Melanin Concentrating Hormone (MCH) Is Involved in the Regulation of Growth Hormone in Cichlasoma Dimerus (Cichlidae, Teleostei)

General and Comparative Endocrinology 176 (2012) 102–111

Contents lists available at SciVerse ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier.com/locate/ygcen

Melanin concentrating hormone (MCH) is involved in the regulation of growth hormone in Cichlasoma dimerus (Cichlidae, Teleostei)

D.I. Pérez Sirkin a, M.M. Cánepa a,b,1, M. Fossati a, J.I. Fernandino c, T. Delgadin a,b, L.F. Canosa c, ⇑ G.M. Somoza c, P.G. Vissio a,b, a Departamento de Biodiversidad y Biología Experimental, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, C1428EHA Buenos Aires, Argentina b Consejo Nacional de Investigaciones Cientíﬁcas y Técnicas (CONICET), Argentina c Instituto de Investigaciones Biotecnológicas – Instituto Tecnológico de Chascomús (CONICET-UNSAM), Chascomús, Buenos Aires, Argentina article info abstract

Article history: Growth hormone (GH) is the main pituitary hormone involved in somatic growth. In fish, the neuroen- Received 15 July 2011 docrine control of GH is multifactorial due to the interaction of multiple inhibitors and stimulators. Mel- Revised 13 December 2011 anin-concentrating hormone (MCH) is a cyclic peptide involved in skin color regulation of fish. In Accepted 3 January 2012 addition, MCH has been related to the regulation of food intake in both mammals and fish. There is only Available online 11 January 2012 one report presenting evidences on the GH release stimulation by MCH in mammals in experiments in vitro, but there are no data on non-mammals. In the present work, we report for the first time the Keywords: sequence of MCH and GH cDNA in Cichlasoma dimerus, a freshwater South American cichlid fish. We Melanin concentrating hormone detected contacts between MCH fibers and GH cells in the proximal pars distalis region of the pituitary Growth hormone Pituitary gland by double label confocal immunofluorescence indicating a possible functional relationship. Besides, Teleost we found that MCH increased GH transcript levels and stimulated GH release in pituitary cultures. Addi- Cichlid tionally, C. dimerus exposed to a white background had a greater number of MCH neurons with a larger nuclear area and higher levels of MCH transcript than those fish exposed to a black background. Further- more, fish reared for 3 months in a white background showed a greater body weight and total length compared to those from black background suggesting that MCH might be related to somatic growth in C. dimerus. Our results report for the first time, that MCH is involved in the regulation of the synthesis and release of GH in vitro in C. dimerus, and probably in the fish growth rate. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction neuropeptide Y, thyrotropin-releasing and corticotrophin-releasing hormones [9]. Recent studies have demonstrated the presence In vertebrates, growth hormone (GH) is the main pituitary hor- of IGF-I in pituitary cells such as GH cells, and it is suggested that mone involved in somatic growth and differentiation. GH initiates this pituitary IGF-I might act as an auto/paracrine mediator of many of its growing actions by binding to GH receptors and stim- feedback mechanisms [17]. ulating the release of the hepatic insulin-like growth factor I (IGF-I) Melanin-concentrating hormone (MCH) is a cyclic 17 amino- [6,16,42]. GH is a single chain polypeptide produced mainly by acid peptide, originally isolated from the pituitary of chum salmon cells located in the anterior pituitary and belongs to the structur- as a hormone involved in the skin color regulation [23]. MCH is a ally and functionally related prolactin (PRL), somatolactin (SL) melanophore-aggregating hormone involved in long-term back- and placental lactogen family [15]. In fish, the neuroendocrine con- ground adaptation inducing physiological and morphological re- trol of GH is multifactorial with inhibitors such as somatostatin sponses of melanophores such as pigment granule movement and a variety of inhibitory neurotransmitters, and stimulators such within these cells, which produce enlightening of the skin color. as growth hormone-releasing hormone, pituitary adenylate The distribution of MCH-immunoreactive (-ir) cell bodies and fi- cyclase-activating peptide, ghrelin, dopamine, gonadotropin- bers in the brain has been described in several fish species [2– releasing hormone, cholecystokinin, gastrin-releasing peptide, 5,28,33,36] including Cichlasoma dimerus [39]. Particularly, in fish, MCH is synthesized in hypothalamic neurons and those from the lateral part of the nucleus lateralis tuberis (NLT) project their fibers ⇑ Corresponding author. Fax: +54 1145763384. towards the neurohypophysis [4,13,28,39]. In addition to the pig- E-mail addresses: [email protected], [email protected] (P.G. Vissio). 1 Present address: School of Biological Sciences, Flinders University, GPO Box 2100, mentary role, MCH has been described as a neurotransmitter or Adelaide, SA 5001, Australia. neuromodulator [36]. Recent studies carried out in goldfish have

