Original Article Mir-23B Inhibits Cell Migration and Invasion Through Targeting PDE7A in Colon Cancer Cells

Int J Clin Exp Pathol 2017;10(9):9436-9443 www.ijcep.com /ISSN:1936-2625/IJCEP0058135

Original Article MiR-23b inhibits cell migration and invasion through targeting PDE7A in colon cancer cells

Lingfang Hao, Honggang Yu

Department of Gastroenterology, Renmin Hospital of Wuhan University, Wuhan, Hubei Province, China Received May 24, 2017; Accepted August 2, 2017; Epub September 1, 2017; Published September 15, 2017

Abstract: It has been found that the abnormal expression of miR-23b is related to the poor prognosis or the weak ability of metastasis in colorectal cancer. Furthermore, high expression of PDE7A in tumors is known to be related to poor prognosis. The aim of this study was to explain whether miR-23b was involved in the invasion and metastasis of colon cancer by regulating PDE7A gene. The expression levels of miR-23b and PDE7A in colon tissues and colon cancer cell lines (SW620 and SW480 cells) were measured by real time PCR. The PDE7A protein level was determined by Western blotting. The relationship between miR-23b and PDE7A was verified by cell transfection and luciferase reporter assay. The effect of miR-23b or PDE7A level on cell invasion and migration was determined by Transwell assay. miR-23b was down-regulated when PDE7A was up-regulated in colon cancer tissues and cells. The result of dual luciferase reporter assay showed that PDE7A was a direct target gene of miR-23b. Overexpression of miR-23b not only reduced the expression of PDE7A in SW620 cells or SW480 cells, but also weakened the migration and invasion abilities of SW620 cells or SW480 cells. When SW620 cells or SW480 cells were transfected with si-PDE7A, the level of PDE7A increased and the migration and invasion abilities of cells diminished. In conclusion, miR-23b is lowly expressed in colon cancer tissues and cells, and miR-23b may play an inhibitory role in the development of colon cancer through down-regulating the expression of PDE7A.

Keywords: miR-23b, colon cancer, PDE7A, migration, invasion

Introduction miR-18a to promote the expression of miR-18a and the development of tumor [9]. Bic (B-cell MiRNAs have been extensively studied as a integration cluster) gene is one of the known short, noncoding single-stranded RNA that reg- oncogenes, and its encoded RNA can be fur- ulate the expression of target genes. The ther processed to form miR-155, miR-155 pre- human miRNA gene has been found to account cursor RNA and bic mRNA are highly expressed for about 1% to 3% of the human genome [1], in children Burkitt’s lymphoma [10]. Invasion and 30% to 60% of the human protein genes and metastasis is one of the hallmarks of malig- are regulated by miRNAs [2, 3]. A single miRNA nancy and the leading cause of death in cancer may bind up to 200 different functional targets, patients. Studies have confirmed that miRNAs including transcription factors, receptors, vec- are involved in the whole process of tumor tors [4]. More than 186 miRNA genes have metastasis. Upregulation of miR-29a expres- been localized in the region of tumor-associat- sion can promote the development of EMT and ed chromosomal rearrangements [5], and lead to tumor metastasis [11]. MiR-9 can work some changes in specific miRNA expression directly on the CDH1 gene encoding E-cadherin genes have been occurred in some of the can- and increase the invasion and metastasis of cer-specific chromosomal fragility sites [6, 7]. cells [12]. The miRNA expression profile is closely related to the embryonic origin of the Many miRNA targets are proto-oncogenes or tumor, and its expression is more tissue-specif- tumor suppressor genes [8]. The abnormal ic, so miRNAs can be used as clinical markers expression of miRNA is a common feature of for effective tumor diagnostic markers. Lu et al. tumorigenesis. HnRNPA1 connexin can bind to proposed the use of whole-gene miRNA expres- MiR-23b inhibits cell migration and invasion in colon cancer cells

