DOCSLIB.ORG

Original Article Mir-23B Inhibits Cell Migration and Invasion Through Targeting PDE7A in Colon Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article Mir-23B Inhibits Cell Migration and Invasion Through Targeting PDE7A in Colon Cancer Cells Int J Clin Exp Pathol 2017;10(9):9436-9443 www.ijcep.com /ISSN:1936-2625/IJCEP0058135 Original Article MiR-23b inhibits cell migration and invasion through targeting PDE7A in colon cancer cells Lingfang Hao, Honggang Yu Department of Gastroenterology, Renmin Hospital of Wuhan University, Wuhan, Hubei Province, China Received May 24, 2017; Accepted August 2, 2017; Epub September 1, 2017; Published September 15, 2017 Abstract: It has been found that the abnormal expression of miR-23b is related to the poor prognosis or the weak ability of metastasis in colorectal cancer. Furthermore, high expression of PDE7A in tumors is known to be related to poor prognosis. The aim of this study was to explain whether miR-23b was involved in the invasion and metas- tasis of colon cancer by regulating PDE7A gene. The expression levels of miR-23b and PDE7A in colon tissues and colon cancer cell lines (SW620 and SW480 cells) were measured by real time PCR. The PDE7A protein level was determined by Western blotting. The relationship between miR-23b and PDE7A was verified by cell transfection and luciferase reporter assay. The effect of miR-23b or PDE7A level on cell invasion and migration was determined by Transwell assay. miR-23b was down-regulated when PDE7A was up-regulated in colon cancer tissues and cells. The result of dual luciferase reporter assay showed that PDE7A was a direct target gene of miR-23b. Overexpression of miR-23b not only reduced the expression of PDE7A in SW620 cells or SW480 cells, but also weakened the migra- tion and invasion abilities of SW620 cells or SW480 cells. When SW620 cells or SW480 cells were transfected with si-PDE7A, the level of PDE7A increased and the migration and invasion abilities of cells diminished. In conclusion, miR-23b is lowly expressed in colon cancer tissues and cells, and miR-23b may play an inhibitory role in the develop- ment of colon cancer through down-regulating the expression of PDE7A. Keywords: miR-23b, colon cancer, PDE7A, migration, invasion Introduction miR-18a to promote the expression of miR-18a and the development of tumor [9]. Bic (B-cell MiRNAs have been extensively studied as a integration cluster) gene is one of the known short, noncoding single-stranded RNA that reg- oncogenes, and its encoded RNA can be fur- ulate the expression of target genes. The ther processed to form miR-155, miR-155 pre- human miRNA gene has been found to account cursor RNA and bic mRNA are highly expressed for about 1% to 3% of the human genome [1], in children Burkitt’s lymphoma [10]. Invasion and 30% to 60% of the human protein genes and metastasis is one of the hallmarks of malig- are regulated by miRNAs [2, 3]. A single miRNA nancy and the leading cause of death in cancer may bind up to 200 different functional targets, patients. Studies have confirmed that miRNAs including transcription factors, receptors, vec- are involved in the whole process of tumor tors [4]. More than 186 miRNA genes have metastasis. Upregulation of miR-29a expres- been localized in the region of tumor-associat- sion can promote the development of EMT and ed chromosomal rearrangements [5], and lead to tumor metastasis [11]. MiR-9 can work some changes in specific miRNA expression directly on the CDH1 gene encoding E-cadherin genes have been occurred in some of the can- and increase the invasion and metastasis of cer-specific chromosomal fragility sites [6, 7]. cells [12]. The miRNA expression profile is closely related to the embryonic origin of the Many miRNA targets are proto-oncogenes or tumor, and its expression is more tissue-specif- tumor suppressor genes [8]. The abnormal ic, so miRNAs can be used as clinical markers expression of miRNA is a common feature of for effective tumor diagnostic markers. Lu et al. tumorigenesis. HnRNPA1 connexin can bind to proposed the use of whole-gene miRNA expres- MiR-23b inhibits cell migration and invasion in colon cancer cells Table 1. The sequences of primers