1 W VLT C M D E R V H I E Q S L G I Q - -P D D ------A H I Y R N A G G I VT D D A I R SASLTT N F F G T- --KEI IVVT H T D C G 62 Euryarchaeota Methanobacteria Methanothermobacter thermautotrophicus strain Delta H CA AAB86055 Cys 33 - Gly 96 1 C I IT C M D S R L I D L LE R A L G I G R G D ------AKVIK N A G N I V D D G V I R SAAVAI YAL G - - -V N EI I IV G H T D C G 64 Euryarchaeota Methanobacteria Methanothermobacter thermautotrophicus CA WP_010877190 Cys 33 - Gly 96 1 C I IT C M D S R L I D L LE R A L G I G R G D ------AKVIK N A G N I V D D G V I R SAAVAI YAL G - - -V N EI I IV G H T D C G 64 Acidobacteria Acidobacteria Acidobacteria bacterium 13 2 20CM 2 57 6 HP OLB85114 Ala 32 - Gly 92 1 A V L T C M D T R LS- T R T L G LK- -E G D ------A H I I R N A G G I VT D D T L R SLVVS H H L L G T- - -EEF M V V N H T D C G 61 Acidobacteria Acidobacteria Acidobacteria bacterium 13 2 20CM 57 17 HP OLB39356 Ala 32 - Gly 92 1 A V L T C M D T R LS- T R T L G LK- -E G D ------A H I I R N A G G I VT D D T L R SLVVS H H L L G T- - -EEF M V I N H T D C G 61 Acidobacteria Acidobacteria Bryobacterales bacterium KBS 96 CA WP_020722144 Ala 34 - Gly 95 1 A I L T C M D A R L D PAKFA G LS- -E G D ------A H V I R N A G G R ATE D A I R SLVISYKLL G T- - -KE W FV I H H V D C G 62 Acidobacteria Acidobacteria Edaphobacter aggregans CA WP_035357967 Ala 34 - Gly 95 1 A I L T C M D A R L D PAKFA G LS- -E G D ------A H V I R N A G G R A S D D A I R SLVISYKLL G T- - - R EFFV I H H T N C G 62 Actinobacteria Actinobacteria Actinosynnema mirum DSM 43827 CA ACU34313 Thr 32 - Gly 93 1 T I L T C M D S R I R VFEI F G LK- - Q G E------A H V L R N A G G VVT D D M I R SLALS Q R K L G T- - - R EVLLV H H T N C G 62 Actinobacteria Actinobacteria Amycolatopsis keratiniphila CA WP_016333233 Ala 31 - Gly 92 1 A V L A C M D A R L N V Y G A L G L Q - -E G E------A H V I R N A G G VVTE D E I R SLAIS Q R L L G T- - - R EI ILI H H T D C G 62 Actinobacteria Actinobacteria Dietzia maris DSM 43672 CA KZO58441 Ala 32 - Gly 93 1 A V V A C M D A R L N P Y G L L G LT- -E G D ------A H V I R N A G G VVT D D V L R SLTIS Q R L L G T- --EEIVLI H H T D C G 62 Actinobacteria Actinobacteria Geodermatophilus obscurus DSM 43160 CA ADB77019 Ala 31 - Gly 92 1 A V V A C M D S R M PLFP M L G LE- -V G D ------A H V I R N A G G VI TE D V I R SLTVS Q H V L G T- - - R EI LLV H H T Q C G 62 Actinobacteria Actinobacteria Gordonia bronchialis DSM 43247 CA ACY22488 Ala 31 - Gly 92 1 A V V A C M D A R L D V Y R I L G L D - - D G E------A H V I R N A G G VI T D D E I R SLAIS Q R L L G T---TEI ILI H H T D C G 62 Actinobacteria Actinobacteria Kitasatospora CA WP_014135273 Ala 41 - Gly 102 1 A V V A C M D A R L D LFAAL G LE- -L G D ------A H I I R N A G G VVT D D A I R SLTIS Q R A L G T- - - R TVVL I H H T G C G 62 Actinobacteria Actinobacteria Mycolicibacterium phlei CA WP_003887124 Ala 31 - Gly 92 1 A V V A C M D A R L D V Y R I L G LK- - D G E------A H V I R N A G G VVT D D E I R SLAIS Q R L L G T- - - R EI ILI H H T D C G 62 Actinobacteria Actinobacteria Mycobacterium tuberculosis strain H37Rv CA NP_215800 Ala 31 - Gly 92 1 A I V A C M D A R L D V Y R M L G IK- -E G E------A H V I R N A G C VVT D D V I R SLAIS Q R L L G T- - - R EI ILL H H T D C G 62 Actinobacteria Actinobacteria Mycolicibacterium rhodesiae CA WP_005146653 Ala 31 - Gly 92 1 A V V A C M D A R L D V Y R I L G LK- - D G