DOCSLIB.ORG

Development of a Thyroperoxidase Inhibition Assay for High- Throughput Screening † ‡ ‡ ∥ § ∥ Katie B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of a Thyroperoxidase Inhibition Assay for High- Throughput Screening † ‡ ‡ ∥ § ∥ Katie B Article pubs.acs.org/crt Development of a Thyroperoxidase Inhibition Assay for High- Throughput Screening † ‡ ‡ ∥ § ∥ Katie B. Paul, , Joan M. Hedge, Daniel M. Rotroff, Michael W. Hornung, Kevin M. Crofton, ‡ and Steven O. Simmons*, † ‡ § Oak Ridge Institute for Science Education Postdoctoral Fellow, Integrated Systems Toxicology Division, Mid-Continent Ecology ∥ Division, National Health and Environmental Effects Research Laboratory, and National Center for Computational Toxicology, Office of Research and Development, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711, United States *S Supporting Information ABSTRACT: High-throughput screening (HTPS) assays to detect inhibitors of thyroperoxidase (TPO), the enzymatic catalyst for thyroid hormone (TH) synthesis, are not currently available. Herein, we describe the development of a HTPS TPO inhibition assay. Rat thyroid microsomes and a fluorescent peroxidase substrate, Amplex UltraRed (AUR), were employed in an end-point assay for comparison to the existing kinetic guaiacol (GUA) oxidation assay. Following optimization of assay metrics, including Z′, dynamic range, and activity, using methimazole (MMI), the assay was tested with a 21-chemical training set. The potency of MMI-induced TPO inhibition was greater with AUR compared to GUA. The dynamic range and Z′ score with MMI were as follows: 127-fold and 0.62 for the GUA assay, 18-fold and 0.86 for the 96-well AUR assay, and 11.5-fold and 0.93 for the 384-well AUR assay. The 384-well AUR assay drastically reduced animal use, requiring one-tenth of the rat thyroid microsomal protein needed for the GUA 96-well format assay. Fourteen chemicals inhibited TPO, with a relative potency ranking of MMI > ethylene thiourea > 6-propylthiouracil > 2,2′,4,4′-tetrahydroxy-benzophenone > 2-mercaptobenzothiazole > 3-amino-1,2,4- triazole > genistein > 4-propoxyphenol > sulfamethazine > daidzein > 4-nonylphenol > triclosan > iopanoic acid > resorcinol. These data demonstrate the capacity of this assay to detect diverse TPO inhibitors. Seven chemicals acted as negatives: 2- hydroxy-4-methoxybenzophenone, dibutylphthalate, diethylhexylphthalate, diethylphthalate, 3,5-dimethylpyrazole-1-methanol, methyl 2-methyl-benzoate, and sodium perchlorate. This assay could be used to screen large numbers of chemicals as an integral component of a tiered TH-disruptor screening approach. − ■ INTRODUCTION ities is well-established.7 12 Even relatively small decreases in maternal thyroxine (T4) during pregnancy affect the IQ of Thyroid hormones (THs) modulate myriad processes in adult children13 as well as other measures of cognition, socialization, and developing organisms in many target tissues, including − and motor function.8,14 17 brain, pituitary, heart, fat, liver, and bone, to maintain diverse Detection of possible thyroid-disrupting activity by environ- functions ranging from metabolic and cardiac output to − mental chemicals represents a salient need for a chemical- neurodevelopment.1 3 Disruption of THs during neuro- ff screening program designed to identify potential developmental development results in permanent changes, whereas the e ects neurotoxicants. Thyroid-disrupting chemicals (TDCs) include during adulthood are generally reversible with a return to xenobiotics that may impact the structure or function of the euthyroid status.4 Severe TH deficiencies during pregnancy result in neurological cretinism, indicated by sensory deficits and mental retardation.1,5,6 Furthermore, the correlation Special Issue: Systems Toxicology between moderate TH disruption (i.e., maternal hypothyrox- Received: August 28, 2013 inemia) and irreversible neurodevelopmental brain abnormal- Published: January 2, 2014 © 2014 American Chemical Society 387 dx.doi.org/10.1021/tx400310w | Chem. Res. Toxicol. 