0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2012.01.002 D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111 103 proposed that MCH would act in the brain regulating the food in- Table 1 take rate as an anorexigenic peptide, in contrast to the orexigenic Primers used for MCH and GH sequencing. role reported in mammals [29–31]. Nevertheless, in barfin floun- Name Sequence (50 ? 30) der, it is suggested that MCH acts as an orexigenic hormone degMCH f GCTTTTRCCTCSCTGCTGAAC [49,50]. Barfin flounders reared in white-colored tanks grew faster degMCH r ATACACTCGTCCCACCATGCA than fish reared in black-colored tanks which correlated well to a degGH f CTCCATTGCHGTCARCAGAG greater number of MCH-ir cell bodies. Segal-Lieberman et al. [45] degGH r CCTTGTGCATGTCCTTCTTG MCH f AGAGGAGAGCCGACGAAAACAAC demonstrated in human and mouse that the MCH receptor type MCH r CCTCGGAGCTCTGGCTTTGGTTACGA 1 is localized in GH pituitary cells and MCH stimulates GH release GRacer f CGACTGGAGCACGAGGACACTGA from dispersed human fetal pituitary cells, GH secreting adenomas GRacer r GCTGTCAACGATACGCTACGTAACG and mouse pituitary cells. It is possible that the stimulatory effect of MCH on GH release from pituitary cells is present in fish as well, and it could be an alternative explanation for the difference found Reagent (MRC, Inc.) following the manufacturer’s instructions. in the growth rate observed in barfin flounder exposed to different RNA samples were quantified and its purity was confirmed by background colors. spectrophotometry. RNA samples (2 lg) were then treated with C. dimerus is a cichlid fish that can be easily maintained and DNase I (Sigma) and then first strand cDNAs were synthesized by bred in the laboratory. In its natural habitat and under laboratory using an AMV enzyme (Promega). Conditions for the reverse tran- conditions, this species shows pronounced changes in body color scription (RT) reaction were: 45 °C for 50 min and 70 °C for 10 min. under stress, mating, and environmental changing conditions. Pre- Degenerate primers (Table 1) were designed according to con- vious studies have reported the localization of GH, SL and PRL cells served regions of MCH or GH cDNA sequences of perciform fish in the pituitary, and the distribution of MCH-ir neurons during the available in the GenBank database. PCR amplification for MCH ontogeny and in adults of C. dimerus [39,40]. As differences in was performed in a final volume of 25 ll by using a GoTaq Flexi weight and length are observed in this species in a short period DNA polimerase (Promega). Following initial 2 min of denaturation of time under laboratory conditions in juvenile animals, C. dimerus at 94 °C, the PCR cycle was repeated 40 times with denaturation at is a good model to study the neuroendocrine control of GH/IGF-1 94 °C for 30 s, annealing at 52 °C for 30 s and elongation at 72 °C for axis (personal observations). 30 s with a last extension step at 72 °C for 10 min. After electro- In the present study, we tested the hypothesis that MCH regu- phoresis on a 1% agarose gel, a specific band, which was assumed lates GH expression and release in C. dimerus. We first obtained to be MCH, was extracted and purified from the agarose gel by and described the C. dimerus MCH and GH sequences. Then, in or- using an AccuPrep gel purification kit (Bioneer). The purified PCR der to test if MCH is involved in the regulation of GH, we examined product was subsequently sequenced (Unidad de Genómica-Insti- MCH fiber innervations mainly focused on GH pituitary cells. In in- tuto de Biotecnología, CICVyA, INTA, Argentina) and confirmed to tact pituitary cultures, we evaluated the effect of MCH on GH syn- be partial MCH sequence using the BLASTN program (http://blast. thesis and release. Finally, we manipulated background color ncbi.nlm.nih.gov/Blast.cgi/). (white or black) in order to influence MCH levels and analyzed Full-length MCH or GH was obtained by RNA ligase-mediated whether MCH and/or GH expression and somatic growth were rapid amplification of 50 and 30 cDNA ends (RLM-RACE) by using affected. the GeneRacer Kit (Invitrogen). The 1st strand cDNA was synthesized according to the GeneRacer Kit instructions using 2 lg total 2. Materials and methods RNA and SuperScript III RT (Invitrogen). The specific C. dimerus MCH reverse and forward primers were designed based on the ob- 2.1. Fish tained partial sequence. For GH amplification, the degenerate primers were used to obtain the full length sequence. PCR amplifi- Adult C. dimerus were collected from ‘‘Esteros del Riachuelo’’, cation was performed by using the primers described above and 0 0 Corrientes, Argentina (27°1205000S, 58°1105000W), transferred to the primers described for the 5 and 3 cDNA ends from the kit (Ta- the laboratory and maintained in fresh water tanks (400 L). They ble 1). The PCR conditions were as follows: 3 min of initial denatur- were acclimated and kept under a stable condition of temperature ation at 94 °C, the PCR cycles were at 94 °C for 30 s, 72 °C for 30 s (25 ± 2 °C) and a 14L:10D photoperiod. Fish were daily fed with for 5 times, 94 °C for 30 s, 70 °C for 30 s for another 5 times and fi- commercial pellets (Tetra Pond Variety Blend) prior to be used nally 94 °C for 30 s, annealing at 65 °C (MCH) or 64 °C (GH) for 30 s for experiments. and 72 °C for 30 s for 35 times. The last extension step was at 72 °C Offspring from different C. dimerus couples were separated from for 10 min. The PCR products were purified and subsequently se- their parents 7 days after hatching (at a free swimming stage) and quenced as described above. The full-length C. dimerus MCH and maintained in fresh water tanks (10 L) at 25 ± 2 °C under a 14L:10D GH sequences were confirmed by using the BLASTN program. photoperiod until they were used in background color adaptation experiments. During this time, fish were daily fed with Artemia 2.3. Double-label immunofluorescence of MCH and GH spp. nauplii (during the first 3 weeks) and then with commercial ground food (Tetra CichlidÓ flakes). Principles of laboratory animal Brains from adult C. dimerus were fixed for 24 h in Bouin’s fluid, care (Guidelines on the care and the use of fish in research, teach- embedded in paraplast (Fisherbrand, Fisher, Wash., USA) and coro- ing and testing, Canadian Council on Animal Care, 2005) were nally sectioned. Sections of 10 lm were deparaffinized in xylene, followed. rehydrated through graded ethanol gradient to phosphate-buffered saline (PBS, pH 7.4), and incubated with PBS containing 5% 2.2. C. dimerus MCH and GH sequence non-fat dry milk at room temperature (RT). They were next incubated at 4 °C overnight (ON) with an anti-rat MCH antiserum Five adult C. dimerus of both sexes (50–70 g) were anesthetized raised in rabbit (kindly donated by Dr. B.I. Baker, University of with benzocaine 0.1% and brain (for sequencing MCH cDNA) and Bath, UK; 1:500 dilution). Then, they were washed in PBS and incu- pituitary glands (for sequencing GH cDNA) were collected after bated with biotinylated anti-rabbit-conjugated secondary antibody decapitation. Total RNA from both tissues was extracted by TRI (1:800) at RT for 1 h. Afterwards, sections were incubated with 104 D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111