Table 1. The sequences of primers at -80°C until further Gene Forward primer (5’-3’) Reverse primer (5’-3’) analysis. MiR-23b GAGCATCACATTGCCAGGG GTGCAGGGTCCGAGGT Cell culture and transfec- PDE7A GGAAATAGTCTAGTAAGCTTAACC GGCAGATGTGAGAATAAGCCTG tion U6 CGCTTCGGCAGCACATATAC TTCACGAATTTGCGTGTCAT GAPDH TGAAGGTCGGAGTCAACGGATTTGGT CATGTGGGCCATGAGGTCCACCAC The human colon cancer cell lines SW620 cells and SW480 cells were cultured sion profiles in identifying poorly differentiated at 37°C in a 5% CO2 atmosphere and main- tumors [13], which are difficult to identify by tained in DMEM containing 10% FBS and 2 mM imaging methods and mRNA-based diagnostic L-glutamine (Invitrogen, CA, USA). Human miR- methods. In addition, miRNAs and their target 23b mimics and negative control oligonucle- genes can serve as effective drug targets for otide (NC) were designed and provided by tumor treatment. The inhibition of oncogene GenePhram (Suzhou, China). Small interfering microRNAs in mice with different organs inject- RNA of PDE7A (si-PDE7A) and negative control ed with AMOs (an anti-microRNA oligonucle- RNA (siRNA-NC) were synthesized and purified otide) leads to inhibitory action on tumor growth by Genifarma too. SW480 cells and SW620 [14]. cells were transfected with miR-23b mimics or NC, and si-PDE7A or siRNA-NC using Lipofec- MiR-23b has been found to be lowly expressed tamine 2000 reagent (Invitrogen) according to in a variety of tumor tissues such as prostate the manufacturer’s protocol. cancer [15], oral squamous cell carcinoma [16], bladder cancer [17] and can act as a tumor sup- Dual luciferase reporter assay pressor miRNA in hepatocellular carcinoma [18], malignant glioma [19] and ovarian cancer Candidate target genes of miR-23b were identi- [20] through inhibiting the growth, proliferation, fied by TargetScan, and we chose the PDE7A to migration and invasion of tumor cells. Similarly, perform the follow-up experiments because miR-23b is also found to be highly expressed in that PDE7A had been reported to play a role in gastric cancer and associated with poor prog- migration and invasion of cancer cells [23]. To nosis of gastric cancer [21]. In order to further construct the PDE7A 3’UTR plasmid, the full- understand the development mechanism of length 3’UTR of human PDE7A mRNA contain- colon cancer [22], this study examined the miR- ing the putative miR-23b binding site was 23b expression in colon cancer tissue and cloned into the pmirGLO Dual-Luciferase miRNA colon cancer cell lines. In addition, miR-23b tar- Target Expression Vector (Promega, WI, USA). get gene was searched and verified by target The putative miR-23b recognition site in PDE7A gene prediction software and dual luciferase 3’UTR was mutated by site-directed mutagen- reporter assay, the function of miR-23b and its esis. For dual luciferase assay, SW620 cells target gene in colon cancer cell line were ana- were transfected with 100 nM miR-23b mimics lyzed too. or negative control using Lipofectamine 2000. After 24 hours, 150 ng of pmir-GLO-PDE7A WT Materials and methods or pmir-GLO-PDE7A mut were transfected in these cells. After 48 hours, cell extracts were Clinical specimens prepared and the detection of relative luciferase activity was performed using Dual-Lucife- A total of 30 primary colon cancer tissues and rase® Reporter Assay System (Promega) acco- its paired non-cancerous colon tissues were rding to the manufacturer’s protocol. collected from the Renmin Hospital of Wuhan University. All patients had provided written Cell migration and invasion assay consent and the study had been approved by the Renmin Hospital of Wuhan University Transfection wells (BD Biosciences, NJ, USA) Institutional Review Committee. All tissues containing an uncoated or matrix adhesive have been histologically confirmed as colon coating containing 8 μm pores were used in cell adenocarcinoma. Tissue samples were collect- migration or invasion assays. Cells transfected ed, frozen quickly in liquid nitrogen, and stored with 100 nM miR-149 mimics/NC or 100 nM