at -80°C until further Gene Forward primer (5’-3’) Reverse primer (5’-3’) analysis. MiR-23b GAGCATCACATTGCCAGGG GTGCAGGGTCCGAGGT Cell culture and transfec- PDE7A GGAAATAGTCTAGTAAGCTTAACC GGCAGATGTGAGAATAAGCCTG tion U6 CGCTTCGGCAGCACATATAC TTCACGAATTTGCGTGTCAT GAPDH TGAAGGTCGGAGTCAACGGATTTGGT CATGTGGGCCATGAGGTCCACCAC The human colon cancer cell lines SW620 cells and SW480 cells were cultured sion profiles in identifying poorly differentiated at 37°C in a 5% CO2 atmosphere and main- tumors [13], which are difficult to identify by tained in DMEM containing 10% FBS and 2 mM imaging methods and mRNA-based diagnostic L-glutamine (Invitrogen, CA, USA). Human miR- methods. In addition, miRNAs and their target 23b mimics and negative control oligonucle- genes can serve as effective drug targets for otide (NC) were designed and provided by tumor treatment. The inhibition of oncogene GenePhram (Suzhou, China). Small interfering microRNAs in mice with different organs inject- RNA of PDE7A (si-PDE7A) and negative control ed with AMOs (an anti-microRNA oligonucle- RNA (siRNA-NC) were synthesized and purified otide) leads to inhibitory action on tumor growth by Genifarma too. SW480 cells and SW620 [14]. cells were transfected with miR-23b mimics or NC, and si-PDE7A or siRNA-NC using Lipofec- MiR-23b has been found to be lowly expressed tamine 2000 reagent (Invitrogen) according to in a variety of tumor tissues such as prostate the manufacturer’s protocol. cancer [15], oral squamous cell carcinoma [16], bladder cancer [17] and can act as a tumor sup- Dual luciferase reporter assay pressor miRNA in hepatocellular carcinoma [18], malignant glioma [19] and ovarian cancer Candidate target genes of miR-23b were identi- [20] through inhibiting the growth, proliferation, fied by TargetScan, and we chose the PDE7A to migration and invasion of tumor cells. Similarly, perform the follow-up experiments because miR-23b is also found to be highly expressed in that PDE7A had been reported to play a role in gastric cancer and associated with poor prog- migration and invasion of cancer cells [23]. To nosis of gastric cancer [21]. In order to further construct the PDE7A 3’UTR plasmid, the full- understand the development mechanism of length 3’UTR of human PDE7A mRNA contain- colon cancer [22], this study examined the miR- ing the putative miR-23b binding site was 23b expression in colon cancer tissue and cloned into the pmirGLO Dual-Luciferase miRNA colon cancer cell lines. In addition, miR-23b tar- Target Expression Vector (Promega, WI, USA). get gene was searched and verified by target The putative miR-23b recognition site in PDE7A gene prediction software and dual luciferase 3’UTR was mutated by site-directed mutagen- reporter assay, the function of miR-23b and its esis. For dual luciferase assay, SW620 cells target gene in colon cancer cell line were ana- were transfected with 100 nM miR-23b mimics lyzed too. or negative control using Lipofectamine 2000. After 24 hours, 150 ng of pmir-GLO-PDE7A WT Materials and methods or pmir-GLO-PDE7A mut were transfected in these cells. After 48 hours, cell extracts were Clinical specimens prepared and the detection of relative lucifer- ase activity was performed using Dual-Lucife- A total of 30 primary colon cancer tissues and rase® Reporter Assay System (Promega) acco- its paired non-cancerous colon tissues were rding to the manufacturer’s protocol. collected from the Renmin Hospital of Wuhan University. All patients had provided written Cell migration and invasion assay consent and the study had been approved by the Renmin Hospital of Wuhan University Transfection wells (BD Biosciences, NJ, USA) Institutional Review Committee. All tissues containing an uncoated or matrix adhesive have been histologically confirmed as colon coating containing 8 μm pores were used in cell adenocarcinoma. Tissue samples were collect- migration or invasion assays. Cells transfected ed, frozen quickly in liquid nitrogen, and stored with 100 nM miR-149 mimics/NC or 100 nM 9437 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells Figure 1. Down-regulation of miR-23b expression and up-regulation of PDE7A expression in colon cancer tissues and cells. A. miR-23b