Streptavidin alexa 546 (Invitrogen) (1:100) (red) for 1 h. Subse- The GH-ir bands (25.5 kDa) from different treatments were quently, the sections were incubated at 4 °C ON with a GH antise- semi-quantified by densitometric analysis and normalized against rum raised in rabbit (anti-chum salmon GH lot 8502, 1:1000, a 148 kDa protein only present in culture medium in order to cor- kindly donated by Dr. H. Kawauchi, Kitasato University, Japan). rect possible variations in the SDS–PAGE loading. The 148 kDa They were washed and incubated at RT for 1 h with an anti-rabbit band was visualized by Ponceau-S in the nitrocelulose membrane, fluorescein-conjugated secondary antibody (1:50) (green). Next, digitalized, and semiquantified as described previously by Cánepa they were mounted in PBS – glycerin (1:1) and analyzed by confo- et al. [8]. cal laser microscopy (Olympus FV-30 attached to an Olympus Bx- The optical density of the 25.5 kDa GH-ir bands and the 148 kDa 61 microscope). This double label immunofluorescence system band was measured by using Image Gauge Version 3.12 (Fuji Photo with two primary antibodies raised in rabbit was performed since Film) Software. MCH-ir fibers and GH cells are easily distinguish one from each GH release from each pituitary was evaluated as follows: days 1 other and they do not co-localize in the pituitary [39,40]. and 2 culture media from each treatment were loaded into adja- Specificity controls were previously performed in our labora- cent lanes for SDS–PAGE. Day 1 was considered as the basal release tory demonstrating that GH and MCH antisera used in this study condition of the gland, and the optical density values of GH-ir specifically recognize GH cells and MCH neurons, respectively bands from day 2 were normalized against those from day 1. This [39,40]. Briefly, each antiserum was preadsorbed with an excess normalization allowed us to compare values obtained from differ- of its antigen and the supernatant of this solution, after centrifuga- ent pituitaries. tion, was used as primary antibody in IHC assays. In addition, in the present study, primary antibodies were omitted and replaced by 2.4.2. GH mRNA expression PBS in one of the slides. Both tests showed no positive immuno- The protocol was similar to the above described to evaluate GH staining which demonstrated the specificity of the antisera. release. Pituitaries were removed from different animals (N =8, body weight: 24.86 ± 3.13 g, total length 10.75 ± 0.56 cm). These were individually incubated as it was described above and main- 2.4. In vitro cultures of pituitaries of C. dimerus tained in a dark incubator at 27 °C for 3 h in order to stabilize the condition of the different glands. Then the medium was re- 2.4.1. GH release moved and fresh medium as an internal control (N = 4) or medium Pituitaries were removed from adult C. dimerus under sterile containing 10 lM of salmon MCH (N = 4) was randomly added and conditions (N = 33, body weight: 31.13 ± 2.28 g and total length pituitaries were incubated for 4.5 h. Next, pituitaries were individ- 10.89 ± 0.26 cm, 11 glands per treatment). Sampling procedures ually collected and total RNA was obtained by using TRI Reagent were similar to those described previously by Cánepa et al. [8]. (MRC, Inc.) following manufacturer’s instructions. Total RNA Glands were obtained from fish of both sexes and they were indi- (1 lg) was used to synthesize cDNA in order to quantify GH tran- vidually incubated in a 96-multiwell plate with 80% (v/v) Leibovitz script levels by fluorescent-based quantitative real-time polymer- L15 medium (Gibco), pH 7.4, containing 10% fetal bovine serum, ase chain reaction (RT-qPCR). RT-qPCR GH and b-actin (reference 10 mM Hepes, 100 IU/ml penicillin, and 100 lg/ml of streptomycin gene) was performed by using FastStart Universal SyBR green Mas- and maintained in a dark incubator at 27 °C for 3 h in order to sta- ter (ROCHE) with a mixture of forward and reverse specific primers bilize the culture condition of the glands. The medium was re- (Table 2) and 1 ll of cDNA template per tube. The RT-qPCR proto- moved and immediately fresh medium was added. Twenty-four col was as follows: 10 min of denaturation at 95 °C and 40 cycles of hours later (day 1), the medium was removed and stored at 20° 95 °C for 10 s and 60 °C for 30 s. Results were analyzed by the com- in order to establish basal conditions of GH release. Subsequently, parative 2DDCt method [27]. The efficiency of the target (GH) and medium as an internal control or medium containing salmon MCH reference (b-actin) amplification was calculated by using template (Bachem Lot No. 0537967, 0.1 or 10 lM) was randomly added. serial dilutions and they were close to 100%. b-Actin expression After 24 h (day 2), each medium was removed and stored frozen was stable throughout the experiments (data not shown). for posterior analysis. Pituitary culture assays were carried out on intact pituitaries, so 10 lM was used as the highest concentra- 2.5. Effect of long term background color exposure on somatic growth, tion to ensure that salmon MCH reaches GH cells localized in the MCH and GH expression levels inner portion of the pituitary. The GH release into the pituitary culture media was revealed by Thirty juvenile animals (50 days after hatching) were randomly western blot using the GH antiserum described above. Briefly, sam- chosen and transferred to experimental glass tanks covered by a ples (15 ll) from each pituitary culture medium were subjected to black or white polyethylene sheet, except for the top surface, and 15% sodium dodecylsulfatepolyacrylamide gels by electrophoresis maintained with a 14L:10D photoperiod. Total volume of water (SDS–PAGE). The proteins and molecular markers (SeeBlue Plus2 was changed 2 times per week. Each fish was maintained individ- PreStained Standard, Invitrogen) were then transferred onto a ually in order to avoid social interactions that could lead to a differ- nitrocellulose membrane (Amersham Biosciences, UK) for 75 min ential growth rate (personal observations). They were fed ad at 75 V, as previously described by Cánepa et al. [7]. Membranes libitum with flakes and no differences in feeding behavior were were washed in Tris-buffered saline with Tween (TBST) at pH 7.5 visually detected. Body weight (BW) and total length (TL) were (100 mM Tris–HCl, 0.9% NaCl, 0.1% Tween-20) and blocked with TBST containing 3% non-fat dry milk and 3% bovine serum albumin at 4 °C ON. Later, they were incubated at RT for 3 h with GH anti- Table 2 serum (anti- chum salmon GH mentioned above, 1:2000). After Primers used for quantitative real time PCR. three washes in TBST, membranes were incubated with a biotinyl- Name Sequence (50 ? 30) ated anti-rabbit-conjugated secondary antibody (1:2000) for 1 h, MCH f GGCTGAAGACGGCTCCTTGG washed again and then incubated with IgG peroxidase-conjugated MCH r GCGGCGATGACGATTACCC streptavidin (1:1500) at RT for 1 h. The reaction was visualized on GH f GTCAGTCGTGTGTTTGGGTGTC the nitrocellulose membrane with 0.3% 3.30-diaminobenzidine GH r CGAGCAGGTGGAGGTGTTGG ACTIN f GCTGTCCCTGTACGCCTCTGG (DAB) in Tris buffer (pH 7.6) and 0.02% H2O2. Blotting and develop- ACTIN r GCTCGGCTGTGGTGGTGAAGC ing conditions were carefully repeated. D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111 105 measured and recorded every 2 weeks until the end of the experi- microscope (400) in three randomly selected coronal sections ment when the final BW and TL were recorded. Somatic growth and normalized to the fish weights. was evaluated as the ratio between final and initial BW and TL of Antiserum specificity controls were previously performed in each fish due to the heterogeneity in both body weight and length our laboratory demonstrating that MCH antiserum used in this measurements at the beginning of the experiment. study specifically recognize MCH cells [39]. The procedure was At the end of the background color exposure experiment (3 similar as described above. Both tests (preadsorption and antise- months), 10 fish per treatment were anesthetized with benzocaine rum omission tests) showed no immunostaining which demon- 0.1% and brains, pituitaries and livers were collected after decapi- strates the MCH antiserum specificity. tation. Livers were used to calculate de hepatosomatic index (HSI) (hepatic weight/body weight 100) as an indirect indicator of the 2.6. Statistical analysis nutritional state. Total RNA was obtained by TRI Reagent (MRC, Inc.) from the brain and pituitaries, and the corresponding cDNA For somatic growth parameters and MCH immunohistochemis- was synthesized in order to quantify MCH and GH transcripts by try analyses a randomized block design (RBD) ANOVA was used. RT-qPCR. The product was normalized to b-actin and the efficiency Comparisons between group means from RT-qPCR data were per- of MCH was tested as above. b-Actin did not show variations be- formed by using a one-way ANOVA in a completely randomized tween treatments (data not shown). design. GH released from pituitary cultures was analyzed using a In addition, an immunohistochemistry (IHC) study was per- RBD ANOVA followed by Tukey’s Post Hoc test. In those analyses formed in order to evaluate morphological parameter of MCH neu- where two or more variables were measured from the same exper- rons in fish under different background color exposures. Five fish imental units, a statistical correction was applied to keep the fam- per treatment were processed for MCH immunohistochemistry. ilywise error rate at 5% and corrected p-values are indicated as p0 Differences in the soma length, nuclear area (as estimators of neu- [1]. Values are expressed as means ± SEM. ronal activity) and number of MCH-ir cells between the two treatments were assessed. Briefly, brains were fixed for 24 h in Bouin’s fluid, embedded in paraplast (Fisherbrand, Fisher, Wash., USA), 3. Results coronally sectioned at 7 lm intervals and mounted on gelatin- coated slides. Sections at the NLT region were then deparaffinized, 3.1. C. dimerus MCH sequence rehydrated and followed by incubation for 10 min in 0.3% hydro- gen peroxide in order to block endogenous peroxidase activity. The MCH full-length transcript obtained consisted of 621 nucle- Then, they were washed in PBS and incubated 45 min in PBS con- otides, excluding the poly(A) tail (Genbank Accession No. taining 5% non-fat dry milk at room temperature to avoid nonspe- GQ253057, Fig. 1). It involved 70 bp in the 50-untranslated region cific staining. Next, they were incubated ON at 4 °C with the above (UTR), 408 bp for the coding region whose 51 bp downstream cor- mentioned MCH antiserum. Then biotinylated anti-rabbit-conju- responded to the mature C. dimerus (cd) MCH, and 140 bp in the 30 gated secondary antibody followed by peroxidase-conjugated UTR. A typical polyadenylation motif including the hexanucleotide streptavidin was applied for 1 h each. The final reactive products AATAAA was located 15 nucleotides upstream of the poly(A) tail. were visualized with 0.3% 3.30-diaminobenzidine (DAB) in Tris buf- The deduced MCH mature peptide showed 2 cysteine residues at fer (pH 7.6) and 0.02% H2O2. The sections were slightly counter- positions 5 and 14 which would form the typical MCH ring struc- stained with hematoxylin, mounted with DPX and examined ture. The MCH transcript was comparable to those published from with a NIKON Microphot FX microscope and digitally photo- other fish species showing around a 90% of identity with those graphed. The soma length (measured in the greater length axis) from cichlid species such as Oreochromis mossambicus [21], Ore- and nuclear area were measured in those cells with clearly detect- ochromis aureus (AF534543), Oreochromis niloticus (AF534542). able nucleus by using the Image Pro Plus (Media cybernetics) soft- Additionally, the cdMCH deduced amino-acid sequence was totally ware. MCH-ir neurons were manually counted by using an optical identical to those mature MCH sequences from teleost species