9437 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells

Figure 1. Down-regulation of miR-23b expression and up-regulation of PDE7A expression in colon cancer tissues and cells. A. miR-23b expression in colon cancer tissues and cells compared with adjacent tissues; B. PDE7A mRNA levels in colon cancer tissues and cells compared with adjacent tissues; C. PDE7A protein levels were significantly elevated in colon cancer tissues. ***P < 0.001, compared with adjacent tissues. siRNA-PDE7A/si-NC were seeded into the upper body (ab9485)] and horseradish peroxidase chamber of serum-free DMEM. After 24 hours (HRP) conjugated secondary antibody [goat the cells were fixed in 100% methanol and anti-Rabbit IgG H&L (HRP) (ab6721)] were ob- stained with crystal violet at room temperature tained from Abcam and used according to the for 30 minutes. The cells remaining on the filter manufacturer’s instructions. side were removed with a cotton swab. The filter was then imaged under an inverted micro- Statistical analysis scope and the number of migrating or invading cells was counted from these images. The concentration of the vector and the concentration of RNA and protein from each tissue QRT-PCR analysis or cell sample were detected three times and the mean value was used for subsequent Total RNA was extracted from colon cancer experiments. Every treatment in the dual lucif- cells or tumor tissues using TRIZOL reagent erase reporter assay was performed three (Invitrogen). CDNA synthesis kit (Takara, Tokyo, times to achieve three values. Every treatment Japan) was used for the synthesis of cDNA in Transwell assay was performed three times according to the manufacturer’s instructions. and every number of cell count was the mean Quantitative RT-PCR was used to detect the value from 5 random sights. QRT-PCR was per- expression levels of miR-23b and PDE7A mRNA, formed in triplicate. Data were analyzed by and was performed using the Light Cycler 480 Student’s t-test using SPSS 16.0 statistical detection system (Roche Diagnostics, IN, USA). software (SPSS, NY, USA) to determine the sta- U6 snRNA and GAPDH mRNA levels were tistical significance. The results were expressed detected and used for standardization. Primer as mean ± SD. P < 0.05, the results were con- sequences are listed in Table 1. sidered statistically significant.

Western blot analysis Results

Total protein was prepared from colon cancer Decreased expression of miR-23b and in- tissues and colon cancer cells. The protein con- creased expression of PDE7A in colon cancer centration was determined using a Bio-Rad tissues and cells protein assay system (Bio-Rad, CA, USA). Proteins were analyzed by SDS polyacrylamide The expression level of miR-23b in colon cancer gel electrophoresis. After electrophoresis, pro- tissues, adjacent non-cancerous tissues and teins were transferred onto NC membrane. The colon cancer cell lines (SW620, SW480) were membrane containing protein was incubated detected by qRT-PCR, and the results showed with the appropriate antibody before scanning that miR-23b was down regulated in colon can- protein bands. The primary antibodies [anti- cer tissues or colon cancer cell lines (SW620, PDE7A antibody (ab154857), anti-GAPDH anti- SW480) compared with the adjacent non-