expression in colon cancer tissues and cells compared with adjacent tissues; B. PDE7A mRNA levels in colon cancer tissues and cells compared with adjacent tissues; C. PDE7A protein levels were significantly elevated in colon cancer tissues. ***P < 0.001, compared with adjacent tissues. siRNA-PDE7A/si-NC were seeded into the upper body (ab9485)] and horseradish peroxidase chamber of serum-free DMEM. After 24 hours (HRP) conjugated secondary antibody [goat the cells were fixed in 100% methanol and anti-Rabbit IgG H&L (HRP) (ab6721)] were ob- stained with crystal violet at room temperature tained from Abcam and used according to the for 30 minutes. The cells remaining on the filter manufacturer’s instructions. side were removed with a cotton swab. The fil- ter was then imaged under an inverted micro- Statistical analysis scope and the number of migrating or invading cells was counted from these images. The concentration of the vector and the con- centration of RNA and protein from each tissue QRT-PCR analysis or cell sample were detected three times and the mean value was used for subsequent Total RNA was extracted from colon cancer experiments. Every treatment in the dual lucif- cells or tumor tissues using TRIZOL reagent erase reporter assay was performed three (Invitrogen). CDNA synthesis kit (Takara, Tokyo, times to achieve three values. Every treatment Japan) was used for the synthesis of cDNA in Transwell assay was performed three times according to the manufacturer’s instructions. and every number of cell count was the mean Quantitative RT-PCR was used to detect the value from 5 random sights.
Load more

Recommended publications
  • Functional T Cells Phosphodiesterase 7A-Deficient Mice Have
    Phosphodiesterase 7A-Deficient Mice Have Functional T Cells Guchen Yang, Kim W. McIntyre, Robert M. Townsend, Henry H. Shen, William J. Pitts, John H. Dodd, Steven G. This information is current as Nadler, Murray McKinnon and Andrew J. Watson of October 2, 2021. J Immunol 2003; 171:6414-6420; ; doi: 10.4049/jimmunol.171.12.6414 http://www.jimmunol.org/content/171/12/6414 Downloaded from References This article cites 37 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/171/12/6414.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 2, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Phosphodiesterase 7A-Deficient Mice Have Functional T Cells Guchen Yang,1 Kim W. McIntyre, Robert M. Townsend, Henry H. Shen, William J. Pitts, John H. Dodd, Steven G. Nadler, Murray McKinnon, and Andrew J.
    [Show full text]
  • Inhibiting PDE7A Enhances the Protective Effects of Neural Stem
    Research Article: New Research | Cognition and Behavior Inhibiting PDE7A enhances the protective effects of neural stem cells on neurodegeneration and memory deficits in sevoflurane-exposed mice https://doi.org/10.1523/ENEURO.0071-21.2021 Cite as: eNeuro 2021; 10.1523/ENEURO.0071-21.2021 Received: 19 February 2021 Revised: 21 May 2021 Accepted: 25 May 2021 This Early Release article has been peer-reviewed and accepted, but has not been through the composition and copyediting processes. The final version may differ slightly in style or formatting and will contain links to any extended data. Alerts: Sign up at www.eneuro.org/alerts to receive customized email alerts when the fully formatted version of this article is published. Copyright © 2021 Huang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license, which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed. 1 Inhibiting PDE7A enhances the protective effects of neural stem cells on 2 neurodegeneration and memory deficits in sevoflurane-exposed mice 3 Yanfang Huang, Yingle Chen*, Zhenming Kang, Shunyuan Li* 4 Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical 5 University, Quanzhou 362000, Fujian, China 6 7 *Corresponding authors 8 Shunyuan Li and Yingle Chen 9 Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical 10 University, Quanzhou 362000, Fujian, China 11 Email: [email protected] (Shunyuan Li); [email protected] (Yingle Chen) 12 Tel: 86-18960333666 13 14 15 Running title: Role of PDE7A in neurodegeneration 16 17 1 18 Abstract 19 Sevoflurane is widely used in general anesthesia, especially for children.