2014, 27, 387−399 Chemical Research in Toxicology Article thyroid gland, perturb enzyme functions that maintain throughput screening assay to detect TPO inhibitors is euthyroid hormone concentrations, or disrupt systemic or unavailable, owing largely to the dependence on low- − tissue thyroid hormone concentrations.18 20 TDCs may act via throughput guaiacol oxidation chemistry. The guaiacol one or more of several molecular-initiating events, including oxidation assay requires absorbance measurements during a inhibition of TH synthesis by disruption of iodide uptake or 60 s kinetic reaction to monitor the development of an unstable thyroperoxidase (TPO), binding to thyroid hormone transport diguaiacol product and requires the use of a large amount of proteins, interference with thyroid receptors systemically, thyroid microsomal protein per test.43,44 The critical need for inhibition of iodothyronine deiodinases at sites of thyroid high-throughput assays to assess multiple molecular-initiating − action, and increased rates of metabolic clearance of THs.20 22 events for TH disruption is underscored by the lack of Screening to identify TDCs will require a multiassay approach, association between rodent thyrotoxicity and high-throughput as maintenance of euthyroid status involves a complicated screening (HTPS) assays for thyroid hormone receptor system of regulatory processes in multiple organs.23 interactions.45 In the present work, we propose to adapt an Toxicants that inhibit TPO activity prevent iodothyronine existing rat thyroid microsome assay to a high-throughput assay production in the thyroid gland.22,23 TPO is a heme-containing, for screening that could be used to screen hundreds to multifunction enzyme critical to TH synthesis located at the thousands of chemicals for potential effects on TPO activity. apical membrane of follicular thyroid cells.24,25 TPO catalyzes This work tested the hypothesis that a commercial fluorescent the oxidation of iodide to hypoiodate, the addition of horseradish-peroxidase substrate, Amplex UltraRed (AUR), hypoiodate to tyrosyl residues on thyroglobulin (Tg), and could be used to detect TPO activity in thyroid microsomes concurrent oxidative coupling of iodinated tyrosyl residues to obtained from rats to generate an in vitro 384-well format assay form iodothyronine hormones triiodothyronine (T3) and that can be used in a high-throughput screening application. − T4.26 28 The antithyroid medication methimazole (MMI) Implementation of this assay drastically reduces the need for corrects hyperthyroidism by decreasing TH synthesis via TPO animal tissue and provides a valuable intermediary approach to inhibition.29 Many other compounds are known to inhibit TPO anchor in vitro screening data from this model or from − activity. The antithyroid drug 6-propylthiouracil (PTU),29 31 potential in vitro cell-based systems to effects on TH the ultraviolet filter benzophenone-2 (BP2),32 isoflavones,33 the homeostasis in whole-animal models. As part of the parasiticide malachite green,34 and ethylene bisdithiocarbamate optimization process, a comparison between the performance pesticides including mancozeb, ziram, and zineb35,36 have all of a 96-well format guaiacol oxidation assay and 96-well as well inhibited TPO. A lack of medium- and high-throughput as 384-well formats of the AUR-TPO assay are demonstrated. screening assays for TPO inhibitors has limited large-scale Importantly, we report a novel method for the AUR-TPO assay screening efforts to identify additional chemicals with potential along with its associated assay metrics and a training-set-based endocrine-disrupting