9438 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells

Figure 2. MiR-23b negatively regulates the PDE7A expression in colon cancer cells. MiR-23b mimics effectively increased the miR-23b level (A) and reduced the mRNA level (B) and protein level (C) of PDE7A in colon cancer cells; (D) The miR-23b targeting on the 3’UTR of PDE7A was predicted by the online tool (http://www.targetscan.org/) and verified by the luciferase reporter assay. *P < 0.05, **P < 0.01, ***P < 0.001, compared with negative control. cancerous tissues (P < 0.001) (Figure 1A). 23b level was also lower than that in SW620 Meanwhile, the mRNA and protein levels of and SW480 cells transfected with NC (Figure PDE7A in colon cancer tissues, adjacent non- 2C). Furthermore, the result of dual luciferase cancerous tissues and colon cancer cell lines reporter assay showed that miR-23b could (SW620, SW480) were detected by qRT-PCR directly target to the 3’-UTR of PDE7A mRNA and western blot, respectively. As shown in and down-regulated the relative activity of lucif- Figure 1B and 1C, the mRNA level of PDE7A in erase (P < 0.05) (Figure 2D). These results sug- colon cancer tissues or colon cancer cell lines gest that PDE7A is a direct target gene of miR- (SW620, SW480) was significantly higher than 23b and miR-23b can down-regulate the that in adjacent non-cancerous tissues (P < expression of PDE7A in SW620 cells and 0.001) as well as the protein level of PDE7A. SW480 cells. These results suggest the low expression of miR-23b and high expression of PDE7A in colon Overexpression of miR-23b weaken the migra- cancer tissues and colon cancer cell lines tion and invasion ability of colon cancer cells SW620 cells and SW480 cells. The effect of high level of miR-23b on the migra- PDE7A is a direct target gene of miR-23b in tion and invasion abilities of colon cancer cells colon cancer cells was tested by Transwell assay, and the result showed that up-regulation of miR-23b reduced To find the relationship between miR-23b and numbers of migrated SW620 cells (48 ± 3 vs. PDE7A in colon cancer cells, the miR-23b level 101 ± 8, P < 0.01) and migrated SW480 cells was enhanced both in SW620 cells and SW480 (52 ± 5 vs. 100 ± 13, P < 0.05) (Figure 3A). cells by being transfected with miR-23b mimics Similarly, the aggressive cell numbers of (Figure 2A). Then the mRNA and protein levels SW620 cells or SW480 cells transfected with of PDE7A in SW620 cells and SW480 cells were miR-23b mimics were dramatically reduced detected by qRT-PCR and western blot, the than that of SW620 and SW480 cells transfect- results showed that PDE7A mRNA level was ed with NC (45 ± 5 vs. 100 ± 10, P < 0.01; 38 ± obviously reduced in SW620 cells and SW480 4 vs. 101 ± 12, P < 0.01) (Figure 3B). The above cells with high miR-23b level (P < 0.01, P < results indicate that high level of miR-23b can 0.05) (Figure 2B). The protein level of PDE7A in weak the migration and invasion abilities of SW620 cells and SW480 cells with high miR- SW620 cells and SW480 cells.

9439 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells

Figure 3. MiR-23b overexpression weakened migration and invasion of colon cancer cells. A. The effect of miR-23b overexpression on cell migration. B. The effect of miR-23b overexpression on cell invasion. *P < 0.05, **P < 0.01, compared with negative control.

Downregulation of PDE7A reduces the migra- this data drops to 15% in metastatic colorectal tion and invasion ability of colon cancer cells cancer [24]. Despite the development of many early screening and treatment programs in The effects of si-PDE7A on mRNA level and pro- recent years, the survival rate of colorectal can- tein level of PDE7A were tested by cell transfec- cer has been not improved significantly over tion, qRT-PCR and western blot. The results the past 20 years, and the introduction of inva- showed that PDE7A expression in SW620 cells sive metastasis is the most common cause of and SW480 cells transfected with si-PDE7A-1 treatment failure. The mechanism of tumor or si-PDE7A-2 was down-regulated both in metastasis is complex, involving the invasion mRNA level and protein level (P < 0.01, P < and adhesion of cancer cells, epithelial mesen- 0.05) (Figure 4A, 4B). In addition, the results of chymal transition (EMT), extracellular matrix Transwell assay showed that migrated cell degradation, angiogenesis and microenviron- number was significantly reduced in SW620 mental chemotaxis. Which are affected by the cells or SW480 cells transfected with si- abnormal activation or inactivation of many PDE7A-1 or si-PDE7A-2 than that in SW620 oncogenes or tumor suppressor genes and cells or SW480 cells transfected with NC (P < related signaling pathways. The activation or 0.01, P < 0.05) (Figure 4C); Invaded cells trans- inactivation of oncogenes or tumor suppressor fected with si-PDE7A-1 or si-PDE7A-2 were also genes is regulated at transcriptional level, post- decreased in SW620 cells or SW480 cells (P < transcriptional and translational level, respec- 0.01, P < 0.05) (Figure 4D). These results sug- tively. The miRNA regulates the target gene gest that si-PDE7A-1 and si-PDE7A-2 can down- expression from the post-transcriptional level regulate the PDE7A expression in SW620 cells by completely or incompletely pairing with the or SW480 cells and weaken the migration and 3’-UTR of target mRNA, causing the degrada- invasion of SW620 cells or SW480 cells. tion or inhibited translation of target mRNA.