    [Show full text]
  • Mechanisms of Action of PDE5 Inhibition in Erectile Dysfunction
    International Journal of Impotence Research (2004) 16, S4–S7 & 2004 Nature Publishing Group All rights reserved 0955-9930/04 $30.00 www.nature.com/ijir Original Research Mechanisms of action of PDE5 inhibition in erectile dysfunction JD Corbin1* 1Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennesse, USA A spinal reflex and the L-arginine–nitric oxide–guanylyl cyclase–cyclic guanosine monophosphate (cGMP) pathway mediate smooth muscle relaxation that results in penile erection. Nerves and endothelial cells directly release nitric oxide in the penis, where it stimulates guanylyl cyclase to produce cGMP and lowers intracellular calcium levels. This triggers relaxation of arterial and trabecular smooth muscle, leading to arterial dilatation, venous constriction, and erection. Phosphodiesterase 5 (PDE5) is the predominant phosphodiesterase in the corpus cavernosum. The catalytic site of PDE5 normally degrades cGMP, and PDE5 inhibitors such as sildenafil potentiate endogenous increases in cGMP by inhibiting its breakdown at the catalytic site. Phosphorylation of PDE5 increases its enzymatic activity as well as the affinity of its allosteric (noncatalytic/GAF domains) sites for cGMP. Binding of cGMP to the allosteric site further stimulates enzymatic activity. Thus phosphorylation of PDE5 and binding of cGMP to the noncatalytic sites mediate negative feedback regulation of the cGMP pathway. International Journal of Impotence Research (2004) 16, S4–S7. doi:10.1038/sj.ijir.3901205 Keywords: phosphodiesterase inhibitors; vasodilator agents; cyclic GMP; impotence; penile erection Introduction the tone of penile vasculature and the smooth muscle of the corpus cavernosum. In primates, including humans, the L-arginine– In recent years, a deeper understanding of the nitric oxide–guanylyl cyclase–cyclic guanosine regulation of penile smooth muscle has led to monophosphate (cGMP) pathway is the key me- greater insight into the physiology of normal erectile chanism of penile erection1–4 (Figure 1).
    [Show full text]
  • Supplementary Table S2
    1-high in cerebrotropic Gene P-value patients Definition BCHE 2.00E-04 1 Butyrylcholinesterase PLCB2 2.00E-04 -1 Phospholipase C, beta 2 SF3B1 2.00E-04 -1 Splicing factor 3b, subunit 1 BCHE 0.00022 1 Butyrylcholinesterase ZNF721 0.00028 -1 Zinc finger protein 721 GNAI1 0.00044 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 0.00049 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PDE1B 0.00069 -1 Phosphodiesterase 1B, calmodulin-dependent MCOLN2 0.00085 -1 Mucolipin 2 PGCP 0.00116 1 Plasma glutamate carboxypeptidase TMX4 0.00116 1 Thioredoxin-related transmembrane protein 4 C10orf11 0.00142 1 Chromosome 10 open reading frame 11 TRIM14 0.00156 -1 Tripartite motif-containing 14 APOBEC3D 0.00173 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D ANXA6 0.00185 -1 Annexin A6 NOS3 0.00209 -1 Nitric oxide synthase 3 SELI 0.00209 -1 Selenoprotein I NYNRIN 0.0023 -1 NYN domain and retroviral integrase containing ANKFY1 0.00253 -1 Ankyrin repeat and FYVE domain containing 1 APOBEC3F 0.00278 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F EBI2 0.00278 -1 Epstein-Barr virus induced gene 2 ETHE1 0.00278 1 Ethylmalonic encephalopathy 1 PDE7A 0.00278 -1 Phosphodiesterase 7A HLA-DOA 0.00305 -1 Major histocompatibility complex, class II, DO alpha SOX13 0.00305 1 SRY (sex determining region Y)-box 13 ABHD2 3.34E-03 1 Abhydrolase domain containing 2 MOCS2 0.00334 1 Molybdenum cofactor synthesis 2 TTLL6 0.00365 -1 Tubulin tyrosine ligase-like family, member 6 SHANK3 0.00394 -1 SH3 and multiple ankyrin repeat domains 3 ADCY4 0.004 -1 Adenylate cyclase 4 CD3D 0.004 -1 CD3d molecule, delta (CD3-TCR complex) (CD3D), transcript variant 1, mRNA.