activity through this specific mode of assay verification. We propose that the AUR-TPO assay could action.23 be used for high-throughput screening to identify potential Previous efforts to identify xenobiotics that alter TPO activity TPO inhibitors. − have primarily used models including purified peroxidases,37 39 thyroid follicles,31 or microsomes in spectrophotometric assays ■ METHODS to measure the TPO-catalyzed iodination of tyrosine to yield Animals. Untreated male Long Evans rats (68−72 days old) were monoiodotyrosine38 or the oxidation of guaiacol to dihydroxy- obtained from Charles River Laboratories Inc. (Raleigh, NC) in dimethoxy-diphenyl.30,33 TPO has a C-terminal extension groups of 60 and acclimated 1−7 days in an American Association for thought to be the transmembrane anchor of the protein that Accreditation of Laboratory Animal Care International (AALAC)- approved animal facility. Rats were pair-housed in plastic hanging is notably absent from other human peroxidases, including × × 3 lactoperoxidase (LPO), myeloperoxidase, and eosinophil cages (45 24 20 cm ), with heat-sterilized pine-shavings bedding ffi 40 (Northeastern Products Corp., Warranton, NC). Colony rooms were peroxidase, making TPO more di cult to express and purify. maintained at 21 ± 2 °C with 50 ± 10% humidity on a photoperiod of Due to the high sequence homology and conservation of 28,40,41 12 h light/12 h dark. Food (Purina Rodent Chow no. 5001, Barnes catalytic activity among human peroxidases, purified LPO Supply Co., Durham, NC) and water were provided ad libitum. Tap activity has been utilized as a commercially available surrogate water (Durham, NC water) was filtered through sand and activated for TPO activity to identify TPO inhibitors successfully.28,38,39 charcoal and rechlorinated to 4 to 5 ppm Cl− before use in the animal Cultured porcine thyroid follicles were previously used to facility. Rats were decapitated, and thyroid glands were removed from demonstrate TPO inhibition by MMI using the guaiacol the trachea, weighed (approximately 10 mg per lobe), frozen in liquid
Load more

Recommended publications
  • Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution
    Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution KUNIHIRO YAMAMOTO AND LESLIE J. DEGROOT Thyroid Study Unit, Department of Medicine, University of Chicago, Chicago, Illinois 60637 ABSTRACT. The regulation of iodination was in- TSH injection, whether expressed per mg gland vestigated in male rats during physiological altera- weight, per mg protein, or per fxg DNA, suggesting tions in thyroid function. Thyroid hyperplasia was enzyme induction and cellular hypertrophy. Involu- Downloaded from https://academic.oup.com/endo/article/95/2/606/2618917 by guest on 30 September 2021 produced by giving 0.01% PTU in drinking water or tion by T4 administration caused a decrease in injection of TSH (2 USP U/day); involution was thyroid weight, DNA content, and enzyme activity per induced after PTU treatment by giving 3 fig L-T4/ml gland. The main reason for the decrease in enzyme in drinking water. Increase in activity of thyroid activity per gland was a diminution of cell numbers. peroxidase and NADPH-cytochrome c reductase per During thyroid hyperplasia and involution, perox- gland exceeded gains in thyroid weight and DNA idase and NADPH-cytochrome c reductase activity content early in hyperplasia, but increased essen- is regulated by TSH. During the onset of TSH tially in parallel manner during chronic PTU treat- action, peroxidase and NADPH-cytochrome c re- ment. Enzyme activity per /xg DNA increased to ductase increase to a greater extent than thyroid 155% of control after 4 days of PTU treatment, weight and DNA content, suggesting preferential decreased to 138% on the seventh day, and was at enzyme synthesis in addition to cell hypertrophy.