Discussion Studies have shown that miRNAs regulate the expression of at least 30% of the human pro- About 655,000 people die from colorectal can- tein-encoding genes [25] and play a greater cer each year, and the incidence of colorectal role than protein-encoding genes [26]. In a vari- cancer is on the rise. The 5-year survival rate ety of human tumors, miRNAs are character- for early colorectal cancer is about 90%, and ized by abnormal expression due to gene muta-

9440 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells

Figure 4. Knockdown of PDE7A weakened migration and invasion of colon cancer cells. A. The mRNA level of PDE7A in colon cancer cells transfected with si-PDE7A; B. The protein expression of PDE7A in colon cancer cells transfected with si-PDE7A; C. The effect of PDE7A knockdown on cell migration; D. The effect of PDE7A knockdown on cell invasion. *P < 0.05, **P < 0.01, compared with negative control. tion or gene fragility sites [27]. MiR-23b is sion of PDE7A in colon cancer tissues and cells, currently known to be abnormally expressed in and when transfected with miR-23b mimics, hepatocellular carcinoma cells, which reduce colon cancer cells show high level of miR-23b the proliferation and migration ability of hepato- and low level of PDE7A, indicating that the cellular carcinoma cells [18]. Our study find the PDE7A level is affected by miR-23b level in low level of miR-23b in colon cancer tissues colon cancer cells. PDE7A is a target of miR- and cells, suggesting that miR-23b may play a 23b, and miR-23b directly regulates PDE7A tumor suppression role during the development expression has been confirmed by dual lucifer- of colon cancer. The colon cancer cells trans- ase reporter assay. In view of the role of miR- fected with miR-23b mimics show high level of 23b in colon cancer cells, PDE7A, which is neg- miR-23b and weaken migration or invasion abil- atively regulated by miR-23b, may act as an ity, which indicate that miR-23b could exert the oncogene in colon cancer cells. And this is also anti-tumor effect by inhibiting the migration and confirmed by RNA interference test and invasion of colon cancer cells. Transwell assay.

PDE7A is a phosphodiesterase that regulates In conclusion, our results suggest that miR-23b the cellular levels of cAMP and cGMP [28-30]. is lowly expressed in colon cancer tissues and Low level of cAMP and high level of PDE were cells, whereas PDE7A is highly expressed in found in multiple cancer cells, whereas PDE7A colon cancer tissues and cells. Our further was found to be overexpressed in lymphocytic study shows that PDE7A is a target gene of miR- leukemia and endometrial cancer [23, 31], indi- 23b and the expression of PDE7A is negatively cating that PDE7A may also be involved in the regulated by miR-23b. And increased miR-23b development of cancer. In this study, we find level or decreased PDE7A level both can sup- that low expression of miR-23b and overexpres- press the migration and invasion ability of colon

