Original Article Mir-23B Inhibits Cell Migration and Invasion Through Targeting PDE7A in Colon Cancer Cells

Original Article Mir-23B Inhibits Cell Migration and Invasion Through Targeting PDE7A in Colon Cancer Cells

Int J Clin Exp Pathol 2017;10(9):9436-9443 www.ijcep.com /ISSN:1936-2625/IJCEP0058135 Original Article MiR-23b inhibits cell migration and invasion through targeting PDE7A in colon cancer cells Lingfang Hao, Honggang Yu Department of Gastroenterology, Renmin Hospital of Wuhan University, Wuhan, Hubei Province, China Received May 24, 2017; Accepted August 2, 2017; Epub September 1, 2017; Published September 15, 2017 Abstract: It has been found that the abnormal expression of miR-23b is related to the poor prognosis or the weak ability of metastasis in colorectal cancer. Furthermore, high expression of PDE7A in tumors is known to be related to poor prognosis. The aim of this study was to explain whether miR-23b was involved in the invasion and metas- tasis of colon cancer by regulating PDE7A gene. The expression levels of miR-23b and PDE7A in colon tissues and colon cancer cell lines (SW620 and SW480 cells) were measured by real time PCR. The PDE7A protein level was determined by Western blotting. The relationship between miR-23b and PDE7A was verified by cell transfection and luciferase reporter assay. The effect of miR-23b or PDE7A level on cell invasion and migration was determined by Transwell assay. miR-23b was down-regulated when PDE7A was up-regulated in colon cancer tissues and cells. The result of dual luciferase reporter assay showed that PDE7A was a direct target gene of miR-23b. Overexpression of miR-23b not only reduced the expression of PDE7A in SW620 cells or SW480 cells, but also weakened the migra- tion and invasion abilities of SW620 cells or SW480 cells. When SW620 cells or SW480 cells were transfected with si-PDE7A, the level of PDE7A increased and the migration and invasion abilities of cells diminished. In conclusion, miR-23b is lowly expressed in colon cancer tissues and cells, and miR-23b may play an inhibitory role in the develop- ment of colon cancer through down-regulating the expression of PDE7A. Keywords: miR-23b, colon cancer, PDE7A, migration, invasion Introduction miR-18a to promote the expression of miR-18a and the development of tumor [9]. Bic (B-cell MiRNAs have been extensively studied as a integration cluster) gene is one of the known short, noncoding single-stranded RNA that reg- oncogenes, and its encoded RNA can be fur- ulate the expression of target genes. The ther processed to form miR-155, miR-155 pre- human miRNA gene has been found to account cursor RNA and bic mRNA are highly expressed for about 1% to 3% of the human genome [1], in children Burkitt’s lymphoma [10]. Invasion and 30% to 60% of the human protein genes and metastasis is one of the hallmarks of malig- are regulated by miRNAs [2, 3]. A single miRNA nancy and the leading cause of death in cancer may bind up to 200 different functional targets, patients. Studies have confirmed that miRNAs including transcription factors, receptors, vec- are involved in the whole process of tumor tors [4]. More than 186 miRNA genes have metastasis. Upregulation of miR-29a expres- been localized in the region of tumor-associat- sion can promote the development of EMT and ed chromosomal rearrangements [5], and lead to tumor metastasis [11]. MiR-9 can work some changes in specific miRNA expression directly on the CDH1 gene encoding E-cadherin genes have been occurred in some of the can- and increase the invasion and metastasis of cer-specific chromosomal fragility sites [6, 7]. cells [12]. The miRNA expression profile is closely related to the embryonic origin of the Many miRNA targets are proto-oncogenes or tumor, and its expression is more tissue-specif- tumor suppressor genes [8]. The abnormal ic, so miRNAs can be used as clinical markers expression of miRNA is a common feature of for effective tumor diagnostic markers. Lu et al. tumorigenesis. HnRNPA1 connexin can bind to proposed the use of whole-gene miRNA expres- MiR-23b inhibits cell migration and invasion in colon cancer cells Table 1. The sequences of primers at -80°C until further Gene Forward primer (5’-3’) Reverse primer (5’-3’) analysis. MiR-23b GAGCATCACATTGCCAGGG GTGCAGGGTCCGAGGT Cell culture and transfec- PDE7A GGAAATAGTCTAGTAAGCTTAACC GGCAGATGTGAGAATAAGCCTG tion U6 CGCTTCGGCAGCACATATAC TTCACGAATTTGCGTGTCAT GAPDH TGAAGGTCGGAGTCAACGGATTTGGT CATGTGGGCCATGAGGTCCACCAC The human colon cancer cell lines SW620 cells and SW480 cells were cultured sion profiles in identifying poorly differentiated at 37°C in a 5% CO2 atmosphere and main- tumors [13], which are difficult to identify by tained in DMEM containing 10% FBS and 2 mM imaging methods and mRNA-based diagnostic L-glutamine (Invitrogen, CA, USA). Human miR- methods. In addition, miRNAs and their target 23b mimics and negative control oligonucle- genes can serve as effective drug targets for otide (NC) were designed and provided by tumor treatment. The inhibition of oncogene GenePhram (Suzhou, China). Small