    [Show full text]
  • PDE7A, Active PDE7A, Active
    Catalog # Aliquot Size P95-31G -05 5 µg P95-31G -10 10 µg PDE7A, Active Human recombinant protein expressed in Sf9 cells Catalog # P95-31G Lot # F723 -2 Product Description Specific Activity Recombinant human PDE7A (104-end) was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. The gene accession number is NM_002603 . 2,400,000 Gene Aliases 1,800,000 1,200,000 HCP1; PDE7 600,000 Formulation (RLU) Activity 0 5 10 15 20 Recombinant protein stored in 50mM Tris-HCl, pH 7.5, 150mM NaCl, 10mM glutathione, 0.1mM EDTA, 0.25mM Protein (ng) DTT, 0.1mM PMSF, 25% glycerol. The specific activity of PDE7A was determined to be 160 nmol /min/mg as per activity assay protocol. Storage and Stability Purity o Store product at –70 C. For optimal storage, aliquot target into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple freeze/thaw cycles. The purity of PDE7A was Scientific Background determined to be >90% by densitometry. PDE7A is a member of the phosphodiesterase family of Approx. MW 64kDa . proteins that play a critical role in regulating intracellular levels of cAMP and cGMP. PDE7A is a high-affinity cAMP-specific PDE and is expressed in T cell lines, peripheral blood T lymphocytes, epithelial cell lines, airway and vascular smooth muscle cells, lung fibroblasts, and eosinophils. PDE7 plays a critical role in PDE7A, Active the regulation of human T cell function and selective Human recombinant protein expressed in Sf9 cells PDE7 inhibitors are being examined to treat immunological and inflammatory disorders (1).
    [Show full text]
  • Oligonucleotide Compositions and Methods for Treating Disease Including Inflammatory Conditions
    (19) & (11) EP 2 314 595 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 27.04.2011 Bulletin 2011/17 C07H 21/00 (2006.01) C12N 15/11 (2006.01) A61K 31/7088 (2006.01) A61P 29/00 (2006.01) (21) Application number: 10183977.7 (22) Date of filing: 29.09.2004 (84) Designated Contracting States: • Zemzoumi, Khalid AT BE BG CH CY CZ DE DK EE ES FI FR GB GR MONTREAL Québec H2H 1V3 (CA) HU IE IT LI LU MC NL PL PT RO SE SI SK TR • D’Anjou, Hélène BROSSARD Québec J4X 2W5 (CA) (30) Priority: 29.09.2003 US 507016 P (74) Representative: Cabinet Plasseraud (62) Document number(s) of the earlier application(s) in 52, rue de la Victoire accordance with Art. 76 EPC: 75440 Paris Cedex 09 (FR) 04786683.5 / 1 668 024 Remarks: (71) Applicant: Topigen Pharmaceuticals Inc. This application was filed on 30-09-2010 as a Montréal, QC H1W 4A4 (CA) divisional application to the application mentioned under INID code 62. (72) Inventors: • Renzi, Paolo WESTMOUNT Québec H3Y 1E9 (CA) (54) Oligonucleotide compositions and methods for treating disease including inflammatory conditions (57) The invention relates to therapeutic antisense structive pulmonary disease (COPD), acute respiratory oligonucleotides directed against genes coding for phos- distress syndrome, bronchitis, chronic bronchitis, silico- phodiesterase (PDEs) and the use of these in combina- sis, pulmonary fibrosis, lung allograft rejection, allergic tion. These antisense oligonucleotides may be used as rhinitis and chronic sinusitis as well as other conditions analytical tools and/or as therapeutic agents in the treat- in which an increase in cyclic AMP or a decrease in PDE ment of disease associated with reduced cellular cAMP levels is beneficial in a patient, such as inflammatory diseases of the respi- ratory tract including, for example, asthma, chronic ob- EP 2 314 595 A2 Printed by Jouve, 75001 PARIS (FR) EP 2 314 595 A2 Description Field of the Invention 5 [0001] The invention relates to methods, reagents and compositions of use for antisense oligonucleotide-based ther- apy.