E------A H V I R N A G G VI T D D E I R SLAIS Q R L L G T---KEI ILI H H T D C G 62 Actinobacteria Actinobacteria Nocardia jiangxiensis CA WP_040830785 Ala 31 - Gly 92 1 A V V A C M D A R L D V Y R I L G L G - -E G E------A H V I R N A G G VVT D D E I R SLAIS Q R L L G T---TEI ILI H H T D C G 62 Actinobacteria Actinobacteria Streptomyces ambofaciens ATCC23877 CA AKZ55233 Ala 57 - Gly 118 1 A V V A C M D A R L D VTAAL G L R - - N G D ------ C H V I R N A G G AVT D D V I R SLTIS Q R A L G T- - - R SVI LV H H T A C G 62 Actinobacteria Actinobacteria Streptosporangium roseum CA WP_012893510 Ala 32 - Gly 93 1 A V V T C M D S R I D P L G V F G LK- -P G D ------AKIL R N A G A R V T D D V L R TLVLAVYLL G V- - - N R VLV M P H T D C G 62 Proteobacteria Acidithiobacillia Acidithiobacillus thiooxidans strain G8 CS2 hydrolase AGQ48122 Trp 32 - Gly 95 1 W V C A C M D E R LPV D D A L G I R - - G D R ---- G D A H V F R N A G G L I T D D A I R S A M L T C N F F G T---EEIVI I N H T E C G 64 Proteobacteria Acidithiobacillia Acidithiobacillus thiooxidans strain S1p CS2 hydrolase AGQ48123 Trp 35 - Gly 102 1 W VLA C M D E R LPV D EAL G I H - -V D TPA G G G D A H C F R N A G G I VT D D A I R S A M L T C N F F G T---KEIVIV Q H T Q C G 68 Proteobacteria Betaproteobacteria Thiobacillus
Load more

Recommended publications
  • Phylogenetics of Archaeal Lipids Amy Kelly 9/27/2006 Outline
    Phylogenetics of Archaeal Lipids Amy Kelly 9/27/2006 Outline • Phlogenetics of Archaea • Phlogenetics of archaeal lipids • Papers Phyla • Two? main phyla – Euryarchaeota • Methanogens • Extreme halophiles • Extreme thermophiles • Sulfate-reducing – Crenarchaeota • Extreme thermophiles – Korarchaeota? • Hyperthermophiles • indicated only by environmental DNA sequences – Nanoarchaeum? • N. equitans a fast evolving euryarchaeal lineage, not novel, early diverging archaeal phylum – Ancient archael group? • In deepest brances of Crenarchaea? Euryarchaea? Archaeal Lipids • Methanogens – Di- and tetra-ethers of glycerol and isoprenoid alcohols – Core mostly archaeol or caldarchaeol – Core sometimes sn-2- or Images removed due to sn-3-hydroxyarchaeol or copyright considerations. macrocyclic archaeol –PMI • Halophiles – Similar to methanogens – Exclusively synthesize bacterioruberin • Marine Crenarchaea Depositional Archaeal Lipids Biological Origin Environment Crocetane methanotrophs? methane seeps? methanogens, PMI (2,6,10,15,19-pentamethylicosane) methanotrophs hypersaline, anoxic Squalane hypersaline? C31-C40 head-to-head isoprenoids Smit & Mushegian • “Lost” enzymes of MVA pathway must exist – Phosphomevalonate kinase (PMK) – Diphosphomevalonate decarboxylase – Isopentenyl diphosphate isomerase (IPPI) Kaneda et al. 2001 Rohdich et al. 2001 Boucher et al. • Isoprenoid biosynthesis of archaea evolved through a combination of processes – Co-option of ancestral enzymes – Modification of enzymatic specificity – Orthologous and non-orthologous gene
    [Show full text]
  • Template for Taxonomic Proposal to the ICTV Executive Committee to Create a New Family