    [Show full text]
  • Thyroid Peroxidase Antibody Is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease
    Published online: 2018-07-02 Article Thieme Li Fang et al. Thyroid Peroxidase Antibody is … Exp Clin Endocrinol Diabetes 2018; 00: 00–00 Thyroid Peroxidase Antibody is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease Authors Fang Li1 * , Gulibositan Aji1 * , Yun Wang2, Zhiqiang Lu1, Yan Ling1 Affiliations ABSTRACT 1 Department of Endocrinology and Metabolism, Zhong- Purpose Homocysteine is associated with cardiovascular, shan Hospital, Fudan University, Shanghai, China inflammation and autoimmune diseases. Previous studies have 2 Department of Endocrinology and Metabolism, the shown that thyroid peroxidase antibody is associated with ho- Second Hospital of Shijiazhuang City, Shijiazhuang, mocysteine levels in hypothyroidism. The relationship between Hebei Province, China thyroid antibodies and homocysteine in hyperthyroidism re- mains unclear. In this study, we aimed to investigate the asso- Key words ciation of thyroid antibodies with homocysteine in patients human, cardiovascular risk, hyperthyroidism with Graves’ disease. Methods This was a cross-sectional study including 478 received 07.04.2018 Graves’ disease patients who were consecutively admitted and revised 10.05.2018 underwent radioiodine therapy. Homocysteine, thyroid hor- accepted 14.06.2018 mones, thyroid antibodies, glucose and lipids were measured. Results Patients with homocysteine levels above the median Bibliography were older and had unfavorable metabolic parameters com- DOI https://doi.org/10.1055/a-0643-4692 pared to patients with homocysteine levels below the median. Published online: 2.7.2018 Thyroglobulin antibody or thyroid peroxidase antibody was Exp Clin Endocrinol Diabetes 2020; 128: 8–14 associated with homocysteine levels (β = 0.56, 95 %CI 0.03- © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · 1.08, p = 0.04; β = 0.75, 95 %CI 0.23-1.27, p = 0.005).
    [Show full text]
  • Thyroid Surgery for Patients with Hashimoto's Disease
    ® Clinical Thyroidology for the Public VOLUME 12 | ISSUE 7 | JULY 2019 HYPOTHYROIDISM Thyroid surgery for patients with Hashimoto’s disease BACKGROUND SUMMARY OF THE STUDY Hypothyroidism, or an underactive thyroid, is a common This study enrolled patients with hypothyroidism due to problem. In the United States, the most common cause Hashimoto’s thyroiditis who received treatment with thy- of hypothyroidism is Hashimoto’s thyroiditis. This is an roidectomy and thyroid hormone replacement or thyroid autoimmune disorder where antibodies attack the thyroid, hormone replacement alone. The outcome of the study causing inflammation and destruction of the gland. Char- was a patient-reported health score on the generic Short acteristic of Hashimoto’s thyroiditis are high antibodies Form-36 Health Survey (SF-36) after 18 months. to thyroid peroxidase (TPO Ab) on blood tests. Hypo- thyroidism is treated by thyroid hormone and returning Patients were in the age group of 18 to 79 years. They all thyroid hormone levels to the normal range usually had a TPOAb titer >1000 IU/L and reported persistent resolves symptoms in most patients. symptoms despite having normal thyroid hormone levels based on blood tests. Typical symptoms included fatigue, However, in some patients, symptoms may persist despite increased need for sleep associated with reduced sleep what appears to be adequate treatment based on blood quality, joint and muscle tenderness, dry mouth, and dry tests of thyroid function. This raises the possibility that eyes. Follow up visits were done every 3 months for 18 some symptoms may be related to the autoimmune months and the thyroid hormone therapy was adjusted as condition itself.
    [Show full text]
  • How Useful Are Autoantibodies in Diagnosing Thyroid Disorders?
    Evidence Based Answers CLINIcAL INQUiRiES from the Family Physicians Inquiries Network Heather Downs, DO, How useful are autoantibodies and Albert A. Meyer, MD New Hanover Regional Medical in diagnosing thyroid disorders? Center, Wilmington, NC Donna Flake, MSLS, MSAS Coastal Area Health Education Evidence-based answer Center, Wilmington, NC They’re useful in diagnosing Graves’ increases or decreases the probability disease and, to a lesser extent, of autoimmune thyroid disease by only autoimmune thyroid disease; they can also a small to moderate degree (SOR: B, 3 help predict hypothyroidism. Thyrotropin cross-sectional studies). receptor antibodies (TRAb) may be mildly Thyroid-stimulating hormone (TSH) elevated in a variety of thyroid disorders, levels >2 mU/L, although still in the normal but a TRAb level >10 U/L increases range, can be followed up with TPOAb ® the probability of Graves’ disease by Dowdentesting to determine Health whether Mediathe patient a moderate to large degree (strength has an increased probability of developing of recommendation [SORCopyright]: B, cross- hypothyroidism (SOR: B, cohort study sectional study). A positive or negativeFor personalwith a vague hypothyroidism use only reference thyroid peroxidase antibody (TPOAb) test standard). Clinical commentary FAST TRACK In equivocal situations and pregnancy, infiltrative disorders, Reidel’s thyroiditis, antibodies may help or subacute granulomatous thyroiditis are Thyroid Under most circumstances, hypo- and suspected. TPOAb may help predict the autoantibodies hyperthyroid disorders can be diagnosed development of clinical hypothyroidism in can help diagnose by testing TSH and free T , without thyroid patients with TSH in the range of 5-10 mU/L. 4 Graves’ disease antibody testing. Radionuclide uptake and Pregnancy-related hyperthyroidism scan provide diagnostic information for requires antibody testing because and autoimmune hyperthyroid states.