    [Show full text]
  • Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways
    biomolecules Article Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways Aayushi Srivastava 1,2,3,4 , Abhishek Kumar 1,5,6 , Sara Giangiobbe 1, Elena Bonora 7, Kari Hemminki 1, Asta Försti 1,2,3 and Obul Reddy Bandapalli 1,2,3,* 1 Division of Molecular Genetic Epidemiology, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany; [email protected] (A.S.); [email protected] (A.K.); [email protected] (S.G.); [email protected] (K.H.); [email protected] (A.F.) 2 Hopp Children’s Cancer Center (KiTZ), D-69120 Heidelberg, Germany 3 Division of Pediatric Neurooncology, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), D-69120 Heidelberg, Germany 4 Medical Faculty, Heidelberg University, D-69120 Heidelberg, Germany 5 Institute of Bioinformatics, International Technology Park, Bangalore 560066, India 6 Manipal Academy of Higher Education (MAHE), Manipal, Karnataka 576104, India 7 S.Orsola-Malphigi Hospital, Unit of Medical Genetics, 40138 Bologna, Italy; [email protected] * Correspondence: [email protected]; Tel.: +49-6221-42-1709 Received: 29 August 2019; Accepted: 10 October 2019; Published: 13 October 2019 Abstract: Evidence of familial inheritance in non-medullary thyroid cancer (NMTC) has accumulated over the last few decades. However, known variants account for a very small percentage of the genetic burden. Here, we focused on the identification of common pathways and networks enriched in NMTC families to better understand its pathogenesis with the final aim of identifying one novel high/moderate-penetrance germline predisposition variant segregating with the disease in each studied family.
    [Show full text]
  • In T Cell Activity. Effects of Selective PDE7 Inhibitors and Dual PDE4/7
    International Journal of Molecular Sciences Review Role of Phosphodiesterase 7 (PDE7) in T Cell Activity. Effects of Selective PDE7 Inhibitors and Dual PDE4/7 Inhibitors on T Cell Functions Marianna Szczypka Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Wrocław University of Environmental and Life Sciences, Norwida 31, 50-375 Wrocław, Poland; [email protected]; Tel.: +48-71-320-5215 Received: 25 July 2020; Accepted: 22 August 2020; Published: 25 August 2020 Abstract: Phosphodiesterase 7 (PDE7), a cAMP-specific PDE family, insensitive to rolipram, is present in many immune cells, including T lymphocytes. Two genes of PDE7 have been identified: PDE7A and PDE7B with three or four splice variants, respectively. Both PDE7A and PDE7B are expressed in T cells, and the predominant splice variant in these cells is PDE7A1. PDE7 is one of several PDE families that terminates biological functions of cAMP—a major regulating intracellular factor. However, the precise role of PDE7 in T cell activation and function is still ambiguous. Some authors reported its crucial role in T cell activation, while according to other studies PDE7 activity was not pivotal to T cells. Several studies showed that inhibition of PDE7 by its selective or dual PDE4/7 inhibitors suppresses T cell activity, and consequently T-mediated immune response. Taken together, it seems quite likely that simultaneous inhibition of PDE4 and PDE7 by dual PDE4/7 inhibitors or a combination of selective PDE4 and PDE7 remains the most interesting therapeutic target for the treatment of some immune-related disorders, such as autoimmune diseases, or selected respiratory diseases.