    Template for Taxonomic Proposal to the ICTV Executive Committee To create a new Family Code† 2005.088B.04 To create a new family* Code† 2005.089B.04 To name the new family* Ampullaviridae † Code 2005.090B.04 To designate the following genera as part of the new family*: Ampullavirus † Assigned by ICTV officers ° Leave blank is not appropriate * repeat these lines and the corresponding arguments for each genus created in the family Author(s) with email address(es) of the Taxonomic Proposal David Prangishvili [email protected] Old Taxonomic Order Order Family Genus Ampullavirus Type Species Acidianus bottle-shaped virus Species in the Genus Acidianus bottle-shaped virus Tentative Species in the Genus none Unassigned Species in the family none New Taxonomic Order Order Family Ampullaviridae Genus Ampullavirus Type Species Acidianus bottle-shaped virus Species in the Genus Acidianus bottle-shaped virus Tentative Species in the Genus none Unassigned Species in the family none ICTV-EC comments and response of the SG Argumentation to create a new family: We propose classifying the Acidianus bottle-shaped virus as a first representative of a new family because of the unique bottle-shaped morphology of the virion which, to our knowledge, has not previously been observed in the viral world. Moreover, the complex asymmetric virion, lacking elements with icosahedral or regular helical symmetry, with two completely different structures at each end and an envelope encasing a funnel-shaped core represents, as far as we can judge, represents a principally novel type of virus particle. The funnel-shaped core of the enveloped virion consists of three distinct structural units: the “stopper”, the nucleoprotein cone, consisting of double-stranded DNA and DNA-binding proteins, and the inner core.
    [Show full text]
  • Spindle Shaped Virus (SSV) : Mutants and Their Infectivity
    Portland State University PDXScholar University Honors Theses University Honors College 2014 Spindle Shaped Virus (SSV) : Mutants and Their Infectivity Thien Hoang Portland State University Follow this and additional works at: https://pdxscholar.library.pdx.edu/honorstheses Let us know how access to this document benefits ou.y Recommended Citation Hoang, Thien, "Spindle Shaped Virus (SSV) : Mutants and Their Infectivity" (2014). University Honors Theses. Paper 231. https://doi.org/10.15760/honors.56 This Thesis is brought to you for free and open access. It has been accepted for inclusion in University Honors Theses by an authorized administrator of PDXScholar. Please contact us if we can make this document more accessible: [email protected]. Spindle Shaped Virus (SSV): Mutants and Their Infectivity by Thien Hoang An undergraduate honors thesis submitted in partial fulfillment of the requirements for the degree of Bachelor of Science in University Honors and Biology: Micro/molecular biology Thesis Adviser Dr. Kenneth Stedman Portland State University 2014 Abstract: SSV1 is an archaeal virus that infects the thermoacidophile Sulfolobus residing in hot springs. The lemon shaped/spindle-shaped fuselloviruses (SSV) that infect Sulfolobus solfataricus is quite morphologically different from almost all other viruses. Because these archaeal viruses live in hot springs with high temperatures and low pH, their genomes and structures have adapted to withstand such harsh conditions. Little research has been done on these extreme viruses, and of the little research, SSV has been the most prominent. Not much is known about the genes that the genome encodes and so I have inserted transposons randomly into genome to determine functionality.