    [Show full text]
  • NNT Mutations: a Cause of Primary Adrenal Insufficiency, Oxidative Stress and Extra- Adrenal Defects
    175:1 F Roucher-Boulez and others NNT, adrenal and extra-adrenal 175:1 73–84 Clinical Study defects NNT mutations: a cause of primary adrenal insufficiency, oxidative stress and extra- adrenal defects Florence Roucher-Boulez1,2, Delphine Mallet-Motak1, Dinane Samara-Boustani3, Houweyda Jilani1, Asmahane Ladjouze4, Pierre-François Souchon5, Dominique Simon6, Sylvie Nivot7, Claudine Heinrichs8, Maryline Ronze9, Xavier Bertagna10, Laure Groisne11, Bruno Leheup12, Catherine Naud-Saudreau13, Gilles Blondin13, Christine Lefevre14, Laetitia Lemarchand15 and Yves Morel1,2 1Molecular Endocrinology and Rare Diseases, Lyon University Hospital, Bron, France, 2Claude Bernard Lyon 1 University, Lyon, France, 3Pediatric Endocrinology, Gynecology and Diabetology, Necker University Hospital, Paris, France, 4Pediatric Department, Bab El Oued University Hospital, Alger, Algeria, 5Pediatric Endocrinology and Diabetology, American Memorial Hospital, Reims, France, 6Pediatric Endocrinology, Robert Debré Hospital, Paris, France, 7Department of Pediatrics, Rennes Teaching Hospital, Rennes, France, 8Pediatric Endocrinology, Queen Fabiola Children’s University Hospital, Brussels, Belgium, 9Endocrinology Department, L.-Hussel Hospital, Vienne, France, 10Endocrinology Department, Cochin University Hospital, Paris, France, 11Endocrinology Department, Lyon University Hospital, Bron-Lyon, France, 12Paediatric and Clinical Genetic Department, Correspondence Nancy University Hospital, Vandoeuvre les Nancy, France, 13Pediatric Endocrinology and Diabetology, should be
    [Show full text]
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • Illness-Induced Changes in Thyroid Hormone Metabolism: Focus on the Tissue Level
    r e V i e W illness-induced changes in thyroid hormone metabolism: focus on the tissue level J. Kwakkel*, E. Fliers, A. Boelen Department of Endocrinology & Metabolism, Academic Medical Center, University of Amsterdam, the Netherlands, *corresponding author: tel.: +31 (0)20-566 67 01, fax: +31 (0)20-691 76 82, e-mail: [email protected] a b s t r a C t during illness changes in thyroid hormone metabolism ring and the outer (tyrosyl) ring of T4 can be deiodinated, occur, collectively known as the non-thyroidal illness ultimately leading to the formation of 3,3’-di-iodothyronine syndrome (NTIS). NTIS is characterised by low serum (T2) (figure 1). thyroid hormone levels without the expected rise in serum thyroid-stimulating hormone, indicating a major change in thyroid hormone feedback regulation. recent studies n o n - t H yroidal illness syndro M e have made clear that during NTIS differential changes in thyroid hormone metabolism occur in various tissues, the During illness many aspects of thyroid hormone net effect of which may be either activation or inhibition of metabolism change, collectively known as the thyroid hormone action. in this review we discuss systemic non-thyroidal illness syndrome (NTIS). The hallmark of and local changes in thyroid hormone metabolism during NTIS is decreased serum thyroid hormone levels without illness, highlighting their physiological implications in an increase in TSH and TRH expression, indicating terms of disease course. the absence of negative feedback regulation. This may represent a useful adaptation of the body to counteract excessive catabolism observed during illness and can be K e y W o r d s viewed as a part of the acute phase response.4 However, especially during prolonged critical illness in the ICU Deiodinase, inflammation, non-thyroidal illness syndrome, setting NTIS may be maladaptative.5 thyroid hormone figure 1.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Type 3 Lodothyronine Deiodinase: Cloning, in Vitro Expression, and Functional Analysis of the Placental Selenoenzyme