    [Show full text]
  • Taqman® Human and Rat Phosphodiesterase Arrays
    TaqMan® Gene Signature Arrays TaqMan® Human and Rat Phosphodiesterase Arrays These arrays are part of a collection of TaqMan® Gene pathway, is released and can act as a signaling molecule in Signature Arrays that enable analysis of hundreds of TaqMan® apoptosis or growth arrest. Gene Expression Assays on a micro fluidic card with minimal Glycerophosphodiester phosphodiesterases (GDPDs) catalyze effort. the hydrolysis of deacylated glycerophospholipids to glycerol Phosphodiesterases are a group of enzymes that cleave a phosphate and alcohol. Members of this family may provide variety of substrates, including phosphodiesterase and a link between phosphoinositide metabolism and G protein pyrophosphate bonds of nucleotides and nucleotide sugars. signal transduction. Five distinct families are included in these arrays: 1) cyclic The TaqMan® Human Phosphodiesterase Gene Signature Array nucleotide phosphodiesterases; 2) nucleotide pyrophosphatase/ contains 43 human assays and five human controls. phosphodiesterases; 3) acid sphingomyelinases; 4) neutral Orthologous genes to the human array are in the Rat membrane sphingomyelin phosphodiesterases, and Phosphodiesterase Array with two exceptions: Pde6g and 5) glycerophosphodiester phosphodiesterases. Gdpd4 are missing and two added controls (Arbp and Ywhaz) The cyclic nucleotide phosphodiesterase (PDE) superfamily are in the rat array. currently includes 24 different genes grouped into 11 different Group Category Description # Human Gene Symbols PDE families. They degrade the second messenger molecules,
    [Show full text]
  • Radiosynthesis and Preclinical Evaluation of a Carbon-11 Labeled PDE7 Inhibitor for PET Neuroimaging
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.12.447900; this version posted June 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Radiosynthesis and preclinical evaluation of a carbon-11 labeled PDE7 inhibitor for PET neuroimaging Zhiwei Xiao,a† Jiyun Sun,a† Masayuki Fujinaga,b† Huiyi Wei,c Chunyu Zhao,a Ahmed Haider,a Richard Van,d Tomoteru Yamasaki,b Yiding Zhang,b Jian Rong,a Kuan Hu,b Jiahui Chen,a Erick Calderon Leon,d Atsuto Hiraishi,b Junjie Wei,c Yi Xu,e Yihan Shao,d Han-Ting Zhang,f KC Kent Lloyd,g Lu Wang,c Ming-Rong Zhangb,* and Steven Lianga,* a Department of Radiology, Division of Nuclear Medicine and Molecular Imaging Massachusetts General Hospital and Harvard Medical School, 55 Fruit Street, Boston, Massachusetts 02114, United States b Department of Advanced Nuclear Medicine Sciences, National Institute of Radiological Sciences, National Institutes for Quantum and Radiological Science and Technology, Chiba 263-8555, Japan c Center of Cyclotron and PET Radiopharmaceuticals, Department of Nuclear Medicine and PET/CT-MRI Center, the First Affiliated Hospital of Jinan University, Guangzhou 510630, China d Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma 73019, United States e Department of Cardiology, The First Affiliated Hospital of Jinan University, Guangzhou, 510630, China. f Departments of Neuroscience, Behavioral Medicine & Psychiatry, and Physiology &, and Pharmacology, the Rockefeller Neuroscience Institute, West Virginia University Health Sciences Center, Morgantown, WV 26506, United States. g Department of Surgery, School of Medicine, and Mouse Biology Program, University of California, Davis, 2795 Second Street, Suite 400, Davis, CA 95618, USA.