    [Show full text]
  • Sp. Nov. and Acidianus Brierleyi Comb
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Oct. 1986, p. 559-564 Vol. 36, No. 4 0020-7713/86/040559-06$02.OO/O Copyright 0 1986, International Union of Microbiological Societies Acidianus infernus gen. nov.? sp. nov. and Acidianus brierleyi comb. nov. : Facultatively Aerobic, Extremely Acidophilic Thermophilic Sulfur-Metabolizing Archaebacteria ANDREAS SEGERER,l ANNEMARIE NEUNER,I JAKOB K. KRISTJANSSON,2 AND KARL 0. STETTER1* Lehrstuhl fur Mikrobiologie, Universitat, 8400 Regensburg, Federal Republic of Germany' and Institute of Biology, University of Iceland, Reykjavik, Icelana A new genus, Acidianus, is characterized from studies of 26 isolates of thermoacidophilic archaebacteria from different solfatara fields and marine hydrothermal systems; these isolates grow as facultative aerobes by lithotrophic oxidation and reduction of So, respectively, and are therefore different from the strictly aerobic Sulfolobus species. The Acidianus isolates have a deoxyribonucleic acid guanine-plus-cytosinecontent of 31 mol%. In contrast, two of three Sulfolobus species, including the type species, have a guanine-plus-cytosine content of 37 mol%; Sulfolobus brierleyi is the exception, with a guanine-plus-cytosine content of 31 mol%. In contrast to its earlier descriptions, S. brierleyi is able to grow strictly anaerobically by hydrogen-sulfur autotrophy. Therefore, it is described here as a member of the genus Acidiunus. The following species are assigned to the genus Acidiunus: Acidiunus infernus sp. nov. (type strain, strain DSM 3191) and Acidiunus brierleyi comb. nov. (type strain, strain DSM 1651). The following two major groups of extremely thermophilic MATERIALS AND METHODS So-metabolizing archaebacteria (12) that thrive within acidic solfatara fields have been described previously: (i) the genus Bacterial strains.
    [Show full text]
  • Lipids of Sulfolobus Spp. | Encyclopedia
    Lipids of Sulfolobus spp. Subjects: Biophysics | Biotechnology Contributors: Kerstin Rastaedter , David J. Wurm Submitted by: Kerstin Rastaedter Definition Archaea, and thereby, Sulfolobus spp. exhibit a unique lipid composition of ether lipids, which are altered in regard to the ratio of diether to tetraether lipids, number of cyclopentane rings and type of head groups, as a coping mechanism against environmental changes. Sulfolobales mainly consist of C40-40 tetraether lipids (caldarchaeol) and partly of C20-20 diether lipids (archaeol). A variant of caldarchaeol called glycerol dialkylnonitol tetraether (GDNT) has only been found in Sulfolobus and other members of the Creanarchaeota phylum so far. Altering the numbers of incorporated cyclopentane rings or the the diether to tetraether ratio results in more tightly packed membranes or vice versa. 1. The Cell Membrane and Lipids of Sulfolobus spp. The thermoacidophilic genus Sulfolobus belongs to the phylum Crenarchaeota and is a promising player for biotechnology [1], since it harbors a couple of valuable products, such as extremozymes[ 2], trehalose [3], archaeocins [4] and lipids for producing archaeosomes [5]. Genetic tools for this genus have rapidly advanced in recent years[ 6], generating new possibilities in basic science and for biotechnological applications alike. The cultivation conditions are preferably at around 80 °C and pH 3 [7]. Sulfolobus species are able to grow aerobically and can be readily cultivated on a laboratory scale. These organisms became a model organism for Crenarchaeota and for adaption processes to extreme environments [8][9][10][11][12][13]. Sulfolobus species were found in solfataric fields all over the world[ 14]. A major drawback of cultivating this organism was the lack of a defined cultivation medium.