Fig. 1. Nucleotide and deduced amino-acid sequences of C. dimerus (cd) melanin concentrating hormone (MCH). The putative signal peptide and polyadenylation signal sites are underlined. Mature cdMCH peptide is indicated in bold and the cysteine residues are in box. Putative cdMCH gene-related peptide (Mgrp) appeared from 72 to 93 amino- acid. Numbers on the left indicate the number of nucleotides and numbers on the right indicate amino-acids. An asterisk (⁄) represents the stop codon. 106 D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111 except two Pleuronectiformes fish, Verasper moseri [49] and proximal pars distalis (PPD) region of the pituitary gland surround- Paralichthis olivaceus (ABY73341), and the Tetraodontiform species ing the neurohypophysis where a high density of MCH-ir fibers Tetraodon nigroviridis (CAF93560). When comparing to both was found (Fig. 3A and B). Noteworthy, dense bundles of MCH-ir Pleuronectiform species, there was a mismatch in the second ami- fibers were observed in close association with GH-ir cells, and a no-acid residue; but, two mismatches in the second and fourth great number of contacts between MCH-ir fibers and GH-ir cells amino-acid were found when comparing to T. nigroviridis. The C. was clearly detected (Fig. 3C). dimerus preprohormone has two cleavage sites that would produce MCH and an additional 22 amino-acid long peptide. 3.4. In vitro cultures of C. dimerus pituitaries

3.2. C. dimerus GH sequence A direct effect of MCH on pituitary glands in vitro on GH expression at both mRNA levels and the hormone release were analyzed. C. dimerus GH cDNA consisted of 888 nucleotides (Genbank The GH-ir bands from the different media consistently showed a Accession No. HQ660075, Fig. 2) including 68 bp in the 50 UTR molecular weight of 25.5 kDa (Fig. 4B) [38]. GH released from pitu- and 205 bp in the 30 UTR. The open reading frame is 612 bp and en- itary glands showed a significant increase after incubation with coded to a 204 amino-acid sequence and a signal peptide of 17 10 lM of salmon MCH with respect to the control group (Fig. 4A; amino-acid. The amino-acid sequence showed four cysteine resi- p = 0.018). No significant differences were observed after incuba- dues at aa positions 69, 177, 194 and 202, and a potential glycosyl- tion with 1 lM of salmon MCH (Fig. 4A). ation site at position 201 (Asn-Cys-Thr, N–C–T). The cdGH cDNA The effect of the incubation with 10 lM of MCH was also as- sequence showed a high identity with GH of cichlid fish from the sessed on GH mRNA levels. The GH transcript abundance, which Oreochromis genus such as O. niloticus [43] and O. urolepis was semi quantified by RT-qPCR, showed a significant increase in (EF371465), and around 88% with GH from other perciform fish those pituitaries incubated with MCH compared to the control such as Epinephelus coioides [26], Thunnus thynnus [44], Siniperca group (Fig. 4C). kneri (AY155227), Amphiprion clarkii (JN008015), Amphiprion melanopus (HM135406). The encoded cdGH amino-acid sequence 3.5. Effect of long term background color exposure on somatic growth, presented between 92% and 93% of identity with the corresponding MCH and GH expression levels sequences of other GH from perciform fish such as E. coioides [26], Siniperca chuatsi (ABM67063), Cromileptes altivelis (ABS19662). After 3 months of background color exposure, the body weight (Fig. 5A; p0 = 0.0072) and total length (Fig. 5B; p0 = 0.0436) of fish 3.3. Double-label immunofluorescence of MCH and GH adapted to white tanks were significantly higher than those values from fish kept in black tanks. No differences were observed in the Taking advantage of the hypothalamic projections into the pitu- HSI% (white adapted fish = 1.45 ± 0.15, black adapted fish = 1.3 ± itary in teleost fish, a double-label immunofluorescence was car- 0.18). ried out to investigate whether MCH neurons and GH cells are A greater number of MCH-ir cell bodies was observed in the NLT morphologically associated. GH cells appeared mainly in the from fish exposed to a white background with respect to those