    Type 3 lodothyronine deiodinase: cloning, in vitro expression, and functional analysis of the placental selenoenzyme. D Salvatore, … , D L St Germain, P R Larsen J Clin Invest. 1995;96(5):2421-2430. https://doi.org/10.1172/JCI118299. Research Article Type 3 iodothyronine deiodinase (D3) catalyzes the conversion of T4 and T3 to inactive metabolites. It is highly expressed in placenta and thus can regulate circulating fetal thyroid hormone concentrations throughout gestation. We have cloned and expressed a 2.1-kb human placental D3 cDNA which encodes a 32-kD protein with a Km of 1.2 nM for 5 deiodination of T3 and 340 nM for 5' deiodination of reverse T3. The reaction requires DTT and is not inhibited by 6n- propylthiouracil. We quantitated transiently expressed D3 by specifically labeling the protein with bromoacetyl [125I]T3. The Kcat/Km ratio for 5 deiodination of T3 was over 1,000-fold that for 5' deiodination of reverse T3. Human D3 is a selenoenzyme as evidenced by (a) the presence of an in frame UGA codon at position 144, (b) the synthesis of a 32-kD 75Se-labeled protein in D3 cDNA transfected cells, and (c) the presence of a selenocysteine insertion sequence element in the 3' untranslated region of the mRNA which is required for its expression. The D3 selenocysteine insertion sequence element is more potent than that in the type 1 deiodinase or glutathione peroxidase gene, suggesting a high priority for selenocysteine incorporation into this enzyme. The conservation of this enzyme from Xenopus laevis tadpoles to humans implies an essential role for regulation of thyroid hormone inactivation during embryological development.
    [Show full text]
  • Lactoperoxidase Antibacterial System: Natural Occurrence, Biological Functions and Practical Applications
    724 Journal of Food Protection, Vol. 47. No. 9, Pages 724-732 (September 1984) Copyright®, International Association of Milk, Food, and Environmental Sanitarians Lactoperoxidase Antibacterial System: Natural Occurrence, Biological Functions and Practical Applications BRUNO REITER1 and GORAN HARNULV2* Downloaded from http://meridian.allenpress.com/jfp/article-pdf/47/9/724/1650811/0362-028x-47_9_724.pdf by guest on 29 September 2021 National Institute for Research in Dairying, Shinfield, Reading, RG2 9AT, England and Alfa-Laval Agri International AS, P.O. Box 39, S-I47 00 Tumba, Sweden (Received for publication January 30, 1984) ABSTRACT (37,80). The various biological functions of the LP sys­ tem, which have now been established, will be discussed In the present review dealing with the antibacterial lac­ below. toperoxidase (LP) system, it is shown that the two reactants In recent years, much work has been devoted to practi­ thiocyanate (SCN~) and hydrogen peroxide (H202) as well as cal applications of the LP system. The effect against oral the catalytic enzyme lactoperoxidase (LP) are widely distributed streptococci (5,19,33,101,105,107) has led to the de­ in nature and that evidence for the activity of the LP system velopment and marketing of a toothpaste containing nec­ in animals, including man, is accumulating. The in vitro effects on bacterial and animal cells are discussed and the unique ac­ essary ingredients to activate the LP system. Promising tion of the LP system on the bacterial cytoplasmic membrane results have also been obtained when including activating is pointed out. Some practical applications are also presented, components in the feed to calves (81,83,86) with the aim with particular emphses on the possibility of utilizing the LP of potentiating the LP system in the intestinal tract.