    [Show full text]
  • Extremophiles-Basic Concepts
    CONTENTS CONTENTS EXTREMOPHILES Extremophiles - Volume 1 No. of Pages: 396 ISBN: 978-1-905839-93-3 (eBook) ISBN: 978-1-84826-993-4 (Print Volume) Extremophiles - Volume 2 No. of Pages: 392 ISBN: 978-1-905839-94-0 (eBook) ISBN: 978-1-84826-994-1 (Print Volume) Extremophiles - Volume 3 No. of Pages: 364 ISBN: 978-1-905839-95-7 (eBook) ISBN: 978-1-84826-995-8 (Print Volume) For more information of e-book and Print Volume(s) order, please click here Or contact : [email protected] ©Encyclopedia of Life Support Systems (EOLSS) EXTREMOPHILES CONTENTS VOLUME I Extremophiles: Basic Concepts 1 Charles Gerday, Laboratory of Biochemistry, University of Liège, Belgium 1. Introduction 2. Effects of Extreme Conditions on Cellular Components 2.1. Membrane Structure 2.2. Nucleic Acids 2.2.1. Introduction 2.2.2. Desoxyribonucleic Acids 2.2.3. Ribonucleic Acids 2.3. Proteins 2.3.1. Introduction 2.3.2. Thermophilic Proteins 2.3.2.1. Enthalpically Driven Stabilization Factors: 2.3.2.2. Entropically Driven Stabilization Factors: 2.3.3. Psychrophilic Proteins 2.3.4. Halophilic Proteins 2.3.5. Piezophilic Proteins 2.3.5.1. Interaction with Other Proteins and Ligands: 2.3.5.2. Substrate Binding and Catalytic Efficiency: 2.3.6. Alkaliphilic Proteins 2.3.7. Acidophilic Proteins 3. Conclusions Extremophiles: Overview of the Biotopes 43 Michael Gross, University of London, London, UK 1. Introduction 2. Extreme Temperatures 2.1. Terrestrial Hot Springs 2.2. Hot Springs on the Ocean Floor and Black Smokers 2.3. Life at Low Temperatures 3. High Pressure 3.1.
    [Show full text]
  • 4 Metabolic and Taxonomic Diversification in Continental Magmatic Hydrothermal Systems
    Maximiliano J. Amenabar, Matthew R. Urschel, and Eric S. Boyd 4 Metabolic and taxonomic diversification in continental magmatic hydrothermal systems 4.1 Introduction Hydrothermal systems integrate geological processes from the deep crust to the Earth’s surface yielding an extensive array of spring types with an extraordinary diversity of geochemical compositions. Such geochemical diversity selects for unique metabolic properties expressed through novel enzymes and functional characteristics that are tailored to the specific conditions of their local environment. This dynamic interaction between geochemical variation and biology has played out over evolu- tionary time to engender tightly coupled and efficient biogeochemical cycles. The timescales by which these evolutionary events took place, however, are typically in- accessible for direct observation. This inaccessibility impedes experimentation aimed at understanding the causative principles of linked biological and geological change unless alternative approaches are used. A successful approach that is commonly used in geological studies involves comparative analysis of spatial variations to test ideas about temporal changes that occur over inaccessible (i.e. geological) timescales. The same approach can be used to examine the links between biology and environment with the aim of reconstructing the sequence of evolutionary events that resulted in the diversity of organisms that inhabit modern day hydrothermal environments and the mechanisms by which this sequence of events occurred. By combining molecu- lar biological and geochemical analyses with robust phylogenetic frameworks using approaches commonly referred to as phylogenetic ecology [1, 2], it is now possible to take advantage of variation within the present – the distribution of biodiversity and metabolic strategies across geochemical gradients – to recognize the extent of diversity and the reasons that it exists.