Fig. 2. Nucleotide and deduced amino-acid sequences of C. dimerus (cd) growth hormone (GH). The putative signal peptide and polyadenylation signal sites are underlined. Mature cdGH is indicated in bold and the glycosylation site and conserved cysteine residues are in box. Numbers on the left side indicate the number of nucleotides and those on the right margin indicate amino-acids. An asterisk (⁄) represents the stop codon. D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111 107

Fig. 3. Contact between MCH fibers and GH cells detected by double-label immunofluorescence in coronal sections of the hypothalamus–pituitary region of Cichlasoma dimerus. (A) Confocal microphotograph of double-label immunofluorescence showing MCH fibers (red) and GH cells (green). Scale bar: 200 lm. (B) Higher magnification showing high quantities of MCH-ir fibers in the neurohypophysis at the proximal pars distalis region of the pituitary (red). MCH fibers are in close association with GH-ir cells (green) which are surrounding the neurohypophysis. Scale bar: 50 lm (C) Detail of MCH fibers and GH cells contact (white arrows). Scale bar: 5 lm. HPT: hypothalamus, PIT: pituitary, NH: neurohypophysis, ADH: adenohypophysis. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this paper.)

Fig. 4. Analysis of GH released (A and B) and GH transcript levels (C) from C. dimerus pituitary cultures. (A) Values are expressed in arbitrary units (a.u.) as means ± SEM of optical density of GH released on day 2 (after 0, 1 and 10 lM)/optical density of GH released on day 1 (ROD relative optical density). A stimulatory effect of salmon MCH (sMCH) on GH release from pituitaries was detected at a 10 lM concentration. Different letters indicates signiﬁcant differences (p < 0.05). (B) Representative immunoblots of GH from pituitary culture media of day 1 (d1) and after treatment at day 2 (d2) with 1 and 10 lM concentrations of salmon MCH. (C) Analysis of GH expression from C. dimerus pituitary cultures stimulated with 10 lM sMCH. The graph represents the relative fold induction of GH mRNA (2DDCt) from 10 lM sMCH stimulated pituitaries with respect to control pituitaries. Each bar represents the mean ± SEM. Asterisk indicates signiﬁcant differences (p < 0.05). 108 D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111

Fig. 5. Effect of long-term background color acclimation on body weight and total length of C. dimerus. The vertical bars represent the final body weight (A) and final total length (B) respect to respective initial measures from fishes reared in white (W) or black (B) tanks. N = 30. Fish exposed to a white background show greater body weight, p0 = 0.0072 (A) and greater total length, p0 = 0.0436 (B) than fish exposed to black tanks. from the black tanks (Fig. 6E; p0 < 0.001). Also, the soma length and levels between the two experimental conditions (data not shown, the nuclear area of MCH-ir cells in the NLT were significantly high- p0 = 0.8). er in fish adapted to white tanks (p0 < 0.01, Fig. 6C and D). In addition, fish reared in white tanks had greater quantities of MCH transcript than those reared in black tanks measured by RT- 4. Discussion qPCR (p0 < 0.01, Fig. 6F). In spite of the differences in the somatic growth rate observed between fish adapted to white and black In this study, we have provided evidences supporting a role of background, no statistical differences were found in GH mRNA MCH in the regulation of the GH synthesis and release in C. dimerus.

Fig. 6. Effects of long term background color aclimatation on MCH-ir cells (A–E) and MCH mRNA levels (F). Coronal sections of C. dimerus hypothalamus at lateral NLT (NLTl) of fish adapted to black (A) and white (B) tanks. Scale bars: 20 lm. Semiquantitative analysis of MCH cell length (C), nuclear area (D) and number of MCH-ir neurons/animal weight (E). N = 10. Results show that all these parameters are increased in fish adapted to white background. (F) The graph bars represent the relative fold induction of MCH or GH mRNA (2DDCt) from white (W) adapted fish with respect to black (B) adapted fish. N = 20. Each bar represents the mean ± SEM. Significance (p < 0.05) is designated by an asterisk. D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111 109