9441 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells cancer cells. This suggests that miR-23b may ty PA, Weber BL and Coukos G. microRNAs function as a tumor suppressor in the develop- exhibit high frequency genomic alterations in ment of colon cancer by regulating the expres- human cancer. Proc Natl Acad Sci U S A 2006; sion of PDE7A. Our study contributes to reveal- 103: 9136-9141. ing the development mechanisms of colon [8] Ryazansky SS and Gvozdev VA. Small RNAs and cancerogenesis. Biochemistry (Mosc) cancer and studying the treatment strategy for 2008; 73: 514-527. colon cancer. [9] Koo JH, Lee HJ, Kim W and Kim SG. Endoplas- mic reticulum stress in hepatic stellate cells Acknowledgements promotes liver fibrosis via PERK-mediated degradation of HNRNPA1 and up-regulation of This study was supported by National Natural SMAD2. Gastroenterology 2016; 150: 181- Science Foundation of China (Grant No.: 193, e188. 81672387). [10] van den Berg A, Kroesen BJ, Kooistra K, de Jong D, Briggs J, Blokzijl T, Jacobs S, Kluiver J, Disclosure of conflict of interest Diepstra A, Maggio E and Poppema S. High expression of B-cell receptor inducible gene BIC None. in all subtypes of Hodgkin lymphoma. Genes Chromosomes Cancer 2003; 37: 20-28. Address correspondence to: Dr. Honggang Yu, De- [11] Gebeshuber CA, Zatloukal K and Martinez J. partment of Gastroenterology, Renmin Hospital of miR-29a suppresses tristetraprolin, which is a Wuhan University, 238 Jiefang Road, Wuhan 430- regulator of epithelial polarity and metastasis. 060, Hubei Province, China. Tel: +86-27-88041911; EMBO Rep 2009; 10: 400-405. Fax: +86-27-88042292; E-mail: [email protected] [12] Ma L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J, Reinhardt F, Onder References TT, Valastyan S, Westermann F, Speleman F, Vandesompele J and Weinberg RA. miR-9, a [1] Zhao Y and Srivastava D. A developmental MYC/MYCN-activated microRNA, regulates E- view of microRNA function. Trends Biochem cadherin and cancer metastasis. Nat Cell Biol Sci 2007; 32: 189-197. 2010; 12: 247-256. [2] Bartel DP. MicroRNAs: genomics, biogenesis, [13] Lu J, Getz G, Miska EA, Alvarez-Saavedra E, mechanism, and function. Cell 2004; 116: Lamb J, Peck D, Sweet-Cordero A, Ebert BL, 281-297. Mak RH, Ferrando AA, Downing JR, Jacks T, [3] Friedman RC, Farh KK, Burge CB and Bartel Horvitz HR and Golub TR. MicroRNA expres- DP. Most mammalian mRNAs are conserved sion profiles classify human cancers. Nature targets of microRNAs. Genome Res 2009; 19: 2005; 435: 834-838. 92-105. [14] Hatley ME, Patrick DM, Garcia MR, Richardson [4] Bao N, Lye KW and Barton MK. MicroRNA bind- JA, Bassel-Duby R, van Rooij E and Olson EN. ing sites in Arabidopsis class III HD-ZIP mRNAs Modulation of K-Ras-dependent lung tumori- are required for methylation of the template genesis by MicroRNA-21. Cancer Cell 2010; chromosome. Dev Cell 2004; 7: 653-662. 18: 282-293. [5] Calin GA, Sevignani C, Dumitru CD, Hyslop T, [15] Castillo RC, MacKenzie EJ, Archer KR, Bosse Noch E, Yendamuri S, Shimizu M, Rattan S, MJ, Webb LX and Group LS. Evidence of benefi- Bullrich F, Negrini M and Croce CM. Human mi- cial effect of physical therapy after lower-ex- croRNA genes are frequently located at fragile tremity trauma. Arch Phys Med Rehabil 2008; sites and genomic regions involved in cancers. 89: 1873-1879. Proc Natl Acad Sci U S A 2004; 101: 2999- [16] Fukumoto I, Hanazawa T, Kinoshita T, Kikkawa 3004. N, Koshizuka K, Goto Y, Nishikawa R, Chiyo- [6] Calin GA, Liu CG, Sevignani C, Ferracin M, Felli maru T, Enokida H, Nakagawa M, Okamoto Y N, Dumitru CD, Shimizu M, Cimmino A, Zupo S, and Seki N. MicroRNA expression signature of Dono M, Dell’Aquila ML, Alder H, Rassenti L, oral squamous cell carcinoma: functional role Kipps TJ, Bullrich F, Negrini M and Croce CM. of microRNA-26a/b in the modulation of novel MicroRNA profiling reveals distinct signatures cancer pathways. Br J Cancer 2015; 112: 891- in B cell chronic lymphocytic leukemias. Proc 900. Natl Acad Sci U S A 2004; 101: 11755-11760. [17] Itesako T, Seki N, Yoshino H, Chiyomaru T, Ya- [7] Zhang L, Huang J, Yang N, Greshock J, Megraw masaki T, Hidaka H, Yonezawa T, Nohata N, MS, Giannakakis A, Liang S, Naylor TL, Bar- Kinoshita T, Nakagawa M and Enokida H. The chetti A, Ward MR, Yao G, Medina A, O’Brien- microRNA expression signature of bladder Jenkins A, Katsaros D, Hatzigeorgiou A, Gimot- cancer by deep sequencing: the functional sig-