    [Show full text]
  • International Code of Nomenclature of Prokaryotes
    2019, volume 69, issue 1A, pages S1–S111 International Code of Nomenclature of Prokaryotes Prokaryotic Code (2008 Revision) Charles T. Parker1, Brian J. Tindall2 and George M. Garrity3 (Editors) 1NamesforLife, LLC (East Lansing, Michigan, United States) 2Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany) 3Michigan State University (East Lansing, Michigan, United States) Corresponding Author: George M. Garrity ([email protected]) Table of Contents 1. Foreword to the First Edition S1–S1 2. Preface to the First Edition S2–S2 3. Preface to the 1975 Edition S3–S4 4. Preface to the 1990 Edition S5–S6 5. Preface to the Current Edition S7–S8 6. Memorial to Professor R. E. Buchanan S9–S12 7. Chapter 1. General Considerations S13–S14 8. Chapter 2. Principles S15–S16 9. Chapter 3. Rules of Nomenclature with Recommendations S17–S40 10. Chapter 4. Advisory Notes S41–S42 11. References S43–S44 12. Appendix 1. Codes of Nomenclature S45–S48 13. Appendix 2. Approved Lists of Bacterial Names S49–S49 14. Appendix 3. Published Sources for Names of Prokaryotic, Algal, Protozoal, Fungal, and Viral Taxa S50–S51 15. Appendix 4. Conserved and Rejected Names of Prokaryotic Taxa S52–S57 16. Appendix 5. Opinions Relating to the Nomenclature of Prokaryotes S58–S77 17. Appendix 6. Published Sources for Recommended Minimal Descriptions S78–S78 18. Appendix 7. Publication of a New Name S79–S80 19. Appendix 8. Preparation of a Request for an Opinion S81–S81 20. Appendix 9. Orthography S82–S89 21. Appendix 10. Infrasubspecific Subdivisions S90–S91 22. Appendix 11. The Provisional Status of Candidatus S92–S93 23.
    [Show full text]
  • The Oligomeric State of the Active Vps4 AAA Atpase
    NIH Public Access Author Manuscript J Mol Biol. Author manuscript; available in PMC 2015 February 06. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: J Mol Biol. 2014 February 6; 426(3): 510–525. doi:10.1016/j.jmb.2013.09.043. The oligomeric state of the active Vps4 AAA ATPase Nicole Monroe1, Han Han1, Malgorzata D. Gonciarz1,2, Debra M. Eckert1, Mary Anne Karren1, Frank G. Whitby1, Wesley I. Sundquist1,*, and Christopher P. Hill1,* 1Department of Biochemistry, University of Utah School of Medicine, 15 N Medical Drive East RM 4100, Salt Lake City, UT 84112-5650, USA Abstract The cellular ESCRT pathway drives membrane constriction toward the cytosol and effects membrane fission during cytokinesis, endosomal sorting, and the release of many enveloped viruses, including HIV. A component of this pathway, the AAA ATPase Vps4, provides energy for pathway progression. Although it is established that Vps4 functions as an oligomer, subunit stoichiometry and other fundamental features of the functional enzyme are unclear. Higher-order oligomers have thus far only been characterized for a Walker B mutant of Vps4 in the presence of ATP. Here, we report that although some mutant Vps4 proteins form dodecameric assemblies, active wild-type S. cerevisiae and S. solfataricus Vps4 enzymes can form hexamers in the presence of ATP and ADP, as assayed by size exclusion chromatography and equilibrium analytical ultracentifugation. The Vta1p activator binds hexameric yeast Vps4p without changing the oligomeric state of Vps4p, implying that the active Vta1p:Vps4p complex also contains a single hexameric ring.