    [Show full text]
  • BRL 50481) with Guanylate Cyclase Activation (A-350619
    logy & N ro eu u r e o N p h f Nandhakumar et al. J Neurol Neurophysiol 2011, 2:1 y o s l i a o l n DOI: 10.4172/2155-9562.1000110 o r g u y o J Journal of Neurology & Neurophysiology ISSN: 2155-9562 Research Article OpenOpen Access Access Evaluation of Seizure Activity After Phospho-diesterase Inhibition (BRL 50481) with Guanylate Cyclase Activation (A-350619) and Inhibition (Methylene blue) in Animal Models of Epilepsy J Nandhakumar, Vinita Ernest and Manoj G Tyagi* Department of Pharmacology, Christian Medical College, Tamilnadu, India Abstract The role of soluble guanylate cyclase (GC) activator (A-350619) and inhibitor (methylene blue) was evaluated in the presence of phosphodiesterase-7 (PDE-7) inhibitor such as BRL-50481, in animal models of epilepsy. Seizures were induced in the animals by subjecting them to an injection of chemical convulsant, pentylenetetrazole (PTZ) and maximal electroshock (MES). The study mainly comprises the onset of seizures, mortality/recovery, percentage of prevention of seizures (anti-convulsant) and total duration of convulsive time. The combination of GC inhibitor, methylene blue with BRL 50481 showed a delay onset (P<0.001) in incidence of seizures, compared to A-350619 and BRL 50481 alone treated group. The total convulsive time was prolonged significantly (P<0.01) in methylene blue alone treated (69.2%) groups, compared to DMSO received group (100%). The study also demonstrates that methylene blue alone and methylene blue with BRL 50481 greatly increased the anti-convulsant activity (P<0.01 and P<0.05) along with higher protection 83.3% and 66.7% range respectively in PTZ model.
    [Show full text]
  • Inhibition of PDE3B Augments PDE4 Inhibitor-Induced Apoptosis in a Subset of Patients with Chronic Lymphocytic Leukemia1
    Vol. 8, 589–595, February 2002 Clinical Cancer Research 589 Inhibition of PDE3B Augments PDE4 Inhibitor-induced Apoptosis in a Subset of Patients with Chronic Lymphocytic Leukemia1 Eunyi Moon, Richard Lee, Richard Near, benefit in a subset of relatively PDE4-inhibitor resistant Lewis Weintraub, Sharon Wolda, and CLL patients. Adam Lerner2 INTRODUCTION Department of Medicine, Section of Hematology and Oncology, Boston Medical Center, Boston, Massachusetts 02118 [E. M., R. L., Methylxanthines such as theophylline, a drug widely used R. N., L. W., A. L.]; Department of Pathology, Boston University for treatment of asthma and neonatal apnea, induce apoptosis in School of Medicine, Boston, Massachusetts 02118 [A. L.]; and ICOS CLL3 cells in vitro (1). The sensitivity of CLL cells to other Corporation, Bothell, Washington 98021 [S. W.] agents that raise cAMP levels such as dibutyryl cAMP or forskolin has suggested that the proapoptotic activity of meth- ABSTRACT ylxanthines may arise, at least in part, because of their activity as nonspecific cyclic nucleotide PDE inhibitors (2). A Phase II Purpose: cAMP phosphodiesterase (PDE) 4 is a family clinical trial by Binet et al. (3) in patients with chlorambucil- of enzymes the inhibition of which induces chronic lympho- resistant CLL, as well as case reports (4), have suggested that cytic leukemia (CLL) apoptosis. However, leukemic cells adding theophylline to chlorambucil may be of clinical value in from a subset of CLL patients are relatively resistant to this disease. The efficacy of theophylline as a single agent in treatment with the PDE4 inhibitor rolipram, particularly early stage CLL is currently being examined by Makower et al.
    [Show full text]