interfering microRNAs in mice with different organs inject- RNA of PDE7A (si-PDE7A) and negative control ed with AMOs (an anti-microRNA oligonucle- RNA (siRNA-NC) were synthesized and purified otide) leads to inhibitory action on tumor growth by Genifarma too. SW480 cells and SW620 [14]. cells were transfected with miR-23b mimics or NC, and si-PDE7A or siRNA-NC using Lipofec- MiR-23b has been found to be lowly expressed tamine 2000 reagent (Invitrogen) according to in a variety of tumor tissues such as prostate the manufacturer’s protocol. cancer [15], oral squamous cell carcinoma [16], bladder cancer [17] and can act as a tumor sup- Dual luciferase reporter assay pressor miRNA in hepatocellular carcinoma [18], malignant glioma [19] and ovarian cancer Candidate target genes of miR-23b were identi- [20] through inhibiting the growth, proliferation, fied by TargetScan, and we chose the PDE7A to migration and invasion of tumor cells. Similarly, perform the follow-up experiments because miR-23b is also found to be highly expressed in that PDE7A had been reported to play a role in gastric cancer and associated with poor prog- migration and invasion of cancer cells [23]. To nosis of gastric cancer [21]. In order to further construct the PDE7A 3’UTR plasmid, the full- understand the development mechanism of length 3’UTR of human PDE7A mRNA contain- colon cancer [22], this study examined the miR- ing the putative miR-23b binding site was 23b expression in colon cancer tissue and cloned into the pmirGLO Dual-Luciferase miRNA colon cancer cell lines. In addition, miR-23b tar- Target Expression Vector (Promega, WI, USA). get gene was searched and verified by target The putative miR-23b recognition site in PDE7A gene prediction software and dual luciferase 3’UTR was mutated by site-directed mutagen- reporter assay, the function of miR-23b and its esis. For dual luciferase assay, SW620 cells target gene in colon cancer cell line were ana- were transfected with 100 nM miR-23b mimics lyzed too. or negative control using Lipofectamine 2000. After 24 hours, 150 ng of pmir-GLO-PDE7A WT Materials and methods or pmir-GLO-PDE7A mut were transfected in these cells. After 48 hours, cell extracts were Clinical specimens prepared and the detection of relative lucifer- ase activity was performed using Dual-Lucife- A total of 30 primary colon cancer tissues and rase® Reporter Assay System (Promega) acco- its paired non-cancerous colon tissues were rding to the manufacturer’s protocol. collected from the Renmin Hospital of Wuhan University. All patients had provided written Cell migration and invasion assay consent and the study had been approved by the Renmin Hospital of Wuhan University Transfection wells (BD Biosciences, NJ, USA) Institutional Review Committee. All tissues containing an uncoated or matrix adhesive have been histologically confirmed as colon coating containing 8 μm pores were used in cell adenocarcinoma. Tissue samples were collect- migration or invasion assays. Cells transfected ed, frozen quickly in liquid nitrogen, and stored with 100 nM miR-149 mimics/NC or 100 nM 9437 Int J Clin Exp Pathol 2017;10(9):9436-9443 MiR-23b inhibits cell migration and invasion in colon cancer cells Figure 1. Down-regulation of miR-23b expression and up-regulation of PDE7A expression in colon cancer tissues and cells. A. miR-23b expression in colon cancer tissues and cells compared with adjacent tissues; B. PDE7A mRNA levels in colon cancer tissues and cells compared with adjacent tissues; C. PDE7A protein levels were significantly elevated in colon cancer tissues. ***P < 0.001, compared with adjacent tissues. siRNA-PDE7A/si-NC were seeded into the upper body (ab9485)] and horseradish peroxidase chamber of serum-free DMEM. After 24 hours (HRP) conjugated secondary antibody [goat the cells were fixed in 100% methanol and anti-Rabbit IgG H&L (HRP) (ab6721)] were ob- stained with crystal violet at room temperature tained from Abcam and used according to the for 30 minutes. The cells remaining on the filter manufacturer’s instructions. side were removed with a cotton swab. The fil- ter was then imaged under an inverted micro- Statistical analysis scope and the number of migrating or invading cells was counted from these images. The concentration of the vector and the con- centration of RNA and protein from each tissue QRT-PCR analysis or cell sample were detected three times and the mean value was used for subsequent Total RNA was extracted from colon cancer experiments. Every treatment in the dual lucif- cells or tumor tissues using TRIZOL reagent erase reporter assay was performed three (Invitrogen). CDNA synthesis kit (Takara, Tokyo, times to achieve three values. Every treatment Japan) was used for the synthesis of cDNA in Transwell assay was performed three times according to the manufacturer’s instructions. and every number of cell count was the mean Quantitative RT-PCR was used to detect the value from 5 random sights.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    8 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us