9442 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells

nificance of the miR-195/497 cluster. PLoS [25] Croce CM and Calin GA. miRNAs, cancer, and One 2014; 9: e84311. stem cell division. Cell 2005; 122: 6-7. [18] Salvi A, Sabelli C, Moncini S, Venturin M, Arici [26] Kim VN and Nam JW. Genomics of microRNA. B, Riva P, Portolani N, Giulini SM, De Petro G Trends Genet 2006; 22: 165-173. and Barlati S. MicroRNA-23b mediates uroki- [27] Calin GA and Croce CM. MicroRNA signatures nase and c-met downmodulation and a de- in human cancers. Nat Rev Cancer 2006; 6: creased migration of human hepatocellular 857-866. carcinoma cells. FEBS J 2009; 276: 2966- [28] Zhang L, Murray F, Zahno A, Kanter JR, Chou D, 2982. Suda R, Fenlon M, Rassenti L, Cottam H, Kipps [19] Loftus JC, Ross JT, Paquette KM, Paulino VM, TJ and Insel PA. Cyclic nucleotide phosphodies- Nasser S, Yang Z, Kloss J, Kim S, Berens ME terase profiling reveals increased expression and Tran NL. miRNA expression profiling in mi- of phosphodiesterase 7B in chronic lympho- grating glioblastoma cells: regulation of cell cytic leukemia. Proc Natl Acad Sci U S A 2008; migration and invasion by miR-23b via target- 105: 19532-19537. ing of Pyk2. PLoS One 2012; 7: e39818. [29] Marko D, Romanakis K, Zankl H, Furstenberg- [20] Li W, Liu Z, Chen L, Zhou L and Yao Y. MicroR- er G, Steinbauer B and Eisenbrand G. Induc- NA-23b is an independent prognostic marker tion of apoptosis by an inhibitor of cAMP-spe- and suppresses ovarian cancer progression by cific PDE in malignant murine carcinoma cells targeting runt-related transcription factor-2. overexpressing PDE activity in comparison to FEBS Lett 2014; 588: 1608-1615. their nonmalignant counterparts. Cell Biochem [21] Zhuang K, Han K, Tang H, Yin X, Zhang J, Zhang Biophys 1998; 28: 75-101. X and Zhang L. Up-regulation of plasma miR- [30] Savai R, Pullamsetti SS, Banat GA, Weissmann 23b is associated with poor prognosis of gas- N, Ghofrani HA, Grimminger F and Schermuly tric cancer. Med Sci Monit 2016; 22: 356-361. RT. Targeting cancer with phosphodiesterase [22] Kou CH, Zhou T, Han XL, Zhuang HJ and Qian inhibitors. Expert Opin Investig Drugs 2010; HX. Downregulation of mir-23b in plasma is as- 19: 117-131. sociated with poor prognosis in patients with [31] Dong H, Zitt C, Auriga C, Hatzelmann A and Ep- colorectal cancer. Oncol Lett 2016; 12: 4838- stein PM. Inhibition of PDE3, PDE4 and PDE7 4844. potentiates glucocorticoid-induced apoptosis [23] Yamamoto N, Nishikawa R, Chiyomaru T, Goto and overcomes glucocorticoid resistance in Y, Fukumoto I, Usui H, Mitsuhashi A, Enokida CEM T leukemic cells. Biochem Pharmacol H, Nakagawa M, Shozu M and Seki N. The tu- 2010; 79: 321-329. mor-suppressive microRNA-1/133a cluster targets PDE7A and inhibits cancer cell migration and invasion in endometrial cancer. Int J Oncol 2015; 47: 325-334. [24] Din FV, Theodoratou E, Farrington SM, Tenesa A, Barnetson RA, Cetnarskyj R, Stark L, Porte- ous ME, Campbell H and Dunlop MG. Effect of aspirin and NSAIDs on risk and survival from colorectal cancer. Gut 2010; 59: 1670-1679.

9443 Int J Clin Exp Pathol 2017;10(9):9436-9443