We have found contacts between MCH-ir fibers and GH-ir cells and GH released were measured by radioimmunoassay, a clearly more a stimulatory effect on GH release and mRNA levels by MCH in an sensitive method. In spite of absence of stimulation over GH cells a in vitro approach. In addition, the differences in body weight and to- dose dependence of LH release was observed. This discrepancy be- tal length found between white adapted fish (with high levels of tween our results and those obtained in goldfish probably indicate MCH) and black adapted fish would support a role of MCH in the species specific differences. In this context, two MCH receptors, regulation of the somatic growth axis. MCH-R1 and MCH-R2, have been described in the goldfish pitui- This is the first report on MCH and GH sequences from C. dimerus, tary [34], but only MCH-R2 in the barfin flounder pituitary gland The nucleotide primary structure of cdMCH is comparable to those [35]. Thus, we cannot rule out the possibility of a differential distri- published from other fish species showing around 90% of identity bution of MCH receptors among pituitary cell types in different with MCH of cichlid fish from the Oreochromis genus such as O. mos- species, which could lead to very diverse results on the pituitary sambicus [20]. The alignment analysis has shown that the encoded hormone regulations. Further studies regarding to the distribution amino-acid sequence was identical to those described for other of MCH receptors in different teleost species have to be done in or- MCH teleost species, such as salmon [37], tilapia [21] and goldfish der to clarify this point. Despite the close relationship between [14]. In general, MCH is synthesized as a preprohormone with two MCH fibers and GH cells and the in vitro response of pituitary cleavage sites that produce MCH and a second peptide named neu- glands stimulated by MCH, an indirect, autocrine or paracrine ropeptide EI (NEI) in mammals, neuropeptide EV (NEV) in salmonids stimulus triggered by MCH cannot be excluded. and MCH gene-related peptide (Mgrp) in other fish species [19].InC. As we expected, C. dimerus reared in white background showed dimerus, this related peptide, as in tilapia, has 22 amino-acids and is a significantly greater MCH transcript level, and number, soma longer than those observed in salmonids because the typical cleav- length and nuclear area of MCH producing neurons in the NLT. age site appears to be absent. Similar results were reported in barfin flounder [49,50]. In spite The complete sequence of C. dimerus GH was also obtained. The of the increased somatic growth in fish reared in a white back- cdGH nucleotide sequence showed high similarity with those from ground and contrasting to our expectations, they did not show other cichlid fish from the Oreochromis genus and other perciforms an increased GH expression though they had higher MCH mRNA [43]. The deduced amino-acid sequence also presented a high iden- levels. This fact would not necessary mean that the serum GH level tity with those GH sequences from other perciform fish. As in most was not elevated in this condition. In the present study, serum GH of teleosts, cdGH presents 4 cysteine residues, which are involved levels were not measured because of the impossibility of obtaining in the formation of two disulfure bonds, and a putative glycosyla- plasma samples due to the small size of the fish. Somatic growth is tion site (NCT). a complex event that involves not only GH, hepatic IGF-I and hypo- The neuroanatomical close relationship between GH cells and thalamic neuropeptides such as somatostatin but also extra hepa- MCH fibers innervating the pituitary gland presented in this study tic IGF-I, IGF-II, IGF binding proteins and GH/IGF receptors [46].We suggests an effect of MCH on GH synthesis and/or release. MCH-ir speculate that the lack of stimulation on GH mRNA levels after fibers were found in the neurohypophysis reaching the proximal 3 months of white background adaptation is probably due to the pars distalis as it was previously reported for this species [39]. multifactorial nature of the GH regulatory network [9]. In this Additionally, GH cells were found surrounding the neurohypophy- network, a negative feedback is exerted by somatostatin (SS) or sis at the proximal pars distalis region, as it was also previously de- IGF-I which keeps the GH expression levels within control values. scribed as well [40]. A similar staining pattern using the same A similar feedback control was proposed in goldfish where antiserum was described in tilapia, another cichlid fish [22]. high hypothalamic SS mRNA levels are found concomitant Intriguingly, double labeling staining has shown that MCH fibers with high serum GH levels [10,11]. Furthermore, intracerebroven- are in close contact with GH cells, suggesting a possible direct ef- tricular administration of antiGH antibody in the goldfish brain re- fect on these cells. To the best of our knowledge this is the first reduces the hypothalamic SS mRNA levels suggesting that GH itself port that shows such an anatomical relationship. stimulate the tonic inhibitory feedback of SS [9]. Nevertheless, The possible direct effect of MCH on GH cells was analyzed by additional studies in different teleost species have to be performed performing an in vitro culture study of pituitary glands. As we to support this explanation and provide alternative regulatory had previously demonstrated, the in vitro culture of individual mechanisms. pituitaries is a feasible method for studying the secretion control In C. dimerus, the exposure to a white background was concom- of pituitary hormones in C. dimerus [8]. In this study, the culture itant with an increase in the somatic growth rate, and similar re- media of pituitary glands evidenced that the released cdGH has a sults were observed in flounder [49,50]. In mammals, it is well molecular weight of 25.5 kDa which match the expected size cal- established that MCH plays a major role in the control of feeding culated from the deduced aa sequence of cdGH obtained in the cur- and energy homeostasis [12,18,25,41,47]. However, in teleost fish, rent work. This method is sensitive enough to detect differences in MCH clearly regulates skin color antagonizing the actions of the peptide release from pituitaries under different stimuli [8].As a-MSH [41], but its role in the regulation of food intake remains mentioned above, the amino-acid sequence of C. dimerus MCH is controversial. In fish, it is generally assumed that MCH is an identical to salmon MCH and biologically active, which was previ- anorexigenic neuropeptide since in goldfish, ICV treatment with ously confirmed by the aggregation of melanophores in scale cul- MCH decreases food intake [29,31,32,48], and fasting protocols in- tures [8]. In the present study, we have observed that 10 lM duce a decrease in the number of hypothalamic MCH-like-ir neu- salmon MCH stimulated the GH release and increase the GH mRNA rons [30]. Nevertheless, in the barfin flounder, a fasting protocol levels in intact pituitary cultures. As only intact pituitaries were stimulates the hypothalamic expression of MCH suggesting an used in this culture assay, high doses of MCH were used in order orexigenic effect of MCH [49]. Intriguingly, the over-expression to stimulate GH cells which are localized in the inner portion of of the MCH gene in medaka did not affect either growth or feeding the pituitary gland. It is possible that a MCH effect at lower concen- behavior while induced changes in body color [24]. Taken into ac- trations on GH release can be revealed by using a dispersed pitui- count the results described in other species and the data presented tary cell assay since a trend was observed in our current in this study, we cannot rule out a role of MCH in food intake in C. experiment. In this regard, it is important to mention that Cerdá- dimerus. Moreover, we did not observe differences in HSI between Reverter et al. [14] studied the effect of lower doses of salmon fish maintained in white and black background possibly indicating MCH on luteinizing hormone (LH) and GH secretion using dis- similar nutritional conditions. Additional studies evaluating food persed goldfish pituitary cell cultures. In that study, the LH and intake will be carried out in order to clarify this point. 110 D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111