    [Show full text]
  • Template for Taxonomic Proposal to the ICTV Executive Committee Creating Species in an Existing Genus
    Template for Taxonomic Proposal to the ICTV Executive Committee Creating Species in an existing genus † Code 2008.005B.U To create the following 5 species in the genus: Betalipothrixvirus belonging to the family° : Lipothrixviridae Acidianus filamentous virus 3 Acidianus filamentous virus 6 Acidianus filamentous virus 7 Acidianus filamentous virus 8 Acidianus filamentous virus 9 † Assigned by ICTV officers ° leave blank if inappropriate or in the case of an unassigned genus Author(s) with email address(es) of the Taxonomic Proposal David Prangishvili [email protected] Old Taxonomic Order Order Family Lipothrixviridae Genus Betalipothrixvirus Type Species Sulfolobus islandicus filamentous virus Species in the Genus Sulfolobus islandicus filamentous virus Sulfolobus islandicus filamentous virus (SIFV) Tentative Species in the Genus Desulfurolobus ambivalens filamentous virus (DAFV) Thermoproteus tenax virus 2 (TTV-2) Thermoproteus tenax virus 3 (TTV-3) New Taxonomic Order Order Family Lipothrixviridae Genus Betalipothrxvirus Type Species Sulfolobus islandicus filamentous virus Species in the Genus Sulfolobus islandicus filamentous virus Sulfolobus islandicus filamentous virus (SIFV) Acidianus filamentous virus 3 Acidianus filamentous virus 3 (AFV3) Acidianus filamentous virus 6 Acidianus filamentous virus 6 (AFV6) Acidianus filamentous virus 7 Acidianus filamentous virus 7 (AFV7) Acidianus filamentous virus 8 Acidianus filamentous virus 6 (AFV8) Acidianus filamentous virus 9 Acidianus filamentous virus 9 (AFV9) Tentative Species
    [Show full text]
  • Microbial Diversity in Nonsulfur, Sulfur and Iron Geothermal Steam Vents
    RESEARCH ARTICLE Microbial diversity in nonsulfur,sulfurand iron geothermal steam vents Courtney A. Benson, Richard W. Bizzoco, David A. Lipson & Scott T. Kelley Department of Biology, San Diego State University, San Diego, CA, USA Correspondence: Scott T. Kelley, Abstract Department of Biology, San Diego State University, 5500 Campanile Drive, San Diego, Fumaroles, commonly called steam vents, are ubiquitous features of geothermal CA 92182-4614, USA. Tel.: 11 619 594 habitats. Recent studies have discovered microorganisms in condensed fumarole 5371; fax: 11 619 594 5676; e-mail: steam, but fumarole deposits have proven refractory to DNA isolation. In this [email protected] study, we report the development of novel DNA isolation approaches for fumarole deposit microbial community analysis. Deposit samples were collected from steam Received 24 June 2010; revised 26 October vents and caves in Hawaii Volcanoes National Park, Yellowstone National Park and 2010; accepted 3 December 2010. Lassen Volcanic National Park. Samples were analyzed by X-ray microanalysis and Final version published online 1 February 2011. classified as nonsulfur, sulfur or iron-dominated steam deposits. We experienced considerable difficulty in obtaining high-yield, high-quality DNA for cloning: only DOI:10.1111/j.1574-6941.2011.01047.x half of all the samples ultimately yielded sequences. Analysis of archaeal 16S rRNA Editor: Alfons Stams gene sequences showed that sulfur steam deposits were dominated by Sulfolobus and Acidianus, while nonsulfur deposits contained mainly unknown Crenarchaeota. Keywords Several of these novel Crenarchaeota lineages were related to chemoautotrophic 16S; phylogeny; microbial community; ammonia oxidizers, indicating that fumaroles represent a putative habitat for Crenarchaeota; Sulfolobus.
    [Show full text]
  • Ptc Plasmids from Sulfolobus Species in the Geothermal Area Of
    Life 2015, 5, 506-520; doi:10.3390/life5010506 OPEN ACCESS life ISSN 2075-1729 www.mdpi.com/journal/life Article pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements Xiaoyu Xiang †, Xiaoxing Huang †, Haina Wang † and Li Huang * State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, No. 1 West Beichen Road, Chaoyang District, Beijing 100101, China; E-Mails: [email protected] (X.X.); [email protected] (X.H.); [email protected] (H.W.) † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-10-6480-7430; Fax: +86-10-6480-7429. Academic Editors: Roger A. Garrett, Michael W. W. Adams and Hans-Peter Klenk Received: 16 December 2014 / Accepted: 4 February 2015 / Published: 12 February 2015 Abstract: Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong.
    [Show full text]