    [Show full text]
  • Thyroxine Binding to Type III Iodothyronine Deiodinase Craig A
    www.nature.com/scientificreports OPEN Thyroxine binding to type III iodothyronine deiodinase Craig A. Bayse*, Eric S. Marsan, Jenna R. Garcia & Alexis T. Tran‑Thompson Iodothyronine deiodinases (Dios) are important selenoproteins that control the concentration of the active thyroid hormone (TH) triiodothyronine through regioselective deiodination. The X‑ray structure of a truncated monomer of Type III Dio (Dio3), which deiodinates TH inner rings through a selenocysteine (Sec) residue, revealed a thioredoxin-fold catalytic domain supplemented with an unstructured Ω-loop. Loop dynamics are driven by interactions of the conserved Trp207 with solvent in multi-microsecond molecular dynamics simulations of the Dio3 thioredoxin(Trx)-fold domain. Hydrogen bonding interactions of Glu200 with residues conserved across the Dio family anchor the loop’s n‑terminus to the active site Ser‑cys-Thr‑Sec sequence. A key long‑lived loop conformation coincides with the opening of a cryptic pocket that accommodates thyroxine (T4) through an I⋯Se halogen bond to Sec170 and the amino acid group with a polar cleft. The Dio3-T4 complex is stabilized by an I⋯O halogen bond between an outer ring iodine and Asp211, consistent with Dio3 selectivity for inner ring deiodination. Non-conservation of residues, such as Asp211, in other Dio types in the fexible portion of the loop sequence suggests a mechanism for regioselectivity through Dio type- specifc loop conformations. Cys168 is proposed to attack the selenenyl iodide intermediate to regenerate Dio3 based upon structural comparison with related Trx-fold proteins. Iodothyronine deiodinase (Dio) membrane selenoproteins regulate thyroid hormone (TH) activity through regioselective deiodination (Fig. 1a)1–10.
    [Show full text]
  • The Interactions Between Selenium and Iodine Deficiencies in Man And
    Nutrition Research Reviews (1999), 12, 55±73 55 The interactions between selenium and iodine de®ciencies in man and animals John R. Arthur1*, Geoffrey J. Beckett2 and Julie H. Mitchell1 1Division of Micronutrient and Lipid Metabolism, Rowett Research Institute, Greenburn Road, Bucksburn, Aberdeen AB21 9SB, UK 2University Department of Clinical Biochemistry, The Royal In®rmary, Edinburgh EH3 9YW, UK Abstract Up to one billion people live in areas where they may be at risk from I de®ciency. Many of the debilitating effects of the de®ciency may be irreversible, consequently it is essential to understand the mechanisms whereby lack of I can cause disease 0 through decreased thyroxine and 3,3 ,5-triiodothyronine (T3) synthesis. Since Se has an essential role in thyroid hormone metabolism, it has the potential to play a major part in the outcome of I de®ciency. These effects of Se derive from two aspects of its biological function. First, three Se-containing deiodinases regulate the synthesis and degradation of the biologically active thyroid hormone, T3. Second, selenoperoxidases and possibly thioredoxin reductase (EC 1.6.4.5) protect the thyroid gland from H2O2 produced during the synthesis of thyroid hormones. The mechanisms whereby Se de®ciency exacerbates the hypothyroidism due to I de®ciency have been elucidated in animals. In contrast to these adverse effects, concurrent Se de®ciency may also cause changes in deiodinase activities which can protect the brain from low T3 concentrations in I de®ciency. Animals with Se and I de®ciency have changes in serum thyroid hormone concentrations that are similar to those observed in patients with I de®ciency disease.
    [Show full text]