In conclusion, our results clearly show that MCH regulates GH real-time RT-PCR, in situ hybridisation and immunohistochemistry, Gen. expression and secretion in vitro in this species. They are supported Comp. Endocrinol. 150 (2007) 87–95. [18] B. Griffond, P.Y. Risold, MCH and feeding behavior-interaction with peptidic by: (1) a double immunofluorescence showing clear contacts be- network, Peptides 30 (2009) 2045–2051. tween MCH fibers and GH cells in the proximal pars distalis; (2) [19] D. Gröneveld, P.H. Balm, S.E. Wendelaar Bonga, Identification, cellular the fact that salmon MCH stimulated GH release and mRNA localization and in vitro release of a novel teleost melanin-concentrating hormone gene-related peptide, Neuroendocrinology 62 (1995) 498–505. expression in C. dimerus pituitary cultures. In addition, fish reared [20] D. Gröneveld, E.R. Eckhardt, A.J. Coenen, G.J. Martens, P.H. Balm, S.E. in white background showed a better growing performance than Wendelaar Bonga, Expression of tilapia prepro-melanin-concentrating fish reared in black background concomitant with an increase of hormone mRNA in hypothalamic and neurohypophysial cells, J. Mol. Endocrinol. 14 (1995) 199–207. MCH mRNA levels and morphological changes in MCH expressing [21] D. Gröneveld, M. Hut, P. Balm, G. Martens, S. Wendelaar Bonga, Cloning and neurons. Taken together, our results suggest that MCH would be sequence analysis of hypothalamus cDNA encoding tilapia melanin- involved in the stimulation of the somatic growth in C. dimerus. concentrating hormone, Fish Physiol. Biochem. 11 (1993) 117–124. [22] R.S. Kasper, N. Shved, A. Takahashi, M. Reinecke, E. Eppler, A systematic immunohistochemical survey of the distribution patterns of GH, prolactin, Acknowledgments somatolactin, beta-TSH, beta-FSH, beta-LH, ACTH, and alpha-MSH in the adenohypophysis of Oreochromis niloticus, the Nile tilapia, Cell Tissue Res. 325 (2006) 303–313. We thank Dr. B.I. Baker (University of Bath, England), for the [23] H. Kawauchi, I. Kawazoe, M. Tsubokawa, M. Kishida, B.I. Baker, generous gift of the MCH antiserum and Dr. Kawauchi (Kitasato Characterization of melanin-concentrating hormone in chum salmon pituitaries, Nature 305 (1983) 321–323. University, Japan) for the GH antiserum. [24] M. Kinoshita, T. Morita, H. Toyohara, T. Hirata, M. Sakaguchi, M. Ono, K. Inoue, This work was supported by CONICET (Grant No. PIP: 0276, Y. Wakamatsu, K. Ozato, Transgenic medaka overexpressing a melanin- P.V.), Agencia Nacional de Promoción Científica y Tecnológica concentrating hormone exhibit lightened body color but no remarkable abnormality, Mar. Biotechnol. 3 (2001) 536–543. (Grant No. PICT 2005–2008, P.G.V.) and Universidad de Buenos [25] P. Lagos, P. Torterolo, H. Jantos, J.M. Monti, Immunoneutralization of melanin- Aires (Grant No. 20020090200673, P.G.V.). concentrating hormone (MCH) in the dorsal raphe nucleus: effects on sleep and wakefulness, Brain Res. 1369 (2011) 112–118. [26] W.S. Li, D. Chen, A.O. Wong, H.R. Lin, Molecular cloning, tissue References distribution, and ontogeny of mRNA expression of growth hormone in orange-spotted grouper (Epinephelus coioides), Gen. Comp. Endocrinol. 144 (2005) 78–89. [1] H. Abdi, Holm’s sequential Bonferroni procedure, in: N.J. Salkind, D.M. [27] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real- Dougherty, B. Frey (Eds.), Encyclopedia of Research Design, Sage time quantitative PCR and the 2DDCt method, Methods 25 (2001) 402–408. Publications, Thousand Oaks, CA, USA, 2010, pp. 573–577. [28] J.M. Mancera, P. Fernández-Llebrez, Development of melanin-concentrating [2] M. Amano, A. Takahashi, Y. Oka, T. Yamanome, H. Kawauchi, K. Yamamori, hormone-immunoreactive elements in the brain of gilthead seabream (Sparus Immunocytochemical localization and ontogenic development of melanin- auratus), Cell Tissue Res. 282 (1995) 523–526. concentrating hormone in the brain of a pleuronectiform fish, the barfin [29] K. Matsuda, S.I. Shimakura, K. Maruyama, T. Miura, M. Uchiyama, H. Kawauchi, flounder, Cell Tissue Res. 311 (2003) 71–77. S. Shioda, A. Takahashi, Central administration of melanin-concentrating [3] B.I. Baker, D.J. Bird, Neuronal organization of the melanin-concentrating hormone (MCH) suppresses food intake, but not locomotor activity, in the hormone system in primitive Actinopterygians: evolutionary changes leading goldfish, Carassius auratus, Neurosci. Lett. 399 (2006) 259–263. to teleosts, J. Comp. Neurol. 442 (2002) 99–114. [30] K. Matsuda, S.I. Shimakura, T. Miura, K. Maruyama, M. Uchiyama, H. Kawauchi, [4] T.F.C. Batten, B.I. Baker, Melanin-concentrating hormone (MCH) S. Shioda, A. Takahashi, Feeding-induced changes of melanin-concentrating immunoreactive hypophysial neurosecretory system in the teleost Poecilia hormone (MCH)-like immunoreactivity in goldfish brain, Cell Tissue Res. 328 latipinna: light and electron microscopic study, Gen. Comp. Endocrinol. 70 (2007) 375–382. (1988) 193–205. [31] K. Matsuda, K. Kojima, S.I. Shimakura, T. Miura, M. Uchiyama, S. Shioda, H. [5] D.J. Bird, B.I. Baker, An immunological study of the secretory activity of Ando, A. Takahashi, Relationship between melanin-concentrating hormone- neurons producing melanin-concentrating hormone in a teleost, Neuroscience and neuropeptide Y-containing neurons in the goldfish hypothalamus, Comp. 28 (1989) 245–251. Biochem. Physiol., A: Mol. Integr. Physiol. 157 (2009) 3–7. [6] B.T. Björnsson, V. Johansson, S. Benedet, I.E. Einarsdottir, J. Hildahl, T. [32] K. Matsuda, K. Kojima, S.I. Shimakura, A. Takahashi, Regulation of food intake Agustsson, E. Jönsson, Growth hormone endocrinology of salmonids: by melanin-concentrating hormone in goldfish, Peptides 30 (2009) 2060– regulatory mechanisms and mode of action, Fish Physiol. Biochem. 27 (2002) 2065. 227–242. [33] C.D. Minth, H. Qiu, H. Akil, S.J. Watson, J.E. Dixon, Two precursors of melanin- [7] M.M. Cánepa, M. Pandolfi, M.C. Maggese, P.G. Vissio, Involvement of concentrating hormone: DNA sequence analysis and in situ immunochemical somatolactin in background adaptation of the cichlid fish Cichlasoma localization, Proc. Natl. Acad. Sci. USA 86 (1989) 4292–4296. dimerus, J. Exp. Zool. A. Comp. Exp. Biol. 305 (2006) 410–419. [34] K. Mizusawa, Y. Saito, Z. Wang, Y. Kobayashi, K. Matsuda, A. Takahashi, [8] M. Cánepa, A. Pozzi, A. Astola, M.C. Maggese, P. Vissio, Effect of salmon Molecular cloning and expression of two melanin-concentrating hormone melanin-concentrating hormone and mammalian gonadotrophin-releasing receptors in goldfish, Peptides 30 (2009) 1990–1996. hormone on somatolactin release in pituitary culture of Cichlasoma dimerus, [35] K. Mizusawa, Y. Kobayashi, T. Sunuma, T. Asahida, Y. Saito, A. Takahashi, Cell Tissue Res. 333 (2008) 49–59. Inhibiting roles of melanin-concentrating hormone for skin pigment [9] L.F. Canosa, J.P. Chang, R.E. Peter, Neuroendocrine control of growth hormone dispersion in barfin flounder, Verasper moseri, Gen. Comp. Endocrinol. 171 in fish, Gen. Comp. Endocrinol. 151 (2007) 1–26. (2011) 75–81. [10] L.F. Canosa, S. Unniappan, R.E. Peter, Periprandial changes in growth hormone [36] N. Naito, Y. Nakai, H. Kawauchi, Y. Hayashi, Immunocytochemical release in goldfish: role of somatostatin, ghrelin, and gastrin-releasing peptide, identification of melanin-concentrating hormone in the brain and pituitary Am. J. Physiol. Regul. Int. Comp. Physiol. 289 (2006) R125–R133. gland of the teleost fishes Oncorhynchus keta and Salmo gairdneri, Cell Tissue [11] L.F. Canosa, W.L. Xi, R.E. Peter, Regulation of expression of somatostatin genes Res. 242 (1985) 41–48. by sex steroid hormones in goldfish forebrain, Neuroendocrinology 76 (2002) [37] M. Ono, C. Wada, I. Oikawa, I. Kawazoe, H. Kawauchi, Structures of two kinds of 8–17. mRNA encoding the chum salmon melanin-concentrating hormone, Gene 71 [12] B. Cardinaud, F. Darré-Toulemonde, J. Duhault, J.A. Boutin, J.L. Nahon, (1988) 433–438. Comparative analysis of melanin-concentrating hormone structure and [38] M. Pandolfi, M.M. Cánepa, F.J. Meijide, F. Alonso, G.R. Vázquez, M.C. Maggese, activity in fishes and mammals, Peptides 25 (2004) 1623–1632. P.G. Vissio, Studies on the reproductive and developmental biology of [13] J.M. Cerdá-Reverter, L.F. Canosa, Neuroendocrine circuits of the fish brain, in: Cichlasoma dimerus (Percifomes, Cichlidae), Biocell 33 (2009) 1–18. N. Bernier, G. Van Der Kraak, A. Farrell, C. Brauner (Eds.), Fish [39] M. Pandolfi, M.M. Cánepa, M.A. Ravaglia, M.C. Maggese, D.A. Paz, P.G. Vissio, Neuroendocrinology, vol. 28, Elsevier Inc., San Diego, CA, USA, 2009, pp. 3–74. Melanin-concentrating hormone system in the brain and skin of the cichlid [14] J.M. Cerdá-Reverter, L.F. Canosa, R.E. Peter, Regulation of the hypothalamic fish Cichlasoma dimerus: anatomical localization, ontogeny and distribution in melanin-concentrating hormone neurons by sex steroids in the goldfish: comparison to alpha-melanocyte-stimulating hormone-expressing cells, Cell possible role in the modulation of luteinizing hormone secretion, Tissue Res. 311 (2003) 61–69. Neuroendocrinology 84 (2006) 364–377. [40] M. Pandolfi, D.A. Paz, C. Maggese, F.J. Meijide, P.G. Vissio, Immunocytochemical [15] M. Chen, X. Huang, D.S.H. Yuen, C.H.K. Cheng, A study on the functional localization of different cell types in the adenohypophysis of the cichlid fish interaction between the GH/PRL family of polypeptides with their receptors in Cichlasoma dimerus (Heckel, 1840), Biocell 25 (2001) 35–42. zebrafish: evidence against GHR1 being the receptor for somatolactin, Mol. [41] P. Pissios, R.L. Bradley, E. Maratos-Flier, Expanding the scales: the multiple Cell. Endocrinol. 337 (2011) 114–121. roles of MCH in regulating energy balance and other biological functions, [16] C. Duan, Nutritional and developmental regulation of insulin-like growth Endocr. Rev. 27 (2006) 606–620. factors in fish, J. Nutr. 128 (1998) 306S–314S. [42] M. Reinecke, Insulin-like growth factors and fish reproduction, Biol. Reprod. 82 [17] E. Eppler, N. Shved, O. Moret, M. Reinecke, IGF-I is distinctly located in the (2010) 656–661. bony fish pituitary as revealed for Oreochromis niloticus, the Nile tilapia, using D.I. Pérez Sirkin et al. / General and Comparative Endocrinology 176 (2012) 102–111 111

[43] F. Rentier-Delrue, D. Swennen, J.C. Philippart, C. L’Hoir, M. Lion, O. Benrubi, J.A. [47] Y. Shi, Beyond skin color: emerging roles of melanin-concentrating hormone in Martial, Tilapia growth hormone: molecular cloning of cDNA and expression in energy homeostasis and other physiological functions, Peptides 25 (2004) Escherichia coli, DNA 8 (1989) 271–278. 1605–1611. [44] N. Sato, K. Watanabe, K. Murata, M. Sakaguchi, Y. Kariya, S. Kimura, M. Nonaka, [48] S. Shimakura, K. Kojima, T. Nakamachi, H. Kageyama, M. Uchiyama, S. Shioda, A. Kimura, Molecular cloning and nucleotide sequence of tuna growth A. Takahashi, K. Matsuda, Neuronal interaction between melanin hormone cDNA, Biochim. Biophys. Acta 949 (1988) 35–42. concentrating hormone and alpha-melanocyte-stimulating hormone [45] G. Segal-Lieberman, H. Rubinfeld, M. Glick, N. Kronfeld-Schor, I. Shimon, containing neurons in the goldfish hypothalamus, Peptides 29 (2008) 1432– Melanin-concentrating hormone stimulates human growth hormone 1440. secretion: a novel effect of MCH on the hypothalamic–pituitary axis, Am. J. [49] A. Takahashi, K. Tsuchiya, T. Yamanome, M. Amano, A. Yasuda, K. Yamamori, H. Physiol. Endocrinol. Metab. 290 (2006) E982–E988. Kawauchi, Possible involvement of melanin-concentrating hormone in food [46] B.S. Shepherd, J.K. Johnson, J.T. Silverstein, I.S. Parhar, M.M. Vijayan, A. intake in a teleost, barfin flounder, Peptides 25 (2004) 1613–1622. McGuire, G.M. Weber, Endocrine and orexigenic actions of growth hormone [50] T. Yamanome, M. Amano, A. Takahashi, White background reduces the secretagogues in rainbow trout (Oncorhynchus mykiss), Comp. Biochem. occurrence of staining, activates melanin-concentrating hormone and Physiol., A: Mol. Integr. Physiol. 146 (2007) 90–399. promotes somatic growth in barfin flounder, Aquaculture 244 (2005) 323–329.